alfalfa (medicago sativa l) · genetic irnprovement of stress tolerance is an urgent need for the...
TRANSCRIPT
EXPRESSION OF RD29A COLD RESPONSIVE PROMOTER ELEMENTS IN
ALFALFA (MEDICAGO SATIVA L)
A Thesis
Presented to
The F a d t y of Graduate Studies
of
The University of Guelph
by
YANG WANG
In Partial ftlfilment of requirements
for the degree of
Master of Science
October, 1997
O Yang Wang, 1997
National Library Bibliothèque nationale du Canada
Acquisitions and Acquisitions et Bibliographie Services services bibliographiques
395 Wellington Street 395. nie Wellington OttawaON K1AON4 OttawaON K1A ON4 Canada canada
The author has granted a non- L'auteur a accordé une licence non exclusive licence allowing the exclusive pemettmt la National Library of Canada to Bibliothèque nationale du Canada de reproduce, loan, distribute or sell reproduire, prêter, distribuer ou copies of this thesis in microform, vendre des copies de cette thèse sous paper or electronic formats. la forme de microfiche/^ de
reproduction sur papier ou sur format électronique.
The author retains ownership of the L'auteur conserve la propriété du copyright in this thesis. Neither the droit d'auteur qui protège cette thèse. thesis nor substantial extracts fiom it Ni la thèse ni des extraits substantiels may be printed or otherwise de celle-ci ne doivent être imprimés reproduced without the author's ou autrement reproduits sans son permission. autorisation.
ANALYSE OF RD29A COLD INDUCIBLE PROMOTER IN TRANSGENIC ALFALFA (Medicaeo sativa L. )
Yang Wang University of Guelph
SupeMsor Dr. Bryan D. McKersie
A rd29a cold inducible promoter was introduce into alfalfa (Medicago &a L. )
by Agrobac teb transformation. The GUS activity driven by the rd29a promoter
increased in leafand stem, but decreased in the root when the transgenic alfalfa was placed
at 2OC. The GUS mRNA in stem tissue tramientiy increased within 2-3 days at 2OC.
One or three wpy number of a tnincated rd29a promoter containhg the
dehydration responsive element was transcriptionally fised in two orientations with GUS
and firefly luciferase genes respectively. These constructs were introduced into alfalfà
leaflets by particle bombardment. In luçiferase activity assay, the Dual Luciferase Assay
System (firefly and Renilla luderase) was used. The activities of firefly, Renilla
luciferases, and GUS were unstable under cold treatment.
The alfalfa response to the rd29a promoter was difference observed in Arabidopsis
and tobacco. The Dual Luciferase Assay System was unsuitable for investigation at cold
in alfitEa.
1 would like to thank Dr. Bryan D. McKersie, my major advisor, for his guidance,
patience and encouragement throughout this work. His advise and supe~sion helped me
in my Masters' study and let me enjoy the work in his lab.
1 wouid Wce to thank Dr. Ken Kasha and Dr. Larry Erickson for their valuable
advice.
I wouid like to thank Dave Vadnais for his help in statistical d y s i s of my data
and 0th- members in Dr. McKersieYs lab.
1 would Wre to thank the members in Dr. Kasha's lab for the help doing particle
bombardment . Very special thanks to my wXe, Xiaoping Song, without whose great
encouragement, 1 could not have been able to complete m y studies. Aïso give a special
th& to rny unborn baby. Her or his coming gave me good luck at the end of my
research.
Figure
LIST OF FIGURES
Page
The rd29a-GUS vector .......................................................................... 16
GUS activity under nomial temperatures in stems of tramgenic alfalfa
plants containhg the rd29a-GUS vector .................................................. 22
Histochemical staining for GUS activity in rd29a-GUS transgenic alfalfa
.................................. (N4rd29a- 1 3B) under n o d growth temperatures 24
GUS actîvity of leaf; stem, and root tissues in transgenic alfalfà
............................................. ('4-rd29a- 13B) under wld treatment (2°C) 26
mRNA levels of GUS in stem tissue nom rd29a-GUS traasgenic alfaIfa
.................................... N4-rd29a-13B d e r incubation at 2°C for 5 days 31
...................... DNA restriction map of plasmid pBI22 1 and pUC-GUS902 35
................... DNA restriction map of plasmid pUC-LUC and pUC-LUC90 38
DNA restriction map of plasmid pUC-GUS901F and pRG35S ................. 40
................................. Partial DNA sequence of the rd29a promoter region 42
Maps of plasrnids pUC-LUC90 1 F, pUC-LUC90 IR, and
pUC-LUC903F ..................................................................................... 43
Restriction enzyme digestion of pUC.GUS902. pUC.LUC90. pUC-LUC
.............................................................................. and p u - 3 5s plasrnids 46
..................................................................... Restriction enzyme digestion 48
Post incubation time test of bombarded alfalfa leaflets ............................... 53
Cornpuison of the response of the ReniIh luciferase activity in stress
.................................................................................. treatments in U a 60
.................... Signal transduction and regulation mode1 of rd29a promoter 65
Subclonhg of plasmid pUC.GUS902. pUC.LUC90. pUC.LUC.
and pRL-3 5 S .......................................................................................... 83
17 . Subcloning of plasrnid pUC-GUS902 1F. pUC-LUC90 IF.
pUC-LUC90 1 R and pUC-LUC903 F .................................................... 85
..................................... 18 . Partial DNA sequence of plasmid pUC-GUS902 87
....................................... 19 . Partial DNA sequence of plasmid pUC-LUC90 89
20 . Partial DNA sequence of one forward copy of a tnincated rd29a
promoter ligated into plasmid Bluescript KS(+) ...................................... 91
Table
LIST OF TABLES
Page
Firdy lucifiefase activity of bombarded alfalfa leafiets with 5 plasmids during normal growth and wld temperature .......................................... 56
Firefly luciferase activity of bombarded alfalfa leaflets with pUC-LUC and pUC-UC901F plasmids during stress treatments ................................... 57
GUS activity of bombarded alfala leafiets with pBI221 and pUC-GUS902 1F plasmids .......................................................................... 6 1
SAS resuits of GUS activÎty of transgenic alfiilfii tissues under cold tratment ......................... .., ...................................................................... 76
SAS results of 35-reporter gene activity over incubation time ..................... 77
SAS results of fiefly luciferase activity of bombarded alfalfa leaf blades with 5 plasrnids during nomial growth and cold temperatures .......... 78
SAS results of firefly luciferase activity of bombarded alfalfa leaf blades with pUC-LUC and pUC-LUC901F plasmids d u ~ g stress treatments .................................................................................................. 79
SAS results of Renilla luciferase activity of bombarded alfalfa leaf blades with pRG3 5s plasmid during stress treatments ............................... 80
SAS results of GUS activity of bombarded alfalfa leaf blades with pBI22 1 and pUC-GUS902 IF plasmids during stress treatments ................. 8 1
TABLE OF ABBREVIATIONS
ABA
abi
ABRE
AtPLC
ATP
AMP
CaMV35S
CAT
CDPK
cor
CYS
DRE
GFP
GUS
LEA
I t i
LTRE
luc
lux
MOPS
MU
MUG
NOS
NPTII
PCR
PEG
PR
abscisic acid
absçisic acid insensitive
abscisic acid responsive element
Arubihpsis tthoiana phospholipase C
adenosine triphosphate
adenosine monophosphat e
caulifiower mosiac virus
chloramphenicol acetyltramferase
ca2+- dependent protein kinase
wld-regdated
cysteme
dehydraîion responsive element
green fluorescent protein
B-glucuronidase
late embryogenesis abundant
low-temperature-inducible
low temperature responsive element
firefly luciferase gene
bacterial luciferase gene
3-(N-morpholino)propanesulfonic acid
Cmethylumbelliferone
Cmethylurnbellifyl P-glucuronide
nopiine synthase
neomycin phosphotransferase
polymerase chah reaction
polyethylene giycol
pyrophosphate
PY rd
mc
SDS
SSC
'm X-Gluc
V P ~
pyrimidine
responsive to desiccation
Reniih luciferase gene
sodium dodecyi sulfate
3 M NaCI, 340 mM sodium citrate, pH 7.0
tryptophan
5-bromo-4-chloro-3 -indolyl glucuronide
v1viparous- 1
INTRODUCTION
The productivity of plants is greatly aEected by environmental stresses. The
genetic irnprovement of stress tolerance is an urgent need for the future of Agriculture.
The winterhardiness of perennial and winter annuai crops has been a major preoccupation
of agronornists in North Arnenca for a long t h e (McKersie and Leshem, 1994). Malfa
(Medicago sativa L.) is an important forage legume grown in North America as a hay and
silage crop, and is susceptible to fieezing injury (Jung, 1972). Because tolerance involves
complicated p hysiological and biochemicai pathways, it is difncult to develo p freezing
tolerant alfalfa using only traditional breeding methods.
During the last decade, scientists have developed tools which allow the application
of rnolecular biology to study complex physiological problems. Combined with a
traditionai breeding program, plant genetic engineering has the potential to develop stress
tolerant genotypes in a relatively short period of time. Recently, a few cold and fkeeze
inducible genes have been cloned and characterized. Functions for a number of the
encoded products have been predicted fiom sequence homology with known functional
proteins.
However, the mechanism of their temporal and spatial regulation has not been
studied in detail. How does a physical phenornenon, i.e. the loss of water due to low
temperature, cause a biochemical response and the induction of specific genes? Is there a
specific receptor in the cell membrane required for recognition of cold temperature? How
is the signal responsive to cold produced and passed on to the cold inducible gene? Which
cis-element in the promoter region is essential for gene transcription? How do the stable
transcription complexes form to initiate gene induction? 1s the transcript subject to post-
transcriptional processing? 1s the regulatory pattern the same in dEerent tissues and
diEerent developmental stages? Further applications of cold or fieeze inducible genes to
improve winterhardiness in alfalfa depends upon a complete understanding of the
functional architecture of the proximal region in those genes in alfalfa.
A promoter called rd29a is cold inducible in transgenic tobacco and Arabidopsis
(Yamaguchi-Shinozaki and Shinozaki, 1993; 1994) and may be introduced into alfalfa for
regulation of transgenes involved in cold tolerance. The purposes of this study were to: 1)
determine whether or not the rd29a promoter would be effective as a cold inducible
promoter in alfalfa; 2) develop a method to evaluate and compare the efficiency of
different cold inducible promoters in alf ia; 3) idente regulatory elements within the
rd29a promoter that might function in transgenic alfalfa.
1.1 Physiology of Stress Tolerance in AIfalfa
Plants respond to conditions of stress through a number of physiological and
developmental changes (McKersie and Leshem, 1994). The mechanisms responsible for salt,
cold and drought tolerance are probably similar, since aU lead to a depletion of cellular water
(Shinozaki and Yamaguchi-Shinozaki, 1996). Mal fa (Medcugo saliva L.) grows naturdy
under more diverse conditions than most pe re~ ia l species; thus some ecotypes are adapted to
cold, northern climates, and others to warm, dry southem climates.
Acclimation at a iow temperature involves a number of morphological, biochemicd,
and physiological changes (Hallgren and Quist, 1990; Huner, 1985; Guy, 1990). Varyhg
degrees of cold tolerance can be observed for most alfaLfa tissues and is usually greatest for
crowns, intermediate for roots, and least for leaves (Jung, 1972). Sucrose and several soluble
proteins have been consistently associated with cold tolerance. Such alterations are
accompanied by an increase in bound water and increased activity in a number of
dehydrogenases associated with respiratory pathways (Guy, 1990). Results obtained by
Mohapatra et al. (1988,1989) showed that mRNA corresponding to cold-induced genes
indeed accumulated in alfalfa plants exposed to low temperature. Desiccation resulting fiom
drought, salt, and cold, induces membrane darnage, Le. aiterations in membrane structural
integrity and function, dong with alterations of membrane physico-chemical properties
(Leprince et al., 1993).
1.2 Molecular Genetics of Stress
1.2.1 Stress Inducible Proteins and Genes
The phenornenon of stress tolerance is a multi-faceted conditioned response to a
combination of environmentai factors that differentialiy affect plant varieties. In recent years
efforts have turned toward the isolation of genes that are induced during water deficit in order
to study the function of stress-induced gene produas and the pathways that lead to their
induction. A number of water-deficit-induced gene products, which were first identiiïed fi-om
genes that are expressed during the maturation and desiccation phases of seed development
(Late Embryogenesis Abundant FEA] proteins) are predicted to protect cellular structures
tiom the effects of water loss (Baker er a%, 1988). It has since been recognized that these leu
genes are also expressed in vegetative tissues during penods of water loss resulting from
water, osmotic, a d o r low temperature stresses. At least six groups of lea genes have been
identified on amino acid sequence similarities among several species (Dure, 1993). The
majority of the lea gene products are predorninantly hydrophiiic, based on amino acid
composition, and lacking in Cys and Trp and are proposed to be located in the cytoplasm
(Bray 1993). These predicted functions include sequestration of ions, protection of other
proteins or membranes, and renaturation of unfolded proteins (Dure, 1993).
Abscisic acid (ABA) is an important hormone responsible for mediating seed
development and plant stress response. ABA is synthesized through the carotenoid
biosynthetic pathway. The function of ABA can be classified into two functiond groups: seed
ABA and vegetative ABA. Seed ABA is involved in embryo maturation, dormancy and
germination. Vegetative ABA is involved in environmental stresses (McCourt, 1997). The
levels of endogenous ABA increase significantly in many plants subjected to drought and
high-salinity conditions (Davies et al., 1991). ABA levels also increase, at least transiently, in
response to low-temperature stress (Thomashow, 1994). Additionally, many drought-
inducible and cold-inducible genes are induced by exogenous ABA treatment (Michel et al.,
1994). Transcription and translation are required for ABA biosynthesis during stress
(Guerrero and Mullet, 1986), indicating that the ABA biosynthetic enzymes or other proteins
in the pathway must be synthesized for elevated levels of ABA to accumulate and before
ABA-requiring genes cm be induced.
