2008 bioprocess biosys_eng_a._mosquera_31-6-535-540
Post on 26-May-2015
149 Views
Preview:
TRANSCRIPT
ORIGINAL PAPER
Anaerobic treatment of low-strength synthetic TCF effluentsand biomass adhesion in fixed-bed systems
Anuska Mosquera-Corral Æ Angela Belmar ÆJacqueline Decap Æ Katherine Sossa ÆHomero Urrutia Æ Gladys Vidal
Received: 13 November 2007 / Accepted: 21 December 2007 / Published online: 12 January 2008
� Springer-Verlag 2008
Abstract Toxicity effects produced by kraft mill efflu-
ents are due to the productive process. New bleaching
processes have been proposed (e.g. total chlorine free,
TCF) to reduce the production of toxic chlorine com-
pounds. In the TCF processes large amounts of chelating
compounds like the ethylenediaminetetraacetic acid
(EDTA) and diethylenetriaminepentaacetic acid (DPTA)
are used. The aim of this work is to research the feasi-
bility of the degradation of low-strength synthetic TCF
effluents in a anaerobic filter reactor (AF) and the bio-
mass adhesion. The effects on the operation of the AF at
different EDTA loading rates were tested in the range
from 0.07 to 0.51 g EDTA l-1 days-1. The maximum
EDTA removal percentage achieved was of 27%. Acute
toxicity (measured as 24 h-LC50) with Daphnia magna
was reduced from 14.23 to 54.53% before and after
anaerobic treatment, respectively. Observations of bio-
mass samples from the AF under the scanning microscope
verified the attached biomass.
Keywords Anaerobic � Biomass adhesion �Ethylenediaminetetraacetic acid (EDTA) �Total chlorine free (TCF) effluent
Introduction
In recent years, important technological innovations have
been developed worldwide in the forest industry, aimed at
reducing water consumption and generation of toxic con-
taminants. Thus, water circuit closures, new pulping and
bleaching processes have been introduced in order to
reduce water consumption and production of chlorinated
phenolic compounds. The TCF (total chlorine free)
bleaching process is one of these processes, which aims to
completely remove the discharges of chlorinated com-
pounds [1]. Furthermore, it has been stated that TCF
bleaching enhances the anaerobic COD biodegradability of
the effluent generated up to 75% [2].
However, the introduction of this TCF pulp is associated
to an increment on the amounts of chelating compounds used
to remove the metals present in the obtained cellulose pulp
[3]. The most commonly used chelating compounds are
ethylenediaminetetraacetic acid (EDTA) and diethylenetri-
aminepentaacetic acid (DPTA) [4]. No studies have been
completed within the pulping industry that demonstrates the
feasibility of removal of these chelating compounds by
anaerobic biological treatment. In some cases after a chem-
ical oxidation it has been observed the aerobic degradation of
both compounds [3]. Furthermore, the recalcitrant properties
of the DPTA have been already studied [5]. EDTA has been
also used to decrease the inhibitory effects on the methano-
genic activity of metals like cadmium, copper, nickel [6, 7].
All this factors make it interesting the study of these com-
pounds in the anaerobic processes.
A. Mosquera-Corral
Department of Chemical Engineering, School of Engineering,
University of Santiago de Compostela,
Lope Gomez de Marzoa s/n, 15782
Santiago de Compostela, Spain
A. Belmar � J. Decap � G. Vidal (&)
Environmental Science Center EULA-Chile,
University of Concepcion, P.O. Box 160-C, Concepcion, Chile
e-mail: glvidal@udec.cl
K. Sossa � H. Urrutia
Biotechnology Center, University of Concepcion,
P.O. Box 160-C, Concepcion, Chile
123
Bioprocess Biosyst Eng (2008) 31:535–540
DOI 10.1007/s00449-007-0194-0
In the half 60 s the anaerobic digestion was established as
an alternative to treat effluents with high organic loads (1–
40 g COD l-1 days-1), but also for low-strength (\1 g
COD l-1 days-1). It was in the early 90 s when these
technologies were extensively applied to the forest industry
[8]. The use of these technologies allows the production of
effluents which can be reused in the production process
provoking a decrease of fresh water consumption [9].
