ADRENERGIC REGULATION OF ADIPOSE TISSUE LIPOLYSIS IN

TRANSITION DAIRY CATTLE BASED ON GENETIC MERIT AND ENERGY

INTAKE

By

SHAWNESE MARIE ROCCO

A thesis submitted in partial fulfillment of the requirements for the degree of

MASTER OF ANIMAL SCIENCE NUTRITION

Washington State University Department of Animal Sciences

AUGUST 2010

ii

To the Faculty of Washington State University:

The members of the Committee appointed to examine the thesis of Shawnese

Marie Rocco find it satisfactory and recommend that it be accepted.

John P. McNamara, Ph.D., Chair Derek McLean, Ph.D. Joseph H. Harrison, Ph.D.

iii

ACKNOWLEDGMENT

I would like to thank the faculty and staff of the Department of Animal

Sciences for providing the facilities and supportive environment that made this

thesis possible. This department has been nothing but supportive.

I would also like to acknowledge and thank Dr. McNamara for being a

supportive and effective advisor. I am truly grateful for your dedication to my

success and for inspiring me to do better.

Thank you, as well, to Dr. Derek McLean and Dr. Joe Harrison for serving on

my committee. You were a great resource to turn to and I very much appreciate you

taking the time to help me finish this great project.

I would like to extend my deepest gratitude to my parents, my sister, my

boyfriend, and my closest friends for providing me the strength to finish this

accomplishment. Thank you for your unwavering support, advice, and love because

without it I would never have made it this far.

More specifically I need to thank Vanessa Michelizzi for never failing to help

me get through every rough patch I’ve encountered in college from the first day I

met her as my roommate freshman year, until today as a fellow graduate student

and neighbor. I would never have made it through if you hadn’t been there.

iv

ADRENERGIC REGULATION OF ADIPOSE TISSUE LIPOLYSIS IN

TRANSITION DAIRY CATTLE BASED ON GENETIC MERIT AND ENERGY

INTAKE

Abstract

by Shawnese Marie Rocco, M.S. Washington State University

August 2010 Chair: John P. McNamara

In lactating dairy cattle the adipose tissue stores energy as triacylglycerol

(TAG) that can be used during early lactation. Breakdown of TAG (lipolysis) is

regulated by stimulation of the beta-2 adrenergic receptors (β2

Cows were selected for genetic merit (high merit, HM; low merit, LM) based

on sire predicted transmitting ability of milk (PTAM) and fed to requirements (NE)

or to 90% of energy requirements (LE). We took adipose tissue biopsies at 21 and 7

days prepartum; and 7, 28, and 56 DIM to determine rates of lipogenesis and

lipolysis; and to measure gene expression of key lipolytic genes (β

AR) leading to

activation of hormone-sensitive lipase (HSL). It is not known whether control of

lipolysis is also a function of increased expression of mRNA for the ß2-adrenergic

receptor, HSL, and perilipin (PLIN). A decrease in rates of lipogenesis (fatty acid

synthesis) also occurs in early lactation. Therefore, objectives of this project were to

help define adipocyte responses to lactation and energy deficit, including changes in

expression of proteins known to control lipid metabolism.

2, HSL, and

v

PLIN). The cows on the LE diet consumed 12% less feed prepartum and 16% less

feed postpartum. Dietary energy restriction decreased milk production overall but

HM, LE fed animals produced more milk (P < 0.03).

Serum glucose was relatively unchanged and serum NEFA were highest at 7

DIM (P < 0.02). The slowest rates of lipogenesis occurred at 7 and 28 DIM (P <

0.001). HM cows had faster rates than LM cows (P < 0.04) and dietary restriction

further decreased (P < 0.05) lipogenesis in early lactation. Lipolysis increased (P <

0.03) in early lactation in a pattern consistent with differences in milk production.

The expression of β2

AR, HSL, and PLIN did not change expression in NE cows due

to lactation, but expression was decreased in early lactation by dietary restriction (P

< 0.05). Data from this experiment support the hypothesis that regulation of

adipose tissue metabolism in lactation is a function of diet and genetic merit and is

controlled by multiple mechanisms including gene transcription and post-

translational protein modifications.

vi

TABLE OF CONTENTS Page

ACKNOWLEDGMENT ..................................................................................... iii

ABSTRACT ....................................................................................................... iv

LIST OF FIGURES ......................................................................................... viii

LIST OF TABLES .............................................................................................. xi

CHAPTER

1. INTRODUCTION..................................................................................1

2. EXPRESSION OF GENES CONTROLLING LIPOLYSIS IN

TRANSITION DAIRY CATTLE ...........................................................2

Review of Pertinent Literature .....................................................2

Materials and Methods ................................................................ 17

Results and Discussion ................................................................ 25

Feed Intake .............................................................................. 25

Milk Yield ................................................................................29

Body Weight, Body Condition Score, and

Empty Body Fat...................................................................... 33

Blood Nutrients .......................................................................37

Glucose ............................................................................... 37

Non-esterified Fatty Acids, and Energy Balance ............. 39

Rates of Lipogenesis in Adipose Tissue in vitro ..................... 43

Rates of Lipolysis in Adipose Tissue in vitro ......................... 50

vii

Gene Expression ...................................................................... 57

Beta-2 Adrenergic Receptor ......................................................... 58

Hormone Sensitive Lipase ........................................................... 62

Perilipin ....................................................................................... 65

3. ANALYSIS AND CONCLUSIONS ............................................... 69

REFERENCES .................................................................................................. 71

viii

LIST OF FIGURES

1a. Feed intake of cows varying genetic merit fed normally or an energy restricted diet, effect of dietary energy intake over time ................................. 27 1b. Feed intake of cows varying genetic merit fed normally or an energy restricted diet, effect of genetic merit over time ............................................... 28 2a. Milk yield (kg/DM) of cows varying genetic merit fed normally or an energy restricted diet, effect of energy intake ............................................. 31 2b. Milk yield (kg/DM) of cows varying genetic merit fed normally or an energy restricted diet, effect of genetic merit .............................................. 32 3. Rate of lipogenesis in cows of varying genetic merit fed normally or an energy restricted diet, effect of dietary energy intake and genetic merit ...................................................................................................... 48 4. Rate of lipogenesis in cows of varying genetic merit fed normally or an energy restricted diet, effect of dietary energy intake and genetic merit ...................................................................................................... 49

ix

LIST OF TABLES

1. Dietary Ingredients and Chemical Composition .......................................... 22 2. RT-PCR Primers Used for Determining Gene Expression in Bovine Adipose Tissue ................................................................................................... 24 3. Feed intake of cows varying genetic merit fed normally or an energy restricted diet, effect of genetic merit, energy intake, and parity prepartum and Postpartum ................................................................................................. 26 4. Milk yield (kg/d) of cows varying genetic merit fed normally or an energy restricted diet, effect of genetic merit, energy intake, and parity ... ....................................................................................................... 30 5. Body weight (BW), body condition score (BCS), and empty body fat (EBF) of cows varying genetic merit fed normally or an energy restricted diet, interaction effect of diet and genetic merit ....................................................... 35 6. Serum glucose (mg/dL) of cows varying genetic merit fed normally or an energy restricted diet, interaction effect of diet and genetic merit across target days in Milk ................................................................................. 38 7. Serum NEFA (µM) concentration of cows varying genetic merit fed normally or an energy restricted diet, interaction effect of diet and genetic merit across target days in milk........................................................... 41 8. Estimated energy balance (Mcal/d) of cows varying genetic merit fed normally or an energy restricted diet, effect of diet and genetic merit interaction across target days in milk .............................................................. 42 9. Rates of lipogenesis of cows varying genetic merit fed normally or an energy restricted diet, overall diets and genetic merit; effect of parity .......... 44 10. Rates of lipogenesis of cows varying genetic merit fed normally or an energy restricted diet, effect of diet and genetic merit .................................... 46

x

11. Rates of lipolysis of cows varying genetic merit fed normally or an energy restricted diet, effect of parity ............................................................... 52 12. Rates of lipolysis of cows varying genetic merit fed normally or an energy restricted diet, effect of diet and genetic merit .................................... 55 13. Beta-2 adrenergic receptor gene expression of cows varying genetic merit fed normally or an energy restricted diet, effect of diet and genetic merit ...................................................................................................... 60

14. Hormone sensitive lipase gene expression of cows varying genetic merit fed normally or an energy restricted diet, effect of diet and genetic merit ...................................................................................................... 63 15. Perilipin gene expression of cows varying genetic merit fed normally or an energy restricted diet, effect of diet and genetic merit ........................... 67

1

Introduction

The transition period around parturition in dairy cattle is a time of increased

metabolic stress. Many cows, though not all, experience a negative energy balance

during this period that impacts metabolic efficiency. Ideally, cows need to not only

produce many pounds of milk but also maintain body condition and body fat

reserves to supply the demand of milk production and maintain health status.

Dairy managers can lose around $30,000 per 100 head (“Metritis: A Foul Disease

With Financial Costs”, 2010) annually because of metabolic disorders such as

metritis, displaced abomasum, milk fever, mastitis, and ketosis resulting from a

poor plane of nutrition during the transition period. Sumner and McNamara (2007)

and others have shown that in addition to parity and dietary energy intake, genetic

merit plays a tremendous role in metabolic status and thus efficiency during the

transition period.

Present research is integrating knowledge regarding the interaction of

genetics and nutritional status, commonly referred to as nutrigenetics or

nutrigenomics. The emerging field of nutrigenomics aims to study how diet affects

specific genes and nutrigenetics aims to determine how expression of genes affect

how individuals respond to specific nutrients (Mutch et al., 2005). Research is

needed to elucidate more specific integrated knowledge of metabolism, gene

expression, and overall production. One application of this systems approach could

be to select for higher genetic merit cows that will produce the same amount or

more milk by minimizing a negative energy balance and resulting loss of efficiency.

2

The overall hypothesis was that animals that vary in genetic merit for milk

production and in energy intake will have a different pattern of lipid metabolism in

the adipose tissue, including expression of key regulatory genes.

Thus, the objective of this experiment was to investigate the mechanisms

involved in lipid mobilization and utilization in adipose tissue as these mechanisms

relate to the interaction of genetics and diet. The experiment was designed to

determine whether or not specific genes known to control lipid metabolism are

altered in expression in adipose tissue of dairy cattle with varied genetic merit and

energy intake.

Lipolysis and Lipogenesis in Adipose Tissue

Review of Pertinent Literature

Lactation is considered one of the most versatile and important developments

in the evolution of mammals. Mammals are adapted to carry a food-producing

organ for their young that provides for greater efficiency and adaptability to

seasonal, predatory, or climatic changes to increase survival rates. Wild-type

mammals tend to produce just enough milk to nourish their offspring; however,

humans have domesticated animals and selected them for increased milk

production to provide milk for human consumption.

Even though we have selected for rapid rates of milk production and

extended lactation periods in dairy cattle, the underlying common patterns of

regulation of nutrient use are still present. All mammals generally undergo a

period of transient reduction in food intake near parturition, followed by a rapid

3

increase in mammary growth, milk secretion, and concomitant demand for

nutrients. In first lactation animals the mammary gland undergoes extensive

growth and development in addition to the demand for milk secretion. The female

often responds by quickly increasing feed intake. In mammals as diverse as the

order rodentia; and the families of canidae, felidae, bovidae, and suidae, feed intake

can double in one or two days and increase three to five times the normal level in

one to several weeks (Verstegen et al., 1985; Munday and Earle, 1991; Case, 1999;

Tyler and Ensminger, 2006; Peterson and Baumgardt, 1971).

A correlate of the evolution of lactation has been the evolution of adipose

tissue. In mammals, adipose has become a highly active and adaptable organ. In

wild-type mammals, adipose tissue stores energy dense triacylglycerols in periods of

nutritional abundance (as in spring, summer, and early fall) to provide energy when

nutrient supply is limited in winter. Interestingly, many thousands of years of

domestication have not altered the circadian nature of body fat storage and use; as

domesticated animals still demonstrate a seasonal cyclicity of body fat reserves

(Vernon et al., 1997; McNamara et al., 1986).

In addition to the seasonal cyclicity, mammals in their reproductive years

have an additional pattern superimposed on the functions and amounts of adipose

tissue. In early pregnancy, mammals store an increased amount of body fat even

when energy intake is moderately limited. Later in pregnancy this energy can be

used to support rapid fetal growth, and then at the initiation of lactation, the body

fat can be used to provide fatty acids and glycerol for milk fat and lactose synthesis

4

as well as for energy use in other organs. This pattern of adipose tissue use is

present in all mammals but has been finely manipulated and developed through

selection in domesticated mammals, especially the dairy cow.

