ada-07 suppresses solar ultraviolet induced skin carcinogenesis by directly inhibiting ... · small...

Small Molecule Therapeutics

ADA-07 Suppresses Solar Ultraviolet–InducedSkin Carcinogenesis by Directly Inhibiting TOPKGe Gao1,2, Tianshun Zhang1, Qiushi Wang1, Kanamata Reddy1, Hanyong Chen1,Ke Yao1, Keke Wang1,3, Eunmiri Roh1, Tatyana Zykova1,Weiya Ma1, Joohyun Ryu1,Clara Curiel-Lewandrowski4, David Alberts4, Sally E. Dickinson4, Ann M. Bode1,Ying Xing2, and Zigang Dong1,3

Abstract

Cumulative exposure to solar ultraviolet (SUV) irradiation isregarded as the major etiologic factor in the development of skincancer. The activation of the MAPK cascades occurs rapidly and isvital in the regulation of SUV-induced cellular responses. TheT-LAK cell–originated protein kinase (TOPK), an upstream acti-vator of MAPKs, is heavily involved in inflammation, DNAdamage, and tumor development. However, the chemopreven-tive and therapeutic effects of specific TOPK inhibitors in SUV-induced skin cancer have not yet been elucidated. In the currentstudy, ADA-07, a novel TOPK inhibitor, was synthesized andcharacterized. Pull-down assay results, ATP competition, and

in vitro kinase assay data revealed that ADA-07 interacted withTOPK at the ATP-binding pocket and inhibited its kinaseactivity. Western blot analysis showed that ADA-07 suppressedSUV-induced phosphorylation of ERK1/2, p38, and JNKs andsubsequently inhibited AP-1 activity. Importantly, topical treat-ment with ADA-07 dramatically attenuated tumor incidence,multiplicity, and volume in SKH-1 hairless mice exposed tochronic SUV. Our findings suggest that ADA-07 is a promisingchemopreventive or potential therapeutic agent against SUV-induced skin carcinogenesis that acts by specifically targetingTOPK. Mol Cancer Ther; 16(9); 1843–54. �2017 AACR.

IntroductionSkin cancer is one of the most frequently diagnosed malignan-

cies in the United States, and its incidence has been increasing atan astonishing rate over the past few decades, exceeding thenumber of all other human cancers combined (1). Nonmela-noma skin cancer (NMSC) includes basal cell carcinomas (BCC)and squamous cell carcinomas (SCC) and is the most commontype of skin cancer with substantial associated morbidity andmortality (2). BCCs comprise approximately 80% of skin cancers,with SCC as the secondmost common skin cancer. SCCs aremoreaggressive and have a higher potential for metastasis comparedwith BCCs (3). Solar ultraviolet (SUV) irradiation is well docu-mented as a prominent environmental carcinogen responsible forvarious physiologic and biological effects, including immuno-suppression, cellular aging, andDNAdamage (4, 5). Furthermore,strong epidemiologic and molecular evidence indicates that

cumulative exposure to SUV irradiation is the major etiologicfactor in the development of NMSC (6–8). The SUV spectrum canbe divided into three subtypes according to wavelength andinclude UVA (320–400 nm), UVB (280–320 nm), and UVC(200–280 nm; ref. 9). Previous studies indicated that althoughUVC is filtered out by stratospheric ozone, UVA andUVB each hasstrong carcinogenic effects on the skin, which can lead to DNAdamage, erythema, sunburn, immunosuppression, and eventu-ally, skin cancer (5, 10, 11). Therefore, targeting SUV-inducedsignaling could be an effective strategy for developing agentsfor effective chemoprevention and chemotherapy against skincarcinogenesis.

Activation of intracellular signaling pathways in response toSUV irradiation plays a crucial role in SUV-induced skin cancer.The MAPKs are serine/threonine protein kinases that are strong-ly activated by SUV irradiation, and are essential in the regu-lation of fundamental cellular processes, such as proliferation,differentiation, and apoptosis (12). The MAPK cascades com-prise the ERKs, p38 MAPKs, and c-Jun NH2-terminal kinases(JNK). The activation of these pathways occurs rapidly and isvital in the regulation of SUV-induced cellular responses thatcan lead to skin carcinogenesis (12). T-LAK cell–originatedprotein kinase (TOPK) is a member of the MEK3/6–relatedMAPKK family and is highly expressed in many cancers (13).TOPK is an upstream activator of ERKs, p38 MAPKs, and JNKsand has been identified as an oncogenic protein that is involvedin various cellular functions, such as DNA damage, neoplastictransformation, and inflammation (14–16). Moreover, anaccumulation of data provides evidence that the inhibition ofTOPK might be useful in cancer chemoprevention and treat-ment (17, 18). However, very few effective TOPK inhibitorshave been discovered. Here, we report that a novel compound,

1The Hormel Institute, University of Minnesota, Austin, Minnesota. 2School ofBasic Medical Sciences, Zhengzhou University, Zhengzhou, Henan, P.R. China.3China-US (Henan) Hormel Cancer Institute, Zhengzhou, Henan, P.R. China. 4TheUniversity of Arizona Cancer Center, Tucson, Arizona.

