Recombinant Attenuated Salmonella Vaccines: New Technologies for

Inducing Cross-Protective and Cellular Immunities

Roy Curtiss III

Professor of Life Sciences, School of Life Science and Director, Center for Infectious Diseases and Vaccinology and Center for Microbial Genetic Engineering

Arizona State UniversityScott J. Thaler Lecture May 12, 2014

Objectives for Orally Delivered Live Salmonella Vectored Vaccines

• Maximize invasiveness to and colonization of internal effector lymphoid tissues

• Recruit innate immune responses without being over reactogenic to cause distress or disease symptoms

• Maximize induction of mucosal, systemic and cellular immunities

• Be safe for newborn, pregnant, malnourished and immunocompromised individuals

• Exhibit biological containment

Why Salmonella as a vaccine vector?Mucosally-delivered Salmonella enterica Serotypes

efficiently attach to and invade mucosal associated lymphoid tissues (MALT, GALT, NALT, BALT, etc.) in mice and humans before colonizing internal lymph nodes, liver and spleen. They can also be delivered parenterally.

All routes of delivery result in induction of mucosal, systemic and cellular immune responses with induction of long-term protective immunity. Attenuated pathogens that are not invasive or only invasive to mucosal tissues seldom induce long-lasting immunity.

We know a great deal about the pathogenicity, physiology, genetics and genomics of Salmonella serotypes and Salmonella can be genetically manipulated with ease.

asd(4.121-4.122 Mb)

araE(3.018-3.020 Mb)

araBAD(0.118-0.122 Mb)

crp(4.197-4.198 Mb)

relA::lacI(2.994-2.996 Mb)

tviABCDE(4.5-4.508 Mb)

wza-wcaM(0.843-0.866 Mb)

pmi (manA)(1.395-1.396 Mb)

sopB (sigD)(1.890-1.892 Mb)

rpoS(2.901-2.902 Mb)

hilA (iagA)(2.857-2.859 Mb)

Mutations inSalmonella

Typhimurium & Typhi vaccines

Need to add adiAC & gadand more to come

agfC-agfG (1.84-1.841 Mb)

pagP::lpxE(2.303-2.304 Mb)

murA(3.315-3.316 Mb)

origin(3.75 Mb)

terminus(1.54 Mb)

rfc(1.278-1.279 Mb)

fur(2.248 Mb)

galE(2.174-2.175 Mb)

endA(3.096-3.097 Mb)

sifA(1.76-1.761 Mb)

cysG::spvABCD(4.186-4.185 Mb)

mntR(2.113-2.114 Mb)

rfaH(3.421-3.422 Mb)

fliC(1.013-1.015 Mb)

purA(4.568-4.569 Mb)

sseL(0.651-0.652 Mb)

tar(1.045-1.046 Mb)

Focus on Vaccines for Neonates and Infants

Our goal is to design, construct and evaluate novel innovative low-cost recombinant Salmonella vaccines to prevent infections caused by:

Enteric bacterial pathogens causing diarrhea Streptococcus pneumoniae of all serotypes Influenza viruses of all types Mycobacterium tuberculosis (and hopefully M. leprae)

RASVs will induce after one or two oral needle-free immunizations protective immunity. The vaccine designs are based on many newly developed technologies.

1. Regulated delayed in vivo expression of attenuating phenotype

2. Regulated delayed in vivo expression of codon-optimized sequences encoding protective antigens to be delivered by Type 2, 3 or 5 secretion systems and/or by regulated delayed lysis in vivo

3. Expression of arginine decarboxylase and/or glutamate decarboxylase at time of vaccine administration to neutralize stomach acidity to enable more vaccine cells to reach the ileum*

These three features enable the vaccine strain at the time of oral vaccination to exhibit the same or better attributes than the wild-type parental strain to survive host-induced stresses to increase ability to colonize internal lymphoid tissues to maximize immunogenicity.