Selection for rapid rates of milk production has resulted in a large proportion

of dairy cattle that do not increase their rate of nutrient intakes quickly enough to

avoid a period of nutrient deficit. For many years this period of nutritional

deficiency resulted in an increased incidence of metabolic diseases and reproductive

problems. In the population of lactating dairy cattle, regardless of parity, genetic

merit, and management intensity; there is wide variation in milk production,

increase in feed intake in response to higher demand for milk production, and an

increase in metabolic diseases due to the negative energy balance that high

producing dairy cows incur during lactation. The U.S. Holstein population is not a

genetically or environmentally homogenous population; so during the peri-

parturient period the herd and individual cows within the herd vary in how much

energy they need to support milk production and maintain normal body function.

During the late 20th century there was an increasing trend in dairy cattle to

develop metabolic diseases such as ketosis, milk fever, displaced abomasum,

retained placenta, bloat, acidosis, and fatty liver as a function of being in an intense

or constant negative energy balance (Drackley, 1999; Tyler and Ensminger, 2006).

However, with increased emphasis on nutritional and environmental management,

nutritionists now do a much better job of formulating and feeding rations balanced

for proper nutrient content which are prepared and fed to maximize intake. As a

5

result of better management practices the incidence of most metabolic diseases has

declined dramatically. Nevertheless, there remains a wide variation not only in

milk production but in voluntary feed intake regardless of milk production level in

cows in the same herd on the same rations. There are continued presences of

subclinical metabolic deficiencies in energy and other nutrients that diminish

overall efficiency (Mulligan and Doherty, 2008). One aspect of the control of feed

intake and therefore clinical diseases, subclinical diseases, and milk production is

the metabolism of lipid in the adipose tissue.

Cows mobilize fat reserves to support milk production and without adequate

fat reserves the cow is unable to meet her genetic potential for milk production

because they are in a negative energy balance. However, there are usually high

producing cows in a herd that eat substantially more than their herd mates and, at

the same productive level, have less or even no negative energy balance

(Schactshneider et al., 2009). While many cows will go into that negative energy

balance, there are some cows—that even on a restricted energy diet—will not go

into as negative of an energy balance and can still maintain high milk production

(McNamara and Valdez, 2005; Schactshneider et al., 2009; Sumner and McNamara,

2007). Thus, adipose tissue can be a limiting factor in milk production.

These high producing and feed efficient cows are those that producers need.

Improvement of selection criteria to increase the overall milk production yield, feed

efficiency, and economic return of the herd would be beneficial. Theoretically, if

producers can select for a cow that meets her milk production potential with

6

minimal negative energy balance and loss of body fat to produce a high milk yield,

we can produce more milk with fewer cows and the cost of feeding would decrease.

McNamara (1989) demonstrated that cows with an introduced energy

restriction of around 13%, due to increased forage content, showed a decrease in

milk production of about 7%. The cows that showed the highest weight gain were,

interestingly, low genetic merit cows fed a high energy diet, suggesting that lower

genetic merit cows will partition more energy toward weight gain on a diet

optimally formulated for energy. The cows that showed lower gains in weight

illustrate that, during lactation, nutrients are prioritized to the mammary gland for

milk synthesis before rebuilding body fat reserves (McNamara, 1989). What we

ideally want are animals that partition energy to both milk yield and body

maintenance or growth. By looking at genetic merit and energy intake we can

determine which cows express key genes indicative of high milk yield, high feed

efficiency, and a milder negative energy balance during the periparturient period.

A period of negative energy balance can lead to a decrease in pregnancy rates

(Tyler and Ensminger, 2006). Many cows will decrease feed intake around

parturition which increases fat mobilization and the risk of metabolic disorders; as

well as possibly decrease milk production in both the short term and long term

reproductive life of the cow (Roche, 2006). A loss in reproductive efficiency is also a

loss in productivity which ultimately causes a loss in profit. This presents the

problem of ensuring that cows achieve a positive energy balance more quickly to

maintain efficient fertility and decrease the susceptibility to metabolic disorders.

7

In general, high producing cows tend to be more susceptible to metabolic

disorders than low producing cows (Guo et al., 2007, Guo et al., 2008), which implies

that higher producing cows that do not consume enough energy will be forced into a

more negative energy balance than the lower producing cows. Guo et al. (2008)

have developed a model based on NEFA and insulin concentrations in peri-

parturient cows and heifers to assess and perhaps predict the occurrence or relative

risk of a cow or heifer developing ketosis. However, the metabolic pathways and

their regulation underlying the model need to be understood completely to define

the variation and reasons why these animals may develop a metabolic disorder.

The major pathways of lipid metabolism in white adipose tissue include

lipogenesis, lipolysis, and ß-oxidation. During the peri-parturient period, lipolysis

increases and stays elevated throughout lactation whereas lipogenesis (or fat

synthesis) decreases greatly during early lactation and increases during mid-

lactation (McNamara et al., 1986; Doris et al., 1996). Lipogenesis is the process of

free fatty acid conversion to triacylglyerol (TAG). During nutrient deprivation there

is an increase in lipolysis and ß-oxidation to utilize fat stores for energy. Lipolysis

is the breakdown of triglycerides into free fatty acids and glycerol to be used for

energy. The free fatty acids are then oxidized to CO2 in ß -oxidation for energy and

glycerol is recycled to form more triglycerides or is used in the synthesis of

phospholipids to maintain the lipid membrane. The primary purpose of lipolysis is

to provide fatty acids for milk fat synthesis as well as energy. However, it is often

overlooked that in the dairy cow the glycerol released from adipose tissue can

8

provide glucose for milk lactose synthesis, possibly as much as 15% of the total

(Hanigan et al., 2007).

Rates of adipose tissue lipolysis and lipogenesis differ in animals depending

on age, physiological state, and energy intake (McNamara, 1994). In the transition

period there is often a substantial increase in lipolysis. There is already a fairly

developed knowledge base on the control of lipid metabolism; therefore current

research is concentrating on the details of the multi-faceted mechanisms regulating

lipolysis, including the mechanisms of genetic and transcriptome regulation.

Regulation of Lipolysis

Adrenergic Stimulation

Due to its key role in energy balance, the regulation of lipolysis was studied

in great detail during the 1960s and 1970s, at which time researchers such as Metz

and Van den Bergh (1971), Yang and Baldwin (1973), and Guidicelli et al. (1974)

were able to begin to elucidate the metabolic control of lipolysis. Scientists observed

that in a starved state certain metabolic pathways such as the G-coupled protein

receptor pathway of ß-agonist receptors which, once activated, converts adenyl

cyclase to cyclic AMP, (Gorman et al., 1972 and 1973) signal the cascade of events

that lead to the breakdown of triglycerides. The early work on lipolysis led to

development of the ‘fight or flight response’. This response, activated by the binding

of the catecholamines (epinephrine or norepinephrine) to a ß-adrenergic receptor,

signals the cascade of events that lead to the release and breakdown of

triacylglycerols from the adipocyte for immediate energy (Burns et al., 1981;

9

Lefkowitz, 1974). Evolutionarily, this response allows an animal to escape a

dangerous situation or predator with a quick burst of energy for either fighting or

running away to enhance the chances of survival. In dairy cows, this catecholamine

mediated response is a survival mechanism to provide energy in times of nutrient

deprivation to be partitioned to milk production. Humans, by genetically selecting

for higher producing cows, have capitalized on this adrenaline response to increase

milk yield.

Adipocytes are in a constant flux of lipolysis and lipogenesis. During

lactation, the rate of lipolysis increases in response to the negative energy balance

(Bauman and Vernon, 1993). Hormonally, lipolysis is signaled by the

catecholamines epinephrine and norepinephrine that bind to the beta-adrenergic

receptor and activate a G-protein coupled receptor to convert adenyl cyclase to cyclic

AMP. Cyclic AMP activates protein kinase A (PKA) to phosphorylate hormone

sensitive lipase (HSL) to its active state. In addition, PKA phosphorylates the co-

factor protein perilipin (PLIN), which allows HSL to access the hydrophobic

triacylglycerol (TAG) droplet. Hormone sensitive lipase activates the breakdown of

TAGs into free fatty acids. Free fatty acids are then oxidized through ß-oxidation in

the mitochondria of various organs to CO2

The actions of catecholamines also inactivate acetyl CoA carboxylase to

decrease lipogenesis. Insulin elicits the opposite response of the catecholamines by

inactivating cyclic AMP and activating acetyl CoA carboxylase to increase

lipogenesis (Salway, 2004). The role of transcription in control of lipogenesis has

for energy.

10

been fairly well established. In lactating dairy cattle, lipolysis may be controlled by

increased expression of mRNA for the ß2-adrenergic receptor, HSL, and PLIN

during the transition period (Sumner and McNamara, 2007). However, the body of

knowledge on this process is limited and we need to determine more specifically the

quantitative complex of control of lipolysis.

Hormone Sensitive Lipase

Hormone sensitive lipase in the adipose tissue is an 86 kDa cytoplasmic

protein (Shen et al., 1999). Holm et al. (1988) showed that hormone sensitive lipase

responds negatively to insulin, positively to catecholamines, and has no sequence

homology to other lipases. There are both a long form and short form codes for a

protein isoform of hormone sensitive lipase that is involved in lipolysis while the

long form is important for steroidogenesis in the testes (Kraemer, 2002).

Perilipin

Perilipin A is a 57 kDa protein that coats lipid droplets to prevent them from

being hydrolyzed by lipases such as hormone sensitive lipases (Kern et al., 2004).

Perilipin A is the primary perilipin involved in adipocyte metabolism. During

lipolysis, perilipin is phosphorylated by protein kinase A (PKA) that causes a

conformational change in the protein coating to allow lipases access to the lipid

droplet contents (Kern et al., 2004). The triacylglcerols in the lipid droplet can then

be hydrolyzed to non-esterified fatty acids (NEFAs). Sumner and McNamara (2007)

showed that PLIN mRNA levels were very highly expressed in bovine adipocytes

and was increased in adipose tissue at 90 DIM. There was a much smaller increase

11

in PLIN mRNA levels during early lactation when there is greatly increased

lipolysis. It may be that by 90 DIM, when milk production is at maximal rates,

increased expression of PLIN is needed to make more of this protein to maintain

fast rates of lipolysis. It is as yet unclear if perilipin has any regulatory role in

control of lipolysis, or a constitutive permissive role.

ß -adrenergic receptors

There are three ß-adrenergic receptor subtypes known with a possible fourth

involved in cardiac muscle function (Galitsky et al., 1997; Chruscinski et al., 1999;

Kaumann et al., 1998; Grujic et al., 1997; Cao et al., 1998; McNeel and Mersmann,

1999; Pietri-Rouzel et al., 1995; Sillence and Matthews, 1994; Forrest and Hickford,

2000; Liang and Mills, 2002). Beta-adrenergic receptors are found in many cells

and are old proteins found in simple invertebrates as part of a rudimentary neural

response system (Stiles et al., 1984). In general, the expression of the ß-adrenergic

receptor subtypes is involved in adipose metabolism in rodents, pigs, and cattle

(Castiella et al., 1994; Galitsky et al., 1997; Cao et al., 1998; Chruscinski et al.,

1999; Kaumann et al., 1998; Grujic et al., 1997; McNeel and Mersmann, 1999;

Mersmann 1996; Mersmann et al., 1997). The ß2-adrenergic receptor subtype is

most involved in lipolysis in cattle, if not all ruminants (Sumner and McNamara,

2007; Chruscinski et al., 1999) whereas the ß3-adrenergic receptor subtype is the

primary adrenergic receptor for lipolysis in humans, rodents, and other non-

ruminant mammals (Chruscinski et al., 1999; Grujic et al., 1997; McNeel and

Mersmann, 1999; Mersmann, 1996; Mersmann et al., 1997). The ß1-adrenergic

12

receptor subtype, in dairy cattle, is the least expressed of the three known ß-

adrenergic receptor subtypes (Sumner and McNamara, 2007) while the ß-

adrenergic receptor subtype that induces lipolysis strongest is the ß2-adrenergic

receptor subtype.

Receptor Desensitization

Receptor activity and responsiveness can be decreased if exposed to chronic

stimulation over time, also tending to decrease the affinity for receptor agonists to

bind (Portillo et al., 1995). This desensitization is either a decrease in affinity for

receptor agonists or down regulation of receptor synthesis (Carpéné, 1992).

Beta adrenergic receptors are found within the G-coupled protein receptor

family and are characterized within the seven transmembrane g-coupled protein

receptor (7TMR) superfamily. A ligand binds to the 7TMR which causes a

conformational change in the receptor at the carboxyl group intracellularly. This

conformational change either promotes the activation of a second messenger

system, such as cyclic AMP (cAMP), or an inhibitory system through

phosphorylation of a G protein-coupled receptor kinase (GRK) that promotes the β-

arrestin adaptor protein to inhibit the second messenger activity (Rajagopal et al.,

2010). The β-arrestins desensitize the receptor by recruiting enzymes to degrade

the second messenger cAMP (Rajagopal et al., 2010). While desensitizing the

adrenergic receptors will reduce second messenger systems such as the cAMP

pathway that leads to lipolysis, the desensitization does not completely shut down

the entire system (Vicario et al., 1997). While this experiment did not focus on the

13

endocrinology of the 7-transmembrane receptor superfamily it is important to note

that current research in this area is finding that 7TMR and the ligands that bind

them have the ability to selectively recruit β-arrestins and or GRKs for regulating

the pathways activated by the ligands. For example, Β2AR ligands bind the

receptor, causing a conformational change that can allow the receptor to selectively

recruit β-arrestins (Rajagopal et al., 2010, Drake et al., 2008). These β-arrestins

recruit a signaling scaffold to recruit proteins that can internalize and essentially

desensitize the β2ARs (Drake et al., 2008, Willoughby et al., 2007). β-arrestins have

been shown to reduce the amplitude of cAMP signals by possibly recruiting

phosphodiesterase-4D to degrade cAMP, which leads to the attenuating β2AR

signals observed during β-arrestin recruitment (Willoughby et al., 2007).