Note: Supplementary data for this article are available at Molecular CancerTherapeutics Online (http://mct.aacrjournals.org/).

G. Gao and T. Zhang contributed equally to this article.

Corresponding Authors: Zigang Dong, University of Minnesota, 801 16thAvenue NE, Austin, MN 55912-3679. Phone: 507-437-9600; Fax: 507-437-9606; E-mail: [email protected]; and Ying Xing, Zhengzhou University, No.100 Kexue Road, Henan 450001, P.R. China. E-mail: [email protected]

doi: 10.1158/1535-7163.MCT-17-0212

�2017 American Association for Cancer Research.

MolecularCancerTherapeutics

www.aacrjournals.org 1843

on August 4, 2021. © 2017 American Association for Cancer Research. mct.aacrjournals.org Downloaded from

Published OnlineFirst June 27, 2017; DOI: 10.1158/1535-7163.MCT-17-0212

http://crossmark.crossref.org/dialog/?doi=10.1158/1535-7163.MCT-17-0212&domain=pdf&date_stamp=2017-8-14

http://mct.aacrjournals.org/

ADA-07 (5-((1s, 3s)-adamantan-1-yl)-3-(hydroxyimino) indolin-2-one), is a potent TOPK inhibitor that effectively suppressesSUV-induced activation ofMAPK signal transduction, resulting inreduced SUV-induced skin carcinogenesis. These results suggestthat ADA-07 might have beneficial effects in the preventionand treatment of SUV-induced skin carcinogenesis by directlytargeting TOPK.

Materials and MethodsChemicals and reagents

ADA-07 was synthesized in-house, and MS analysis was per-formed (Supplementary Fig. S1A and S1B). Cell culture mediawere all obtained from Invitrogen. FBS was from Gemini Bio-Products. Tris, NaCl, and SDS for molecular biology and bufferpreparationwere purchased fromSigma-Aldrich. The active TOPKand MEK1 human recombinant proteins for the kinase assayswere from SignalChem and Millipore, respectively. The antibo-dies against phosphorylated TOPK (Thr9), ERK1/2 (Thr202/204),p38, JNKs, c-Jun and total TOPK, ERK1/2, p38, JNKs, p-c-Jun, andPCNA were from Cell Signaling Technology. Antibodies to detectb-actin were purchased from Santa Cruz Biotechnology. TheCellTiter 96 Aqueous One Solution Cell Proliferation Assay Kitand the luciferase assay substrate were purchased from Promega.CNBr-activated Sepharose 4B beads were purchased from GEHealthcare Bio-Sciences.

Cell cultureThe human skin keratinocytes (HaCaT cells, obtained in 2011),

normal humandermalfibroblasts (NHDF, obtained in 2009), JB6Pþ mouse epidermal cells (obtained in 1999), human epider-moid carcinomaA431 cells (obtained in 2000), and theHEK293Tcell line (obtained in 2013) were purchased from ATCC. Thehuman SCC SCC12 cell line (obtained in 2008) was purchasedfrom Thermo Fisher Scientific. All the cell lines were cytogeneti-cally tested and authenticated before freezing. Each vial wasthawed and maintained for a maximum of 10 passages. JB6 Pþmouse epidermal skin cells were cultured in Eagle MinimumEssential Medium (MEM) with 5% FBS and 1% antibiotics. TheHaCaT, NHDF, HEK293T, and A431 cells were cultured inDMEM containing 10% FBS and 1% antibiotics. The SCC12cell line was cultured in DMEM/Ham's F-12 50/50 Mix(DMEM: F-12K 50/50) medium supplemented with 10% FBSand 1% antibiotics. All cell culture conditions were performedfollowing ATCC's instructions.