Technologies based on anaerobic biomass grown in the form
of biofilms have been found to provide biomass more
resistant to the presence of toxic compounds as those usually
contained in the effluents of the pulp and paper industry.
The aim of the present work was to study the effects of
EDTA present in the low-strength synthetic TCF effluents
on the operation of an anaerobic filter reactor (AF) and the
biomass adhesion to PVC corrugated rings.
Methods and materials
Wastewater
Effluent was prepared similar to the model media from
Rodrıguez et al. [3] as detailed in Table 1. The COD
concentration was between 0.38 and 0.48 g COD l-1 tak-
ing into account the COD supply from the different
concentrations of organic compounds including the EDTA
tested (107–214 mg l-1).
Inoculum
The reactor was inoculated with 5 g VSS l-1 of anaerobic
flocculent sludge treating effluents from a kraft process and
with a specific activity of 0.9 g COD g-1 VSS days-1.
Reactor
An anaerobic filter reactor with a working volume of
200 ml (Fig. 1) was operated in a continuous flow mode
during 370 days. The AF was filled with corrugated PVC
Raschig rings (1.4 cm internal diameter) acting as carrier
material and with a specific surface area of 449 m2 m-3.
The temperature was maintained at 37�C by using a ther-
mostatic chamber and pH was maintained in the range
7.0–8.5 by means of bicarbonate addition.
Operational conditions
The reactor was operated in five different periods with two
different operational strategies: (a) decrease of HRT from
1.25 to 0.46 days (I–IV) and (b) doubling of the EDTA
concentration from 107 to 214 mg EDTA�l-1 keeping the
HRT on 0.46 days (V).
The EDTA loading rates (LREDTA) applied to the reactor
ranged from 0.07 to 0.51 g EDTA l-1 days-1.
Adhesion experiments
The adhesion of the anaerobic biomass to the corrugated
PVC rings was tested in batch experiments performed by
Table 1 TCF synthetic effluent composition
Feeding media Nutrient solution
Compound g l-1 Compound g l-1
Sodium formate 0.5 H3PO4 0.314 9 10-6
Sodium acetate 0.1 MgSO4�7H2O 0.54
Sodium bicarbonate 4 CaCl2�2H2O 0.54
EDTA 0.107–0.214 FeCl3�6H2O 1.05
FeCl3�6 H2O NH4Cl 2.085
Nutrient solution 5 ml l-1 KH2PO4 0.285
Glyoxal 0.3
Vanillin 0.8
INFLUENT EFFLUENT
CH4
2
3
INFLUENT EFFLUENT
CH4
1
4
5
6
7
Fig. 1 Anaerobic filter reactor (AF) layout: 1 influent, 2 feeding
distributor, 3 sludge bed, 4 separator system solid/liquid/gas, 5 biogas
measurement, 6 carrier material, 7 effluent
536 Bioprocess Biosyst Eng (2008) 31:535–540
123
duplicate. Assays were carried out in dark vials of 100 ml
of volume. The same inoculum as in the reactor was used
in the tests and an amount of 2 g VSS l-1 were intro-
duced in each vessel. Around 30 pieces of cut corrugated
rings (surface of 2 9 10-4 m2 by piece) were added to
each vial. Different concentrations of EDTA (0, 0.05,
0.10 and 0.20 g l-1) were tested. No organic substrate,
except for the EDTA, was added to the tests. A propor-
tional concentration of iron in the vessels medium, as that
indicated in Table 1, was used. The vials were placed in
a thermostated bath where temperature was fixed at 37�C.