Lipogenesis

Lipogenesis is the process of synthesizing triacylglycerol via esterification of

fatty acids and glycerol. Mature adipocytes in the adipose tissue are made up of a

lipid droplet containing primarily triacylglycerol. During homeostasis lipogenesis is

in simultaneous flux with lipolysis so that the animal generally is constantly

breaking down and rebuilding adipose stores. However, during lactation the

demand for energy increases and as a result lipogenesis is typically reduced to an

altered state of flux known as homeorhesis (Bauman and Currie, 1980). For

example, Tepperman and Tepperman (1970) discussed how animals in a starved

state will decrease rates of lipogenesis to mobilize body energy stores, typically in

the form of adipose. In contrast, when animals are refed, rates of lipogenesis

14

increased and surpassed rates of lipolysis to rebuild the energy stores lost to

starvation.

Glucose supply is the major driver of lipogenesis. Lipogenesis is a major

component of adipose tissue metabolism during the transition period in dairy cattle.

Rates of lipogenesis in relation to rates of lipolysis indicate the effect of negative

energy balance in a cow and perhaps how quickly the cow can reach a positive

energy balance. Research done in this laboratory demonstrated that lipogenesis is

highly sensitive to energy intake, falling quickly to zero as energy balances reduces

to zero (McNamara and Hillers, 1986). In addition, animals of higher genetic merit

for milk production have lower rates of lipogenesis even at the same energy intake.

However, it is clear that lipogenesis is much more responsive to diet than is

lipolysis; whereas lipolysis is a function of genetic differences. Herein is the crux of

nutrigenomics and nutrigenetics in the control of efficiency in dairy cattle: what is

the totality of the mechanisms that control lipid metabolism.

Acetyl Co A

Acetyl CoA Carboxylase is an enzyme responsible for regulating lipid

mobilization and malonyl coA synthesis—which is the substrate for fatty acid

synthesis (Wakil, 2008). Insulin upregulates Acetyl CoA Carboxylase in times of

exogenous energy availability to store excess energy as glycerol and triglycerides.

Acetyl CoA Carboxylase helps regulate lipid mobilization by acting as a product and

intermediate for β-oxidation.

Control of Lipolysis and Lipogenesis During Lactation

15

The mechanisms of control of lipogenesis by endogenous energy availability

and physiological state are well defined. The control of lipolysis is not as fully

understood. It is well known that lipolysis is controlled by the sympathetic nervous

system through binding of the β-adrenergic receptor and subsequent 2nd

In dairy cattle, genetic merit plays a role in determining or controlling rates

of lipogenesis and lipolysis, especially during lactation. For example, higher genetic

merit cows are able to more efficiently balance rates of lipolysis and lipogenesis to

respond to a decrease in energy balance.

messenger

cascade as defined above. However, it is not clear whether or to what extent control

of transcription affects lipolysis. In most situations lipogenesis and lipolysis are

controlled in a concerted balance to prevent the mobilization of excess energy or

unnecessary storage.

Milk production and feed efficiency are both a function of the rates of lipolysis

and lipogenesis. The cow tends to protect milk production by mobilizing body stores,

which is a function of both increased lipolysis and decreased rates of lipogenesis.

During physiological states of increased productivity the maintenance rates of

lipolysis and lipogenesis are altered to function in a different pattern, known as

homeorhesis. Usually during lactation lipogenesis decreases and lipolysis increases

to mobilize body fat to supply energy for milk production.

For example, during the transition period dairy cows will typically reduce

their feed intake around parturition which puts them at a decreased energy balance

that often becomes negative around lactation. Once the cow starts lactating she

16

will typically experience an increase in lipolysis and decrease in lipogenesis. The

cow will typically experience a decrease in empty body fat, serum glucose, insulin,

and acetyl coA carboxylase which attenuates the rate of lipogenesis; while

increasing transcription of HSL, PLIN, and β2-adrenergic receptors which enhances

lipolysis. This homeorhetic increase in lipolytic protein transcription is also closely

regulated by the sympathetic nervous system release of catecholamines and other

hormones that may enhance the rates of lipolysis.

Because of the complex nature of metabolic control, and the relative lack of

knowledge on mechanisms of control of lipolysis, we conducted an experiment to

attempt to define mechanisms of lipolysis by nutrigenomic and nutrigenetic

controls. How do animals of different genetic merit control lipolysis and lipogenesis

when faced with an energy restriction that is sufficient enough to alter energy

balance, but not severe enough to be out of a normal range for the average dairy

cow? Therefore, the overall hypothesis was that animals that vary in genetic merit

for milk production and in energy intake will have a different pattern of lipid

metabolism in the adipose tissue, including expression of key regulatory genes.

Thus, the objective of this experiment was to investigate the mechanisms

involved in lipid mobilization and utilization in adipose tissue as these mechanisms

relate to the interaction of genetics and diet. The experiment was designed to

determine whether or not specific genes known to control lipid metabolism are

altered in expression in adipose tissue of dairy cattle with varied genetic merit and

energy intake.

17

Methods and Materials

Animals and Treatment Protocol

Forty-eight Holstein cows from the Knott Dairy Herd (Pullman, WA) were

selected, blocked by parity (1st or 2nd) and by sire genetic merit as predicted

transmitting ability for milk (PTAM). There were 24 1st lactation and 24 2nd

lactation animals. Genetic Merit sire PTAM average was 1913 (High Genetic Merit,

HM) or 832 kg (Low Genetic Merit, LM) (SD 686). For 1st lactation animals sire

PTAM was 2072 (HM) and 787 kg (LM) and for 2nd lactation animals sire PTAM

was 1691 (HM) and 907 (LM). The 305ME for HM 2nd

Animals were fed once a day through Calan gates (American Calan, 1997;

Northwood, NH) between 10:00am and 11:00am. Animals were adapted to the

gates approximately 3 to 7 days prior to beginning dietary treatments which began

21 days prepartum and continued through 56 DIM. Normally fed (NE) animals

were fed to achieve 5 % ORTS, and LE animals were fed to achieve 90% of that

lactation animals was 30,582

kg and for LM it was 27,997 (SD 3,893), which places these animals in the top 10 %

of production in US Holsteins. Dietary treatments were either fed at TMR to

requirements (NRC, 2001; NE); or fed a TMR at 90 % of the intake of the NE group

based on intake as a percent of BW (LE) (Table 1). The LE diet was fortified with

10 % more protein as well as vitamin and mineral mixes so that was consistent

across groups, however other dietary compositions were not altered so that the

experimental model was a difference in overall energy intake regardless of energy

source.

18

intake as a % of BW. Intake as a % of BW was calculated daily for adjustments.

Dietary ingredients were sampled with each new batch; the TMR and orts were

sampled weekly and composited monthly for analysis at Kuo Labs (Othello, WA)

using AOAC methods for DM, ADF, NDF, CP, fat, Ca, and P (AOAC, 2000).

Samples and Measurements

Cows were milked twice a day and yield was measured daily. Milk

composition was determined approximately monthly by DHIA sampling using

infrared spectrophotometry at the regional DHIA laboratory in Burlington, WA

(AOAC, 2000). Body weight (BW) and body condition score (BCS) (Bernabucci et al.,

2005; Waltner et al., 1994) were assessed weekly. Body weight and BCS were used

to calculate body fat (Waltner et al., 1993). Blood was collected weekly via

venipuncture of the coxygeal vessel at 28, 21, 14, 11, 7, and 4 days prepartum and

then postpartum at days 1, 3, 7, and then weekly until week 8.

Subcutaneous adipose tissue biopsies were collected at 21 and 7 days

prepartum and at 7, 28, and 56 days postpartum, from the tail head region under

spinal anesthesia (Sumner and McNamara, 2007). Part of the sample was

immediately placed in Krebs/HEPES buffer (Sumner and McNamara, 2007) at 37°

C for tissue incubations to estimate rates of lipogenesis and lipolysis and part was

immediately homogenized in Qiazol reagent (Qiagen 75842, Valencia, CA; 91355)

and the homogenate frozen until extracted for RNA.

Analytical Methods Blood serum was collected and analyzed for non-esterified fatty acids (NEFA-

19

C kit; Wako Chemicals, Richmond, VA) with the modifications published previously

(McNamara and Hillers, 1986) and for glucose (Glucose (HK) Kit, Sigma-Aldrich;

St. Louis, MO).

Rates of lipogenesis were measured in vitro using adipose tissue incubated in

medium containing KREBS/HEPES buffer, 2% bovine serum albumin (fatty acid

free); 5 mM glucose and 0.5, 1, 2, 4, 8 mM acetate at 0.1 µCi/mM 2-C14

Incubations of adipose tissue were used to measure basal and stimulated

rates of lipolysis. Adipose tissue was sliced and pre-incubated in 2 ml of Krebs-

Hepes media containing 2 % bovine serum albumin (fatty acid free) for 20 min to

remove the effects of handling and slicing (McNamara and Hillers, 1986b;

McNamara and Valdez, 2005). The media was then removed and replaced with

fresh media and the tissue was incubated another 2 hours. Basal media had no

added stimulators. The response curve to beta-adrenergic receptor binding was

conducted using isoproterenol at 10

acetate, at

pH of 7.4 and 37º C for 2 hours in triplicate. The tissue was sliced to a thickness of

approximately 500 µm on a calibrated microtome (Etherton et al., 1977) and was

measured into approximately 80-100 mg slices for the triplicate incubations. After

incubation, samples were placed in DOLE’s reagent (Smith and Crouse, 1984) to be

extracted for total fatty acid synthesis. Rates were reported as mM acetate

converted to fatty acids per 2h/g tissue.

-8, 10-7, 10-6, 10-5, and 10-4 M. Adenosine

deaminase (6.6 U/ml; Calbiochem, #116880) and theophylline (1mM; Sigma-Aldrich

no. 200-305-7) were included to maximize response to isoproterenol. Rates of

20

lipolysis were expressed as glycerol release in nm/g tissue per 2h.

Gene Expression

Adipose tissue was saved for mRNA extraction in duplicate, each duplicate

was placed in 5 ml of Qiazol and RNA was immediately homogenized and chilled to

-20°C until extraction; then extracted using the RNA-easy midi-kit (Qiagen 75842,

Valencia, CA; 91355). The quality of the mRNA, once extracted, was determined by

re-suspending the RNA in RNAse free water and using the NanoDrop1000 (Thermo

Fischer Scientific; Wilmington, DE) spectrophotometer to estimate RNA purity via

the ratio of A260/A280. The absorbance for pure RNA should have an A260/A280

(RNA to Protein) ratio of between 1.9 and 2.1. For most samples purity was also

assessed on a 1.2% agarose gel to visualize quality of the RNA.

First strand cDNA synthesis was performed once quality and purity of RNA

was assessed and confirmed. A reverse transcriptase (RT) and a no RT control were

made from each set of cDNA to be run on the ICycler real time PCR machine

(BioRad, Hercules, CA). The primers in Table 2 were used to determine gene

expression. Reverse transcriptase, real-time polymerase chain reaction (RT-rtPCR)

analysis was done to determine gene expression of the biopsied bovine adipose

tissue. IQ SYBR Green PCR (Bio-Rad, Hercules, CA) was the dye used to visualize

fluorescence of amplified gene products for real-time rtPCR run on the thermal

iCycler from Bio-Rad (Hercules, CA). The system software is designed to generate

and plot the data based on cycle threshold and Δ-Rn fluorescence over a given

number of cycles. A ribosomal S2 (bRPS2) protein reference gene was used against

21

the primers to calculate relative gene expression (Table 2).

Experimental Design and Statistical Analysis

The experiment was designed and conducted as a randomized complete block

with repeated measures, with sire genetic merit (PTAM) and parity as blocks and

time around parturition as the repeated measure. The model for analysis was:

Yijklmn = μ + GMi + Pj+ Dk + (GM X P)ij + (GM X D)ik + (P X D)jk + (GM X P X D)ijk +

C(ijk)l + γm + αγjl + εijkl. In this model, μ is the overall mean, GMi describes the

effect of genetic merit (either high or low), Pj describes the effect of parity (either 1st

lactation or 2nd lactation), and Dk describes the effect of dietary energy (either

normal or low). The random error, C(ijk)l, is associated with the fixed effects, γm

describes the repeated measure effect of the month, day, or week; and εijkl

describes

the residual error. Data were analyzed using PROC GLM of SAS (SAS Institute,

Cary, NC), depending on the data structure.