MTS assayCells (1 � 104 cells/well) were seeded into 96-well plates for

determining cytotoxicity. After an overnight incubation, cellsweretreatedwith different concentrations of ADA-07 and incubated for24 or 48 hours. Then, 20 mL of the CellTiter 96 Aqueous OneSolution (Promega Corporation) was added to each well, andcells were incubated for an additional 1 hour at 37�C. Absorbancewas measured at an optical density of 492 and 690 nm using theThermo Multiskan plate-reader (Thermo Fisher Scientific).

Anchorage-independent cell growth assayCells (8 � 103/well) were seeded into 6-well plates with 0.3%

BasalMediumEagleagar containing10%FBSwithEGF (10ng/mL)and different concentrations of ADA-07 and then cultured for 1 to2 weeks. Colonies were scored under a microscope using the

Image-Pro PLUS (v6.) computer software program (MediaCybernetics).

Crystal violet staining assayCell proliferation was determined by a crystal violet staining

assay. Cells (3 � 104/well) were seeded into 24-well plates. Afteran overnight incubation, cells were treated with different con-centrations of ADA-07 and incubated for several days. Then, eachwell was washed 3 times with PBS and stained with 0.2% (w/v)crystal violet in 2% (v/v) ethanol. After 10 minutes, cells werewashed 3 times with distilled water, and the remaining dye wasdissolved in 0.5% (w/v) SDS in 50% (v/v) ethanol. Absorbancewas measured at an optical density of 540 nm using the ThermoMultiskan plate-reader (Thermo Fisher Scientific).

SUV irradiation systemThe SUV irradiation system (UVA-340 lamps) was purchased

fromQ-Lab Corporation and used to stimulate cells in this study.The UVA-340 lamps provide the best possible simulation ofsunlight in the critical short wavelength region from 365 nmdown to the solar cutoff of 295 nm with a peak emission of 340nm(19).Using this system, cellswere exposedonce at a dose of 60kJ UVA/m2 and 2.9 kJ UVB/m2.

Western blot analysisHaCaT or JB6 Pþ cells (1� 106) were cultured in 10-cm dishes

for 24 hours, and then, the medium was replaced with 0.1% FBSmedium for 24 hours. Cells were then treated with differentconcentrations of ADA-07 for 4 hours, followed by exposure toSUV (60 kJ UVA/m2 and 2.9 kJ UVB/m2). After SUV, cells wereincubated for 15 minutes at 37�C in a 5% CO2 humidifiedincubator. SCC12 and A431 cells (1.5 � 106) were cultured in10-cm dishes overnight and then starved for 24 hours. Cells werethen treated with different concentrations of ADA-07 for anadditional 24 hours. Protein concentration in cell lysates wasdetermined using a Protein Assay Kit (Bio-Rad Laboratories).Equal amounts of proteins were resolved by SDS-PAGE and thentransferred onto polyvinylidene difluoride membranes (EMDMillipore Corp.), and membranes were blocked with 5% nonfatmilk for 1 hour at room temperature. Blots were probed withappropriate primary antibodies (1:1,000) overnight at 4�C, fol-lowed by incubation with a horseradish peroxidase–conjugatedsecondary antibody (1:5,000) for hybridization. Protein bandswere visualized with a chemiluminescent reagent (GE HealthcareBiosciences).

Lentiviral InfectionLentivirus plasmids shTOPK (#1, TRCN0000001807; 50-CCG-

GGAATATGGCAAGAGGGTTAAACTCGAGTTTAACCCTCTTGCCA-TATTCTTTTT -30, #2 TRCN0000001806; 50-CCGGCACCAAGCAA-ATTATCAGAAACTCGAGTTTCTGATAATTTGCTTGGTGTTTTT-30)were purchased from GE Healthcare Dharmacon (Open Biosys-tems). pLKO.1-puro Non-Target shRNA Control Plasmid DNA waspurchased from Sigma-Aldrich Co. LLC. To generate knockdownTOPK cells, the lentiviral expression vector of TOPK or shRNAcontrol plasmid DNA was transfected into HEK293T cells togetherwith pMD2.0G and psPAX, which were purchased from ThermoFisher Scientific. Cells were transfected using iMFectin poly DNAtransfection reagent (GenDEPOT) according to the manufacturer'sinstructions. Viral supernatant fractions were collected at 48 hours

Gao et al.

Mol Cancer Ther; 16(9) September 2017 Molecular Cancer Therapeutics1844




after transfection and filtered through a 0.45-mm syringe filterfollowed by infection into the appropriate cells together with10 mg/mL polybrene (Millipore). At 16 hours after infection, themediumwas replacedwith fresh complete growthmediumcontain-ing the appropriate concentration of puromycin. At 3 to 4 days afterinfection, the selected cells were used for experiments.