The specific activity of the adhesion experiments was
monitored according to the procedure described by Soto
et al. [10] by measuring the volumes of liquid displaced
due to biogas production. In order to quantify the number
of microorganisms attached to the supports three pieces
of corrugated PVC were removed from each vial along
the time. The pieces were sonicated in 10 ml of water
during 30 min; the liquid was filtered through filters of
0.2 lm pore size. The retained biomass on the filters was
treated with the DAPI dye (0.2 ml of a solution of
0.1 mg l-1). The filters were deposited on a slide covered
with vaseline and placed in the epifluorescence chamber
where the number of microorganisms was counted by
hand.
Toxicity experiments
The acute toxicity of the EDTA was determined in the
liquid samples by exposing juveniles (\24 h old) Daph-
nia magna and Daphnia obtusa during 24–48 h to this
compound. The mortality of organisms was monitored at
the end of the exposure time and it was defined as the
lack of organism motility when the vessel is shaken. The
average lethal concentrations at 24 and 48 h (LC50) were
estimated using the methods of Probit and Spear-
man–Karber [11, 12].
Analytical methods
Volatile suspended solid (VSS), chemical oxygen demand
(COD), biological oxygen demand (BOD5) were measured
according to the ‘‘Standard Methods’’ [13]. Total alkalinity
(TA) was determined by titration [14]. EDTA was deter-
mined according Bhattacharya and Kundu [15]. Samples
for COD, BOD5 and EDTA analysis were filtered through a
membrane of 0.45 lm (pore size).
Biomass samples for scanning electron microscopy were
analyzed according to the technique developed by Nation
[16]. The identification and quantification of the microbial
populations were performed by means of the Dot-Blot
technique [17]. The 16S rRNA of a biomass sample was
analyzed on a membrane using the specific oligonucleotide
probes detailed in Table 2 using the hybridization proce-
dure described by Stahl et al. [18].
Results and discussion
Process operation
The reactor was operated during 370 days (periods I–V)
fed with a synthetic TCF effluent and operated at different
HRT values from 1.4 to 0.46 days (see Table 3; Fig. 2).
The EDTA concentrations in the feeding media to the AF
were chosen in the range they are usually found in the
wastewater produced in TCF processes (0.06–0.10 g l-1)
[5]. The chosen values did not cause inhibition on the
Table 2 Oligonucleotide probes used for the Dot-Blot analysis
Probe Target organism Probe sequence (50–30) Ref.
EUB338 Bacteria GCTGCCTCCCGTAGGAGT [19]
ARC915 Archaea GTGCTCCCCCGCCAATTCCT [20]
MS1414 Methanosarcinaspecies and
close relatives
CTCACCCATACCTCACTCGGG [21]
Table 3 Operational conditions of the AF
Parameter Period (days)
I (0–67) II (68–130) III (131–194) IV (195–340) V (341–370)
LR (g EDTA l-1 days-1) 0.08 0.13 0.07 0.22 0.51
HRT (days) 1.25 ± 0.10 0.84 ± 0.06 1.44 ± 0.47 0.46 ± 0.19 0.46 ± 0.19
Removal (%) Media Range Media Range Media Range Media Range Media Range
COD 52.2 41.2–71.3 54.7 42.2–60.5 69.0 49.5–81.7 78.4 64.0–84.2 50.8 42.4–65.3
BOD5 89.0 83.0–92.0 93.0 82.0–98.0 97.5 95.2–98.8 97.8 96.4–98.7 94.3 91.2–98.1
EDTA 27.3 8.0–40 13.5 5.0–28.0 15.0 5.0–26.0 5.6 6.0–15.9 19.1 5.7–39.3
Bioprocess Biosyst Eng (2008) 31:535–540 537
123
methanogenic activity of the biomass, as it was determined
from previous batch experiments that an inhibition of 50%
of this activity occurred at concentrations of 0.4 g
EDTA l-1 [22].
The AF was started up with an organic load lower than
the maximum load feasible to be treated by the inoculated
amount of anaerobic sludge (around 14.5 times lower than
the maximum specific activity of the biomass) to overcome
the possible detrimental effects of the presence of EDTA.