Other genes induced under stress conditions are thought to function in protecting cells
from water deficit or temperature change by the production of several different gene
products: water channel proteins involved in altering cellular water potential (Bray, 1993;
Chrispeels et al., 1994; Yarnada et al., 1995); the enzymes required for the biosynthesis of
various osmoprotectants, such as proline (Bray, 1993; Bartels and Nelson, 1994); lipid
desaturases for membrane modification (Bray, L 993 ; Thomashow, 1994; Bohner et al., 1995;
Bartels et al., 1994); thiol proteases and ubiquitin, which are required for protein turnover
(Kiyosue et al., 1994; Williams et al., 1994); detoxification proteins, such as glutathione S-
tramferase, soluble epoxide hydrolase, catalase, and ascorbate peroxidase (Bohner et al.,
1 995; Bartels et al., 1 994; Prased et al-. 1 994; Kiyosue et al, 1 994; Mittler et al., 1 994). AIso
protein kinase, phospholipase C, and transcription factors, which are involved in further
regdation of signal transduction and gene expression, are produced in response to stress
conditions (Hiyayama et al., 1995; Urao et al.. 1994; Kusano et al., 1995).
1.2.2 Stress Signal Transduction
Signal transduction cascades between the perception of a stress signal and the
expression of various genes, have only been recently studied. h higher plants, many genes
involved in signal transduction pathways, such as those encoding G proteins, protein kinase,
and transcription factors, are induced by environmental signals or stresses (Shinozahi et al..
1996). The genes for several protein kinases and for phospholipase C are also induced by
drought and cold stress. A cDNA for Arabidopsis thaliana phospholipase C, AtPLCl, has
been isolated ffom dehydrated Arabidopsis (Hiyayama et al., 1995). Two cDNAs for the
ca2'-dependent protein kinases (CDPKs), AtCKPK 1 and AtCDPK2, have also been isolated
fiom Arabidopsis (Urao et al., 1994). Northern blot analyses have shown that these genes are
rapidly induced by drought and salt stresses. Moreover, the gene for CDPK fiom alfalfa is
also induced by cold stress (Monroy et al.. 1995).
ABA-regulated closure of stomata and the dehydration-dependent, cold-dependent or
ABA-dependent responses of guard cells have been extensively andyzed at physiological
levels (Giraudat et al., 1994; Giraudat, 1995). Transient elevations of cytoplasmic ca2+ ions
have been observed in response to cold and to ABA treatment (Giraudat et al.. 1994). An
influx of ca2' ions into the cytoplasm occurs under cold conditions and is thought to function
in the induction of cold-inducible genes (Monroy et ai.. 1995).
Although the ABA receptors have not been identified, the role of ABA in stress-
related signal transduction has been analyzed with ABA-insensitive mutants in various
species. The rnaize vpl (viviparous- 1) and Arabidopsis abil (abscisic acid insensitive 1) genes
have been cloned and extensively characterized (Hattori et al., 1995; Leung et al., 1994).
1.2.3 Cold Inducible Promoter
Cells have evolved multiple strategies to adapt the composition and quality of their
proteins to requirements imposed by changes in environmentai conditions. T'ose proteins
traasmitting novel hctional propdes to celis can be wntroiled at the transcriptional,
posttranSCnptiond, translational or post-translational Iwel. Extensive research over the past
decade has shown that transcriptional regdation is used as the predominant strategy to
control the production of new proteins in response to environmental stimuli (Yamaguchi-
Shinozaki and Shinozaki, 1994). A few promoters of stress inducible genes have been isolated
and studied. The best studied element is the ABA responsive element designated ABRE,
which has a conserved sequence PyACGTGGC (Marcotte et al, 1989; Mundy et al.. 1990;
Bray et al., 199 1). cDNAs encodiig DNA binding proteins that specifically bmd to the ABRE
have been cloned and are shown to contain the basic domaideucine zipper (bZIP) structure
(Guiltinan et al., 1990; Oeda et al., 199 1). Recently, different cis-acting elements have been
reponed to fhction in ABA-induced gene expression and ABA independent gene expression
(Yamaguchi-Shinozaki et al., 1994; White et al.., 1994).
1 -2.4 RD29A Gene and Promoter
Yamaguchi-Shinozaki et al. (1993) isolated the dehydration-responsive genes rd29a
and rd29b which showed ABA-independent and ABA-dependent expression, respectively, in
Arabidopsis. The two gens are located in tandem in an 8 kb region of the Arabidopsis
genome and encode hydrophilic proteins for which their physiological hctions are not clear.
Dehydration induces the rd29a mRNA accumulation in a two-step kinetic manner.
Transcription is induced very rapidly at a high rate, 20 miautes &er the start of dehydration,
foilowed by a second induction after more than 3 hours. Meanwhile, the transcription of
rd29b mRNA is induced within 3 hours of dehydration. When the plant is treated with AB&
the expression of both genes is shulated more than 3 hours after treatrnent. It appears that
rd29a has at least two cis-acting elements. One is involved in an ABA-associated slow
response to dehydration and the other bctions in ABA-independent rapid induction. Using
differential cDNA screening, Nordin et ai. (1 993) have isolated low-temperature-inducible
(ltz] genes f?om Arabidopsis, two of which, In'78 and lli65, are identical to rd29a and rd29b,
respectively. The expression of lti78 is induced mainly by low temperature, while the
expression of lti6S is induced by both ABA and drought.
To idente the cis-acting elements involved in the ABA-independent gene expression
of rd29a, further research in transgenic Arabidopsis and tobacco shows that the 157-bp
prornoter region f?om -268 to - 1 1 1 includes orientation-independent cis-acting elements
involved in the dehydration-induced expression of rd29a (Yamaguchi-Shinozaki and
Shinozaki, 1994). An enhancer region is located between -4 17 and -323. One ABRE-like
sequence (ACGTGG) was found in the rd29a promoter region. Two 9-bp core sequences
(TACCGACAT) were found to be essentid and are able to tiinction alone as a positive cis-
acting element for dehydration-responsive expression of rd29a (Yamaguchi-Shinozaki and
Shinozaki, 1994). When the 57 bp (-69 to -133) fiagrnent containhg one of the 9 bp core
sequences was tandemly duplicated, the gene expression level increased twofold.
Examing the eEects of environmental stresses, such as low temperature, hi& salt,
ABA and dehydration, the cis-acting element was found to function in al1 of these stresses
except for ABA (Yamaguchi-Shinozaki and Shinozaki, 1994). These results indicated that the
9-bp element functions as a positive cis-acting element in low-temperature or high-salt-
responsive expression as well as in dehydration-responsive expression and was narned
Dehydration Responsive Element (DRE). Nuclear factors that specifically bind to D E
designated as DRE Binding Factor 1 (DRBFI) have been identified by gel shift assay with
nuclear extracts prepared from both normal and stress environments (Yamaguchi-Shinozaki
and Shinozaki, 1994). The DRBF1 are always present in the nucleus and always bind to DRE
but only act to stimulate the transcription of rd29a under stress conditions (Yamaguchi-
Shinozaki and Shinozaki, 1994).
DRE related motifs have been reported in the promoter regions of cold-inducible and
drought-inducible genes such as krnl and cor6.6 (Wang et al., 1995). Baker et al. (1994)
reported a similar motif (TGGCCGAC) in the promoter regions of the cold-inducible corl5a.
The 5 bp CCGAC core sequence was found in the promoter region of the winter Brassica
napus gene, BNI 1 5 (White et al., 1994), and was designated as a low temperature responsive
element (LTRE) .
1 -3 Gene Transformation
Genetic transformation of plants is one of the most important advances in plant
science research. Foreign genes can be introduced into plants either directly or indirectly
using biological or mechanical methods. The application of gene transformation to the
understanding of the physiology and biochemistry of stress tolerance has led to a new way of
discovering and improving stress-responsive gene expression by either Agrobacterhm or
biolistic particle bornbardment methods (Yamaguchi-Shinozaki and Shinozaki, 1993; White et
al., 1994).
1.3.1 Promoter Reporter Fusion System
The analysis of promoter-reporter gene fusions is one of the most widely used
techniques for identifying sequences that control the temporal and spatial regulation of cloned
genes. The use of precise gene fusions can simple anaiysis of the complex process of gene
transcnptional control. For instance, it is possible to delineate the contribution of
transcriptional control in mRNA stability by elirninating al1 the specific signals for post-
transcriptional controls and replacing them with sequences fiom a readily assayed reporter
gene (Jefferson, 1987).
Some researchers had assumed that the translational fusion can maintain the stabiiity
of the reporter gene product under stresses (Vazquez-Tel10 et al., 1997), i.e. when the
promoter and additional fragment of its own coding region are fbsed in fiame with the
reporter gene, the srnall piece of inducible prornoter protein product should stabilize the
following reporter protein. However, in investigations of the environmentally inducible
promoters, the gene products of the promoter-reporter fusion sometimes were unstable for
reasons that are not yet understood (Taylor, 1997). In addition, there are sorne arguments
that promoter-reporter fusion can produce artifactuai expression that does not accurately
reflect the in vivo regulation of the gene of interest (Taylor 1997). Besides the promoter
region, the gene can be regulated by several other structures within the gene, such as introns,
or in the 3' untranslated region. Reporter gene products are also capable of difhsing from the
cells in which they were synthesized. GUS activity was not confirmeci with in situ mRNA
hybridization when this reporter gene was used to compare the expression patterns of the
tobacco P I 2 patatin gene with histochernical staining (Drews et al., 1992). Currently,
however, there are no other reliable techniques which can be used for performing the
transcriptional analysis. Combined with other methods, such as mRNA in situ hybridization
and Northem blot analysis, promoter-reporter gene fusions are stU an option for gene
regulation analysis.
1.3.2 Caulinower Mosaic Virus 3 5s Promoter in Promoter Reporter Fusion System
Stress regulated genes Vary in their tissue specificity. They may be root specific (King
et ai., l988), Ieaf specific (Plant et al., 199 1; Bartels et al., 1992) or stem specific (Feuillet et
ai., 1995). Others have normal Ievels of expression in roots, but show an increased expression
level in leaves in response to stress (Godoy et al., 1990; LaRosa et al., 1992). Specific
promoter elements or motifs are essential for tissue-specific gene expression, for example in
the caulinower mosaic virus (CaMV) 35s promoter. That has been shown to be highly active
in most plant organs and during most stages of development when integrated into the genome
of transgenic plants (Odell et al., 1985; Jefferson et al.. 1987; Timmermans et al., 1990). This
constitutive promoter contains multiple cis-elements which have a modular organization and
synergistic interactions occur among cis-elements in tobacco (Philip et al., 1990). The 3 5s
promoter contains two domains: A domain (-90 to +8) contains a root specific cis element
as 1 (TGACGTCA) (Qin et al.. 1994) and B domain (-343 bp to -90 bp). The B domain also
contains 5 sub-domains each regulating gene expression in specific tissues (Benfey and Chua,
1990).
1 -3 -3 Transient Gene Transformation
Transient gene transformation can be defined as the expression of non-integrated
genes d e r their introduction into cells or tissues. With the development of direct DNA
uptake techniques, transient gene transformation has proven to be a simple and reliable tool
prirnarily to study gene function in a heterologous expression systern. For promoter studies,
the promoter reporter gene fusion system has been widely used with transient gene
transformation (Godon et al., 1993; Itzhaki et al., 1994).
1.3.4 Biolistic Gene Transformation
Microbombardment or biolistic delivery was developed by Sanford and his coileagues
in Comeil University (Klein et al.. 1987). The method involved using high speed DNA-coated
microparticles (gold or tungsten) to penetrate the cell wall and membrane. The major
advantage of this technique is it overcornes the limitation of genotype-specific regeneration in
plant tissue culture. A wide range of cellular compartments, cell types and plant species can
be utilized for particle bombardment (Gallo-Meagher and IMne, 1993). Because of its
reliability, this technique is widely used to assess plant promoter Nnction in a transient
expression system. Using promoter-reporter gene fusion constmcts, a number of stress
inducible cis-elements were identified after bombardment (Schaeffer et a l , 1995; White et al.,
1994; Kao et al., 1996).
1.3.5 Reporter &ne
Dflerential gene expression is essentiai for the acclimation of higher organisms under
biotic and abiotic stresses. Transcriptional regulation appears to play a key role in this process
and the analysis of this process is greatly simplified if promoters of other regulatory
sequences are linked to reporter genes. The reporter genes should have the following
characteristics:
1. The gene product should not be present in the organism or tissue under study.
2. Activity of the reporter enzyme should be maintained when fused to other
promoters, to allow the study of transcription.
3. The product of the reaction catalyzed by the reporter gene product should be
stable, easy to quanti@ and highly sensitive.
Several reporter genes, such as GUS (pglucuronidase), CAT (chloramphenicol
acetyltransferase), NPTII (neomycin phosphotransferase II), luciferase, and GFP (green
fluorescent protein) are currently used in plants (Suter-Crazzolara et al.. 1995).