Luciferase reporter assayConfluentmonolayers of JB6Pþ cells stably transfectedwith an

AP-1 luciferase reporter plasmid were trypsinized and viable cells(4� 104) suspended in 1mL of 5% FBS-MEMwere added to eachwell of a 24-well plate. After a 24-hour incubation at 37�C in a 5%CO2 humidified incubator, cells were starved in 0.1% serummedium for another 24 hours and then treated with differentconcentrations of ADA-07 for 1 hour. Cells were then exposed toSUV (60 kJ UVA/m2 and 2.9 kJ UVB/m2) and harvested after a3-hour incubation. Finally, the cells were disrupted with 100 mLof lysis buffer [0.1mol/L potassium phosphate pH 7.8, 1% TritonX-100, 1mmol/L dithiothreitol (DTT), and 2mmol/L EDTA], andluciferase activity was measured using a luminometer (Luminos-kan Ascent, Thermo Electro).

Stable control or TOPK knockdown cells were cotransfectedwith 100 ng of the AP-1 luciferase reporter plasmid and 50 ng ofinternal control b-galactosidase plasmid. Cells were transfectedusing iMFectin poly DNA transfection reagent (GenDEPOT)according to the manufacturer's instructions. After 12 hours oftransfection, cells were incubated with different concentrations ofADA-07 for another 24 hours. Luciferase and b-galactosidaseactivities were measured using the Luminoskan Ascent and Mul-tiskanMCC (Labsystems), respectively. The luciferase activity wasnormalized to b-galactosidase activity.

Pull-down assaysADA-07 (2.5mg) was coupled to CNBr-activated Sepharose 4B

(GE Healthcare Biosciences) matrix-beads (0.5 g) in 0.5 mol/LNaCl and 40%DMSO (pH 8.3) overnight at 4�C, according to themanufacturer's instructions. Active TOPK, MEK, or HaCaT celllysates (500 mg) were mixed with ADA-07–conjugated Sepharose4Bbeads orwith Sepharose 4Bbeads alone as a control in reactionbuffer [50mmol/L Tris-HCl pH 7.5, 5mmol/L EDTA, 150mmol/LNaCl, 1mmol/LDTT, 0.01%NP-40, 2mg/mLBSA, 0.02mmol/Lphenylmethylsulfonylfluoride (PMSF), and1�protease inhibitorcocktail]. After gentle rocking at 4�C overnight, the beads werewashed 5 timeswith buffer (50mmol/L Tris-HCl pH7.5, 5mmol/L EDTA, 150 mmol/L NaCl, 1 mmol/L DTT, 0.01% NP-40, and0.02mmol/L PMSF). Binding was examined byWestern blotting.For the ATP competition assay, active TOPK (200 ng) was incu-bated with different concentrations of ATP (0, 10, or 100 mmol/L)in reaction buffer at 4�C overnight. ADA-07–conjugated Sephar-ose 4B beads or Sepharose 4B beads alone were added andincubated at 4�C overnight, followed by 5 washes with buffer.Then, binding was examined by Western blotting.

In vitro kinase assayThe in vitro kinase assay was conducted according to the

instructions provided by Millipore. Briefly, reactions were per-formed in the presence of 10 mCi [g�32P] ATP with active TOPK(200 ng) or MEK1 (200 ng), ADA-07 (0.5, 1, 3, or 5 mmol/L)or HI-032 (10 mmol/L, in-house synthesis) or PD098059(10 mmol/L, Sigma) in 40 mL of reaction buffer (40 mmol/LMOPS/NaOH pH 7.0, 1 mmol/L EDTA, 10 mmol/L MnCl2, and

0.8 mol/L ammonium sulphate) at 30�C for 30 minutes. HI-032orPD098059, awell-knownTOPKorMEK1 inhibitor, wasused asa positive control. Reactions were stopped by adding 10 mLprotein loading buffer, and the mixture was separated by SDS-PAGE. The relative amounts of incorporated radioactivity wereassessed by autoradiography.

Molecular modelingThe computer modeling of ADA-07 with TOPK was per-

formed using the Schr€odinger Suite 2015 software programs(20). The TOPK crystal structures were prepared under thestandard procedure of the Protein Preparation Wizard inSchr€odinger Suite 2015. Hydrogen atoms were added consis-tent with a pH of 7, and all water molecules were removed.The ATP binding site-based receptor grid was generated fordocking. ADA-07 was prepared using the LigPrep program(Schr€odinger), and the lowest energy conformations for dock-ing were determined by using default parameters under theextra precision (XP) mode and the program Glide. The protein–ligand docking analysis was conducted using the induced fitdocking program of Schr€odinger, which can provide the ligand-binding flexibility with binding pocket residues.