The organic load was increased to reach a value of 1.06 g
COD l-1 days-1 (period V). The maximum COD removal
percentages were obtained during periods III and IV
reaching values of 78.4% (Fig. 2a) while in terms of BOD5
percentages were close to 100% (Fig. 2b). The total alka-
linity was always above 2 g CaCO3 l-1 to guarantee the
stability of the pH value from 7.3 to 8.5.
The average EDTA removal percentage obtained was
during the whole operation of the AF in the range from 5.6
to 27.3%. A balance calculation was performed to establish
the route of disappearance of the EDTA from the media.
The assumption that the readily biodegradable compounds
(acetate and formate) were removed in the reactor, as the
BOD5 concentration in the effluent was almost neglected,
was made. From the COD measurements it was obtained
that the percentage of COD remaining in the media
corresponded to the not degraded EDTA due to the fact that
this compound contributes to the 26% (periods I–IV) and to
the 52% (period V) of the theoretical COD in the feeding
which almost fits to the 80 and 50% of COD removal
percentages obtained, respectively. These observations are
similar to those from Alarcon et al. [5] working with and
effluent containing DPTA (0.1 g l-1) in a similar reactor.
The apparent disappearance of EDTA in the AF was then
attributed to the errors associated to sampling and analyt-
ical determinations. The complete depletion of the BOD5
was an indicative of the stable performance of the metha-
nogenic process indicating the absence of negative effects
on this activity due to the presence of EDTA in the feeding.
Similar behavior was observed by Alarcon et al. [5]
working with DPTA.
The toxicity of the influent and effluent to the AF in
period I, determined with D. obtusa and D. magna, indi-
cated a reduction of the toxicity of the media after the
anaerobic degradation. With D. obtusa the value of the
24 h-LC50 (acute toxicity) was reduced from 23.94 to
67.71%. In the experiments performed with D. magna
results indicated a reduction from 14.23 to 54.53%,
slightly different due to the higher sensitivity of the latter
compared to the D. obtusa. The results obtained from the
influent can be, in a certain way, compared to those from
Martins et al. [23] who indicate that the concentration of
acetate corresponding to the 24 h-LC50 for D. magna is
of 10.79 mg l-1 which is similar to that of the influent of
14.23 mg l-1 expressed in concentration. The results must
be interpreted with care because the feeding media to the
AF contained other major compounds like the formate
which could contribute to the acute toxicity at different
extent as it has been found by Cooman et al. [12] to
happen with other toxic compounds of the tannery efflu-
ents. The EDTA was not expected to cause toxic effect
due to the fact that it has been added to the media when
the acute toxicity of metals was determined and it has
been stated that its presence reduces the toxic effect of
metals like copper, cadmium, etc [6]. Taking into account
that the biodegradable substrates (acetate and formate)
were degraded during the anaerobic process the residual
toxicity in the effluent can be attributed to other salts like
ammonia present in the media [12].
Bacteria attachment
The reactor was inoculated with flocculent biomass char-
acterized by a wide diversity (Fig. 3a). With the objective
to determine the formation of bacteria attachment, after
33 days of operation samples of corrugated rings were
collected from the AF. The observation under the electron-
scanning microscope of the surface of the support material
Time (d)
LREDTA (gEDTA/L·d) 0.08 0.13
0
20
40
60
80
100
0.07 0.22 0.51
0 100 200 300 4000
20
40
60
80
100
Biofilm formation Treatment stage
I II III IV VPERIOD IV
CO
D r
emo
val (
%)
ED
TA
an
d B
OD
5 re
mo
val (
%)
a
b
Fig. 2 Anaerobic filter reactor (AF) performance. a COD (filledcircle) removal, b BOD5 (filled circle) and EDTA (filled diamond)
removal percentages, respectively
538 Bioprocess Biosyst Eng (2008) 31:535–540
123
positively indicated that the growth of bacteria attachment
occurred and it was found to be mainly composed by
bacillus-type bacteria (Fig. 3 b, c). In principle it could be
established that the presence of EDTA in the feeding media
did not exert any prejudicial effect on the development of
the bacteria attachment.