22

Table 1. Dietary Ingredients and Chemical Composition

NE NE LE LE

__________________

Item1

Feedstuff, % DM

Dry Lact. Dry Lact.

Alfalfa Hay 0 23.57 0 23.57

Alfalfa Haylage 24 25.57 24 25.57

Grass Hay 60 0 60 0

Whole Cottonseed 0 7 0 7

DGS 0 5.26 0 5.26

Concentrate Mix 16 38.6 16 38.6

Concentrate Composition

Corn 76 93 86 73

Soybean Meal 11 0 0 12.2

Peas 8 0 0 8.9

Limestone 1 1 2 1.1

Salt (TM w/ Selenium) 1 1 2 0.8

Yeast 1 1.4 3 0.67

Ammonium Oxide 0 2.5 5 0

Magnesium Oxide2

Vitamin D Premix 0.4 0.1 0 0.06

0.1 0.6 1 0.44

Vitamin A Premix 0.1 0.05 0 0.03

23

(Table 1. Cont’d. )

Vitamin E Premix 0 0.1 0 0.01

4-Plex3

Sodium Bicarbonate 2 0 0 2.2

0.1 0.2 0 0.11

Seleno Yeast 0 0 0 0.02

Chemical Analysis, % DM NE Dry NE Lact LE dry LE Lact CP, % 12.4 18.5 12.7 19.0

CF, % 2.3 3.8 2.3 3.4

Cfib, % 24.5 18.5 24.4 18.2

NFE, % 50.6 50.0 49.9 51.1

ADF, % 26.3 19.6 26.3 19.8

NDF, % 37.1 24.2 37.1 24.1

Lignin, % 6.9 7.8 7.2 7.6

Ca, % 0.99 0.87 1.03 1.12

P, % 0.26 0.37 0.26 0.35

Ash, % 10.3 9.2 10.6 9.0

NEl, Mcal/kg 1.25 1.42 1.25 1.42 ____________________________________________________________________________

1. Chemical composition from analysis of individual components (AOAC, 2000)

2. Premier Chemicals, LLC, W. Conshohocken, PA

3. Zinpro Corp., Eden Prairie, MN

24

Table 2. RT-PCR Primers1

Gene

Used for Determining Gene Expression in Bovine

Adipose Tissue

Genbank Access. No. Sequence, (3’-5’)

Β2 AR

NM_194266

CCCCAGGCACCGAAAACT

TCCCTTGTGAATCAATGCTATCA

HSL

NM_001080220

GAGTTTGAGCGGATCATTCA

TGAGGCCATGTTTGCTAGAG

Perilipin

NM_001083699

AGACACTGCCGAGTATGCTG

TGGAGGGAGGAGGAACTCTA

bRP S2

NM_001033613

GGAGCATCCCTGAAGGATGA

TCCCCGATAGCAACAAACG

1

Primers were designed using Primer Express 2.0 (Applied Biosystems, Foster City,

CA) and were ordered from IDT Technologies (Coralville, IA)

25

Results and Discussion

Feed Intake

In this experiment the purpose of measuring feed intake, milk production,

and body fat was to provide a framework to interpret metabolic adaptations to

genetic merit and energy intake, not to re-test the well-known effects of genetics

and diet on production.

When provided with feed ad libitum (Normal) cows ate to meet their energy

demands from 21 days prepartum up to 56 DIM, as indicated by the increasing DMI

(Table 2, Figure 1a, 1b). As expected, 2nd parity cows ate more than 1st

Cows of higher genetic merit (HM) did not eat more than lower merit (LM)

animals when fed ad libitum, for all time periods. However, between 1 and 10 days

postpartum HM cows ate more than LM cows (Figure 1a); (P < 0.05). Primiparous

LM cows had the lowest feed intake (Table 3). When energy was restricted, animals

of higher genetic merit consumed more food than LM cows. This may indicate that

cows of lower genetic merit may not have as high a drive for feed intake so when

challenged the cows reduced energy utilization and subsequent feed intake.

parity cows

(P < 0.01). The cows on the LE diet consumed 12% less feed prepartum and 16%

less feed postpartum, regardless of genetic merit or parity (Table 3, Figure 1b).

26

Table 3. Feed intake (kg/DM) of cows varying genetic merit fed normally or an

energy restricted diet, effect of genetic merit, energy intake, and parity prepartum

and postpartum

Treatment Interactions

Item

High Merit

Normal Diet

High Merit

Low Diet

Low Merit

Normal Diet

Low Merit

Low Diet SEM

1st Lactation

Prepartum 12.4 A. 12.6 13.0 9.0 0.5

Postpartum 18.8 B. 17.7 19.3 14.8 0.5

2nd Lactation

Prepartum 15.1 A. 15.5 14.4 13.0 0.8

Postpartum 23.9 B. 20.4 25.0 20.2 0.9

A. Effect of genetic merit (P < 0.05), parity (P < 0.001), genetic merit by diet (P <

0.03)

B.

Effect of parity (P < 0.001), diet ( P < 0.001 ); trend of genetic merit by diet (P <

0.09)

27

Figure 1a. Feed intake of cows varying genetic merit fed normally or an energy

restricted diet, effect of dietary energy intake1

.

1Diamonds represent NE animals and open triangles represent LE animals.

Normally fed intake line is represented by the equation: y=4.79 ln (x) + 1.39 with an

R2 of 0.87. Lower energy intake line is represented by the equation: y=4.25 ln (x) +

0.82 with an R2

of 0.85. Postpartum effect of diet (P < 0.0001).

28

Figure 1b. Feed intake of cows varying genetic merit fed normally or an energy

restricted diet, effect of genetic merit over time1.

1Diamonds represent HM animals and open triangles represent LM animals. High

genetic merit line is represented by the equation: y=4.54 ln (x) + 0.89 with an R2 of

0.89. Lower genetic merit line is represented by the equation: y=4.61 ln (x) + 0.84

with an R2

of 0.83. Prepartum effect of genetic merit (P < 0.05).

29

Milk Production

As expected, cows fed ad libitum generally produced more milk than those fed

a restricted energy diet, though the main effect of diet was not statistically

significant. However, the interaction of merit and diet was quite interesting. When

fed ad libitum higher genetic merit cows did not produce more milk than cows of LM

at 28 and 56 DIM. But when feed restricted, HM cows produced 6 kg/d more in

primiparous cows and 4 kg/d more in 2nd

It may be that the HM animals can better adapt to an energy deficit to

prioritize milk production. The LM animals, however, reacted by eating even less

and producing less milk. Such an adaptation has been noted previously

(McNamara and Hillers, 1986) and will be discussed further when the data on

metabolic flux is presented.

lactation than LM cows (P < 0.03; effect of

genetic merit by diet) (Table 4). Second lactation cow produced more milk than

primiparous cows, as expected (P < 0.0001).

30

Table 4. Milk yield (kg/d) of cows varying genetic merit fed normally or an energy

restricted diet, effect of genetic merit, energy intake, and parity

Treatment Interactions

Item

High Merit

Normal Diet

High Merit

Low Diet

Low Merit

Normal Diet

Low Merit

Low Diet SEM

1st Lactation

Overall 26.7 A 29.7 26.7 23.7 1.2

Days 1-28 23.0 B. 26.6 24.3 20.8 1.1

Days 29-56 31.2 C. 33.3 29.5 27.4 1.4

2nd Lactation

Overall 35.3 A 40.9 43.1 35.0 1.8

Days 1-28 31.0 B. 39.8 38.6 31.9 1.7

Days 29-56 39.5 C. 43.1 47.1 38.3 2.0

A. Effect of parity (P < 0.0001), genetic merit by diet interaction (P < 0.03)

B. Effect of parity (P < 0.0001), genetic merit by diet (P < 0.006)

C.

Effect of parity (P < 0.0001); trend of genetic merit by diet (P = 0.12)

31

Figure 2a. Milk yield (kg/DM) of cows varying genetic merit fed normally or an

energy restricted diet, effect of energy intake1

.

1Diamonds represent NE animals and open triangles represent LE animals.

Normally fed intake line is represented by the equation: y=6.19 ln (x) + 12.07 with

an R2 of 0.96. Lower energy intake line is represented by the equation: y=5.40 ln (x)

+ 13.32 with an R2

of 0.94. Overall effect of genetic merit and diet (P < 0.0001).

32

Figure 2b. Milk yield (kg/DM) of cows varying genetic merit fed normally or an

energy restricted diet, effect of genetic merit1.

1Diamonds represent HM animals and open triangles represent LM animals.

Higher genetic merit line is represented by the equation: y=6.30 ln (x) + 12.30 with

an R2 of 0.95. Lower genetic merit line is represented by the equation: y=5.44 ln (x)

+ 13.09 with an R2

of 0.94. Overall effect of genetic merit and diet (P < 0.0001).

33

Body Weight, Body Condition Score, and Body Fat

When animals are challenged with a reduction in energy intake they must

use stored body reserves, primarily fat, to make up the deficit. In general, dairy

cows will lose a significant amount of body fat in early lactation, but this is highly

dependent on milk yield and energy intake. In this study we are interested in

changes in body fat as we probe mechanisms of dairy efficiency with both genetic

merit and dietary energy differences.

Body condition score (BCS) is an external, subjective estimate of body fat.

The scores were assigned on a scale of 1 to 5 with 1 being emaciated and 5 being

obese. Body fat itself (EBF) was also estimated directly from body weight (BW) and

BCS using the equation -122.1 + 0.21*BW + 36*BCS (Waltner et al., 1994).

Cows in their 2nd lactation tended to be slightly heavier and retained body

weight better than primiparous cows (P < 0.0001; effect of body weight, BCS, and

EBF). The cows, regardless of parity, lost weight from 7 days prepartum to 28 days

postpartum (P < 0.0001; effect of BW, BCS, and EBF). This weight and loss makes

sense because the cows are pulling from their fat depots and energy reserved to

produce normal amounts of milk. From 7 days prepartum to 7, 28, or 56 DIM, HM

cows lost more weight on the LE diet than the other groups (Table 5, P < 0.06), as

expected. Cows across all genetic merit and diet interaction groups decreased in

body weight and EBF until 28 DIM with slight recovery occurring around 56 DIM.

Body condition score followed a similar trend or continued to decrease as seen in

cows on the LE diet (P < 0.02; quadratic effect of DIM); (Table 5). From 28 to 56

34

DIM most animals regained some body fat, however HM animals fed the LE diet did

not (Table 5). These subtle differences are consistent with the feed intake and milk

production.

In brief summary of the production data, HM first parity animals ate a

similar amount of feed and gave slightly more milk when fed ad libitum, but 2nd

parity HM animals actually produced less milk than 2nd

parity LM animals. When

feed restricted, all groups tended to give less milk, but in fact the LM animals of

both parities were much more depressed in milk production than were HM animals.

Changes in BW, BCS and EBF were in general consistent with the differences in

energy intake and milk production.

35

Table 5. Body weight (BW), body condition score (BCS), and empty body fat (EBF) of

cows varying genetic merit fed normally or an energy restricted diet, interaction

effect of diet and genetic merit

DIM

Treatment -21 -7 7 28 56

BWA

High Merit Normal Diet

, kg

666.9 691.2 618.6 600.5 635.4

High Merit Low Diet 694.1 705.8 614.8 585.8 602.8

Low Merit Normal Diet 679.5 668.6 615.2 586.8 606.2

Low Merit Low Diet 676.8 677.5 631.6 582.0 631.5

SEM 11.2 1 12.4 14.8 10.9 12.7

BCS

B

High Merit Normal Diet 3.4 3.4 3.1 3.0 3.2

High Merit Low Diet 3.4 3.5 3.3 3.3 3.0

Low Merit Normal Diet 3.4 3.4 3.3 3.2 3.3

Low Merit Low Diet 3.4 3.5 3.3 3.2 3.2

SEM 0.0 2 0.0 0.1 0.1 0.1

EBF3,C

, kg

High Merit Normal Diet 141.4 145.0 120.3 112.0 127.3

High Merit Low Diet 146.0 152.1 124.0 117.9 112.5

Low Merit Normal Diet 144.0 140.7 125.1 115.7 123.0

Low Merit Low Diet 144.0 144.4 127.6 114.7 126.2

36

(Table 5 Cont’d.)

SEM 2.6 4 3.4 3.8 3.0 3.2

1 Overall SEM of BW is 7.5

3 Calculated according to Waltner et al. (1994)

2 Overall SEM of BCS is 0.5

4 Overall SEM of EBF is 4.2

A Effect of parity (P <0.0001), DIM (P < 0.0001), genetic merit by diet (P < 0.06), and

quadratic effect of DIM (P = 0.0001); trend of parity by gene by diet (P = 0.12), and

genetic merit (P = 0.12)

B Effect of DIM (P < 0.0001), DIM by parity (P < 0.02), and the quadratic effect of

DIM (P < 0.02); trend of parity (P = 0.08) and quadratic effect of DIM by diet (P =

0.09)

C

Effect of parity (P <0.0001), DIM (P < 0.0001), DIM by parity (P < 0.06), and the

quadratic effect of DIM (P < 0.0002)

37

Glucose

Blood Nutrients

Serum glucose concentration can be an important indicator of homeostasis

and energy availability in an animal. Many factors of glucose uptake and use are at

work in early lactation; and blood glucose concentrations are highly regulated.