1 -3.5.1 Pglucuronidase (GUS) Reporter Gene
P-glucuronidase (GUS) has a monomer molecular weight of about 68,200 daltons and
is encoded by the 1806 bp long Escherichia coli uid4 gene ( Jefferson, 1987). The protein is
a hydrolase that catalyses the cleavage of the B-glucuronides. The GUS gene has been
developed as a plant reporter gene (Jefferson et al., 1986, 1987) and is widely used in plants.
GUS has no cofactors nor ionic requirements. It is very stable under a range of physiological
conditions which means it can be assayed under a variety of stress environments (Jefferson et
ai., 1987, Suter-Crazzolara et al.. 1995). Many plants assayed to date lack detectable f3-
glucuronidase activity, providing a nul1 background in which to assay chimeric gene
expression. The frequent use of GUS is justified because it allows histochemical localization
of enzyme activity in tissues or complete plantlets, in addition to the fluorogenic assay, which
provides a highly sensitive method for q u a n t m g GUS activity.
In the fluorogenic assay, GUS hydrolyzes the Cmethyl umbelMery1 glucuronide
(MUG) substrate forming the fluorogenic compound 4-methyl umbeiIliferone (MU). In the
histochemical assay, the colorless substrate 5-bromo-4-chloro-3-indolyl glucuronide (X-Gluc)
is hydrolyzed by GUS to yield a blue precipitate at the site of enzyme activity.
1.3.5 -2 Luciferase Reporter Gene
There are several forms of luciferase: bacterial luciferase (lux), firefly luciferase (luc),
and Renilla luciferase (mc) (Bronstein et al., 1994).
Firefly luciferase (luciferin Cmonooxygenase) is denved fiom the North Amencan
firefly Photinuspyralis. It has an apparent molecular weight of 62,000 dalton and requires
luciferin, ATP, and O2 as substrates (de Wet el al., 1987). The firefly gene (luc) was first
cloned by de Wet et al. (1985, 1987), the transcript being about 1,800 nucleotides long. The
reaction catalyzed by firefly luciferase occurs in two steps.
M ~ * + luciferase + luciferin + ATP <------> luciferase . lucifeq-AMP + PPi ( 1 >
luciferase . lucifery-AMP + O2 -----> luciferase + oxylucifenn + AMP + CO2 (2)
+ light (560 nm)
The first reaction is the formation of an enzyme-bound luciferyl-adenylate. During the
second reaction, the luciferyl-adenylate undergoes an oxidative decarboxylation which results
in the production of Ca, o x y l u c i f ~ AMP, and light (de Wet et al-, 1987).
The advantageous features of fuefly luciferase are that it is highly efficient, linear over
8 orders of magnitude of protein concentration, dows detection of sub-atîomole (less than
10 '18 mole) amounts of enyme and has negligible background in many organisms (Bronstein
et al., 1994). The enzyme requires no post-translational modification for enzyme actkity
which means that it cm be used for transcriptional analysis (Bronstein et al-, 1994).
The sensitiviw of the luciferase assay has made it the marker of choice for studies of
transient gene expression using bombardment (Andrew et al.. 1992). Using the luc gene
constructs, Gailie et al (1991) characterized the hctioas of the cap and poly (A) taïl for
mRNA stability in plants. Kay et al ( 1 994) used minimal CaMV 35s promoter (-90 to +8)
fùsed to the luc gene to identify the promoter cis elernents for tissue specifc gene expression.
Because the luciferin substrate can penetrate the ceIl wall and membrane, Chua et al. (1992)
was able to use a vida system to characterize gene and promoter hction in luc transgenic
plants.
Renilla renijionnis (class Anthozoa) is a bioluminescent soft coral found in the
shailow coastal waters of North America Renilla renifmis luciferase is a monomenc
protein (35 kDa) that catalyzes the oxidaîive decarboxylation of melenterazine in the
presence of dissolved oxygen to yield melenteramide, C a , and light (480 nrn) (Lomenz et
al., 1991).
The gene (mc) has been cloned (Lorenz et ai. 1991) and used as a reporter gene in
transgenic plants (Mayerhofer et al. 1995). Mayerhofer et al. (1995) utilized a 970 bp cDNA
of Renilla renifrmis luciferase which was fused with the CaMV 3 5s promoter. They
obtained transient gene expression in transgenic alfalfa protoplasts by the PEG method and
stable gene expression in tobacco, tornato and potato plants by Agrobacterium mediated
transformation. Owhg to their creative research, Renilh luciferase may becorne a useful and
novel tool for gene expression studies in plants.
1.3.5.2.3 Dual Luciferase Assay System
Recemly a Dual ~ u c i f e r a ~ e ~ ~ Assay System was introduced by Promega Inc (Cat. No.
E 19 10). In this system, two luciferases are used to make relational or ratiometric
measurernents within an scperimental system. Usually, the fint reporter gene is fi& to a
regdatory promoter to study the structural or physiological bais of regulated gene
expression. Relative changes in the expression of reporter activity correlate to the changes in
the transcriptional activity of the coupled regulateû promoter. To provide an intemal control
for minimization of inherent variabilities that can undermine experirnentai accuracy, the
second reporter gene is coupled to a constitutive promoter that is unperturbecl by the various
experimental conditions.
Dual-reporter applications utilizing firefly luciferase in combination with other
reporter genes, such as GUS m t e et al, 1994), have becorne popular in recent years.
Howwer, these CO-reporter combinations dimiaish the performance advantages of luciferase
(Sherf et al., 1996). For instance, while the luciferase assay c m be perfomed and quantitated
in seconds, the GUS assay is an endpoint assay requiring a lengthy incubation period prior to
quantification and need to be sampled in another machine. Furthemore, GUS and the other
reporter genes are limited in theu sensitivity and range of iinear response (Sherf et ai.. 1996).
The ideal dual-reporter method wodd allow the user to assay two reporters in a single
sample with similar handling conditions, speed, sensitivity, iinear range, and simple
instrumentation requirements. Firefly and ReniZh luciferases fit the above requûernents,
making this system ideal for promoter-reporter anaiysis (Sherfer al., 1996). The firefly and
Renilla luciferases need dSerent substrates Ouciferin and coelenterazine), but through
compatible chemistries, the two enzymes are able to produce light at different wavelengths
(560 and 480 nm respectively). Using the same luminometer, the two enzyme activities can be
read separately.
CHAPTER 2. ANALYSIS OF RD29A PROMOTER IN TRANSGENIC ALFALFA
PLANTS BY AGROBACTERlllTM MEDIATED TRANSFORMATION METHOD
2.1 Introduction
The rd29a prornoter is a cold, salt and drought inducible promoter isolated fi-om
Arabidopsis. Because there are two DREs and one ABRE located in this promoter,
transcriptional regulation of rd29a probably involves at least two dserent tram-acting
factors (Yamaguchi-Shinozaki and Shinozaki, 1994). Alfalfa is a perennial plant that has
the abiiity to develop cold tolerance. The putative cis-elements @RE and ABRE) of
rd29a are cold inducible in transgenic tobacco and may function in a similar way in aKalfa.
Ifthis is correct, then this promoter might be used to regulate transgene expression in
transgenic alfalfa. To test this hypothesis, a promoter region of rd29a fiom -880 to +8 1,
which contains two DREs and one ABRE driving the GUS reporter gene, was transferred
into alfalfa.
2.2 Materials and Methods
2.2.1 Binary Vector
The rd29a promoter region -880 to +8 1 containing 2 DRES and one A B E was
cloned into pBIlO 1 binary vector SmaI site making the vector rd29a-GUS (Yamaguchi-
Shinozaki and Shinozaki, 1994) and was provided by Dr. Shinozaki (Fig. 1).
2.2.2 Plant Materials
The alfalfa plant N4-4-2 (SR. Bowley, University of Guelph ) was transformed
with the binary vector rd29a-GUS by Molian Deng (University of Guelph) using the
Agrobacterium mediated method (Deng, 1993). Transgenic plants were selected on
regeneration media containing kanamycin. When the plants were 5 cm long with roots,
they were moved to a greenhouse under growth conditions of dayhight temperature
23/20°C, 16 hours photoperiod, and hurnidity approximately 65%. Screening was done by
a GUS fluorometric assay (as described below). Young and middle stems
Figure 1 . The rd29a-GUS vector
A 961 bp MaIV ftagment containhg the 880 bp region upstrearn from the site of initiation
of transcription, 64 bp of the untranslated leader sequence and 17 bp of the coding region
of rd29a was ligated into the SmaI site of the pl31101 binary vector (Yamaguchi-Shinozaki
and Shinozaki, 1993) used for Agrobacferium tumefacie~ir transformation mediated
transformation of Medicago sativa clone N4-4-2.
NOS P NPTIl NOS T rd29a promoter GUS NOS T
were sarnpled. The plants containing the highest GUS activity (Tamara Wilson, University
of Guelph, unpoblished data) were selected for subsequent experiments.
2.2.3. Coid Treatment
When transgenic alfalfa plants were at development stage 2 (late vegetative stage)
(Fick and Mueller, 1989), four rooted plants propagated by cuttings of one transgenic
plant (N4-rd29a- 13B) were placed in a growth charnber with a dayhight temperature
2"C, 16 hours photoperiod, and 60% hurnidity. Young leaves, stems and roots were
sampled d e r O, 1, 2, 3, and 4 days of cold treatment. The samples were ffozen in liquid
nitrogen and stored in -70°C for subsequent GUS activity and RNA analysis.
2.2.4 GUS assay
For the GUS tluorometric assay (Jefferson 1987), the sample was homogenised
with extraction buffer (50 mM sodium phosphate pH 7.0, 10 rnM EDTA pH 8.0, 10 m M
mercaptoethanol, 0.1 % triton X- 100 and 0.1 % sodium lauryl sarcosine). Leaves, stems or
roots were ground in liquid nitrogen and transferred to a new tube with 600 pl extraction
buffer. Total protein concentration was determined according to the Bradford method
(1976) using with ~ i o - ~ a d ~ Protein Assay Dye. A sarnple containing 5 pg of total
protein was incubated with 300 pi of assay buffer containing 0.1 M of 4-rnethyl
umbellyferyl-f3-glucuronide (MUG) (Sigma, Cat No. M 9 130) in extraction buffer for 30
minutes at 3 7 T . The reaction was stopped with 1.5 ml of 0.2 M sodium carbonate.
The GUS fluorescence was measured with a Shimadm spectrofluorophotometer and
concentration was calculated with a 4-methylumbe~ferone (MU) (Sigma, Cat. No. M
1 508) standard curve.
For the histochernical assay, kesh tissue was directly stained in X-Gluc solution
(Jefferson, 1987). To prepare a stock solution, 100 mg X-Gluc (5-bromo-4-chloro-3-
indolyl glucuronide, Sigma, Cat. No. B 9401) was dissolved in 1 ml dimethylformarnide.
The standard staining solution was prepared by adding 50 pl X-Gluc stock solution to 10
ml GUS extraction buffer (final concentration is 0.5 mglrnl). Plant materials were placed
in Eppendorftubes and 100 pl X-Gluc staining solution was added. M e r vacuum
infiltration for 1 minute, the plant material was stained at 37°C for 16 hours, and then
h e d with fomaldehyde for 1 hour. The tissue was incubated in 70% ethanol to remove
chlorophyll before observation.
2.2.5 RNA analysis
2.2.5.1 Total RNA Isolation
Total RNA isolation was performed according to Pawlowski et al. (1994). Malla
leaves, stems or roots (2 g) were ground in liquid nitrogen and extracted by adding 9 ml
RNA extraction buffer ( 100 mM NaCl, 10 rnM Tris pH 7.5, 1 rnM EDTA pH 8.0, 1%
SDS and 0.1% ME) and 6 ml phenoVchloroform (1: 1) solution. The total RNA was
precipitated with 0.1 volume 3 M sodium acetate pH 5.2 and equal volume of cold
isopropanol and put at -20°C for 30 minutes. M e r centnfiiging, the RNA pellet was
washed with 70% cold ethanol and resuspended with 2 ml DEPC-treated water and 2 ml 4
M lithium acetate and incubated for 3 hours at 4°C. M e r centrifbging, the RNA pellet
was resuspended with 0.9 ml DEPC-treated water. The quantity and quality of RNA was
evaluated by spectrophotometric determination (Sambrook et al., 1989) and by a
formaldehyde agarose gel (Sambrook et al., 1989). For the spectrophotomenc
determination, readings were taken at wavelengths of 260 nm and 280 nrn. An unit
corresponds to approximately 40 &ml RNA. The ratio between the readings at 260 nm
and 280 nrn provides an estimaie of the purity of the RNA. Running through a
formaldehyde agarose gel, RNA quality was evaluated after staining with ethiduim
bromide ( O S &ml).
2.2.5.2 RNA Slot blot
Total RNA (20 pg) was denatured by adding 3 volumes of the denaturing solution
(500 pl formamide, 162 pl formaldehyde, 100 pl MPOS buffer, pH 7.0) and incubated at
65°C for 15 minutes. Using the GIBCO BRL HYBRI-SLOT~' 24-Weil Filtration
Manifold (Cat No. 2 1052 O 14 ), the denatured RNA was transferred to a nylon membrane
(Boehringer Mannheim Cat. No. 1417 240) with 1ûx SSC solution (3 M NaCl, 340 rnM
sodium citrate, pH 7.0). M e r transfer, the membrane was baked at 80°C for 1 hour.