Adhesion experiments, performed with biomass with the
same origin as that inoculated to the reactor, indicated that
no EDTA degradation occurred in the test. The amount of
organisms adhered to the surface of the carrier material
indicated that the bacteria attachment was formed during
the initial 12 h (Fig. 4). No significant effect on the bio-
mass adhesion was observed with the different tested
EDTA concentrations compared to the results obtained
with the blank experiment (0 g l-1). These results cor-
roborated those obtained from the AF operation.
Furthermore, the microbial populations present in the
biomass adhesion were identified and quantified by means of
Fig. 3 Scanning microscope observation of the biomass: inoculum, 910,000 a, microorganisms attached to the support material on day 33 of the
AF operation, 92,500 (b) and 95,000 (c)
0 10 20 30 40 500
25
50
75
100
125
150
175
Time (d)
Mic
roor
gani
ms
num
ber
/ PV
C c
orru
gate
d su
ppor
t (cm
-2)
(x10
3 )
Fig. 4 Adhesion experiments: blank 0 g EDTA l-1 (filled diamond),
0.05 g EDTA l-1 (open circle), 0.1 g EDTA l-1 (open diamond),
0.2 g EDTA l-1 (filled circle)
Bioprocess Biosyst Eng (2008) 31:535–540 539
123
the Dot-Blot technique. Results indicated the presence of
65% of the microorganisms belonging to the domain Bac-
teria and 35% belonging to the domain Archaea. In the latter
35% of the population was found to belong to the Methan-
osarcina species. These are common archaea organisms
present in anaerobic reactors fed with relatively high acetate
concentrations and which easily accomplish with sudden
load changes [24]. Once more the appropriate operation of
the AF is corroborated by the grown microbial populations.
Conclusions
The biodegradation of a low-strength synthetic TCF
effluent in an AF was successfully accomplished in the
presence of different concentrations of EDTA (0.1–
0.2 g l-1). The maximum removal percentages reached
were close to 100% for BOD5 and of 78.4% for COD when
loads up to 0.83 g COD�l-1�days-1 were treated. Also,
anaerobic degradation of the synthetic effluent reduced the
acute toxicity measured with D. magna and D. obtusa in 64
and 74%, respectively.
The maximum EDTA removal percentage achieved was
of 27%.
No detrimental effect on the attachment of the biomass
to the carrier surface was observed caused by the presence
of the EDTA in the media. An amount of 35% of the
bacteria attachment corresponded to methanogenic bacteria
from the family Methanosarcinaceae, which conferred to
the biofilm a high resistance to operational changes.
Acknowledgments This work was financially supported by
FONDECYT 1070509. A. Mosquera-Corral thanks to the European
ALFA N� II-0311-FA-FCD-FI-FC by supporting her stay at the
Environmental Science Center EULA-Chile, Universidad de Con-
cepcion (Chile).
References
1. Thompson G, Swain J, Kay M, Foster CF (2001) The treatment of
pulp and paper mill effluent: a review. Bioresour Technol
77:275–286
2. Vidal G, Soto M, Field J, Mendez-Pampın R, Lema JM (1997)
Anaerobic biodegradability and toxicity of wastewaters from
chlorine and total chlorine-free bleaching of eucalyptus kraft
pulps. Water Res 31(10):2487–2494
3. Rodrıguez J, Mutis A, Yeber MC, Freer J, Baeza J, Mansilla HD
(1999) Chemical degradation of EDTA and DTPA in a totally
chlorine free (TCF) effluent. Water Sci Technol 40:267–272
4. Sillanpaa M, Pirkanniem K (2001) Recent developments in
chelate degradation. Environ Technol 22:791–801
5. Alarcon E, Decap J, Vidal G (2005) Resistance of diethylene-
triaminepentaacetic acid to anaerobic biodegradation. Electron J
Biotechnol 8(3):308–313 doi:10.2225/vol8-issue3-fulltext-5
6. Guilhermino L, Diamantino TC, Ribeiro R, GonCalves F, Soares
AMVM (1997) Stability of test media containing EDTA for the
evaluation of acute metal toxicity to Daphnia magna Straus.