We achieve our objectives by genetically engineering Salmonella to exhibit:

We achieve our objectives by genetically engineering Salmonella to exhibit (cont’d):

4. Constitutive expression of a highly invasive phenotype to enhance colonization of lymphoid tissues to induce maximal levels of protective immunity*

This decreases dose of vaccine needed to induce protective immunity

5. Decreased ability to induce antibody responses to serotype-specific and immuno-dominant surface antigens

This facilitates reuse of the vaccine vector for multiple vaccines

6. Decreased ability to suppress or modulate induction of immunity*

These multiple alterations also act to increase induction of mucosal immunity, decrease inflammation of the intestinal tract and decrease ability to form biofilms and thus lessen persistence of vaccine cells in vivo

Regulated delayed in vivo expression of the attenuating phenotype is achieved by:

1. Turning off ability to synthesize LPS O-antigen (and/or parts of the LPS core) in vivo (5 means).

2. Replacing promoters for genes needed to display virulence with regulatable promoters (2 types) that will be on for vaccine strain growth and initial colonization of the GI tract and lymphoid tissues and then be turned off in vivo to preclude disease symptoms (8 means).

3. Using regulated delayed lysis in vivo as the ultimate means of attenuation with complete biological containment and no shedding of survivors (1 basic strategy with multiple modifications to alter timing).

Turn off ability to synthesize LPS O-antigen in vivo to confer complete attenuation

pmi mutants synthesize LPS O-antigen side chains when grown in the presence of mannose and cease to synthesize LPS O-antigen side chains in its absence.

We also make WaaL synthesis (needed for addition of O-antigen on LPS core) dependent on growth in the presence of arabinose.

O-antigen side chain ceases in vivo since free non-phosphorylated mannose and arabinose are unavailable.

Regulation of PwaaL::TT araC PBAD waaL

L-arabinose absent in vivo

AraC dimer

No transcriptionO-antigen not synthesized or assembled; LPS core exposed

Transcription

waaL

Complete synthesis of LPS O-antigen

+ Arabinose

waaL

Regulated delayed in vivo expression of the attenuating phenotype is achieved by:

1. Turning off ability to synthesize LPS O-antigen (and/or parts of the LPS core) in vivo (5 means).

2. Replacing promoters for genes needed to display virulence with regulatable promoters (2 types) that will be on for vaccine strain growth and initial colonization of the GI tract and lymphoid tissues and then be turned off in vivo to preclude disease symptoms (8 means).

3. Using regulated delayed lysis in vivo as the ultimate means of attenuation with complete biological containment and no shedding of survivors (1 basic strategy with multiple modifications to alter timing).

Regulation of Pfur::TT araC PBAD fur

L-arabinose absent in vivo

AraC dimer

No transcriptionFur

IROMPs, etc,synthesized and iron toxicity

Transcription

Fur

Very low levels of IROMPs andiron-acquisitionsystems

+ Arabinose

Regulation of Pcrp70::TT araC PBAD crp-70

L-arabinose absent in vivo

AraC dimer

No transcription Crp-70

Total absence of Crp-70

Transcription

Crp-70

Production of catabolite-resistant (cAMP-insensitive) Crp

+ Arabinose

melR adiA adiY

Ty2 adi locusPadiA

adiC

PadiY PadiC

adiA terminator

pmrC

Chromosomal cassettes for regulated expression of adiAC and gadBC in Salmonella Typhi to cause acid tolerance

11568: PadiA276::TT rhaSR PrhaBAD adiA (PadiY-adiY-PadiC)-119 adiC

melR adiA

PrhaBAD

adiC pmrC

PrhaSR

rhaR

T4 ip III terminator

rhaS

Arginine decarboxylase

cysG

Ty2 cysG locusPcysG

PbigA

nirC bigA

XbaI XhoI

nirC

cysG::TT araC PBAD gadBC

PcysG

gadB gadC

ParaBAD

gadC terminatorParaC

araC

T4 ip III terminator

PgadCPbigA

bigA

Glutamate decarboxylase

• One of our objectives is to construct a safe, efficacious Salmonella vaccine vector system that will enable repetitive use of the vector system to develop multiple Recombinant Attenuated Salmonella Vaccines (RASVs) against a diversity of animal pathogens, yet would induce cross-protective immunity to diverse S. enterica serotypes and other pathogenic enteric bacteria colonizing chickens, other farm animals and humans.