2.2.5 -3 Probe Preparation and Estimating the Yield of Probe
Using the Boehringer Mannheim DIG DNA labelling system (Cat No. 1 175033),
and the plasmid pBI221 (Clonetech Inc., Cat. No. 6019-2) as a template, an 800 bp DIG
labelled GUS probe was synthesised by PCR with two primers ( 5'- CCG TGG TGA CGC
ATG TGA GCG -3' and 5'- CGC TGA TGG TAT CGG TGT GAG CG -3'). The PCR
procedure was 25 cycles of 30 seconds 95°C denaturing; 1 minute 62°C annealing; and
1.5 minutes 72OC elongation. The yield estimation of probe was done in a side by side
cornparison of the DIG-labelled GUS fiagrnent with a DIG-labelled control.
2.2.5 -4 Hybndisation
For pre-hybridisation, the membrane was sealed in a hybridisation bag and
incubated at 42°C with high SDS hybridisation solution (7% SDS, 50% formamide, 5x
SSC, 2% blocking reagent, 50 mM sodium-phosphate pH 7.0, 0.1% N-lauroylsarcosine)
under gentle shaking. M e r 4 hours pre-hybridisation, the DIG-labelled probe was added
to a concentration of 50 ng/d and incubated at 42°C for 16 to 20 hours.
2.2.5.5 Detection
The cherniluminescent detection was according to the Boehringer Mannheim DIG
DNA labelling detection manual (Cat. No. 1 1750 14). After hybridisation, the membrane
was washed using 2x SSC Washing Solution (2x SSC, 0.1% SDS) twice per 1 5 minutes at
room temperature. Following 0 . 5 ~ SSC Washing Solution ( 0 . 5 ~ SSC, 0.1% SDS)
washing twice for 30 minutes at 65°C. the membrane was biocked in blocking solution for
40 minutes. The ratio of Anti-DIG-Alkaline Phosphatase (Boehringer Mannheim, Cat.
No. 1093 274) 1 :3 000 was used for enzyme immunoassay. Detection was pehrmed with
the colorimetric detecfion reagent ~ ~ ~ f l @ i s o d i u m 3-(4-methoxyspiro{ 1,2dioxetane-
3,2'-(5'-chioro)tricyclo[3.3.1.1 "'ldecan) 4yilphenyl phosphate, Boehringer Mannheim,
Cat. No. 1655 884).
The intensity of RNA dot biot was evaluated with Northem Exposure
(ImagExperts Inc.). Data was andysed using the Microsofi Exel (version 5.0) and the
General Linear Mode1 Procedure in SAS (version 6.1 1).
After the screening of kanarnycin resistance and the GUS histochemical staining ,
sixteen independent transgenic &alfa plants transferred by the vector rd29a-GUS were
evaluated for GUS activity (Fig. 2). There was a 100-fold ciifference in GUS activities
among these transgenic aifalfa plants when stem tissue was sarnpled fkom plants grown in
the greenhouse at standard growth temperatures. The rd29a-GUS transgene was
expressed as shown by the histochemical staining (Fig. 3) in all tissues of transgenic alfalfa
N4-rd29a-13B, including the flower, stem, and root. GUS activity was highest in the root,
then the stem, and lowest in the leaf in N4-rd29a- 13B when grown in the greenhouse at
normal temperature.
To determine if the rd29a promoter was cold inducible in alfitKa, cuttings of the
original p r h a q tramgenic plant were grown to late vegetative stage (Fick and Mueller,
1989) and transferred to the acciimation chamber at 2OC. GUS activity increased in stem
and leaf tissues of transgenic alfaKa plants containing the rd29aGUS transgene with
duration of wld treatment (Fig. 4). However, GUS activity decreased in the roots over
the sarne period of the .
Figure 2. GUS activity under nomal temperatures in stems of tramgenic a l f i a plants
containhg the rd29a-GUS vector (data fiom Tamara Wdson, University of Guelph,
unpolished data)
Transgenic plant
Figure 3. Histochernical staining for GUS activity in rd29a-GUS transgenic &alfa (N4-
rd29a- L 3 8) under normal growth temperature
A. flower: Ieft - non-transgenic N4-4-2; nght - transgenic
B. Stem: longitudinal section of stem, top and boaom
C. Root: secondary root of transgenic alfalfa
Figure 4. GUS activity of le& stem and root tissues in transgenic alfalfa (N4-rd29a- 1 3 B)
under cold treatment (2°C)
For each tissue, vertical error bars represent SE (r = 4, n = 20).
The ANOVA table for this figure is located in Appendix Table A. 1 .
Leaf
Incubation day
Stem
Incubation day
Root
O 0.5 1 1.5 2 2.5 3 3.5 4
Incubation day
During cold acclimation, the mRNA levels in the stems of rd29a-GUS transgenic
a l f i a plants increased within 2 days then decreased to a steady state level that was higher
than O day (Fig 5) . The picture of RNA slot blot of root was not clear because of the high
background (no figure shown here).
2.4 Discussion
The full rd29a promoter (-880 to +8 1) functions in ail tissues tested at normal
growth temperatures, although there was considerable variation arnong transgenic plants
in the level of GUS expression. The rd29a promoter was also cold responsive in alfalfa,
but only in the shoot tissues, because a cold treatment increased GUS activity and GUS
mRNA levels in the shoots. Nonetheless, there was a temporal difEerence between the
accumulation of mRNA and the increase of GUS activity. The mRNA levels peaked at
two days after transfer to the cold, whereas GUS enzyme activity peaked at four days. It is
therefore possible that the GUS protein was too stable to detect changes in transcription
over a short period of tirne. Similar observations have been made by others, prompting the
journal The Plant Cell to require additional confirmation of promoter function beyond
GUS activity (Taylor, 1997).
Although GUS activity increased in the shoots (stems and leaves), it decreased in
roots of the same plant in response to cold. Therefore, the regulation of gene expression
by cold seems to be different in these tissues. Several different trans-acting factors or CO-
activating factors may be involved in the cold response in alfalfa and other plants. If
different trans-acting factors are involved in gene regulation in these tissues, this rnight
explain why the regulation patterns are different in these tissues. In winter cereals, the
root does not cold acclimate to the sarne degree as the crown or leaves (Chen et al.,
1983), but in &alfa, the root does acclimate more than the leaves (Jung, 1972). So the
differences in regulation of the rd29a promoter in alfalfa do not correspond with known
differences in the potential of these tissues to cold acclimate.
Figure 5. mRNA levels of GUS in stem tissue fiom rd29a-GUS transgenic alfalfa N4-
rd29a-13B afler incubation at 2°C for 5 days
A Slot blot
Total RNA (20 pg) was added in each dot.
B. The intensity of RNA slot blot as determined by image analysis
The units of intensity is the percentage over control day 0. Vertical error bars
represent SD.
Wild type DayO Day2 Day3 Day4 DayS
O 1 2 3 4 5
Incubation Days
CHAPTER 3. TRANSFORMATION AND TRANSIENT EXPIZESSION OF
DEHYDRATION RESPONSrVE ELEMENT OF RD29A
3.1 Introduction
As shown in chapter 2, the rd29a promoter was expressed at standard growth
temperatures and was cold induced in transformed a l f ' a plants, although its regulation seems to
Vary among tissues. There is no indication whether the DRE or the A B E or both provide this
regulation. Both might fùnction independently or perhaps there is some interaction between them.
To determine the effeas of the DRE, a region - 1 13 to -44 1 of rd29a was cloned in a series of
promoter-reporter tùsion biolistic constructions.
3.2 Matenals and Methods
3 2.1 Plasmid Construction
Al1 restriction enzymes were purchased fiom Pharmacia Biotech Inc. DNA isolation was
completed by DNA FlexiPrep Kit (Pharmacia Biotech, Cat. No. 27-928 1-0 1). DNA fiagments
were recovered by sephaglasm~and~rep Kit (Pharmacia Biotech Inc., Cat. No. 27-9285-0 1). TJ
DNA ligase was purchased fiom GIBCO BRL Inc. (Cat. No. 15224-0 17). The DNA
recombinant protocols were conducted according to the instruction manuais f?om the supply
companies and Ausubel et al. (199 1).
3.2.1.1 Subcloning of plasmids pUC-LUC90, pUC-LUC, pUC-GUS902, and pRL-35s
Plasrnid pBI22 1 (Fig 6 4 Clonetech Inc., Cat No. 60 1 9- 1 ) was digested with the
restriction enzyme EcoRV. The resulting 700 bp fragment, containing a 90 bp CaMV35S
promoter (TATA box) and a partial GUS gene, was cloned into pUC 19 (Clonetech Inc., Cat. No.
61 11-1) at the SmaI site to create a new plasmid, pUC-GUS901. By using SmaI and EcoRI
restriction enzymes to cut pBIî21, it was possible to insert the whole GUS coding region and
NOS terrninator into equivalent sites in the vector pUC-GUS901 to create a new basic biolistic
vector pUC-GUS902 (Fig. 6B).
The pGEM-luc plasmid (Promega Inc., Cat No. E 154 1) containing a 1.7 kb fiefly
luciferase gene coding region was digested with BamHI to release the gene coding region.
Following digestion the sticky end of the luciferase coding region was fiiled using a Klenow
£kagrnent (GIBCO BRL Inc., Cat. No. 18012-021) and re-cut with Sac 1 to produce a Sac1 sticky
Figure 6. DNA restriction map of plasmid pBI22 1 and pUC-GUS902
k pBI221 plasmid
The 3 kb hgemnt containhg CaMV 35s promoter, GUS gene, and NOS teminater was
cloned into Hindm and EcoRI sites of pUC 19.
B. pUC-GUS902 plasmid
The CaMV35S promoter region fiom -90 to +8 containhg TATA box was cloned into
pBI22 1 instead of the whole 800 bp CaMV35S promoter.
A
Hindlll EcoRV Smal EcoRV EcoRl
CaMV 35s P GUS NOS T
pB1221 5.7 kb
- - II T - 5 - E m E! B c z m I e m m I Sacl EcoRl
I --
CaMV 355 90 bp P GUS NOS T
pUC-GUS902 4.9 kb
end. The pBU21 and pUC-GUS902 plasrnids were cut with SmaI and SacI to remove the GUS
coding region. The fkefIy luciferase gene coding region containing one blunt end and one SacI
sticky end was then Uiserted into the SmaI and SacI sites of both pBI.22 1 and pUC-GUS902,
thereby replacing the GUS coding region to create the new plasmids pUC-LUC (Fig. 7A) and
pUC-LUC90 (Fig. A).
Plasmid pK-nul1 (Promega Inc., Cat. No. E2271) containing a RenzlZa luciferase gene
(940 bp) was digested with Hindm and PstI. The 800 bp 35s promoter HindWSmaI fiagrnent
nom pBI22 1 was cloned into these sites creating the vector pRL-3 5 S (Fig. 8B).
3.2.1.2 Subcloning of plasmids containing rd29a DRE region
Using the rd29a-GUS vector as a template, the - 1 13 to -44 1 region of the rd29a promoter
(Fig. 9), containing two DRE boxes and one enhancer region, was isolated by PCR using two
primers (5'- CGC CTT CCT GAC ATC ATT C -3' and 5'-CTC TCT ACG CGT GTC TG -3').
In order to reduce errors, the enqmepjir DNA Polymerase (Stratagene Inc., Cat. No. 600 135)
was used instead of Taq DNA Polymerase. When thepfu polymerase is used instead of Taq
polymerase, the PCR products are blunt ends. The PCR product was cloned into the pBluescipt
KS(+) (2.9 kb) at the EcoRV site. By using different ratios of vector and insert d u ~ g Ligation,,
the insert was cloned in the vector as 1 or 3 randornly arrayed copies in both orientations. A series
of plasmids with one copy of the rd29a in the fonvard orientation (pBL IF), with one copy of the
rd29a in the reverse orientation (pBL 1 R), with two copies of the rd29a in fonvard orientation
@BLZF), and with three copies of the rd29a in the fonvard orientation (pBL3F) were used in
subsequent experirnents. Following digestion of these pBL plasmids with Hindm and PstI, one or
three copies of the rd29a putative cold responsive region were cloned into the pUC-GUS902 and
pUC-LUC90 at the Hind DI and Pst 1 sites, upstream of the 35s TATA box creating plasmids
called pUC-GUS902 IF, pUC-LUC90 IF, pUC-LUC90 l q and pUC-LUC903F (Fig. 8A and 10).
The identity of the plasmids was confirmed by restriction enzyme analysis and DNA
sequencing (Fig. 11 and 12). DNA sequencing was done with Dye Terminator Cycle Sequence
by Angela Hoiliss in Zoology Department, University of Guelph. The equipment was AB1 Pnsm
377 DNA Automated Sequencer. The -2 1M 13 (fonvard) and M 13 Rev (reverse) pnmers were
used (supplied by Angela Holliss).
3.2.2 Biolistic transformation
3.2.2.1 Preparation of plant material
Figure 7. DNA restriction map of plasmid pUC-LUC and pUC-LUC90
A. pUC-LUC plasmid
The 1.7 kb luc was cloned into pBI22 1 instead of GUS gene.
B. pUC-LUC90 plasmid
The CaMV35S promoter region fiom -90 to +8 containing the TATA box was cloned into
pUC-LUC instead of the whole 800 bp CaMV35S promoter.
Hindllll BamHll Xhol Sacl EcoRl
CaMV 35s P Firefly LUC NOS T
pUC-LUC 5.6 kb
B
BamHll
CaMV 35s 90 bp P Firefly LUC NOS T
pUC-LUC90 4.8 kb
Figure 8. DNA restriction map of plasmid pUC-GUS9021F and pRL-35s
A. Plasrnid pUC-GUS902 1 F map
The -1 13 to -44 1 region of rd29A promoter was cloned into pUC-GUS902
HindIII and Pst1 sites.
B. Plasmid pRL-3 5s map
pRL-35s was based on pRL-nul1 plasmid. The 800 bp CaMV35S promoter
cloned into the HindIIï and SmaI sites in pRL-nul plasrnid.