Mouse skin tumorigenesis studyFemale SKH-1 hairlessmice were purchased fromCharles River

Laboratories andwere acclimated for 2weeks before the study andhad free access to food and water. All animals were maintainedaccording to the guidelines approved by the University of Min-nesota Institutional Animal Care and Use Committee. The ani-mals were housed in climate-controlled quarters with a 12-hourlight/dark cycle. The skin carcinogenesis experiments were con-ductedusing 6- to 8-week-oldmicewith ameanbodyweight of 25g. Skin carcinogenesis was induced by a solar simulated ultravioletirradiation system. The SUV irradiation source (Q-Lab Corpora-tion) emitted at wavelengths of 295 to 365 nm and the peakemission was 340 nm.

The two mouse models included an early-stage preventionmodel and a late-stage prevention model. These models weredesigned for detecting either the respective chemopreventiveeffect or the potential therapeutic value of ADA-07 againstSUV-induced skin damage and carcinogenesis. For the early-stageprevention study, SKH-1 mice were divided into 7 groups, andan oil-in-water emulsion cream was applied topically as thevehicle with or without ADA-07. The three control groupsincluded (i) mice (n ¼ 3) not treated with vehicle or SUV; (ii)mice (n ¼ 3) treated with vehicle but no SUV; and (iii) mice(n ¼ 3) treated with 1 mg ADA-07 in vehicle but not exposed toSUV. Experimental groups included (i) mice (n ¼ 12) treatedwith SUV only; (ii) mice (n ¼ 12) treated with vehicle followedby SUV 1 hour later; and (iii) mice (n ¼ 12 each group) treatedwith topical application of 0.1 or 1 mg of ADA-07 in vehicle1 hour before SUV irradiation. The topical applications andSUV treatment were applied 3 times a week for a total of 15weeks. At 15 weeks, SUV irradiation was discontinued andtopical applications continued with tumor growth monitoringfor an additional 13 weeks until week 28, at which time, micewere euthanized and tissues harvested.

For the late-stage prevention model, the control and experi-mental groups were identical to those for the early preventionmodel. However, the experimental groups of mice were exposedto SUV irradiation 3 times a week for 15 weeks without

ADA-07 Suppresses SUV-Induced Skin Carcinogenesis

www.aacrjournals.org Mol Cancer Ther; 16(9) September 2017 1845




application of vehicle or ADA-07 in vehicle. At the end of 15weeks, SUV exposure was stopped and application of vehicle withor without ADA-07 was begun and continued for 13 weeks untilweek 28, at which time, the study was discontinued and miceeuthanized and tissues harvested.

For both studies, the SUV irradiation was progressivelyincreased by 10% each week. At week 1, mice were irradiatedwith SUV at a dose of 36 kJ/m2UVAand1.8 kJ/m2UVB. Atweek 6,the dose of SUV reached 60 kJ/m2 UVA and 2.9 kJ/m2 UVB, andthis dose was maintained from week 6 to week 15. The respectivedoses of vehicle or ADA-07 were applied topically to the dorsalarea. Mice were weighed and tumors were measured once a weekuntil week 28 or when tumor load reached 1 cm3 total volume. Atthat time, mice were euthanized, and one half of each sample wasimmediately fixed in 10% formalin and processed for hematox-ylin and eosin (H&E) staining and IHC. The other one half of thesample was frozen and used for Western blot analysis.

IHC stainingSkin tissues were embedded in paraffin and subjected to

IHC. Tissues were deparaffinized and hydrated and then per-meabilized with 0.5% Triton X-100/1� PBS for 10 minutes.Tissues were hybridized with PCNA (1:4,000) as the primaryantibody and biotinylated with anti-mouse IgG as the second-ary antibody. Slides were stained using the VECTASTAIN EliteABC Kit (Vector Laboratories, Inc.) to detect protein targetsaccording to the manufacturer's instructions. After developingwith 3, 30-diaminobenzidine, the sections were counterstainedwith hematoxylin.

Statistical analysisAll quantitative data are expressed as mean values � SD of

at least three independent experiments. Significant differenceswere determined by a Student t test or one-way ANOVA. Aprobability value ofP<0.05was used as the criterion for statisticalsignificance.