To induce cross-protective immunity, we use the Pfur33::TT araC PBAD fur and PmntR22::TT araC PBAD mntR regulated delayed attenuating mutations to over-express IROMPS and MnROMPs in vivo to induce production of antibodies that react with IROMPs and MnROMPs made by all Salmonella serotypes and most other enteric pathogens. By using pmi-2426 and PwaaL::TT araC PBAD waaL

mutations, vaccine strains cease O-antigen synthesis in vivo to induce antibodies to the LPS core that is identical in all Salmonella serotypes.

A. Vaccine strain at time of vaccination

LPS O-antigen

pmi-2426 pmi-2426 waaL waaL PPwaaLwaaL::TT::TT araC araC PPBADBAD waaL waaL

PPfur33fur33::TT ::TT araC araC PPBAD BAD fur fur PPmntR22mntR22::TT ::TT araCaraC P PBADBAD mntR mntR

PPcrp70crp70::TT ::TT araC araC PPBAD BAD crp-70 crp-70 araE25araE25

= LPS core

No IROMP or MnROMP expression

B. Vaccine strain in lymphoid tissuesB. Vaccine strain in lymphoid tissues

No LPS O-antigen

IROMPsMnROMPs

pmi-2426 pmi-2426 waaL waaL PPwaaLwaaL::TT::TT araC araC PPBADBAD waaL waaL

PPfur33fur33::TT ::TT araC araC PPBAD BAD fur fur PPmntR22mntR22::TT ::TT araCaraC P PBADBAD mntR mntR

PPcrp70crp70::TT ::TT araC araC PPBAD BAD crp-70 crp-70 araE25araE25

= LPS core

Synthesis of protective IROMPs, MnROMPs and LPS core

Balanced-Lethal Host-Vector Systemsasd Foreign

ss-genX

Asd+ SS-GenX+

DAP+

asd

DAP-

Regulated delayed antigen synthesis with LacI

The regulated delayed antigen synthesis (RDAS) system is used in recombinant attenuated Salmonella vaccine (RASV) strains to enhance immune responses by reducing the adverse effects of high-level antigen synthesis at the time of vaccination.

Chromosomal deletion map for ΔrelA198::araC PBAD lacI TT

In Salmonella

relA::araC PBAD lacI TT

+ Arabinose

No Arabinose

In vivo

Asd+ Ptrc SS-GenX+

DAP+

Asd+ Ptrc SS-GenX+

Antigen Delivery Strategies by Recombinant Attenuated Salmonella Vaccines (RASVs)

• within cytoplasm of Salmonella vaccine

• by partial secretion using the Type 2 -lactamase

(or other) secretion signals and by enhancing

production of outer membrane vesicles

• by secretion/translocation via a Type 3 secretion

system

• by surface presentation using a Type 5 secretion

system

• release by lysis of Salmonella in vivo

New Anti-Pneumococcal Vaccine for Infants

Our goal is to design, construct and evaluate novel innovative low-cost recombinant Salmonella vaccines expressing multiple protective Streptococcus pneumoniae surface protein antigens that are safe for fetuses, newborns, infants and immunocompromized or malnourished individuals and will induce after a single (hopefully) oral needle-free immunization protective immunity to diverse S. pneumoniae serotypes. The vaccine design is based on many newly developed technologies.