Hindllll Pst1 S mal Sacl Eco RI
rd29a 340 bp P CaMV 35s 90 bp P GUS NOS T
Hindlll 800 bp Smal 900 bp 200 bp
CaMV 35s P RUC SV40 PolyA
pRL-35s 4.2 kb
Figure 9. Partial DNA sequence of the rd29a promoter region
An enhancer region is located between -4 17 and -3 23. ABRE-Like sequence, DRES, TATA box,
and primer binding regions for PCR cloning are underlined.
7 -417 Enhancer Region 7 -441 primer
C C T C 77GA CATCATTCAAmMmACGTATAAAATAAAAGATCATAc CT AlTAGAACGATTAAGGAGAAATACAATTCGAATGAGAAGGATGTGCCGmG
-323 ITATAATAAA AGCCACACGACGTAAACGTAAAATGACCACATGATGGGCCA
$274 AJAGACATGGACCGACTACTAATAATAGTMGTTACAmAGGATGGAATAA
DRE BOX ATATCATACCGACATCAGn-lTGAAAGAAAAGGGAAAAAAAGAAAAAATAAA
DRE BOX TAAAAGATATACTACCGACATGAGTTCCAAAAAGCAAAAAAAAAGATCAAGC
primer V -113 CGACACAGACACGCGTAGAGAG ABRE BOX CAAAATGACTJTGACGTCACACCACGAAAACAGACGClTCATACGTGTCCCTT
TATA BOX TATCTCTCTCAGTCTCTCTATAAACTTAGTGAGACCCTCCTcTGmAcTcAc AAATATGCAAACTAGAAAACAATCATCAGGAATAAAGGG-
Figure 10. Maps of plasmids pK-LUC90 IF, pUC-LUC90 1 R, and pUC-LUC903F
The truncated rd29a promoter was cloned into the HindIII and Pst1 sites in vector pUC-
LUC90 with two orientations and one or three copy nurnbers.
Hindllll Pstf Sacl EcoRl
rd29a 340 bp P CaMV 35s 90 bp P Firefly Luc NOS T
pUC-LUCSOIF 5.2 kb
Hindllll Pstl Sacl EcoRl
rd29a 340 bp P CaMV 35s 90 bp P Firefly Luc NOS T
pUC-LUC901 R 5.2 kb
Hindllll Pstl Sacl EwRl
rd29a 340 bp P rd29a 340 bp P rd29a 340 bp P CaMV 35s 90 bp P FireRy Luc NOS T
pUC-LUC903F 5.9 kb
Figure 1 1. Restriction enzyme digestion of pUC-GUS902, pUC-LUC90, pUC-LUC
and pRL-3 5 S plasmids
A pUC-GUS902
Lane 1 - B a digestion of pUC-GUS90 (fiom top to bottom: 4.8 kb pUC19 plus GUS
and Nos terminater, 130 bp tnincated CaMV35S promoter ; Lane 2 - DNA mass ladder (Eom top to bottom: 2 kb, 1.2 kb, 800 bp, 400 bp, 200 bp, 100 bp); Lane 3 - Lamda DNA
HiodIWEcoRI digestion.
B. pUC-LUC90, pUC-LUC, and pRL-3 5s
Lane 1 - Lamda DNA HindIWEcoRI digestion; Lane 2 - DNA mass ladder (same as A);
Lane 3 - HindIII/SmaI digestion of pRLJ5S (fiom top to bottom: 3.3 kb pRL-nu& 870 bp
CaMV35S promoter, Lane 4 - BarnHI/XhoI digestion of pUC-LUC (fiom top to bonom:
3 -4 kb, 1.6 kb luc); Lane 5 - BamHIB(ho1 digestion of pUC-LUC90 (fiom top to bottom:
3 kb, 1.6 kb luc).
Figure 12. Restriction enzyme digestion
A pBL1 F, pBL2F, and pBL3F
Lane 1 and Lane 2 - Hindm/PstI digestion of pBL2F; Lane 3 - Hindm/PstI digestion of
pBL 1 F (fiom top to bottom: 2.9 kb Bluescript, 340 bp one copy of rd29a promoter); Lane 4 - HindIlllPstI digestion of pBL3F (fFom top to bottom: 2.9 kb Bluescript, 1.2 kb thme copies of
rd29a promoter); Lane 5 - Larnda DNA HindIIUEcoRI digestion.
B. pUC-LUC90 1 F, pUC-LUC903F and pUC-GUS902 IF
Lane 1 and 8 - Lamda DNA HindlIVEcoRI digestion; Lane 2 - DNA m a s ladder (same
as Fig. 11A); Lane 3 - 329 bp rd29a PCR product; Lane 4- WindIII/PstI digestion of pUC-
GUS9021F (from top to bottom: 4.9 kb pUC-GUS902 350 bp one copy rd29a promoter; Lane 5
- HindIII/PstI digestion of pBL3F (fiom top to bottom: 2.9 kb Bluescript, 1.2 kb three copies of
rd29a promoter); Lane 6 - HindIII/PstI digestion of pUC-LUC903F (fiom top to bottom: 4.8 kb
pUC-LUC90, 1.2 kb three copies of rd29a promoter); Lane 7 - EndIII/PstI digestion of pUC-
LUC901F (from top to bottom: 4.8 kb pUC-LUC90,350 bp one copy rd29a promoter).
Malfa plants of the clone N442 were grown in the pots containing ~ u r f a c e ~ (Plant
Products, Toronto, Ontario) in a growth room at day/night temperatures 23/20" C; 16 hours
p hot0 period; and 65% humidity . Full y expanded young alfalfa le& blades were sterilized with
70% (v/v) ethanol for 20 seconds, followed by washing twice for 3 to 4 minutes with sterile
water. Six leaf blades (40-50 cm2) were arranged on an agar (1 0 g/L) plate without any nutrient
medium.
3 -2.2.2 Plasrnids
In GUS activity analysis, the test plasmid was pUC-GUS9021F containhg the truncated
rd29a promoter. The positive control plasmid was pBE2 1 (CaMV 3 5 S prornoter). In Iuciferase
activity anaiysis, the positive control plasrnid was pUC-LUC (CaMV 35s prornoter). The
negative control plasmid was pUC-LUC90 and test plasmids were pUC-LUC901F , pUC-
LUCgOlR, and pUC-LUC903F containing truncated rd29a promoter. The internai control
plasmid was pRL-35s. The ratio of DNA amount between pUC-LUC90 series and pRL-35s was
2:l.
3.2.2.3 Bombardment Conditions
Particle bombardment was accomplished using the Dupont PDS 1000/He apparatus.
Particle preparation was according to Sanford et al. (1992): tungsten particles (60 mg of 1 .O pm
diameter) were vortexed in 1 ml freshly prepared 70% ethanol for 3-5 minutes and incubated for
15 minutes. The suspension was centrifbged for 5 seconds and the pellet was washed with 1 ml
sterile deionized water three times. To the washed pellet was added sterile 50% glycerol to bring
the tungsten particle concentration to 60 mghl and these microparticles were stored at room
temperature for up to 2 weeks. Before bombardment, the tungsten solution was vortexed for 5
minutes and 50 pl (3 mg of tungsten) was rernoved to a 1.5 ml microfüge tube. While vortexing
vigorously, precipitation of DNA ont0 the particles was canied out by adding in order: 5 pl DNA
(1 pg/ pl), 50 pl CaClz (2.5 M), and 20 pl spermidine (100 mM). After continuous vortexing for
2-3 minutes, the microcmiers were ailowed to settle for 1 minute and were centrifbged to pellet.
M e r removing the liquid and without disturbing the pellet, the pellet was washed with 140 pl
70% ethanol and 140 pl 100% ethanol sequentially. After adding 48 pl 100% ethanol, the pellet
was gently resuspended with vortexing at low speed for 2-3 seconds. Six aliquots of 6 pl each
were transferred to the centre of a macrocarrier.
Plant tissue was bornbarded imrnediately after DNA precipitation using the bombardment
parameters according to Pereira et al'. (1995). The bornbardment was performed at a pressure of
1000 psi, a 10 cm particle travel distance, a 7 mm gap distance and a 12 mm macrocarrier flying
distance. Each Petri dish was shot twice.
3 -2.3 Luciferase Assay
The luciferase assay was conducted as outlined in Promegays ~ua l -~uc i fe rase~ ' Assay
System (Cat. No. El9 10 ). Leaves were ground in liquid nitrogen and transferred to a new tube
with 600 pl extraction buffer. The luciferase activity was measured with a Biotrace Multilight
Luminorneter (Biotrace Ltd., WK). For firefly luciferase activity, 20 pl of the extract solution was
added into 100 pl Assay Reagent II containing luciferin and placed in the luminometer. M e r
finishing the measurement of firefly luciferase, 100 pl Stop & ~ l o " Reagent containing
coelenterazine was added to the same tube and sampled in the luminometer again. The Bradford
method (1976) was used to measure protein with ~ i o - ~ a d ~ Protein Assay Dye and activities were
expressed as relative light units per pg protein.
For imaging luciferase activity, the luciferin substrate was added to the tissue or to the
assay tube, and the sarnple was placed in a BIQ Bioview imaging system (Image Research Ltd.,
W.
3.2.4 GUS Assay
The protein extraction and GUS assay procedure were conducted as described in chapter
2 .
3.2.5 Experiments
3.2.5.1 Post incubation experiment
After bombardment, the leaf blades were irnmediately placed on 250 mM NaCl (2S°C), or
in a 60% humidity charnber (25"C), or in a 2°C or 25°C environment for 2 to 48 hours. m e r
incubation, the leaves were flash fiozen in Liquid nitrogen and stored at -70°C until assayed for
luciferase and GUS activities. For GUS activity experiments, the pUC-GUS902 and pBI22 1 were
used. For luciferase activity experiments, pUC-LUC90, pUC-LUC, pUC-LUC90 IF, pUC- LUC901R and pUC-LUC903F were used. The pRL-35s was used for an intemal control for
luciferase assay.
LUC901R and pUC-LUC903F were used. The pRL-35s was used for an interna1 control for
luciferase assay.
3.2.5 -2 Pre-cold incubation experiment
Aifâlf'a plants were trderred to a growth charnber with dayhight temperature 2°/20C,
16 hours photoperiod, 60% humidity for 24 hours. The leafblades were imrnediately sterilized as
above, and stored at 4OC until subsequently bombarded with the plasmids @UC-GUS902 and
pBI22 1; pUC-LUC, pUC-LUC90 1F and pRL-35s) as described above. The precold treated leaf
blades were bombarded at the same time as the above post incubation experiment.
3.2.6. Statistical Analysis
Data were analyzed using General Linear Mode1 Procedure in SAS (version 6.1 1). The
experimental design was a completely randomized factorial of plasmid and incubation time; each
stress treatment was analyzed as a separate experirnent. For each treatment, there were 3 or 4
replications (Petri dishes) of different leaves that were done on the same day. Significant
ciifferences were determineci at the 5% level of probability.
3.3 Results
The GUS gene, and firefly and Renilla luciferase genes were introduced into allàlta leaf
blades by particle bombardment. When the alfalfa leaf blades were bombarded with plasmids
pBI22 1, pUC-LUC and pRL3 5s independently and subsequently placed at normal growth
conditions for 48 hours, both luciferase activities reached the maximum at 24 hours whereas GUS
activity reached the maximum at 48 hours (Fig. 13).
The region -1 13 to -441 of the rd29a promoter was introduced into affalfa leaf' blades by
bombardment. At 2S°C, the highest luciferase activity was observed with the fidl length CaMV
35s promoter (Table 2). The tnuicated CaMV 35s promoter had greatly reduced activity which
was greatly increased ifthe DREs of rd29a were added in the forward, but not the reverse
orientation. Adding three copies of DREs did not increase activity above that of a single copy. At
2"C, the luciferase activities were r e d u d compareci to 25OC in all constnicts (Table 1).
In the second experirnent, firefly luciferase activities decreased relative to the non-stressed
control in all stress treatments imposed after particle bombardment, especially in the cold
treatment where activity decreased by almost 100 fold (Table 2). This occurred both for the 35s
Figure 13. Post incubation time test of bombarded alfalfa leafblades at normal growth
temperature
Vertical error bars represent SE.
A. GUS activities (r = 4, n =16, plasrnid - pBU2 1)
B. Firefly luciferase activities (r = 3, n = 2 1, plasmid - pUC-LUC)
C. Renilla luciferase activities (r = 3, n = 2 1, plasrnid - pRL-3 5 s )
The ANOVA table for this figure is located in Appendix Table A.2.
Incubation hours
Lncubation hours
Incubation hours
Table 1 . Firefly luciferase activity of bombarded alfalfa leaf blades with 5 plasmids during normal
growth and cold temperatures (Firefly lucüerase activity = relative Iight unit/pg protein).
Pooled SE = 16 (r =3, n = 30). The ANOVA table for this data is Iocated in Appendix
Table A. 3.
Pl asrn id Promoter Luc activity 2S°C Luc activity 2°C
puc-LUC 35s
PUC-LUC90 -90 35s
pUC-LUC90 1F 1 copy fonvard
pUC-LUC90 1 R 1 copy reverse
pUC-LUC903F 3 copies forward
Table 2. Firefly luciferase activity o f bombarded alfalfa leafblades with pUC-LUC and pUC-
UC90 1F plasmids dunng stress treatments (Firefly luciferase activity = relative Light
unit/pg protein) Treatments were normal (25OC), cold (2"C), sdt (250 mM NaCl, 2S°C),
dry (60% humidity, 2S°C), precold and post normal (2°C pre-incubation and 25°C post
incubation), and precold post cold (2°C pre-incubation and 2°C post incubation). Pooled
SE = 7 (r = 4, n = 48). The ANOVA table for this data is located in Appendk Table A.4.