ResultsADA-07 inhibits proliferation of NMSC cells

Because of the steady increase in skin cancer incidence, che-moprevention is a practical approach to the control of SUV-induced skin cancer that has received much public attention(21). An accumulation of evidence has indicated that TOPKmightbe an attractive target for chemopreventive and therapeuticagents, and it might contribute to p38 activation and JNK phos-phorylation during the SUV-induced DNA damage response(22, 23). Thus, identifying a novel compound that can preventSUV-induced skin cancer by directly targeting TOPK is important.ADA-07 was synthesized as a potential TOPK inhibitor (Fig. 1A).To determine whether ADA-07 exerted any cytotoxic effectsagainst normal skin cells, JB6 Pþmouse epidermal skin cells andNHDF were treated with different concentrations of ADA-07 for24 or 48 hours. The results showed that ADA-07 had no cytotox-icity at concentrations less than 10 mmol/L (Supplementary Fig.S1C and S1D). We examined TOPK expression in JB6, NHDF,A431, and SCC12 cells (Supplementary Fig. S2). The resultsshowed that TOPK is expressed at higher levels in skin carcinomacells (A431andSCC12) comparedwithnormal skin cell lines (JB6and NHDF). This suggests that ADA-07 might specifically targetskin carcinoma cells based on the higher expression of TOPK.

To confirm whether ADA-07 absorbs at UVA or UVB wave-lengths, we examined its ability to absorb SUV light between 250and 320 nm. The result indicated that ADA-07 mainly absorbslight in the wavelength range of 250 to 275 nm, and the peakabsorption of ADA-07 is 259 nm, which indicated that ADA-07did not show significant absorbance of UVA or UVB (Supple-mentary Fig. S3). In addition, an anchorage-independent growthassay was performed to assess the effect of ADA-07 on celltransformation. Data indicated that EGF-induced colony forma-tion of JB6 Pþ cells was attenuated after treatment with differentconcentrations of ADA-07 (Fig. 1B). Similarly, cell proliferationwas determined by a crystal violet staining assay. Results showedthat ADA-07 strongly decreased SCC12 and A431 cell prolifera-tion in a dose-dependent manner (Fig. 1C and D). Overall, theseresults indicated that ADA-07 exhibited strong antitumor efficacyagainst NMSC cell growth and deserves further investigation.

ADA-07 directly suppresses TOPK kinase activityTo better understand the function of ADA-07 in skin carcino-

genesis, homology modeling and subsequent molecular dockingwere conducted to determine whether ADA-07 binds to TOPK.The binding model indicated that ADA-07 formed interactionswithin the ATP-binding pocket of TOPK, and two potentialhydrogen bonds were formed with the hinge residues Gly118and Gly119 of TOPK and ADA-07 (Fig. 2A; Supplementary Fig.S4). In addition, an ATP competition assay showed that thebinding ability of ADA-07 with TOPK was altered in the presenceof ATP (Fig. 2B). Furthermore, an in vitro binding assay wasperformed using ADA-07–conjugated beads and HaCaT celllysates. Results showed that both TOPK and MEK1/2 weredetected in the ADA-07–conjugated beads group but not in thebeads only group (Fig. 2C and D). Next, we conducted an in vitroTOPK or MEK1 kinase activity assay with increasing concentra-tions of ADA-07. The results indicated that ADA-07 effectivelyinhibited TOPK kinase activity but not MEK1 activity (Fig. 2E andF).Overall, the data suggested that ADA-07directly binds to TOPKand suppresses TOPK kinase activity.

ADA-07 attenuates SUV-induced TOPK downstream signalingMAPK signaling cascades are well-known targets in SUV expo-

sure and are involved in the regulation of SUV-induced cellularresponses (12, 16, 24). Particularly, the activation of the ERKpathway is relevant to UVA, whereas activation of JNKs and p38MAPKs is directly triggered byUVBorUVC irradiation (25, 26). Inaddition, evidence indicated that hyperactivation of TOPK resultsin uncontrolled cell proliferation inmany human cancers, includ-ing skin cancer (13, 16, 27). Therefore, we examined the effect ofADA-07 on the SUV-induced TOPK signaling pathway in HaCaTand JB6 Pþ cells. At the same time, we also examined the TOPKsignaling pathway in SCC12 and A431 skin cancer cells aftertreatment with ADA-07. Results showed that the level of phos-phorylation of ERK1/2, p38, and JNKs in HaCaT and JB6 Pþcells exposed to SUV (60 kJ UVA/m2 and 2.9 kJ UVB/m2)was markedly suppressed after treatment with different concen-trations of ADA-07 (Fig. 3A). Similarly, the level of phosphory-lation of ERK1/2, p38, and JNKs was blocked by ADA-07 inSCC12 and A431 cells dose dependently (Fig. 3B). Although nosignificant changeswere observed in the phosphorylated and totalTOPK protein levels, our results showed that ADA-07 directlybinds to TOPK and suppresses TOPK kinase activity and thenblocks the phosphorylation of ERK1/2, p38, and JNKs, which are