Often there is little change in blood glucose, even in times of severe glucose deficit.

For this experiment serum glucose was analyzed to study and interpret metabolic

adaptations to genetic merit and energy intake. Serum glucose may also help

predict rates of lipogenesis.

For the most part primiparous cows had increased serum glucose than 2nd

lactation cows on either diet (Table 6). HM cows had decreased serum glucose

compared to LM cows. Cows of HM also had steady blood glucose pre- and

postpartum for both primiparous and 2nd

Overall the serum glucose data suggests that because concentration between

parity, genetic merit, and dietary energy intake are not markedly different the cows

were able to maintain homeostasis of blood glucose concentrations. Likely the flux

of glucose was different as a factor of diet and milk production.

lactation cows. However, cows of LM had

at least 6 mg/dL decrease to increase from pre- to postpartum across both parities

(P < 0.03; effect of both DIM and quadratic effect of DIM); (Table 6).

38

Table 6. Serum glucose (mg/dL) A

of cows varying genetic merit fed normally or an

energy restricted diet, interaction effect of diet and genetic merit across target days

in milk

Treatment Interactions

Item

High Merit

Normal Diet

High Merit

Low Diet

Low Merit

Normal Diet

Low Merit

Low Diet

SEM1

1st Lactation

-21 DIM 56.5 51.6 63.1 56.3 2.2

-7 DIM 52.3 60.3 57.3 60.9 1.5

7 DIM 53.7 57.5 56.3 36.7 3.6

28 DIM 58.3 58.3 50.8 57.7 2.8

56 DIM 40.1 58.1 2 58.7 60.6 3.0

2nd Lactation

-21 DIM 58.9 62.2 59.7 51.6 6.3

-7 DIM 51.6 60.5 61.0 53.8 3.2

7 DIM 49.4 58.4 53.7 42.6 2.5

28 DIM 51.5 43.1 48.4 41.8 4.8

56 DIM 54.9 65.8 54.1 60.7 2.0

1 Overall SEM is 3.6

2 HM NE group had an n=3

A

(P < 0.03); trend of parity (P = 0.1034)

Effect of DIM (P < 0.03), gene by diet (P < 0.02), and quadratic effect of DIM

39

Non-Esterified Fatty Acids

Serum non-esterified fatty acid (NEFA) concentrations can be an important

indicator of homeostasis and energy status of an animal. During the transition

period cows may go into a negative energy balance due to the high demand of

energy being utilized for milk production. Energy balance can be estimated during

part of lactation using serum NEFA concentrations and was calculated using the

equation: equation is EB= -3.14 - 0.009 * NEFA (µM) + (0.341*DIM) - 0.002 * DIM ^

2) (McGuire, 2006) for postpartum measurements only.

The NEFA of all groups generally trended down from 7 days prepartum to 56

DIM. Normally fed cows had higher serum concentrations than LE cows (Table 7).

Cows in their 2nd

Lower genetic merit cows in their 2

lactation on the restricted energy diet had the highest serum

NEFA concentrations in early lactation (7 DIM) as well as the lowest energy

balance, however there was not a statistical effect of diet.

nd

Cows in all groups were in a negative energy balance at 7 DIM and from 28-

56 DIM the cows tended to become more positive (P < 0.02); (Table 8). Statistically

there were no diet effects on serum NEFA concentrations and energy balance.

Serum NEFA concentrations are a good indicator of fat mobilization.

lactation had the largest spike in serum

NEFA concentration at 7 DIM as compared to primiparous cows (P < 0.02; effect of

parity by DIM).

40

Table 7. Serum NEFA (µM) A

concentration of cows varying genetic merit fed

normally or an energy restricted diet, interaction effect of diet and genetic merit

across target days in milk

Days in Milk

Treatment -21 -7 7 28 56

1st

Lactation

High Merit Normal Diet 273.6 123.3 692.2 125.1 383.5

High Merit Low Diet 643.2 295.2 662.1 345.6 177.6

Low Merit Normal Diet 534.2 290.7 385.1 166.2 206.4

Low Merit Low Diet 368.7 286.7 287.8 159.6 558.0

SEM 78.1 46.8 128.1 35.4 107.4

2nd Lactation

High Merit Normal Diet 521.0 103.6 298.8 168.2 111.7

High Merit Low Diet 139.1 150.6 254.1 461.6 146.4

Low Merit Normal Diet 102.3 296.5 895.5 637.6 355.1

Low Merit Low Diet 142.8 228.3 870.1 386.3 161.0

SEM 68.3 1 47.1 205.1 104.5 63.9

1 Overall SEM is 20.3

A

Effect of DIM by parity (P < 0.02), quadratic effect of parity (P < 0.02), and parity

by gene (P < 0.04); trend of quadratic effect of DIM (P < 0.07)

41

Table 8. Estimated energy balance (Mcal/d) A

of cows varying genetic merit fed

normally or an energy restricted diet, effect of diet and genetic merit interaction

across target days in milk

Days in Milk

Treatment 7 28 56

1st

Lactation

High Merit Normal Diet -7.1 3.7 6.2

High Merit Low Diet -6.8 1.7 8.1

Low Merit Normal Diet -4.3 3.3 7.8

Low Merit Low Diet -3.4 3.4 4.7

SEM 1.2 0.3 1.0

2nd Lactation

High Merit Normal Diet -3.5 3.3 8.7

High Merit Low Diet -3.1 0.7 8.4

Low Merit Normal Diet -8.9 -0.9 6.5

Low Merit Low Diet -8.7 1.4 8.2

SEM 1.8 1 0.9 0.6

1 Overall SEM is 2.1

A

Effect of DIM (P < 0.0001), parity by gene (P < 0.04), DIM by parity (P < 0.02),

quadratic effect of DIM (P < 0.02), and the quadratic effect of parity (P < 0.02)

42

Lipogenesis is highly affected by the energy available in an animal to build

fat reserves so the rates of lipogenesis reflect energy availability. Overall, cows

tended to have the fastest rates of lipogenesis at 7 days prepartum and the lowest

at 21 days prepartum (Table 9, Figure 3). It was unusual that there were lower

rates at 21 vs. 7 days prepartum; however, at day 21 many cows were still adapting

to eating from the Calan gates so it is likely that this data is not representative of

cows 3 weeks prepartum. In several studies on the Knott Dairy Herd lipogenesis,

was measured at much faster rates than in this study (McNamara and Hill, 1986;

McNamara and Valdez, 2005).

Adipose Lipogenesis

Primiparous cows had slower rates of lipogenesis prepartum as compared to

2nd lactation cows, but had faster rates of lipogenesis than 2nd lactation cows at 28

and 56 DIM (Table 9). The 2nd

lactation cows produce more milk and thus reduce

rates of lipogenesis more than prepartum cows. Primiparous cows most likely have

faster rates of lipogenesis postpartum because they are making less milk and still

have a higher priority for growth.

43

Table 9. Rates of lipogenesis of cows varying genetic merit fed normally or an

energy restricted diet, overall diets and genetic merit; effect of parity

Concentration of Acetic Acid mM Overall 2

[Acetate] Item 0.5 1 2 3 4 8

1st

Lactation

-21 Prepartum 35.3 87.4 196.8 283.3 377.2 785.7 294.3

-7 Prepartum 130.3 305.5 496.6 716.2 921.2 1398.2 650.0

7 DIM 84.9 184.2 371.1 532.4 582.2 1792.8 603.8

28 DIM 105.7 159.7 361.5 854.8 1315.7 846.8 607.4

SEM 17.7 40.3 70.1 110.0 155.9 252.1 61.3

2nd

Lactation

-21 Prepartum 118.9 281.3 623.3 833.1 1127.1 2138.5 860.0

-7 Prepartum 208.4 443.4 716.6 927.9 1833.4 2046.0 1037.3

7 DIM 86.0 154.7 331.7 553.7 742.3 474.8 390.5

28 DIM 28.0 65.5 156.0 109.0 260.5 821.0 251.9

SEM 34.6 1 71.7 154.2 179.6 319.5 434.3 108.4

1 There was insufficient adipose tissue at 56 DIM in 2nd lactation animals to collect

sample for lipogenesis assay

2

There was no statistical significance of parity for overall concentrations of acetate

44

Cows on the normal diet had faster rates of lipogenesis than cows on the LE

diet, regardless of genetic merit (Table 10, Figure 3). This result was expected, that

cows on the NE diet at 7 and 28 DIM had faster rates of lipogenesis than cows on

the LE diet at 7 and 28 DIM (Figure 4), because cows on the normal diet had more

dietary energy available.

There was no consistent effect of genetic merit on lipogenesis when compared

within dietary groups (Table 10). The data suggest that genetic merit alone is not

a good predictor of rates of lipogenesis; however cows of higher genetic merit on

either diet tended to have slightly faster rates of lipogenesis than cows of lower

genetic merit on either diet (P < 0.04). Diet in general plays a greater role in

determining the rates of lipogenesis, as has been noted several times earlier

(McNamara and Hillers, 1986; McNamara et al., 1993; McNamara and Valdez,

2005).

It was a notable result in Table 10 that at 56 DIM, especially in 2nd

(P < 0.0001; effect of diet and DIM). This is consistent with the more rapid rate of

fat loss in these animals. Second lactation animals had slower rates of lipogenesis,

consistent with their greater priority for milk production over primiparous animals.

lactation

animals, most cows had insufficient adipose tissue to run metabolic flux assays

45

Table 10. Rates of lipogenesis of cows varying genetic merit fed normally or an

energy restricted diet, effect of diet and genetic merit across target days in milk,

regardless of parity

1

Concentration of Acetic Acid (mM) Overall A

[Acetate] Treatments 0.5 1 2 3 4 8

High Merit Normal Diet

-21 Prepartum 43.6 87.8 117.3 190.3 324.6 729.8 255.7

-7 Prepartum 175.2 409.0 428.8 529.8 1599.5 1245.3 746.1

7 DIM 218.2 463.3 874.5 1221.2 1392.1 4774.0 1490.5

28 DIM 66.0 96.0 253.0 455.0 612.5 653.5 347.0

SEM 36.8 90.0 132.9 184.9 325.0 484.0 130.9

High Merit Low Diet

-21 Prepartum 101.8 252.0 661.6 796.4 1162.6 2206.2 863.4

-7 Prepartum 151.3 379.7 900.3 1315.7 1483.3 3013.5 1101.1

7 DIM 46.3 95.0 205.8 323.3 442.3 812.5 320.8

28 DIM 36.0 51.0 168.0 322.0 321.0 688.0 264.3

SEM 31.1 76.5 213.6 259.7 357.0 599.1 136.0

Low Merit Normal Diet

-21 Prepartum 24.8 64.6 119.0 205.4 314.2 476.8 200.8

-7 Prepartum 141.0 335.7 432.5 803.3 775.7 439.2 487.9

7 DIM 67.9 123.5 283.8 519.6 596.8 457.6 333.8

46

(Table 10 Cont’d.)

28 DIM 139.7 172.7 460.0 1152.0 2035.3 1117.7 846.2

SEM 30.6 65.3 99.5 199.0 289.8 80.6 65.5

Low Merit Low Diet

-21 Prepartum 101.1 249.0 432.5 656.9 852.3 1833.4 687.5

-7 Prepartum 191.6 349.0 751.2 777.0 1586.6 3252.4 1151.3

7 DIM 34.2 69.8 140.6 187.0 220.8 480.0 188.7

28 DIM 51.5 164.0 213.5 502.5 381.5 687.5 333.4

SEM 35.4 58.8 141.2 119.0 282.5 557.2 119.6

1 There was insufficient adipose tissue at 56 DIM in some cows for lipogenesis assay

A

Effect of Diet and DIM (P < 0.001), genetic merit (P < 0.04); Quadratic trend of

DIM ( P = 0.07)

47

Figure 3. Rate of lipogenesis in cows of varying genetic merit fed normally or an

energy restricted diet1

1

Solid line with round cap represents 21 days prepartum (y = 511 ln (x) – 113; R² =

0.70); solid line with arrow cap represents 7 days prepartum(y = 846 ln (x) – 62; R²

= 0.83); dashed line with round cap represents 7 days postpartum (y = 632 ln (x) –

122; R² = 0.68); dashed line with arrow cap represents 28 days postpartum (y = 543

ln (x) – 66; R² = 0.79) ; and dotted line with diamond cap represents 56 days

postpartum (y = 656 ln (x) – 139; R² = 0.77). The interaction of acetate

concentration, DIM, and Diet was significant at P < 0.0001.