Treatment pUC-LUC pUC-LUC90 1F
Normal 76
Cold 0.7
Salt 44
Drought 83
Precold, post normal 38
Precold, post cold 0.5
using tobacco and Arabidopsis (Yamaguchi-S hinozaki and S hinozaki, 1994).
lf the alfalfa leaves were incubated in the cold prior to bombardment, firefly luciferase
activity was completety eliminated both for the 35s promoter (plasmid pUC-LUC) and for the
DRE of the rd29a promoter @lasrnid pUC-LUC901F) (Table 2).
The Renilla luciferase activity of plasmid pRL-3 5s was afEected difEerent1y by aIi stress
treatments. Therefore, this plasmid is not a good choice as an intemal control for these stress
treatments (Fig. 14).
In the next set of experirnents, GUS was used as the reporter gene. GUS activities also
decreased relative to the non-stressed control in ail stress treatments imposed after particle
bombardment, especidy the cold treatment (Table 3). This occurred both for the 35s promoter
@lasrnid pBI22 1) and for the DRE of the rd29a promoter (plasmid pUC-GUS90 IF). This
confirms the previous observation with luciferase and does not support the previous observation
that identified the DRE in the rd29a promoter using tobacco and Arabidopsis (Yamaguchi-
S hinozaki and Shinozaki, 1 994).
If the alfalfa leaves were incubated in the cold prior to bombardment, GUS activity was
higher for the DRE of the rd29a promoter (plasmid pUC-GUS9021F) than with the CaMV 35s
promoter (plasrnid pBI22 1).
3 -4 Discussion
The Dual Luciferase Assay System has been used for determinhg the relative luciferase
activities and characterization of promoter luciferase fusion in marnmaiian systems (Sherfer al.,
1996). Both genes are also expressed in plants (Gallie et al 199 1; Kay et al. 1994; Mayerhofer el
al. 1995). The firefly luciferase and the RenilZc luciferase drîven by CaMV35S promoter were
transiently expressed in alfalfa leaf tissue after particle bombardrnent. Both enzyme activities
were stable under normal growth conditions. The half-life tirne of the two enzymes was sirnilar
and both activities reached their maximum around 24 hours a e r bombardment. Both firefly and
RenilZa luciferase activities were unstable in aifalfa when the tissue was given a cold stress
subsequent to bombardment; this rnay be due to the post-transcriptional processing. In other
species, the activity of firefly luciferase also decreased under cold treatment (Vazquez-TeUo et al.,
Figure 14. Cornparison of the response of the Renilla luciferase activity in stress treatments in
alfalfa
Treatments were normal (25"C), cold (2"C), sdt (250 mM NaCI, 2S°C), dry (60%
humidity, 2S°C), precold and post normal (2°C pre-incubation and 25°C post incubation), and
precold post cold (2°C pre-incubation and 2°C post incubation). Here were 4 replications and 24
observations. Bars represent standard deviations.
- - v * 7- -
I L I T
- dry cold post-normal post-cold
Stress treatments
Table 3. GUS activity of bombarded alfâKa leaf blades with pBI22 1 and pUC-GUS902 1F
plasmids (GUS activity = Mü fmole/pg proteidmin) Treatments were normal (2S°C),
cold (2OC), salt (250 rnM NaC1, 25OC), dry (60% humidity, 25OC), precold and post
normal (2°C pre-incubation and 25°C post incubation), and precold post cold (2°C pre-
incubation and 2°C post incubation). Pooled SE = 0.8 (r = 4, n = 48). The ANOVA table
for these data is located in Appendix Table k 6 .
-- - - - -
Treatment pBI22 1 pUC-GUS902 1 F . -
Normal 36
Cold 19
Salt 23
D v 2 1
Precold, post normal 19
Precold, postcold 19
Table 3. GUS advity of bombardeci alf3ilfa leaf blades with pH22 1 and pUC-GUS902 1F
plasmids (GUS activity = MU finoldpg protein/min) Treatments were nomial (2S°C),
wld (Z°C), sait (250 mM NaCl, 2S°C), dry (60% humidity, 25°C). precold and post
normal (2OC pre-incubation and 25°C post incubation), and precold post cold (2OC pre-
incubation and 2°C post incubation). Pooled SE = 0.8 (r = 4, n = 48). The ANOVA table
for these data is located in Appendk Table A6.
Treatment pBI.2 1 pUC-GUS902 1F
Normal 36 3 1
Cold 19 18
Salt 23 25
Dry 21 23
Precold, post normal 19 27
Precold, postcold 19 25
regulation in transgenic afalfa. With the BN115 promoter (White et al.. 1994), another low
temperature inducible promoter fiom winter Brassica, pre-cold treatment of winter Brassica
leaves did not have any affect on GUS gene expression.
The truncated rd29a promoter gave GUS activities in bornbarded alfalfa leaves that were
less than i i tobacco and Arabidopsis (Yamaguchi-Shinozaki and Shinozaki, 1994). There may be
several reasons. Fust, there may be some signal or CO-activator in DRE regulation pathway
missing (Fig. 15). Because only isolated le& blades were used as the target tissue, perhaps these
signals are produced in other tissues. Perhaps the pre-cold treatment produced these signds and
they were subsequently transferred to le& tissue. Secondly, the cold inducible fùnction of rd29a
may have been lost because the ABRE was missing in the truncated promoter. Either the ABRE
alone or the interaction between ABRE and DRE rnay stimulate gene expression. Because the
ABRE and DRE are very close (about 100 bp apart), some researchers assume that there is
interaction between DRE and ABRE (Ishitani et al., 1997).
Figure 15. Signal transduction and regdation mode1 of rd29a promoter (moditied fiom
Yamaguchi-S hinozaki and Shinozaki, 1 994)
Cold Stress Drought, Salt Stresses + Specific Tissue or Cell ?
Osmotic Change
Second Messenger ? ABA
Kinase 9 Cytoplasm Membrane Kinase
Cascade ? i
DRE DRE ABRE RD29A Gene Promoter
GENERAL DISCUSSION
To study the transcriptional regdation of a gene, a promoter-reporter fusion
system is usudy used. In this study, two sets of promoter fusion systems, GUS and
luciferase, were introduced into alfalfa Previously, Promega's M - ~ u c i f é r a s e ~ Assay
System has been used to determine the relative lucifiefase activities and characteristics of
promoter-luciferase fusions in mammalian systems (Sherf et al., 1996) and both genes
were also expressed in plants (Gallie et d 1991; Kay et al. 1994; Mayerhofer et al. 1995).
In this work, luciferase and Renilh luciferase driven by the CaMV35S promoter
were transientiy expressed in alfalfa leaf tissue following particle bombardment. Both
enzyme activities were stable under nomial growth conditions. The half-life of the two
enzymes was similar and both activities reached a maximum approximately 24 hours d e r
bombardment. Therefore, under normal growth conditions this system works well and can
be used for promoter studies in plants.
However, both tirefly and Renilla luciferase activities proved unstable in a l l i a
when the tissues were given a cold stress subsequent to bombardrnent. In other species the
activity of firefly luciferase also decreased under wld treatment (Vazquez-Tello et ai.,
1997). At present, there is no clear answer why the cold treatment inactivated luciferase
enzyme activity, but it may be due to the post-transcfiptional processing of the transcnpt.
Because this work utilized a transient gene expression system, there was hsufficient
M A provided for RNA lwel analysis. Therefore, the mechanism of cold-inactivation of
luciferase rernains unknown. Nonetheless, this work showed that iïrefly and Renilla
luciferases are unsuitable for investigating cold stress responses in a l f i a .
For the GUS system, it is very stable under a range of physiological conditions
which means it can be assayed under a variety of stress environments (Jefferson et al.,
1987, Suter-Crazzolara et d, 1995). At least in transgenic a l f i a shoots, the levels of
GUS rnRNA and protein were confkned to be upregulated by cold. This Uidicated that
under wntrol of a heterologous promoter in a transgenic alfalfa plant, there is no post-
transcriptional silencing of GUS gene expression f i e r cold conditionkg. However, there
was a temporal difference between the accumulation of mRNA and the increase of GUS
activity. The mRNA levels peaked two days after trader to the wld, whereas GUS
enzyme activity peaked at four days. It is possible that the GUS protein was too stable to
detect changes in transcription over a short period of tirne. Similar observations have been
made by others, prompting Plant Cell (the journal) to require additional confirmation of
promoter function beyond GUS activity (Taylor, 1997).
However, GUS inactivation did occur in bombarded alfaifa leaf tissue foIlowhg
cold temperature. Wang et al. (1995) aiso observed that low temperature dom-regulated
GUS gene expression by post-transcriptional control in Arabidopsis and tobacco. One
reason for GUS inactivation may involve the missing untranslated leader sequence and
additional coding region. When a cold-inducible promoter is tiised in came with a
untranslated leader sequence and a small portion of its own coding region, the protein
product of the heterologous reporter gene may be more stable than those constmcts
without the additional sequences (Sarhan et al. ,University de Montred personal
communication). That kind of translational fbsion may stabilize foreign transgene
expression in a heterologous expression system under cold treatment.
For stable expression in transgenic plants, the fbll rd29a promoter (-880 to +8 1)
functioned in aii tissues tested at normal growth temperatures, although there was
considerable variation among transgenic plants in the level of GUS expression. The rd29a
promoter was also cold responsive in alfalfa, but only in shoot tissues, as shown by an
increase in GUS aaivity and GUS mRNA levels in the shoots afker cold treatment.
Although GUS activity increased in the shoots, it decreased in roots of the sarne
plants in response to cold. Therefore, the regulation of gene expression by cold appears to
be different in these tissues. It is possible that several different tram-acting factors or CO-
activation factors may be involved in the cold response of alfalfa and other plants. Lf
different trans-acting factors are involved in gene regulation in these tissues, this might
explain the differences in regulation patterns. In winter cereals, roots do not cold
acclimate to the sarne degree as crowns or leaves (Chen et al., 1983), but in alfdfa, roots
cold acclimate more than the leaves (Jung, 1972). So the différences in regulation of the
rd29a promoter in alfalfa do not correspond with known differences in the potentid of
these tissues to cold acclimate.
The region - 1 13 to -44 1 of the rd29a promoter, which contains two DREs and a
enhancer region, was introduced into alfalfa leaflets by particle bombardrnent. Under the
cold and normal growth temperatures, the difference in promoter orientation affected the
expression of the tmncated rd29a promoter in alfalla but not in tobacco and Arabidopsis.
The changes of orientation may lead to changes in the way the trans-acting factors binds
to the promoter cis-element. Higher promoter copy nurnbers are assumed to introduce
more room for binding of tram-acting factors or other DNA binding factors in the
promoter region. However, high promoter copy number did not affect the rd29a
regulation in aifalfa.
In the transient expression system, the DREs were able to maintain GUS activity
when a l f i a leaf blades were placed in cold condition prior to particle bombardment. This
appears to indicate that the precold treatment initiated some signais involved in the DRE
regulation pathway. A similar result was observed by Wang et al. (1995). When plants
containing the kinl and cor6.6 cold inducible promoters (see Chapter 1) were treated at
low temperature (5OC) for 6 to 12 hours, the GUS gene driven by the two promoters
showed greater activity than in those plants treated in normal or low temperatures for the
entire penod.
On the other hand, the DRE may involve a synergism with the ABRE or other
elements in response to cold temperature. Because the ABRE and DRE are rery close
(about 100 bp apart), some researchers assume an interaction between the DRE and the
ABRE (Ishitani et al., 1997). Recently, research into ABA inducible cis-elements
contained within a cereal promoter showed that the space between two cis-elements in a
promoter region is necessary to maintain the cis elements funaion (Shen et al., 1997).
McKendree and Fer1 (1992) observed that the ABRE present in Arabidopsis affected
quantitative aspects of gene expression but did not seem to act as an 'odoff switch.
Therefore, it is expected that DRE is essential for gene expression and ABRE is required
in some sort of a CO-operative role.
In summary, the same full and truncated rd29a prornoter caused different
expression patterns in alfalfa, Arabidopsis and tobacco under cold conditions,
demonstrating that plant expression systems are variable even with the sarne transgene.
Ausubd, F.M., Brent, R, Kingston, RE., Moore, D.D., Seidman, J.C., Smith, J.A., Struhl, K. (1991). Current Protocols In Molecular Biology. Greene Publishing Associates and Wdey-Interscience.
Baker, A, Steei, C., Dure, L III. (1988). Sequence and characterization of 6 lea proteins and their genes fiom cotton. Plant Mol. Biol. 1 1,277-29 1.
Baker, S.S., Wühelm, K A , Thomasbow, M.F. (1994). The %region of Arabidopsis thliana cor 1Sa has cis-acting elements that codkr cold-, drought- and ABA- regulated prie expression Plant Mol. Biol. 24.70 1-7 13.
Barteis, D., Hanke, C., Schneider, K., Michel, D., and Saiamini, F. (1992). A desiccation-related Elip-like gene fiorn the resurrection plant Cratero~gma plàntagineum is regulated by light and ABA EMBO J. 11,2771 -2778.
Bartels, D., Nelson, D. (1994). Approaches to improve stress tolerance using molecular genetics. Plant Cell Environ. 17, 659667.
Benfey, PoNe and Chua, WH (1990). The caulinower mosaic Wus 35s promoter: combinatorial regulation of transcription in plants. Science 250, 959-966.