Survivors/total

Inoculating Dose (CFU)

Age of Mice

Genotype*Strain

Safety of orally administered S. Typhimurium UK-1 9558 displaying regulated delayed attenuation in mice with decreasing ages

All strains were grown in LB broth with 0.2% arabinose and 0.2% mannose.LD50 for wild-type S. Typhimurium UK-1 is 10 CFU in newborn mice.* Same genotype as S. Typhi strains evaluated in Phase I trial.** Mother cannibalized two infants due to a large litter.

pmi-2426 (gmd-fcl)-26 Pfur81::TT araC PBAD fur

Pcrp527::TT araC PBAD crp

asdA27::TT araC PBAD c2

araE25 araBAD23 relA198::araC PBAD lacI TT

sopB1925 agfBAC811 containing pYA4088 specifying PspA

9558 7 days

4 days

9.9 x 108

3.0 x 108

3.5 x 108

48/48

41/41

45/47**Day of birth

2 days 3.3 x 108 62/62

Summary of results with S. Typhimurium 9558 having same genotype as 1st generation S. Typhi strains

• Completely safe in newborn, pregnant, malnourished and immuno-compromised (multiple types) mice• Induces better immune responses and higher levels of protective immunity in mice born from mothers immunized prior to breeding with the same vaccine strain• Fusion of two PspA antigens and two PspC antigens from two different PspA and PspC families and with proline-rich domain induced highest levels of protective immunity to pneumococcal challenge by all challenge routes• S. Typhi derived RASVs were completely safe up to doses of 1010 CFU in human volunteers with no bacteremias and no shedding of vaccine cells in feces

Regulated delayed in vivo expression of the attenuating phenotype is achieved by:

1. Turning off ability to synthesize LPS O-antigen (and/or parts of the LPS core) in vivo (5 means).

2. Replacing promoters for genes needed to display virulence with regulatable promoters (2 types) that will be on for vaccine strain growth and initial colonization of the GI tract and lymphoid tissues and then be turned off in vivo to preclude disease symptoms (8 means).

3. Using regulated delayed lysis in vivo as the ultimate means of attenuation with complete biological containment and no shedding of survivors (1 basic strategy with multiple modifications to alter timing).

Biological Containment of Vaccine Strains by In Vivo Lysis

Achieved by regulated expression of essential genes for synthesis of muramic acid and diaminopimelic acid (DAP)

•Is a type of regulated delayed attenuation•Results in no vaccine strain persistence in vivo and no survivors if excreted

•Can be used to deliver a bolus of protective antigen or a DNA vaccine vector

cspE pagP dcuC

cspE lpxE Ptrc dcuC

3761

pagP88::Plpp lpxE

Salmonella pagP88::Ptrc lpxE (codon optimized) mutant

LpxE

3761

pagP88::Pltrc lpxE

relA197::araC PBAD lacI TT regulatable Mono-phosphoryl lipid A

Regulated Lysis Vector pYA3681

Ptrc promoter region sequencePtrc

ATTCTGAAATGAGCTGTTGACAATTAATCATCCGGCTCGTATAATGTGT

GGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGACCATGGGAA

TTCGCAATTCCCGGGGATCCGTCGACCTGCAGCCAAGCTCCCAAGCTT

-35 -10

SD NcoI

SmaI/XmaI

trpA TT

araC*

PBAD

5ST1T2

Ptrc

P22 PR

SD-GTGmurA

SD-GTG asd

rrfG TT

pYA36815818 bp

pBR ori

11803: asdA27::araC PBAD c2 PmurA25::araC PBAD murA (wza-wcaM)-8 relA197::araC PBAD lacI TTpmi-2426recF126pagP88::Ptrc lpxE

DAP-less and Muramic-less Death in Host Strain with Regulated Lysis System Vector

11283

11283(pYA3681)

LB Agar LB Agar + 0.2%Arabinose

+50g/ml DAP

LB Agar + 0.2%Arabinose

LB Agar

Recombinant host-vector strain displaying arabinose-dependent growth and regulated cell lysis in the absence of arabinose.