48

Figure 4. Rate of lipogenesis in cows of varying genetic merit fed normally or an

energy restricted diet, effect of dietary energy intake1

1

Solid line with round cap represents LE, 7 DIM (y = 271 ln (x) – 50); solid line with

arrow cap represents LE, 28 DIM (y = 314 ln (x) – 34); dashed line with round cap

represents HE, 28 DIM (y = 686 ln (x) – 85); and dashed line with arrow cap

represents HE, 7 DIM (y = 857 ln (x) – 156)

49

Lipolysis is the process of breaking down triglycerides into free fatty acids

and glycerol that are used as substrate to produce Acetyl Co A for the Krebs cycle to

produce ATP. For this experiment the rates of lipolysis were measured at basal and

stimulated levels using isoproterenol which is a general beta-2 receptor agonist

(Lefkowitz, 1974; Drake et al., 2008). Isoproterenol was used to observe response of

adipose tissue to beta-adrenergic stimulation, which is known to be a part of control

of lipolysis.

Adipose Lipolysis

Primiparous cows had an overall increase in rates of lipolysis postpartum

while 2nd lactation cows increased at 7 DIM, decreased at 28 DIM and increased

again at 56 DIM (P < 0.03); (Table 11) indicating that 2nd

Regardless of genetic merit, cows on the lower energy diet had about 12-18%

increased rates of lipolysis as compared to normally fed cows, which is consistent

with the 10% reduction in energy intake. The cows on the LE diet were

compensating for a decreased dietary energy intake by increasing their rates of

lioplysis. This oppositely-directed metabolic flux of lipolysis and lipogenesis is

lactation animals did not

need as much energy from adipose tissue release as primiparous cows. Cows at 56

DIM had the fastest rates of lipolysis regardless of dietary treatment or genetic

merit. At 56 DIM the cow is nearing peak lactation and demand for fatty acid

release for energy is higher. The number of lipolysis assays at 56 DIM was fewer,

as few samples were collected at 56 DIM due to the fat depletion from increased

lipolysis.

50

directed by the coordinated regulation of enzymes controlling lipolysis and

lipogenesis (Tepperman and Tepperman, 1970; Bauman and Currie, 1980).

51

Table 11. Rates of lipolysis of cows varying genetic merit fed normally or an energy

restricted diet, effect of parity regardless of diet or genetic merit1

.

Isoproterenol Concentration Avg

Stim A Item Basal 10 -8 10 10-7 10-6 10-5 -4

1st Lactation

-21 DIM 598.4 2728.1 2656.4 2726.4 2481.9 2397.2 2573.8

-7 DIM 1003.8 3352.1 3387.6 3071.1 3035.2 3030.6 3175.3

7 DIM 959.4 2367.5 2875.9 2859.7 2783.9 2427.3 2662.8

28 DIM 1362.8 2958.8 3200.1 3465.4 3473.2 3180.0 3255.5

56 DIM 1938.0 4273.3 4055.0 3711.4 3684.5 3375.3 3897.9

SEM 121.6 163.4 173.1 144.6 153.2 131.6 139.6

2nd Lactation

-21 DIM 973.1 3847.5 3740.2 3838.3 3616.7 3355.9 3679.7

-7 DIM 915.1 2490.1 2630.4 2297.8 2473.9 2206.2 2419.7

7 DIM 1207.3 2571.4 2523.0 2793.1 2817.3 2501.7 2641.3

28 DIM 888.0 2061.5 2197.5 2843.8 2351.3 2368.8 2364.6

56 DIM 1559.0 3698.0 2644.0 3519.0 4001.5 4602.3 4555.2

SEM 115.0 254.2 254.1 254.4 251.7 235.3 245.2

1 The data are the release of glycerol (nM) per 2 hours per gram of tissue.

A

Average Stimulation of Lipolysis: Effect of DIM by Parity (P < 0.03), Quadratic

effect of DIM (P < 0.01), and DIM by parity (P < 0.02)

52

At basal levels the rates of lipolysis in cows of LM trended up postpartum

while cows of HM trended down postpartum, regardless of diet. Overall, the cows of

higher genetic merit did not markedly fluctuate in rates of lipolysis except at 7 DIM

with increased rates of lipolysis and 56 DIM with decreased rates of lipolysis as

compared to LM cows, regardless of diet (P = 0.12; trend of the effect of DIM on

genetic merit during basal lipolysis).

Normally fed cows of higher genetic merit had slower rates of lipolysis at 28

and 56 DIM than cows of either high or low genetic merit on the restricted energy

diet (Table 12). This indicates that the availability of exogenous energy and genetic

merit can help the cow lessen or prevent a negative energy balance by more

efficiently maintaining lipogenesis.

Overall, the data supports the concept previously developed in this lab

(McNamara and Hillers, 1989) that energy intake plays a larger role in determining

the rates of lipolysis and lipogenesis than genetic merit. Genetic merit or actual

milk production rates are more directly related to changes in lipolysis. These

differences are consistent with the separate mechanisms of control of lipogenesis

and lipolysis that have been established previously. Lipogenesis generally responds

to decreased energy intake with a coordinated decrease in enzyme activity and gene

expression for anabolic enzymes. Rates of lipolysis are much more responsive to

immediate needs of the animal (‘flight or fight’, or in this case, milk production) and

are therefore controlled by very rapid post-translational mechanism (activation by

protein phosphorylation). All of the measures above provide a framework for

53

interpretation of the gene expression data to be discussed next.

Table 12. Rates of lipolysis of cows varying genetic merit fed normally or an energy

54

restricted diet, effect of diet and genetic merit across target days in milk, regardless

of parity1

.

Isoproterenol Concentration Avg

Stim B Treatment Basal 10A 10-8 10-7 10-6 10-5 -4

High Merit Normal Diet

-7 Prepartum

2

1179.4 2566.3 2984.8 2686.1 2801.4 2376.3 2683.0

7 DIM 1704.2 2853.7 3968.9 3372.3 3275.3 2553.1 3204.7

28 DIM 1061.0 2191.4 2657.1 3005.3 2961.1 2786.0 2720.2

56 DIM 974.3 4012.5 3534.0 4221.5 2917.0 4509.7 4646.3

SEM 230.7 284.4 343.8 259.1 289.7 290.2 288.3

High Merit Low Diet

-21 Prepartum 740.5 3088.6 2776.6 2992.1 3050.5 2720.4 2925.6

-7 Prepartum 952.6 3071.8 2599.4 2847.0 3572.0 3138.4 3045.7

7 DIM 970.0 2781.8 2798.6 2772.0 2761.2 2885.8 2799.9

28 DIM 1357.7 3942.3 4187.3 3979.0 4438.7 3874.0 4084.3

56 DIM 1874.0 3587.0 3436.0 3352.0 3347.0 3671.5 3278.7

SEM 145.4 257.0 247.4 238.6 249.4 228.5 228.2

55

(Table 12 Cont’d.)

Low Merit Normal Diet

-21 Prepartum 821.1 2736.6 2688.3 2961.5 2730.0 2790.5 2781.4

-7 Prepartum 615.9 3352.9 3340.4 2650.4 2447.1 2655.1 2889.2

7 DIM 766.3 2023.0 1794.4 2701.9 2638.0 2398.0 2311.1

28 DIM 1102.7 2822.7 2335.8 2994.0 2931.5 2668.5 2750.5

56 DIM 2522.0 3784.0 3152.0 3482.7 3815.7 3275.7 3502.0

SEM 150.1 264.5 247.1 226.6 226.4 184.3 210.5

Low Merit Low Diet

-21 Prepartum 530.5 3741.2 3776.8 3646.2 2715.7 2716.5 3319.3

-7 Prepartum 1181.8 2819.8 3078.8 2728.4 2466.4 2592.0 2737.1

7 DIM 959.3 2146.8 2428.8 2238.0 2319.3 1859.8 2198.5

28 DIM 1810.0 2870.8 3703.5 3971.0 3335.8 3305.0 3437.2

56 DIM 2068.0 6485.0 6222.0 6135.0 -----------3 5360.0 6050.5

SEM 202.4 302.1 315.8 354.0 323.5 278.0 300.8

1 The data are the release of glycerol (nM) per 2 hours per gram of tissue

2 21 days prepartum data not available

3 56 DIM data not available for 10-6, LM LE group (n=1)

A

0.12)

Trend of genetic merit (P = 0.06) and quadratic effect of DIM on genetic merit (P =

B

Average Stimulation of Lipolysis: Quadratic effect of DIM (P < 0.01)

56

There are three key proteins that coordinate lipolysis in adipose tissue: beta-

2 adrenergic receptor (β

Expression of genes that control lipolysis in adipose tissue of dairy cattle

2AR); hormone sensitive lipase (HSL); and perilipin (PLIN).

The β2

The expression of the genes of interest were compared to the expression of

ribosomal subunit S2, generally referred to as delta Ct (cycle threshold in the RT-

PCR technique); (ΔCt = Gene of interest Ct – S2 Ct). This “normalization” provides

a comparison of differential control of expression of a gene compared to one that is

usually constitutively expressed. In adipose tissue, especially during the massive

adaptation occurring during transition to lactation, it is difficult to determine with

certainty any gene or set of genes that are constitutively expressed. However,

previous work in this lab with RT-PCR and gene arrays suggested that the

ribosomal S2 unit is relatively constantly expressed. Data discussed below from

this trial may indicate this may not always be the case.

AR responds to epinephrine and norepinephrine binding, initiates the

intracellular cascade resulting in phosphorylation and activation of HSL to break

down TAG to free fatty acids and glycerol. Phosphorylation of PLIN causes

translocation of this protein to the lipid droplet surface, allowing catalytic activity of

HSL. The quantitative role of transcription of these genes in control of adipose

tissue lipolysis in dairy cattle has not been fully defined; thus the transcription of

these three genes was analyzed for this experiment.

Then, the ΔCt measures postpartum were compared to that at 7 d prepartum

to determine the effects of lactation, merit and diet on gene expression. This

57

measure has been referred to as the ‘delta delta Ct (ΔΔCt). Using this number, the

equation (2 raised to the negative power of ΔΔCt) equates to the fold change of

expression relative to the starting point (7 d prepartum). Seven days prepartum

was used because 21 days prepartum was considered an adaptation period and

there would not be representative gene expression at that time to determine the

effects of lactation. In the tables, thus there are 3 measures, the ΔCt of the gene of

interest to ribosomal S2; the ΔΔCt, referred to as ΔCt relative to d 7 prepartum, and

the fold change relative to d 7 prepartum.

β2

The expression of β

AR

2AR is described as ΔCt, which is defined by the difference

of β2AR to S2. The ΔCt of β2AR to S2 was related to 7 days prepartum and was used

to calculate fold change in ΔCt of β2

LE fed cows typically had higher ΔCt of β

AR to S2 related to 7 days prepartum.

2AR to S2 than NE cows prepartum

and at 56 DIM. Cows on the NE diet had a lower ΔCt of β2AR to S2 at 7 d

prepartum, and thus essentially started the experiment with more copies of the

β2

Overall, animals normally fed generally decreased expression of this gene in

early lactation regardless of GM. At 56 DIM, the HM animals had the lowest

relative expression of β

AR mRNA prepartum than cows on the LE diet.

2AR while the LM animals increased expression significantly

(P < 0.03). This result is difficult to explain, as previous work has suggested

expression of this gene is related to milk production. The result in this experiment

could well be due to the much smaller sample size at 56 DIM.

58

The only consistent trend was that dietary restriction clearly resulted in an

increase in relative expression of the β2AR (diet effect, P < 0.05) postpartum,

regardless of genetic merit. Yet examination of all the data shows that the change

in relative expression was due to a decrease in expression of the S2 gene while the

absolute expression of the β2

Biologically, the presence of adequate dietary energy supported adequate

transcription of β

AR remained more constant. This actually can be

explained by the massive drop in all anabolic reactions in adipose tissue

postpartum. The finding of a decrease in expression of a ribosomal gene is a novel

finding, and suggests that control of anabolism is the major driver in adipose tissue

postpartum. Yet, control of transcription of genes regulating lipolysis relative to

anabolic genes is also an affect of dietary energy, while actual rates of lipolysis are

strongly related to milk production. This is consistent with post-translational

control of lipolysis being the major mechanism in response to increased milk

production.

2AR. However, the attenuation of gene copies from 28 to 56 DIM

(Table 13) suggest that the chronic stimulation of the β2AR may have led to

desensitization. Nevertheless, the data also suggest that HM animals may be

better prepared for lactation because of the presence of more β2

AR mRNA

prepartum to buffer or perhaps reduce the metabolic stress many cows endure

during the transition period.

59

Table 13. Beta-2 adrenergic receptor gene expression of cows varying genetic merit

fed normally or an energy restricted diet, effect of diet and genetic merit1

.