Bohnert, EJ., Nelson, D.E., Jensen, RG. (1995). Adaptations to environmentai stresses. Plant Cell7, 1099- 1 1 1 1.
Bray, E.A. (1991). Regulation of gene expression by endogenous ABA during drought stress. In Abscisic Acid: Physiology and Biochernistry, W. J. Davies and H. G. Jones, eds (Mord: Bios Scientific Publishers). pp 81-98.
Bray, E.A. (1 993). Molecular responses to water deficit. Plant Physiol. 103, 1 O3 5- 1040.
Bronstein, L, Fortin, J., Stanley, POEo, Stewart, Go, Kricka, LoJo (1994). Cherniluminescent and bioluminescent reporter gene assays. Analyt . Biochem. 2 19, 169-181.
Chen, T.H.E., Gusta, LV. and FowIer, D.B. (1983). Tolerance to cold stress - the importance of roots and crowns. In New Frontiers In Wmter Wheat Production. The University of Saskatchewan Printing Services pp 57-76.
Chrbpeds, M.J., Agre, P. (1994). Water chamel proteins of plants and animal cells. Trans. Biochem. Soc. 19,42 1-425.
Davies, W. JO, Jones, HœGo (1 99 1). Abscisic Acid: Physiology and Biochernistry, Mord: BIOS Scient&.
Deng, M. (1993). Characterization of the CaMV35S and soybean catalase promoters in transgenic aifalfa (Medicago sativa L.). M.Sc. Thesis. Department of Crop Science, University of Guelph, Canada.
de Wet, J.R, Wood, K.V., Deluca, M., Helinski, D.R, and Subramani, S. (1987). Firefly luciferase gene: structure and expression in marnmalian ceUs. Mol. Cefl. Biol. 7, 725-737.
de Wet, J.R, Wood, K.V., Helinski, D.R, and Deluca, M. (1985). Cloning of firefly luciferase cDNA and the expression of active luciferase in Escherichia coli. Proc. Natl. Acad. Sci. USA 82, 7870-7873.
Drews, G.N., Beals, T.P., Bui, A.Q., and Goldberg, RB. (1992). Regionai and cell- specific gene expression patterns during petal development. Plant Ce11 4, 1383- 1404.
Dure, L.m (1993). Structural motifs in Lea proteins. In Close, T. J.: Bray, E. A., eds, Plant Responses to Cellular Dehydration During Environmental Stress. Current Topics in Plant Physiology, Vol 10. American Society of Plant Physiologists, Rockvifle, MD, pp 9 1 - 1 03.
Feuillet, Ce, Lauvergeat, V., Deswarte, C., Pilate, G., Boundet, A and Grima- Pettenati-J (1995). Tissue- and cell-specific expression of a cinnamyl alcohol dehydrogenase promoter in transgenic poplar plants. Plant Mol. Biol. 27, 65 1-667.
Fick, G.W., and Mueller, S.C. (1989). Alfalfa: Quality, maturity, and mean stage of development. Information Bulletin 2 1. Media SeMces, Comell University, pp 7.
Gailie, D.R (199 1). The cap and poly(A) tail function synergistically to regulate mRNA translational efficiency. Genes Dev. 5, 2 108-2 1 16.
Gallo-Meagher, M., and Irvine, LE. (1991). Effects of tissue type and promoter strength on transient GUS expression in sugarcane foliowing particle bombardment. Plant Ce11 Rep. 12, 666-670.
Godoy, J.A., Pardo, AM., and Pintor-Toro, J.A. (1990). A tomato cDNA inducible by sait stress and abscisic acid: nucleotide sequence and expression pattern. Plant Mol. Biol. 15, 696-705.
Guerrero, F., Mullet, J.E. (1986). Increased abscisic acid biosynthesis d u ~ g plant dehydration requires transcription. Plant Physioi. 80, 588-59 1.
Guiltinan, M.J., Marcotte, W.R, and Quatrano, RS. (1990). A plant leucine zipper protein that recognizes an abscisic acid response element. Science 250, 267-27 1.
Guy, C. (1990). Cold aeclimation and fieezhg stress tolerance: Role of protein metabolism. Annu. Rev. Plant Physiology. Plant Mol. Biol. 41, 187-223.
Hillgren, J. and Qquist, G. (1 990). Adaptations to low temperature. Stress response in plants: Adaptation and acclimation mechanism. Wdey-Liss. N.Y. pp 265-293.
Hattori, T., Terada, T. and Hamasuna, S. (1995). Regulation of the Osem gene by abscisic acid and the transcriptional activator W 1 : analysis of cis-acting promoter elements required for regdation by abscisic acid and VP 1. Plant J. 7, 9 13-925.
Hjayama, Te, Ohto, Ce, Mizoguchi, T., Shniaiki, K. (1995). A gene encoding a phosphatidylinositol-specinc phospholipase C is induced by dehydration and sait stress in Arabid;opsis thliana. Proc. Nad. Acad. Sci. USA 92,3903-3907.
Huner, N.P.A. (1985). Morphological, anatomocal, and molecular consequences of growth and development at low temperature. Am. J. Bot. 72, 1290-1306.
Ishitani, M., Xiong, L, Stevenson, B., Zhu, J-K. (1997). Isolation of stress signal transduction mutants by luciferase imaging in Arabidopsis thaliana. Poster in Plant Biology '97. Supplement to Plant Physiol. 114, pp 266.
Iîzhaki, H., Masson, J.M., Woodson, W.R. (1994). An ethylene-responsive enhancer element is involved in the senescence-related expression of the carnation glutathione-S-transferase (GSTI) gene. Proc. Natl. Acad. Sci. USA 9 1, 8925- 8929.
Jefferson, RA., Knvanagh, TA. and Bevan, M.W. (1987). GUS fision: B- glucuronidase as a sensitive and versatile gene fusion marker in higher plants. EMBO J. 6, 3901-3907.
Jung, GA. and Lamon, K.L. (1 972). Malfa science and technology: Cold, drought, and heat tolerance. Hanson, C.H. eds, Arnenca Society of Agronomy, Xnc. pp 1 85-209.
K.0, C-Y., Cocciolone, S.M., Vasü, LIC, and McCarty, D.R (1996). Localization and interaction of the &acting element for Abscisic Acid, UIVIPAROUS 1, and light activation of the CI gene of maize. Plant Ceil 8, 1 1 7 1 - 1 1 79.
Kay, S.A., Miiîar, A.J., Smith, K.W., Anderson, S.L., Brandes, Ce, H d , J.C. (1994). Vide0 imaghg of regulated fïrefly luciferase activity in transgenic plants and drosophila Promega Notes 49.22-27.
King, G.J., Turner, VA., Hussey, C-E.J., Wurtek, E.S. and Lee, S-M. (1988). Isolation and characterization of a tomato cDNA clone which codes for a At - induced protein. EMBO J. 11, 157-1 66.
Kiyosue, Te, Yamaguchi-Shinozaki, K, Shinozaki, K. (1994). Cloning of cDNA for genes that are early-responsive to dehydration stress (ERDs) in Arubdopsis trhaina L.: identification of three ERDs as HSP cognate genes. Plant Mol. Biol. 25, 791- 798.
Kiyosue, H, Beetham, X, Pinot, Fe, Hammock, B.D., Yamaguchi-Shinouki, K., Shinozrki, K. (1994). Characterization of an Arabidopsis cDNA for a soluble epoxide hydrolase gene that is induaile by a h and water stress. Plant J. 6, 259- 269.
Klein, T.M., Wolf, E.D., Wu, R, Sanford, J.C. (1987). High-velocity microprojectiles for delivering nucleic atids into living ceus. Nature 327, 70-73.
Kusano, T., Berberich, T., Hirida, M., Suniki, Ne, Sugawara, K. (1995). A maize DNA-binding factor with a bZIP motif is induced by low temperature. Mol. Gen. Genet. 248, 507-5 17.
LaRosa, P.C., Cben, Z, Nelson, D.E., Singh, N.K., Hasegawa, P.M. and Bressan, RA. (1992). Osmotin gene expression is post-transcriptionaily regulated. Plant Physiol. 100,409-415.
Leprince, O , Hendry, G.A.F., and Mckersie, B.D. (1993). The mechanisms of desiccation tolerance in developing seeds. Seed Science Research 3,23 1-246.
Leung, J., Bouvier-Durand, M., Mo&, P-C, Guerrier, D., Chefdor, F., Giraudat, J. (1994). Arabidopsis ABA response gene ABII: features of a calcium-modulated protein phosphatase. Science 264, 1448-1452.
Lorenz, W.W, McCann, RO., Loogiam, M, and Cormier, M.J. (1991). Isolation and expression of a cDNA encoding Renilh renifonis luciferase. Proc. Natl. Acad. Sci. USA 88,4438-4442.
Marcotte, W.R, Jr., Russell, S.E., and Quitrnno, RS. (1989). Abscisic acid-response sequences form the Em gene of wheat. Plant Cell 1,969-976.
Mayerhofer, R, Langridge, W . E R , Cormier, M.J., and Szaiay, Ad. (1995). Expression of recombinant Renilla luciferase in transgenic plants results in high b e l s of Light emission. Plant J. 7, 1 O3 1 - 1 O3 8.
Mecourt, P. (1997). Genetic anaiysis of ABA and GA signal transduction in Arabidopsis. Symposium in Plant Biology '97. Supplement to Plant Physiol. 114, pp 6.
McKendree, W.L., Feri, RJ. (1992). Functional elements of the Arabidopsis Adh promoter include the G-box. Plant Mol. Biol. 19, 859-862.
McKersie, B.D. and Leshem, Y.Y. (1994). Stress and stress coping in dtivated plants. Kluwer Acadernic Publishers.
Michei, D., Furini, A., Salamini, Fm, and Barteis, D. (1994). Structure and regdation of an ABA-and desiccation-responsive gene f?om the resurrdon plant Craterostigrrta p h i a m m . Plant Mol Bi01 24, 549-560.
Miiiar, kJ .9 Short, SR, Hiratsuka, K., Chua, N-H, Kay, SA. (1991). Firefly luciferase as a reporter of regulated gene expression in higher plants. Plant Mol. Biol. Rep. 10, 324-337.
Mttler, R, Zilinskas, B.A. (1994). Regdation of pea cytosolic ascorbate peroxidase and other antioxidant enzymes during the progression of drought stress and following recovery from drought. Plant J. 5,397-405.
Mohapafm, S.S., Poole, RJ., Dhindsa, RS. (1988). Absicisic acid-regulated gene expression in relation to fieezing tolerance of coid-acclimation-specific genes of alfalfa. Plant Physiol. 87,468-473.
Mohapatra, S.S., Wlofrnim, Le, Poole, R J,, Dhindsa, RS. (1 989). Molecular cloning and relationship to fieezing tolerance of cold-acchtion-specific genes of aifalfa. Plant Physiol. 89, 375-380.
Monroy, A.F., Dhindsa, RS. (1995). Low-temperature signal transduction: induction of wld acclimation-specific genes of alfalfa by calcium at 25OC. Plant Cell 7, 32 1 - 331.
Mundy, Jo, Yamaguchi-Shinozaki, K., and Chua, N-H (1990). Nuclear proteins bind conservecl elements in the aûscisic acid-responsive promoter of rice rab genes. Proc. Natl. Acad. Sci. USA 87,406410.
Nordin, K., Vahda, Ta, Paiva, E.T. (1993). DSerential expression of two related, low- t emperahire-induced genes in A rabidopsis thaliana (L . ) heynh. Plant Mol. Biol. 21,641-653
Oeda, K., Sdinas, JO, and Chur, N-H (1991). A tobacco bZIP transcription activator (TAF-1) binds to a G-box-like motif conserved in plant genes. EMBO J. 10, 1793- 1802.
Odelî, J.T., Nagy, Fm, and Chua, N-H (1985). Identification of DNA sequences required for activity of the cauli£lower mosaic virus 3 5s promoter. Nature 313, 8 10-8 12.
Pereira, L.F., EEckson, L. (1995). Stable transformation of alfalfa (Medicago sat iv~ L.) by particle bombardment. Plant Cefl Rep. 14,290-293.
Phiiip, N., Chua, N-H (1990). The d o w e r mosaic Wus 35s promoter: combinatonal regdation of transcription in plants. Science 250,959-966.
Plant, AL., Cohen, A., Moses, M.S., and Bray, E.A. (1991). Nucleotide sequence and spatial expression pattern of a drought-and abscisic acid-induced gene in tomato. P h t Physi~l. 97,900-906.
Prased, Te& Anderson, MD, Mirtin, B.A., Stewart, C.R (1994). Evidence for chilling-induced oxidative stress in maize seedlings and a regdatory role for hydrogen peroxide. Plant Ceil 6,65-74.
Qin, X-F, Holuigue, L, Horvath, D.M., and Chua, N-H (1994). Immediate early transcription activation by salicylic acid via the cauliflower mosaic virus as1 element. Plant Ceil 6, 863-874.
Sambrook, Je, Fritsch, E.F.9 Maniatis, T. (1 989). Electrophoresis of RNA through gels containhg formaldehyde. in Moleailar Cloning. 2nd eds. Cold Spring Harbour Laboratory Press. pp 7.43.
Sambrook, J., Fritsch, E.F., Mauiaiis, T. (1989). Spectrophotometric detemination of the amount of DNA or RNA in Molecular Cloning. 2nd eds. Cold Spring Harbour Laboratory Press. pp E. 5.
Sanford, J.C., Smith, F.D. and Russeii, J.A. (1992). Optiminng the biolistic process for different biological applications. Methods Enzymol. 217, 483-509.