11803: asdA27::araC PBAD c2 PmurA25::araC PBAD murA (wza-wcaM)-8 relA197::araC PBAD lacI TTpmi-2426recF126pagP88::Ptrc lpxE

RASV-M. tuberculosis VaccinesGoal: To deliver protein antigens of M. tuberculosis to the cytoplasm of eukaryotic cells in order to elicit a cell-mediated immune response.- M. tuberculosis protein antigens known to elicit protective T-cell responses (ESAT-6, CFP-10, Ag85A) were delivered by attenuated Salmonella vaccine strains by three mechanisms:(1)As fusion proteins with (a) Salmonella Type III Secretion System effector protein SopE2 and (b) Type II Secretion signal sequences from β-lactamase or OmpA.(2)By delivery of the antigens into the eukaryotic cell cytoplasm following escape from the endosome and regulated delayed lysis of the RASV strain.

Mycobacterium tuberculosis Antigens for Vaccine Development

ESAT-6ESAT-6 esxAesxA Early secreted antigenic target of Early secreted antigenic target of M. M. tuberculosistuberculosis; immunodominant T cell antigen; immunodominant T cell antigen

CFP-10CFP-10 esxBesxB Culture filtrate protein - 10 kDa; co-Culture filtrate protein - 10 kDa; co-transcribed with transcribed with esxA;esxA; proteins probably proteins probably secreted together; immunodominant T cell secreted together; immunodominant T cell antigenantigen

Ag85AAg85A fbpAfbpA Mycolyl transferase, involved in the synthesis Mycolyl transferase, involved in the synthesis of trehalose dimycolate, one of the mycolic of trehalose dimycolate, one of the mycolic acidsacids

Plasmids specifying synthesis of M. tuberculosis antigens in 11021

SopENt80-ESAT-6-ESAT-6-CFP-10-BlaSS-Ag85A-BlaCT:pYA4890 (pBR ori)pYA4891 (p15A ori)pYA4892 (pSC101 ori)

OmpCss-ESAT-6-ESAT-6-CFP-10-BlaSS-Ag85A-BlaCT:pYA4893 (pBR ori)pYA4894 (p15A ori)

11021 asdA27::TT araC PBAD c2 PmurA25::TT araC PBAD

murA (gmd-fcl)-26 relA198::araC PBAD lacI TT pmi-2426 (araC PBAD)-5::PR araBAD

Anti-

Ag85

A Ig

G

P<0.001 P<0.01

pYA3681 – vector control, pYA4891 (p15A ori) encoding SopENt80-ESAT-6-ESAT-6-CFP-10-Blass-Ag85A-BlaNt

χ11021 ΔPmurA25:TT araC PBAD murA ΔasdA27::TT araC PBAD c2 ΔaraBAD23 Δ(gmd-fcl)-26 Δpmi-2426 ΔrelA198::TT araC PBAD lacI

Total IgG responses (Endpoint titers) to Ag85A and ESAT-6

Total serum IgG responses to Ag85A and ESAT-6 from mice orally immunized at days 0, 7 and 49 with 11021(pYA3681) or with 11021(pYA4891) and in mice given only BSG. White bars - IgG levels prior to immunization. Black bars - IgG levels on day 77.

Protection against M. tuberculosis Challenge

P<0.05

Protection against M. tuberculosis aerosol infection (100 CFU) 4 weeks after oral immunization with 11021(pYA3681), 11021(pYA4891) or BSG at days 0, 7 and 49. One group was immunized on day 0 by s.c. inoculation of 5 x 104 CFU of M. bovis BCG. Mice were euthanized 6 weeks later and titers of M. tuberculosis determined.

Summary• Live recombinant attenuated Salmonella vaccine

(RASV) strains with regulated delayed lysis in vivo produce, secrete & release M. tuberculosis antigens.