Days around Parturition

Treatment -7 7 28 56 SEM2

High Merit Normal Diet A

ΔCt for β2 to S2 1.5 3.1 4.8 7 0.6

ΔCt relative to d -7 1.6 3.3 5.5

Fold Change in

Relative ΔCt to d -7

33% 10% 2%

High Merit Low Diet A

ΔCt for β2 to S2 3.5 3.9 3.6 3.5 0.4

ΔCt relative to d -7 0.4 0.1 0

Fold Change in

Relative ΔCt to d -7

76% 93% 100%

Low Merit Normal Diet A

ΔCt for β2 to S2 3.1 5.2 3.6 3 0.3

ΔCt relative to d -7 2.1 0.5 -0.1

Fold Change in

Relative ΔCt to d -7

23% 71% 107%

Low Merit Low Diet A

ΔCt for β2 to S2 4.7 3.4 4.5 5.8 0.6

60

(Table 13 Cont’d.)

ΔCt relative to d -7 -1.3 -0.2 1.1

Fold Change in

Relative ΔCt to d -7

246% 115% 47%

SEM (ΔCt) 2 0.5 0.5 0.7 0.7

1 A decrease means an increase in mRNA while an increase indicates a decrease in

mRNA. The ΔCt for β2 to S2 is the difference in CT between β2 and S2 (β2Ct –

S2Ct).

2 Overall SEM is 1.4

A Effect of diet (P < 0.05), DIM by gene by diet (P < 0.03); Trend in gene (P = 0.07),

effect of DIM by diet (P = 0.09) on ΔCt for β2

to S2

61

Hormone Sensitive Lipase

Hormone sensitive lipase (HSL) is an enzyme, which catalyzes lipolysis and

was analyzed to determine if there are any differences in the pattern of expression

based on the effects of dietary energy intake and genetic merit. The expression of

HSL is described as ΔCt which is defined by the difference of HSL to S2. The ΔCt of

HSL to S2 was related to 7 days prepartum and was used to calculate fold change in

ΔCt of HSL to S2 related to 7 days prepartum.

The changes in expression of HSL were closely consistent with those of the

B2AR, which was noted previously (Sumner and McNamara, 2007).

There was an overall statistical response of diet (P <0.04) and gene by diet (P

< 0.001) with a trend for an effect of DIM (P = 0.09) and the quadratic effects of both

gene (P = 0.20) and diet (P = 0.12) of ΔCt of HSL to S2. This effect was most notable

in HM cows on either diet.

Energy restricted cows had a much higher expression of HSL (lower ΔCt of

HSL to S2) as compared to normally fed cows from 7 days prepartum to 28 DIM.

This diet effect indicates that the animals on the LE diet are adapting to an energy

deficit by increasing HSL expression. The changes in HSL expression were similar

to those of the Β2AR pattern of expression.

62

Table 14. Hormone sensitive lipase gene expression of cows varying genetic merit

fed normally or an energy restricted diet, effect of diet and genetic merit

1

Days around Parturition

Treatment -7 7 28 56 SEM2

High Gene Normal Diet A

ΔCt for HSL to S2 1.0 3.4 2.7 5.0 0.7

ΔCt relative to d -7 2.4 1.7 4.0

Fold Change in

Relative ΔCt to d -7

19% 31% 6.0%

High Gene Low Diet A

ΔCt for HSL to S2 2.5 2.5 2.1 7.5 0.9

ΔCt relative to d -7 0.0 -0.4 5.0

Fold Change in

Relative ΔCt to d -7

100% 132% 3.0%

Low Gene Normal Diet A

ΔCt for HSL to S2 2.6 6.5 5.6 2.6 0.7

ΔCt relative to d -7 3.9 3.0 0.0

Fold Change in

Relative ΔCt to d -7

7.0% 13% 100%

Low Gene Low Diet A

ΔCt for HSL to S2 0.7 0.8 3.3 3.8 0.6

63

(Table 15 Cont’d.)

ΔCt relative to d -7 0.1 2.6 3.1

Fold Change in

Relative ΔCt to d -7

93% 16% 12%

SEM (ΔCt )2 0.7 0.8 0.6 1.4

1A decrease in ΔCt for HSL to S2 means in an increase in mRNA and an increase in

ΔCt for HSL to S2 indicates a decrease in mRNA. The ΔCt for is the difference in Ct

between HSL and S2 (HSLCt – S2Ct).

2 Overall SEM is 1.9

A

Effect of Diet (P <0.04), gene and diet (P < 0.001); Trend in DIM (P = 0.09),

quadratic effect of diet (P = 0.20) and quadratic effect of gene (P = 0.12) on ΔCt for

HSL to S2

64

Perilipin

Perilipin (PLIN) is a protein associated with the lipolytic pathway, considered

the co-factor of HSL. Phosphorylation of perilipin allows for access of active

(phosphorylated) HSL to the TAG surface for hydrolysis. Expression of PLIN was

analyzed to determine if there are any differences in the pattern of expression based

on the effects of dietary energy intake and genetic merit. The expression of PLIN is

described as ΔCt, which is defined by the difference of PLIN to S2. The ΔCt of PLIN

to S2 was related to 7 days prepartum and was used to calculate fold change in ΔCt

of PLIN to S2 related to 7 days prepartum.

There was an overall statistically significant response of ΔCt of PLIN to S2 to

DIM (P < 0.04) and to the interaction of genetic merit and diet (P <0.03). Normally

fed cows trended up in ΔCt of PLIN to S2 and peaked at 28 DIM (Table 15). The

ΔCt of PLIN to S2 relative to 7 days prepartum of NE cows increased at 28 DIM and

then decreased at 56 DIM. LE fed cows trended up in ΔCt of PLIN to S2 from 7 DIM

to 28 DIM and either increased (HM) or remained constant (LM) depending on

genetic merit. Consequently, the ΔCt of PLIN to S2 relative to 7 days prepartum for

LE fed cows followed a similar trend as of PLIN to S2.

Generally the expression of PLIN decreased postpartum compared to 7 d

prepartum. The expression was generally highest (lowest ΔCt) at 7 DIM compared

to 28 and 56 DIM, Genetic merit differences in expression of PLIN were similar to

HSL but with greater expression of mRNA comparatively, as seen by the lower ΔCt

of PLIN to S2 compared to ΔCt of HSL to S2. Although there was a fair bit of

65

variation in the data among DIM and merit and dietary groups, the only consistent

pattern was that, similar to the B2AR and HSL, animals on the restricted energy

diet increased expression relative to those normally fed (P < 0.03). This indicates a

coordinated change in relative expression of the three key proteins that regulate

lipolysis in cows faced with a dietary energy restriction. The data do not support

here a major effect of increased GM on increasing expression of these proteins.

66

Table 15. Perilipin gene expression of cows varying genetic merit fed normally or

an energy restricted diet, effect of diet and genetic merit1

.

Days around Parturition

Treatment -7 7 28 56 SEM 2

High Gene Normal Diet A

ΔCt for PLIN to S2 0.6 1.1 5.0 2.4 0.7 3

ΔCt relative to d-7 0.5 4.4 1.8

Fold Change in

Relative ΔCt to d-7

71% 5.0% 29%

High Gene Low Diet A

ΔCt for PLIN to S2 2.7 2.4 2.6 4.4 0.6

ΔCt relative to d-7 -0.3 -0.1 1.7

Fold Change in

Relative ΔCt to d-7

123% 107% 31%

Low Gene Normal Diet A

ΔCt for PLIN to S2 -0.4 3.3 6.0 2.5 0.9

ΔCt relative to d-7 3.7 6.4 2.9

Fold Change in

Relative ΔCt to d-7

8.0% 1.0% 13%

Low Gene Low Diet A

ΔCt for PLIN to S2 0.3 0.7 2.1 2.1 0.7

ΔCt relative to d-7 0.4 1.8 1.8

67

(Table 15 Cont’d.)

Fold Change in

Relative ΔCt to d-7

76% 29% 29%

SEM (ΔCt) 0.7 2 0.7 0.9 1.1

1A decrease in ΔCt of PLIN to S2 means in an increase in mRNA and an increase in

ΔCt of PLIN to S2 indicates a decrease in mRNA. ΔCt is the difference in Ct

between PLIN and S2 (PLINCt – S2Ct).

2 Overall SEM is 1.9

3 Data for HM, NE at 56 DIM has an n=2

A

Effect of DIM (P < 0.04) and Gene by Diet (P < 0.03) for ΔCt of PLIN to S2

68

Summary and Conclusions

When interpreting the overall changes in feed intake, milk yield, body

weight, and estimated empty body fat in this study, the production level data were

consistent with the body of knowledge. Second parity animals gave more milk and

ate more feed. Dietary energy restriction decreased milk production and increased

loss of BW and fat and transiently increased NEFA concentrations. Animals of

higher GM apparently could respond to a dietary energy restriction better than

animals of lower merit.

At the metabolic level, changes in lipogenesis and lipolysis were consistent

with the differences in energy intake and milk production. Lipogenesis decreased

dramatically at 7 and 28 DIM and a dietary restriction decreased these rates even

more. Lipolysis increased in relation to milk production in early lactation, and

animals of higher merit had faster rates of stimulated lipolysis in early lactation.

However the effects of merit were not as striking as has previously been determined

in this herd (McNamara and Hillers, 1989; Sumner and McNamara, 2007). That

can be due to a number of factors including normal animal variation in feed intake

and milk production.

Genetic merit and diet did appear to play a role in mRNA expression for

genes controlling lipolysis. The major effect was actually due to diet, which was

somewhat unexpected. However, the primary effect was one of a decrease in the

‘stable’ gene expression of ribosomal S2 and maintenance of expression of β2AR,

HSL, and PLIN. This is consistent with the known effects of dietary energy

69

restriction on control of anabolic pathways.

For future experiments it would be prudent to more deeply explore how

nutrigenomics effect gene expression to attempt to determine selection criteria of

higher genetic merit cows. Genetic merit has been selected for and improved in

herds for many years, but it will be interesting to see if on both the genomic and

metabolic level the cow will be able to be improved upon.

Overall it is apparent that genetic merit and the interaction between merit

and diet can play a role in the efficiency and productivity of a cow. The pattern of

feed intake, milk production, blood nutrients, metabolic rates and expression of key

lipolytic genes differs in cows of varying genetic merit, either challenged with a mild

energy deficit or not. We can use these data to improve our systems biology models

to more effectively research the mechanisms of metabolic control in dairy cattle.

Eventually, producers can utilize these findings to help improve selection criteria to

produce more efficient, higher producing cows.

70

AOAC. 2000. AOAC. Official Methods of Analysis. Vol. 1 and 2. Gaithersburg, MD: AOAC International 2000.

References

Banting, F.G. 1937. Early work on insulin. Science. 85(2217):594-596. Bauman, D.E. and W.B. Currie. 1980. Partitioning of nutrients during pregnancy

and lactation: a review of mechanisms involving homeostasis and homeorhesis. J. Dairy Sci. 63:1514-1529.

Bauman, D.E. and J.M. Elliot. 1983. Control of nutrient partitioning in lactating

ruminants. In Biology of Lactation, T.B. Mepham, ed. Pp. 437-486. Bauman, D.E. and R.G. Vernon. 1993. Effects of exogenous bovine somatotropin on

lactation. Ann Rev Nutr. 13:437-461. Bernabucci, U, B. Ronchi, N. Lacetera, A. Nardone. 2005. Influence of body

condition score on relationships between status and oxidative stress in periparturient cows. J. Dairy Sci. 88:2017-2026.

Burns, T.W., P.E. Langley, B.E. Terry, D.B. Bylund, B.B. Hoffman, M.D. Tharp,

R.J. Lefkowitz, J.A. Garcia-Saínz, and J.N. Fain. 1981. Pharmacological characterizations of adrenergic receptors in human adipocytes. J Clin Invest. 67(2):467-75.

Cao, H.C., A. Bidwell, S.K. Williams, W. Liang, and S.E. Mills. 1998. Nucleotide

Sequence of the porcine ß1-adrenergic receptor gene. J Anim Sci 76:1720-1721.

Carpene, C., J. Galitzky, P. Collon, F. Esclapez, M. Dauzats. and M. Lafontan. 1992.

Desensitization of Beta-1 and Beta-2, but not Beta-3, adrenoreceptor-mediated lipolytic responses of adipocytes after long-term norepinephrine infusion. J. Pharmacol. & Exp. Therapeutics. 265(1):237-247.

Case, L.P. 1999. The Dog: Its Behavior, Nutrition, and Health. 1st Ed. Iowa State

71

University Press: Ames, IA. Pp. 318-320. Castiella, L., P. Muzzin, J.P. Revelli, D. Ricquier, and J.P. Giacobino. 1994.

Expression of ß1 and ß2 adrenergic receptor messages and adenylate cyclase ß-adrenergic response in bovine perrenal adipose tissue during its transformation from brown to white fat. Biochem J 297:93-97.

Chruscinski, A.J., D.K. Rohrer, E. Schauble, K.H. Desai, D. Bernstein, and B.K.

Kobilka. 1999. Targeted disruption of the ß2-adrenergic receptor gene. J Biol Chem 274:16694-16700.

Doris R.A., G.E. Thompson, E. Finley, E. Kilgour, M.D. Houslay, and R.G. Vernon.

