lscanlonscience.weebly.com · web viewsimulate a polymerase chain reaction experiment. ... word...
Post on 27-Dec-2018
213 Views
Preview:
TRANSCRIPT
Name: _______________________________________ Per: ___________ Date: __________
Unit 10: DNA (Structure/Analysis)
By the end of the unit, you will be able to: Describe the structure of DNA, and properly match base pairs Describe the various techniques used to analyze DNA Simulate DNA analysis using gel electrophoresis Extract DNA from an organism using proper laboratory techniques Simulate a polymerase chain reaction experiment
Unit Vocabulary: DNA:
_________________________________________________________________________ Double helix:
_________________________________________________________________ Nucleotides:
__________________________________________________________________ Genetic code:
_________________________________________________________________ RFLP: ________________________________________________________________________ Restriction enzymes:
___________________________________________________________ Gel electrophoresis:
___________________________________________________________
1Unit 10: DNA (Structure & Analysis) Note Packet
Name: _______________________________________ Per: ___________ Date: __________
Genetic fingerprint: ___________________________________________________________
PCR: _________________________________________________________________________ STR:
__________________________________________________________________________ CODIS:
_______________________________________________________________________ Mitochondrial DNA:
___________________________________________________________ Nuclear DNA:
_________________________________________________________________
What is DNA? DNA stands for
______________________ and contains all of our ________________ _____________________
It is found on ________________________ located in the ________________ of our cells
DNA shape: ________________________
What is DNA made of? The sides or _______________________
of the DNA molecule are made up of sugar (deoxyribose) and _____________________________________.
The rungs that form the middle of the molecule are made up of pairs of _____________ or _________________________. __________________ (A) pairs with ______________ (T), while ______________________ (G) always pairs with _____________________ (C).
Label the DNA moleculeWord Bank: cytosine/backbone/guanine/adenine/thymine/H-bonds
Base Pair Matching The order of the base determines the ________________________________ DNA is made up of ________ strands that are __________________________ to
each other Each base has a specific partner to match with
o ____________________________ A – T T – A
o ____________________________ C – T T – C
How is DNA used as evidence? Each person’s DNA is
__________________ from other people (except identical twins).
DNA collected from a crime scene can either link a
2Unit 10: DNA (Structure & Analysis) Note Packet
Name: _______________________________________ Per: ___________ Date: __________
_______________________________ _________________ or ____________________________________, similar to the use of fingerprints.
DNA _______________________ __________________ through DNA from relatives, even when nobody can be found.
DNA can ___________________ ___________________________, in a _____________, or in a ____________ where the suspect claimed not to have been.
DNA can ___________________ ________________ together by linking the same perpetrator to different scenes locally, statewide, and across the nation.
Where does the DNA evidence come from? ____________________ Blood Hair strands (the root)
_______________ Finger or toe nails Tooth with root material
How is DNA analyzed? There are various techniques that are used to
analyze DNAo ___________________ o ___________________ o ___________________ o __________________________________
What is RFLP? RFLP = ____________________________________________________ Analyzes variable lengths of DNA Original DNA is cut with _______________________________ into smaller pieces
based on the presence of a specific sequence The DNA samples are run through a test called
_________________________________, then are compared
What are restriction enzymes? Restriction enzymes are enzymes that _______________ as specific
_________________ For example, the restriction enzyme EcoRI cuts at the sequence “GAATTC” in
between the G and the Ao Original Sequence: CGGATCTTCTAGGAATTCGTAGCCGTAo Digested Sequence: CGGATCTTCTAGG AATTCGTAGCCGTA
Because different people have different DNA sequences, the ______________________ ________________ and the ___________ of each fragments will differ
What is gel electrophoresis? A technique used to _____________________________ DNA based on ____________
3Unit 10: DNA (Structure & Analysis) Note Packet
Name: _______________________________________ Per: ___________ Date: __________
The gel is a matrix made up of a sugar called ______________
An _____________________________ is run through the gel pulling the ____________________ charged DNA molecules to the positive end
The larger pieces stay closer to the wells, and the ________________ pieces travel _______________ and farther
o Think of traffic on a major highway. Which would you rather be in, a motorcycle or an 18-wheeler? Why?
The DNA fragments ________________________, or patterns in the gel creating a ________________________________
Banding patterns are compared to match DNA at a crime and to determine ____________________________________
o Familial relations will have some bands in common
What is PCR? PCR =
____________________________ It is used to make
_________________ _________________ of a specific portion of the DNA
Allows very ______________________ to be analyzed, such as a sample of a few skin cells
What is STR? STR =
___________________________ Locations on the chromosomes
that contain _____________________________ (3-7 bases) that ________________ themselves in nuclear DNA
4Unit 10: DNA (Structure & Analysis) Note Packet
Name: _______________________________________ Per: ___________ Date: __________
FBI uses ___________ standard specific STR regions for CODIS
What is CODIS? CODIS = ________________________________________ National network that helps identify leads for crimes with no suspects Uses 13 DNA regions that vary from person to person Looks for matches at ____________________________________ location on a
genome for more accurate results
What is mitochondrial DNA analysis? Used for samples that ________________ be analyzed
using ____________ or ______________ Uses DNA extracted from _______________________
rather than nuclear DNA Especially useful in old cases and _____________________
5Unit 10: DNA (Structure & Analysis) Note Packet
Name: _______________________________________ Per: ___________ Date: __________
Daily YOYO SheetWeek of: _____________________________
Directions: Write the answer to the YOYO in the correct box below. Monday:
Tuesday:
Wednesday:
Thursday:
Friday:
6Unit 10: DNA (Structure & Analysis) Note Packet
Name: _______________________________________ Per: ___________ Date: __________
Daily YOYO SheetWeek of: _____________________________
Directions: Write the answer to the YOYO in the correct box below. Monday:
Tuesday:
Wednesday:
Thursday:
Friday:
7Unit 10: DNA (Structure & Analysis) Note Packet
top related