• RASV-M. tuberculosis vaccines elicit antigen-specific antibody and cytokine responses, suggestive of a Th1 immune response.

• RASV-M. tuberculosis vaccines elicit protection in immunized mice against aerosol challenge with live M. tuberculosis H37Rv that is similar to or better than protection by M. bovis BCG vaccination.

• We can now do much better with improved strains.

Improved RASV-M. tuberculosis χ12259: ΔPmurA25::TT araC PBAD murA ΔasdA27::TT araC PBAD c2 Δ(wza-wcaM)-8 Δpmi-2426 ∆PhilA::Ptrc

lacO888 hilA ΔpagP88::Ptrc lpxE ΔrelA197::araC PBAD lacI TT ΔsifA26

M. tuberculosis antigens to be evaluated:

OmpCss-ESAT-6-ESAT-6-CFP-10-Ag85A

Electron micrograph of avian influenza H5N1 virus particles

Courtesy of R. Fleck, National Institute of Biological Standards and Control, UK

Influenza Virus

Infection can lead to:

pneumonia

sinus/ear infection

worsening of chronic conditions (asthma, diabetes, heart disease)

Death

Causative agent of influenza

Experimental Overview Strain & Plasmid-Encoded Antigens

χ11791: ΔPmurA25::TT araC PBAD murA ΔasdA27::TT araC PBAD c2 Δ(wza-wcaM)-8 Δpmi-2426

ΔrelA198::araC PBAD lacI TT ΔsifA26

Plasmids with pBR ori, p15A ori and pSC101 ori

NP

NP-HA

HA210-219 - 3aa linker - HA450-460 (24aa total C-terminal of NP)

T Cell Response Post-Challenge Oral Delivery

pBR pSC101p15A

Peripheral Blood

Lung

Antigen-Specific CD8+ T Cell Response to Influenza Challenge (Day 8 post-challenge)

NP antigen codon optimized for high level expression by oral Salmonella vaccine

%N

P1

47

-15

5 T

et+

,CD

44h

i

(of

tota

l CD

8+ T

cel

ls)

Naive

Contro

lBSG

pBR ori

p15A o

ri

pSC101

ori0

5

10

15

20

%N

P1

47

-15

5 T

et+

,CD

44h

i

(of

tota

l CD

8+ T

cel

ls)

Naive

Contro

lBSG

pBR ori

p15A o

ri

pSC101

ori0

1

2

3

4

5

Lung Peripheral Blood

Weight Loss and Mortality NP antigen codon optimized for high level expression by

oral Salmonella vaccine

Days Post Challenge

% P

re-C

hal

len

ge

Bo

dy

Wei

gh

t

0 5 10 15 2050

60

70

80

90

100

BSG

p15A ori

pBR ori

pSC101 ori

Days Post Challenge

Pe

rce

nt

su

rviv

al

0 5 10 15 200

20

40

60

80

100Weight Loss Mortality

ori

Final RASV-Influenza Vaccine (based on ability to induce 100% protective immunity to influenza

challenge in mice by individual delivery of M2e, NP and HA antigens)

• Will deliver conserved M2e fused to WHV core by regulated delayed lysis in endosome•Will deliver conserved NP-HA epitope and NP-M1 fusion antigens after escape from the endosome into cytosol by regulated delayed lysis for class I MHC presentation•Will deliver DNA vaccine encoding variable HA antigens by regulated delayed lysis in the cytosol with targeting of synthesized protective antigens to proteosome

This research is supported in part by grants from:

Bill and Melinda Gates Foundation

United States Department of AgricultureNational Institute of Food and Agriculture

Tiana Golding

Qingke Kong

Maria Dolores Juarez-Rodriguez

Jiseon Yang

Shifeng Wang

Wei Kong

Amanda GonzalesSoo-Young Wanda

Bronwyn Gunn

Josie Clark-Curtiss

Blessing Okon

Shamaila Ashraf