1996. Chronic effects of somatotropin treatment on response of subcutaneous adipose tissue lipolysis to acutely acting factors in vivo and in vitro. J Anim Sci 74(3):562-8.

Drackley, JK. 1999. ADSA Foundation Scholar Award. Biology of dairy cows during

the transition period: the final frontier? J Dairy Sci. Nov; 82(11):2259-73. Drake, M.T., J.D. Violin, E.J. Whalen, J.W. Wisler, S.K. Shenoy, and R.J. Lefkowitz.

2008. β-Arrestin biased agonism at the β2

-adrenergic receptor. J. Bio. Chem. 283(9):5669-5676.

Etherton, T.D., D.E. Bauman, J.R. Romans. 1977. Lipolysis in subcutaneous and perirenal adipose tissue from sheep and dairy steers. J. An. Sci. 44(6):1100-1106.

Forrest, R.H. and J.G.H. Hickford. 2000. Rapid Communication: nucleotide

sequences of bovine, caprine, and ovine ß3-adrenergic receptor genes. J Anim Sci 78:1397-1398.

Galitsky, J., D. Langin, P. Verwaerde, J.L. Montastruc, M. Lafontan, and M.

Berlan. 1997. Lipolytic effects of conventional ß3-adrenoreceptor agonist and of CGP12,177 in rat and human fat cells: Preliminary pharmacological evidence for a putative ß4-adrenoreceptor. Br J Parmacology 122:1244-1250.

72

Gorman, R.R., H.M. Tepperman, and J. Tepperman. 1972. Effects of starvation, refeeding, and fat feeding on adipocyte ghost adenyl cyclase activity. J Lipid Res 13(2):276-280.

Gorman, R.R., H.M. Tepperman, and J. Tepperman. 1973. Epinephrine binding and

the selective restoration of adenylate cyclase activity in fat-fed rats. 14(3):279-285.

Grujic, D., V.S. Susulic, M. Harper, J. Himms-Jagen, B.A. Cunningham, B.E.

Corkey, and B.B. Lowell. 1997. ß3-adrenergic receptors on white and brown adipocytes mediate ß3-selective agonist-induced effects on energy expenditure, insulin secretion, and food intake. J Biol Chem 272:17686-17693.

Guidicelli, H., N. Combes-Pastre, J. Boyer. 1974. Lipolytic activity of adipose tissue.

IV. The diacylglycerol lipase activity of human adipose tissue. Biochim Biophys Acta 369:25-33.

Guo, J., R.R. Peters, and R.A. Kohn. 2008. Evaluation of a Mechanistic Model of

Glucose and Lipid Metabolism in Periparturient Cows. J Dairy Sci 91:4293-4300.

Guo, J., R.R. Peters, and R.A. Kohn. 2007. Effect of a Transition Diet on Production

Performance and Metabolism in Periparturient Dairy Cows. J. Dairy Sci 90:5247-5258.

Hanigan, MD, L.A. Crompton, B.J. Bequette, J.A. Mills, and J. France. 2002.

Modelling mammary metabolism in the dairy cow to predict milk constituent yield, with emphasis on amino acid metabolism and milk protein production: model evaluation. J Theor Biol 217(3):311-330.

Hausberger, F.X. and S. W. Milstein. 1954. Dietary Effects on Lipogenesis in

Adipose Tissue. J of Biol Chem 483-488. Holm, C., T.G. Kirchgessner, K.L. Svenson, G. Fredrikson, S. Nilsson, C.G. Miller,

J.E. Shively, C. Heinzmann, R.S. Sparkes, T. Mohandas, A.J. Lusis, P.

73

Belfrage, M.C. Shotz. 1988. Hormone-Sensitive Lipase: Sequence, Expression, and Chromosomal Localization to 19 cent-q13.3. Science 241 (4872):1503-1506.

Hubbard, R. and W. Matthew. 1971. Growth and Lipolysis of Rat Adipose Tissue:

effect of age, body weight, and food intake. J Lipid Res 12:286-293. Kaumann, A.J., F. Preitner, D. Sarsero, P. Molenaar, J.P Revelli, and J.P

Giacobino. 1998. (-)-CGP12177 causes cardiostimulation and binds to cardiac putative ß4-adrenoreceptors in both wild-type and ß2-adrenoreceptor knockout mice. Molecular Pharmacology 53:670-675.

Kern, P.A., G. Di Gregorio, T. Lu, N. Rassouli, and G. Ranganathan. 2004. Perilipin

expression in human adipose tissue is elevated with obesity. 89(3):1352-1358. Kraemer, F.B., W.J. Shen. 2002. Hormone-sensitive lipase: control of intracellular

tri-(di-)acylglycerol and cholesteryl ester hydrolysis. J Lipid Res 43(10):1585-1594.

Lefkowitz, R.J. 1974. Selectivity in beta-adrenergic responses: clinical implications.

Circulation 49:783-786. Liang, W. and S.E. Mills. 2002. Quantitative analysis of beta-adrenergic receptor

subtypes in pig tissues. J Anim Sci. 80:963-970. McGuire, M. 2006. Personal Communication. McNamara, J.P. 1994. Lipid metabolism in adipose tissue during lactation: a model

of a metabolic control system. J. of Nutrition. Conference: Regulating Lipid Metabolism 1383S-1391S.

McNamara, J.P. 1989. Regulation of bovine adipose tissue metabolism during

lactation. 5. Relationships of lipid synthesis and lipolysis with energy intake and utilization. J. Dairy Sci 72:407-418.

McNamara, J.P. and J.K. Hillers. 1986. Regulation of Bovine Adipose Tissue

74

Metabolism During Lactation. 1. Lipid Synthesis in Response to Increased Milk production and Decreased Energy Intake. J Dairy Sci 69 (12):3032-3041.

McNamara, J.P. and J.K. Hillers. 1986. Regulation of Bovine Adipose Tissue

Metabolism During Lactation. 2. Lipid Response to Milk Production and Energy Intake. J Dairy Sci 69 (12):3042-3050.

McNamara, J.P. and F. Valdez. 2005. Adipose tissue metabolism and production

responses to calcium propionate and chromium propionate. J. Dairy Sci 88:2498-2507.

McNeel, R.L. and H.J. Mersmann. 1999. Distribution and quantification of ß1, ß2,

and ß3-adrenergic receptor subtype transcripts in porcine tissues. J Anim Sci 77:611-621.

Menendez, J.A., A Vazquez-Martin, F.J. Ortega, and J.M. Fernandez-Real. 2009.

Fatty Acid Synthase: Association with Insulin Resistance, Type 2 Diabetes, and Cancer. Clinical Chemistry 55:425-438.

Mersmann, H.J. 1996. Evidence of classic ß3-adrenergic receptors in porcine

adipocytes. J Anim Sci 75:3161-3168. Mersmann, H.J., G.B. Carey, and E. O’Brian Smith. 1997. Adipose tissue α-

adrenergic and α1 adenosine receptors in suckling pigs. J Anim Sci 74:984-992.

“Metritis: A Foul Disease with Financial Costs.” Hoards Dairyman. 25 April 2010:

290-291. Print Metz, S.H.M., and S.G. van den Bergh. 1971. Regulation of fat mobilization in

adipose tissue of dairy cows in the period around parturition. Neth J Agric Sci 25:198-211.

Mulligan, F.J., and M.L. Doherty. 2008. Production diseases of the transition cow.

The Veterinary Journal 176:3-9.

75

Munday, H.S. and K.E. Earle. 1991. Energy Requirements of the Queen During Lactation and Kittens from Birth to 12 Weeks. J Nutr 121:543-544.

Mutch, D.M., W. Wahli, and G. Williamson. 2005. Nutrigenomics and nutrigenetics:

the emerging faces of nutrition. FASEB Review. 19:1602-1616. National Research Council. 2001. Nutrient Requirements of Dairy Cattle. 7th

revised ed. Natl. Acad. Sci., Washington, DC.

Peterson, A.D. and B.R. Baumgardt. 1971. Influence of Level of Energy Demand on

the Ability of Rats to Compensate for Diet Dilution. J Nutr 101:1069-1074. Pietri-Rouzel, F.G. Lenzen, A. Kappor, M.F. Drumare, P. Archimbault, A.D.

Strosber, and B.S.J. Manning. 1995. Molecular cloning and pharmacological characterization of the bovine ß3-adrenergic receptor. Eur J Biochem 230:350-358.

Portillo, M.P., A.S. Del Barrio, M.A. García-Calonge, and J.A. Martínez. 1995.

Desensitization effect of in vivo treatment with metaproterenol on β1, β2, and β3

-adrenergic responsiveness in rat adipocytes. Life Sciences. 58(5):405-414.

Rajagopal, S., K. Rajagopal, and R. Lefkowitz. 2010. Teaching old receptors new tricks: biasing seven-transmembrane receptors. Nature Reviews. 9:373-386.

Roche, J.F. 2006. The effect of nutritional management of the dairy cow on

reproductive efficiency. Animal Repro. Science 96:282-296. Rohre, D.K., K.H. Desai, J.R. Jasper, M.E. Stevens, D.P. Regula Jr., G.S. Barsh, D.

Bernstein, and B.K. Kobilka. 1996. Targeted disruption of the mouse ß1-adrenergic receptor gene: developmental and cardiovascular effects. Pharmacology 99:7375-7380.

Salway, J.G. 2004. Metabolism at a Glance. 3rd

Malden, MA. edition. Blackwell Publishing

SAS Institute. 2005. SAS 9.2. SAS Users Guide. Cary, NC.

76

Schactschneider C. et al. 2009. Genetics of Feed Conversion Efficiency. Poster. Shen, W.J., K. Sridhar, D.A. Bernlohr, and F.B. Kraemer. 1999. Interaction of rat

hormone-sensitive lipase with adipocyte lipid-binding protein. Proc Natl Acad Sci 96:5528-5532.

Sillence, M.N. and M.L. Matthews. 1994. Classical and atypical binding sites for β-

adrenoceptor ligands and activation of adenylyl cylcase in bovine skeletal muscle and adipose tissue membranes. Br. J. Pharmacol. 111:866-872.

Smith, S.B. and J.D. Crouse. 1984. Relative contribution of acetate, lactate, and

glucose to lipogenesis in bovine intramuscular and subcutaneous adipose tissue. J. Nutr. 114(4):792-800.

Stiles, G.L., M.G. Caron, and R.J. Lefkowitz. 1984. β-adrenergic receptors:

biochemical mechanisms of physiological regulation. Phys. Rev. 64(2):661-743.

Sumner, J. and J.P McNamara. 2007. Expression of the Lipolytic Genes in the

Adipose Tissue of Pregnant and Lactating Holstein Dairy Cattle. J Dairy Sci 90 (11):5236-46.

Tepperman, J. and H.M. Tepperman. 1970. Gluconeogenesis, lipogenesis, and the

Sherringtonian metaphor. Fed. Proc. 29(3):1284-1293. Tyler, H.D., and M.E. Ensminger. 2006. Dairy Cattle Science. 4th

Education Columbus, OH. edition. Pearson

Vernon, R.G. and C.M. Pond. 1997. Adaptations of Maternal Adipose Tissue to

Lactation. J Mammary Gland Biol Neoplasia 2(3):231-241. Verstegen, M.W.A, J. Mesu, G.J.M. van Keempen, and C. Geerse. 1985. Energy

Balances of Lactating Sows in relation to Feeding Level and Stage of Lactation. J Nutr 60:731-740.

77

Vicario, P.P., M.R. Candelore, M.T. Schaeffer, L. Kelly, G.M. Thompson, E.J. Brady,

R. Saperstein, D.E. MacIntyre, L.M. Tota, and M.A. Cascieri. 1997. Desensitization of β3

-adrenergic receptor-stimulated adenylyl cyclase activity and lipolysis in rats. Life Sciences. 62(7):627-638.

Wakil, S.J., and L.A. Abu-Elheiga. 2008. Fatty acid metabolism: target for metabolic syndrome. J. Lipid Research 50:S138-S143.

Waltner, S.S., J.P. McNamara, and J.K. Hillers. 1994. Validation of indirect

measures of body fat in lactating cows. J. Dairy Sci. 77:2570-2579. Waltner, S.S., J.P. McNamara, and J.K. Hillers. 1993. Relationships of body

condition score to production variables in high producing Holstein dairy cattle. J. Dairy Sci. 76:3410-3419.

Willoughby, D., G.S. Baillie, M.J. Lynch, A. Ciruela, M.D. Houslay, and D.M.F.

Cooper. 2007. Dynamic Regulation, Desensitization, and Cross-talk in discrete subcellular microdomains during β2

-adrenoreceptor and prostanoid receptor cAMP signaling. J. Bio. Chem. 282(47):34235-34249.

Yang, Y. and R.L. Baldwin. 1973. Lipolysis in isolated cow adipose cells. J Dairy Sci 56:366-374.

Yeaman, S.J. 1990. Hormone-sensitive lipase-a multipurpose enzyme in lipid

metabolism. Biochem Biophys Acta 1052:128-132.