Gao et al.





downstream of TOPK. Previous reports revealed that AP-1 couldbe activated by SUV irradiation through the MAPK cascades (28,29), and TOPK was involved in the UVB-induced JNK1–c-Jun–dependent signaling pathway leading to AP-1 activation (22).Therefore, we examined the protein levels of phosphorylation and

total c-Jun by Western blot analysis. The results indicated that thephosphorylated c-Jun protein levels in HaCaT and JB6 Pþ cellsexposed to SUVwere significantly suppressed after treatment withdifferent concentrations of ADA-07 (Fig. 3C). Similarly, theprotein levels of phosphorylated c-Jun were blocked dose

ADA-07 (mmol/L)

Untreated

A

B

C

D

0 1.25 2.5 5

N

N

H

OH

O

10

EGF (10 ng/mL)EGF (-)

JB6

SCC12120100

0 0.625 1.25 2.5 5 10ADA-07 (mmol/L)

ADA-07 (mmol/L)

EGF (10 ng/mL)

1052.51.25

0

2040

60

80

100120

--

- + + + + +

Cel

l via

bilit

y(%

of c

ontr

ol)

Num

ber o

f col

onie

s(1

00%

of c

ontr

ol)

80604020

0

120100

0 0.625 1.25 2.5 5 10ADA-07 (mmol/L)

0 0.625 1.25 2.5 5 10ADA-07 (mmol/L)

0 0.625 1.25 2.5 5 10ADA-07 (mmol/L)

A431

Cel

l via

bilit

y(%

of c

ontr

ol)

80604020

0

Figure 1.

ADA-07 inhibits proliferation of NMSC cell lines. A, Chemical structure of ADA-07. B, ADA-07 blocks EGF-induced neoplastic transformation of JB6 Pþ cells.Cells were exposed to EGF (10 ng/mL) and treated with increasing concentrations of ADA-07. Representative photographs are shown, and data are presented asmean values � SD from triplicate experiments. ADA-07 suppresses cell proliferation of SCC12 (C) or A431 (D) cell lines. Cells were treated with differentconcentrations of ADA-07 for several days, and cell proliferation was determined by a crystal violet staining assay. The graph shows data from multipleexperiments expressed as mean values � SD. The asterisk (�) indicates a significant (� , P < 0.05; �� , P < 0.001; ��, P < 0.0001) decrease in cell proliferationwith ADA-07 treatment.






dependently by ADA-07 in SCC12 and A431 cells (Fig. 3D). Toexamine the effect of ADA-07 on SUV-induced transactivation ofAP-1, we exposed JB6 Pþ cells stably transfected with an AP-1luciferase reporter plasmid to ADA-07 and SUV. The data showedthat ADA-07 inhibited SUV-induced transactivation of AP-1 (Fig.3E) dose dependently. Moreover, we also measured AP-1 activityusing a combination of ADA-07 and knockdown of TOPK. Thedata indicated that AP-1 activity was suppressed after knockdownof TOPK in A431 cell line. More specifically, in the control group,

the AP-1 activity was inhibited by ADA-07 in a dose-dependentmanner. However, in the TOPK knockdown group, the AP-1activity was only slightly affected by ADA-07 at the highest con-centration (5 mmol/L), which confirmed that ADA-07 suppressesAP-1 activity by directly targeting TOPK (Fig. 3F). These resultsprovideevidence showing thatADA-07 treatment suppresses SUV-induced TOPK downstream signaling and AP-1 activity in NMSCcells. On the basis of these results, we hypothesized that ADA-07might decrease SUV-induced carcinogenesis in vivo.

TOPK, Active

A B

D

E

F

C

DMSO-Sepharose 4B

ADA-07-Sepharose 4B

DMSO-Sepharose 4B

ADA-07-Sepharose 4B

MEK1/2

Cell lysate

DMSO-Sepharose 4B

ADA-07-Sepharose 4B

TOPK

TOPK, Active (200 ng)

MEK1, Active (200 ng)

pET28-ERK2 (His) (2 mg)

pET28-Erk2 (His) (2 mg)

ADA-07 (mmol/L)

ADA-07 (mmol/L)

HI-032 [TOPK inhibitor (mmol/L)]

PD098059 [MEK1 inhibitor (mmol/L)]

0.5 3 5 101

5

0.5 3 5

10

1

32p-ERK2

Coomassie staining-ERK2

32p-ERK2

Coomassie staining-ERK2

Cell lysate

ATP (mmol/L) 10 100

Figure 2.