Ecotoxicol Environ Saf 38:292–295
7. Chen Y, Cheng JJ, Creamer S (2007) Inhibition of anaerobic
digestion process: a review. Bioresour Technol. doi:10.1016/
j.biortech.2007.01.057
8. Lettinga G, Field J, Sierra-Alvarez R, van Lier J, Rintala J (1991)
Future perspective for the anaerobic treatment of forest industry
wastewater. Water Sci Technol 24(3/4):91–102
9. Van Lier LB, Lens P, Hushoff Pol LW (2001) Anaerobic treat-
ment for C and S removal in ‘‘zero-discharge’’ paper mills:
effects of process design on S removal efficiencies. Water Sci
Technol 44(4):189–194
10. Soto M, Mendez R, Lema JM (1993) Methanogenic and non-
methanogenicactivity tests. Theoretical basis and experimental
set up. Water Res 27(8):1361–1376
11. Finney D (1978) Statistical method in biological assay. Charles
Griffin & Co. Ltd (eds), London, pp 508
12. Cooman K, Gajardo M, Nieto J, Bornhardt C, Vidal G (2003)
Tannery wastewater characterization and toxicity effects on
Daphnia spp. Environ Toxicol 17:45–51
13. APHA-AWWA-WPCF (1985) Standard methods for examination
of water and wastewater, 16th eds, Washington
14. Ripley LE, Boyle W, Converse J (1986) Improved alkalimetric
monitoring for anaerobic digestion of high strength wastes. J
WPCF 58(5):406–411
15. Bhattacharya SN, Kundu KP (1971) Spectrophotometric deter-
mination of EDTA. Talanta 18:446–448
16. Nation JL (1983) A new method for using hexamethyldisilazane
for preparation of soft insect tissue for scanning electron
microscopy. Stain Technol 58:347–351
17. Sambrook J, Fritsch EF, Miniatis T (1989) Dot and Slot
hybridization of RNA. In: Molecular cloning a laboratory man-
ual, 2nd edn. Cold Spring Harbord Laboratory Press, USA pp
7.35–7.55
18. Stahl DA (1997) Application of phylogenetically based hybrid-
ization probes to microbial ecology. Mol Ecol 4:535–542
19. Amann RI, Binder BJ, Olson RJ, Chisholm SW, Devereu R, Stahl
DA (1990) Combination of 16S ribosomal-rRNA-targeted oli-
gonucleotide probes with flow cytometry for analyzing mixed
microbial-populations. Appl Environ Microbiol 56(6):1919–1925
20. Stahl DA, Amann R (1991) Development and application of
nucleic acid probes. In: Stackebrandt E, Goodfellow M (eds)
Nucleic acid techniques in bacterial systematics. Wiley, Chich-
ester, pp 205–248
21. Raskin L, Poulsen LK, Noguera DR, Rittmann BE, Stahl DA
(1994) Quantification of methanogenic groups in anaerobic bio-
logical reactors by oligonucleotide probe hybridization. Appl
Environ Microbiol 60:1241–1248
22. Vidal G, Gajardo M, Belmar A, Diez M (2001) Methanogenic
toxicity of ethylenediaminotetraacetic acid. XXIII Microbiology
Chilean Congress, November 28–30, Tome, Chile, pp 61
23. Martins J, Oliva-Teles L, Vasconcelos V (2007) Assays with
Daphnia magna and Danio rerio as alert systems in aquatic
toxicology. Environ Int 33:414–425
24. Conklin A, Stensel HD, Ferguson J (2006) Growth kinetics and
competition Between Methanosarcina and Methanosaeta in
mesophilic anaerobic digestion. Water Environ Res 78(5):486–
496
540 Bioprocess Biosyst Eng (2008) 31:535–540
123
top related