Schaeffer, He, Forsthoefel, NOR, and Cushman, J.C. (1995). Identification of enhancer and siiencer regions involved in sdt-responsive expression of Crassulacean acid metabolism (CAM) genes in the facultative halophyte Mesemb~anthemm crystallimrm. Palnt Mol. Biol. 28, 205-218.
Shen, Q., Zhang, P., Ho, T.D. (1997). Definition of abscisic acid response promoter complexes in cereals. Symposium in Plant BioIogy '97. Supplement to Plant Physiol. 114, pp 66.
Sherf, B.A., Navarro, SL, Hannah, RR and Vood, K.V. (1996). ~ u a l - ~ u c i f e r a s e ~ Reporter Assay: An advanced CO-reporter technology integrating firefly and Renilla luciferase assays. Promega Notes 57,2-9.
Shinoznki, K. and Yamaguchi-Shinozaki, K. (1996). Molecular response to drought and cold stress. Plant Biotechnology 7, 16 1 - 167.
Suter-Crazzulara, C., Klemm, M., Reiss, B. (1995). Reporter Genes. Method In Ceil Biology, Vol. 50. Academic Press Inc., pp 425-438.
Taylor, CB. (1997). Promoter nision andysis: an insdiicient rneasure of gene expression. Plant Cell9, 273-274.
Thornashow, M o Fm (1994). Arabidopsis thaliana as a mode1 for studying mechanisms of plant cold tolerance- In Arabidopsis. Edited by Meyrowitz, W, Sommerville, C. Cold Spring Harbour: Cold S p ~ g Harbour Press, pp 807-834.
Timmermans, M.C.P., Maliga, P., Vieira, J , Messing, Jo (1990). The pFF plasmids: cassettes utilising CaMV sequences for expression of foreign genes in plants. J. Biotech. 14, 333-44.
Urao, Tm, Katagiri, T., Maoguchi, T., Yamaguchi-Shinozaki, K., Hayashida, N., Shhozaki, K. (1994). Two genes that enwde ca2'-dependent protein kinases are induced by drought and high salt stresses in Arabidopsis thdiana. Mol. Gen. Genet. 224, 33 1-340.
Vaque-Tello, A., Sarhan, Fm (1997). Promoter analysis of the low temperature-induced wcsl2O gene fiom wheat. Poster in Plant Biology '97. Supplement to Plant Physiol. 114, pp 253.
Wang, H., Datia, R, Georges, F, Lawen, M., Cuter, A.J. (1995). Promoters fiom kinl and coro. 6, two homologous Arabidopsis thfiana genes: transcriptional regulation and gene expression induced by low temperature, AB4 osmoticum and dehydration. Plant Mol. Biol. 28,605-61 7.
White, T C , Simmonds, D., Donddson, P., Singh, J. (1994). Regdation of BN 115, a low-temperature-responsive gene fiom winter Brassicu m p s . Plant Physiol. 106, 9 17-928.
Williams, Jo, Bulman, M., Hyttly, A, Phiüips, A., Neill, S. (1994). Characterization of a cDNA fkom Arabictopsis thdiancl encoding a potential thiol protease whose expression is induced independently by wilting and abscisic acid. Plant Mol. Biol. 25, 259-270.
Yarnida, S., Kaîsbuara, M., Keliy, W.B., Michdowski, C.B., Bohnert, HmJo (1995). A f d y of transcript s encoding water c hannei proteins: tissue-specific expression in the common ice plant. Plant Celi 7, 1 129-1 142.
Yamaguchi-Sbinmrki, K. and Shinozaki, K. (1993). Characterization of the expression of a desiccation-responsive rd29a gene of Arabidopsis thaüana and analysis of its promoter in transgenic plants. Mol. Gen. Genet. 236,33 1-340
Yamaguchi-Shinozaki, K. and Shinoznki, K. (1994). A novel cis-acting element in an Arabidopsis gene is involveci in responsiveness t O drought, low-temperature, or high-Salt stress. Plant Cell6, 25 1 -264.
APPENDIX
Table A- 1 SAS results of GUS activity of transgenic alfilfa tissues under cold treatment
This ANûVA table refers to Figure 4.
Source Df Surn of Squares Mean Square F Value Pr > F
Tissue 2 160195488.7 80097744.4 24.9- 0.0001
D ~ Y 4 54553350.6 13638337.7 4.2** 0.0053
Tissue x Day 8 383 148539.9 47893567.5 14.9- 0.0002
Emor 45 1445765 14.3 321281 1.4
Table A.2 SAS results of 35s-reporter gene activity over incubation t h e
This ANOVA table refers to Figure 13.
GUS
Source DF Sum of Squares Mean Square F Value Pr > F
Time
Error
Luc
Source DF Sum of Squares Mean Square F Value Pr > F
Time 6 152 128.4 25354.7 4.4** 0.0067
Error 18 104178.2 5787.7
R-Square = 0.6 C.V. = 64.1
Ruc - -- -- p. - - - - - - - -
Source DF Sum of Squares Mean Square F Value Pr > F
Time 6 46.3
Error 18 37.8
R-Square = 0.6 C.V. =52.6
* * = significant at O. O 1 * = significant at 0.05
Table A.3 SAS results of firefly luciferase activity of bombarded alfalfa leaf blades with 5
plasmids dunng normal growth and cold temperatures
This ANOVA table refers to Table 1 .
--
Source Df Sum of Squares Mean Square F Value Pr > F - -
Plasmid 4 226576.8 56644.1 14.1 ** 0.000 1
Temperature 1 118633.1 118633.2 29.6- 0.000 1
Plasmid x Temperature 4 69068.8 17267.2 4.3* 0.01 13
Error 20 80255.5 40 12.8
R-Square = 0.8 C.V. = 59.4
Table A.4 SAS results of firefly luciferase activity o f bombarded alfalfa leaf blades with
pUC-LUC and pUC-LUC90 IF plasmids during stress treatments This ANOVA table
refers to Table 2.
- -
Source Df Sum of Squares Mean Square F Value Pr > F
Treatment 5 167524.9 33504.9 3 L4** 0.000 1
Plasmid I 30288.5 30288.5 28.4** 0.000 1
Treatment x Plasmid 5 48803.9 9760.8 9.2** 0.000 1
Error 36 38374.5 1065.9
C.V. = 50.0
** = significant at 0.0 1 * = significant at 0.05
Table A S SAS results of Renilla luciferase activity of bombarded aWfa leaf blades with
pRL-3 5s plasmid during stress treatments
This ANOVA table refers to Fig 14.
p .
Source Df Sum of Squares Mean Square F Value Pr > F
Treatment 5 9.3 1.9 I3.8** 0.000 1
Error 18 2.4 O. 13
R-Square = 0.8 C.V. = 46.6
Table A.6 SAS results of GUS activity of bombarded alfdfa leafblades with pBI22 1 and
pUC-GUS902 1F plasrnids during stress treatments
This ANOVA table refers to Table 3.
Source Df Sum of Squares Mean Square F Value Pr > F
Treatment 5 1071.1 214.2 13.3** 0.0001
Plasrnid 1 54.5 54.5 3 -4 0.0738
Treatment x Plasrnid 5 228.9 45.8 2.9* 0.0287
Error 36 578.1 16.1
** = significant at 0.0 1 * = significant at 0.05
Figure 16. Subcloning of plasmid pUC-GUS902, pUC-LUC90,
pUC-LUC, and pRL-3 5 S
Figure 17. Subcloning of plasmid pUC-GUS902 IF, pUC-LUC90 1 F,
pUC-LUC90 1 R and pUC-LUC903F
PHI 4 J
pBluecript il)
Figure 18. Partial DNA sequence of plasmid pUC-GUS902 Restriction enzyme sites and TATA box are underlined. The italic sequence is
tmncated promoter region (-90 to +8) of CaMV 3 5s .
HindIII Pst1 BamHI TTTATTACCCAAGCTTGCATGCCTGCAGGTCGACTCTAGAGGA TCCCA TC
TCCA CTGA CGTAAGGGA TGACGCACAA TCCCACTA TCCTTCGCAAGACCC
TATA Box TTCCTCTA TA TAAGGAAGTTCA l T C A TTTGGAGAGAACACGGGGGACTC
BamHI SmaI +GUS coding region TAGAGGATCCCCGGGTGGTCAGTCCCTTATGTTACGTCCTGTAGAAACCC
CAACCCGTGAAATCAAAAAACTCGACGGCCTGTGGGCATTCAGTCTGGAT
CGCGAAAACTGTGGAATTGATCAGCGTTGGTGGGAAAGCGCGTTACAAGA
AAGCCGGGCAATTGCTGTGCCAGGCAGTTTTAACGATCAGTTCGCCGATG
CAGATATTCGTAATTATGCGGGCAACGTCTGGTATCAGCGCGAANTCTTT
ATACCGAAAGGTTGGGCAGGCCANCGTATCGTGCTGCGTTTCGATGCWT
CACTCATTACGGCAAAGTGTGGGTCAATAATCAGGMGTGATGGANCÂTC
NGGGCGGCTATACGCCATTTGAACCGATGTCCGCCGTATGTTATTGCCGG
GAAAAGTGTACGTNTCACCGTTTGTGTNAACAACNAATGAACTGGCAGAC
ACTTCCATGATTCTTTAACTATGCCGGAATCCATCNCANCTTATGCTCTA
CACACCCCNAACACCTGGGTGGANGANATCCCCGTGGTGACCCTTTTCCN
TTTCNCCTTTAACTGCTTAATCCGANTCACAGGTTGTN
Figure 19. Partial DNA sequence of plasmid pUC-LUC90 Restriction enzyme sites and TATA box are underlined. The italic sequence is
truncated promoter region (-90 to +8) of CaMV 35s.
HindIII Pst1 BamHI GNTTACCCAAGCTTGCATGCCTGCAGGTCGACTCTAGAGGATCCCATCTCCAC
TGACGTAAGGGA TGACGCACAA TCCCACTA TCCmCGCAAGACCCTTCCTCT
TATA Box BamHI A TA TAAGGAAGTTCA TTTCA TTTGGAGAGAACACGGGGGACTCTAGAGGATCCC
-+ Luc coding region
CGATCCAAATGGAAGACGCCAAAAACATAAAGMGGCCCGGCGCCATTCTA
TCCTCTAGAGGATGGAACCGCTGGAGAGCAACTGCATAAGGCTATGAAGAGA
TACGCCCTGGTTCCTGGAACAATTGCTTTTTACAGATGCACATATCGAGGTGAA
CATCACGTNCGCGGAATACTTCGAAATGTCCGTTCGGTTGGCAGAA~TATGA
AACGATATGGGCTGAATACAAATCACAGAATCGTCGTATGCAGTGAPLAACTCT
CTTCAATTCTTTATGCCGGTGTTGGGCGCGTTATTTATCGGAGTTGCAGTTWG
CCCGCGAACGACATTTATAATGAACGTGAATTGCTCAACAGTATGAACATTTC
GCAGCCTACCGTANTGTTTGTTTCCAAAAANGGGTTGCAAAAAATTTTGAACG
TGCAAAAAAAATTACCAATAATCCCGAAAATTATTATCATWATTCTAAAACG
GATTACCAGGGATTTCAGTCGATGTTCACGTTCGTCACATCTCATCTACCTCCC
GGTTTTAATGAATACAATTTGTTCCANAATCCTTTGATCGTGACAAAACAATT
GCCTGATAATGAATCCTCTGGATTACTGGGTTACTAANGGTGTGGCCCTCCCC
NTAAAATGCCTGCNTCGAATCTCCCCTGCN
Figure 20. Partial DNA sequence of one forward copy of tmncated rd29a promoter
ligated into plasmid BIuescript KS(+)
The underiined sequence is the PCR product fiom rd29a -441 to -1 13 region. The
bold sequences are the DRE. The italic sequences are cutting sites of restriction enzymes.
CTTTNNNGTGGGCGCGCGNCATACGACTCACTATAGGGCGAATTGGGTACC
ATTCMTTTTAATTTTACGTATAAAATAAAAGATCATACCTATTAGAACGATTA
AGGAGAAATACAATTCGAATGAGAAGGATGTGCCGTTTGTTATAATAAACAG
CCACACGACGTAAACGTAAAATGACCACATGATGGGCCAATAGACATGGACC
GACTACTAATAATAGTAAGTTACATTTTAGGATGGAATAAATTTC ATA
DRE box CCGACATCAGTTTGAAAGAAAAGGGAAAAAAAGAAAAAATAAATAAAAGA
DRE box TATACTACCGACATGAGTTCCAAAAAGCAAAAAAAAAGATCAAGCCGACAC
Pst1 AGACACGCGTAGAGAGATCGAATTCCTGCAGCCCGGGGGATCCACTAGTTCTA
GAGCGGCCGCCACCGCGGTGGAGCTCCAGCTTTTGTTCCCTTTAGTGAGGGTT
AATTGCGCCTTGGCGTATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATC
CGCTCCCATTCCCNCAACATACANCCGGAGCATAAAGTTTAAGCTGGGGTCTCT
CTGCACTCTTAATAATCGCACCCCNGGGGNAGNGGTGCTNTGNGCCTCCTCCC
AACNGGGAAC
IMAGE EVALUATION TEST TARGET (QA-3)
APPLIED - IMAGE. lnc - - 1653 East Main Street - -* , , Rochester. NY 14609 USA -- -- , , Phone: 7 1 6/482-0300 -- -- - - Fax: 71W88-5989
Q 1993. ~ppried image. Inc.. All Rights Reserved