TOPK is a specific target of ADA-07. A, Computational docking model of ADA-07 with TOPK. B, ADA-07 binds with TOPK in an ATP-competitive manner.Active TOPK (200 ng) was incubated with different concentrations of ATP (0, 10, or 100 mmol/L) and then mixed with ADA-07–conjugated Sepharose 4B beadsor Sepharose 4B beads. Proteins were pulled down and analyzed by Western blot analysis. Data are representative of three independent experiments thatgave similar results. ADA-07 binds to either TOPK (C) or MEK1/2 (D) ex vivo. Lysates from HaCaT cells (500 mg) were incubated with ADA-07–conjugatedSepharose 4B beads or Sepharose 4B beads alone, and the pulled-down proteins were analyzed by Western blot analysis. Data are representative of threeindependent experiments that gave similar results. ADA-07 inhibits TOPK kinase (E) activity but not MEK1 kinase (F) activity in vitro. Active TOPK (200 ng) wasmixed with ADA-07 (0, 0.5, 1, 3, or 5 mmol/L) or HI-032 (TOPK inhibitor, 10 mmol/L) and then incubated with a [g-32P] ATP mixture. Similarly, MEK1 (200 ng)was mixed with ADA-07 (0, 0.5, 1, 3, 5, or 10 mmol/L) or PD098059 (MEK1 inhibitor, 5 mmol/L) and then incubated with a [g-32P] ATP mixture. E and F, Theresults are visualized by autoradiography, and Coomassie blue staining serves as a loading control. Data are representative of three independent experimentsthat gave similar results.

Gao et al.





p-TOPK

HaCaTA BJB6 SCC12 A431

TOPK

p-ERK1/2

ERK1/2

p-p38

p38

p-JNKs

JNKs

b-Actin

p-TOPK

TOPK

p-ERK1/2

ERK1/2

p-p38

p38

p-JNKs

JNKs

b-Actin

0SUV

ADA-07 (mmol/L) ADA-07 (mmol/L)

SCC12 A431

ADA-07 (mmol/L)

ADA-07 (mmol/L)

HaCaT

p-c-Jun (Ser 63)

c-Jun

b-Actin

p-c-Jun (Ser 63)

c-Jun

b-Actin

SUV

ADA-07 (mmol/L)SUV

1.21.00.80.60.40.2

AP-

1 Lu

cife

rase

act

ivity

0

JB6

1.25 2.5 5 0 1.25 2.5 5

0 1.25 2.5 5 0 1.25 2.5 5

ADA-07 (mmol/L)

shControl shTOPK#1

A431

TOPK

b-Actin

shCon

trol

shTO

PK#1sh

-TOPK#2

ADA-07 (mmol/L)

0 1.25 2.5 5 0 1.25 2.5 5

0 1.25 2.5 5

0 1.25 2.5 5 ADA-07 (mmol/L)

1.5

1.0

0.5

AP-

1 Lu

cife

rase

act

ivity

0

0 1.25 2.5 5 0 1.25 2.5 5

0 1.25 2.5 5

C

E

D

F

Figure 3.

ADA-07 attenuates SUV-induced TOPK downstream signaling.A,ADA-07 inhibits SUV-induced phosphorylation of ERK1/2, p38, and JNKs in HaCaT and JB6 Pþ cell lines.The cells were cultured, treated for 4 hours with different concentrations of ADA-07, and then exposed to SUV (60 kJ UVA/m2 and 2.9 kJ UVB/m2), followed by anadditional 15-minute incubation. Cellswereharvested, and the levels ofphosphorylatedand total proteinsweredeterminedbyWesternblot analysiswith specific antibodiesas indicated.B,ADA-07 inhibits phosphorylation of ERK1/2, p38, and JNKs in SCC12 and A431 cell lines. The cells were cultured and treatedwith different concentrations ofADA-07 for 24 hours. Cells were harvested and the levels of phosphorylated and total proteins were determined by Western blot analysis with specific antibodiesas indicated. C, ADA-07 suppresses the phosphorylation c-Jun protein levels in HaCaT and JB6 Pþ cells exposed to SUV (60 kJ UVA/m2 and 2.9 kJ UVB/m2). D, ADA-07attenuates phosphorylation c-Jun protein levels in SCC12 and A431 cells dose dependently. E, ADA-07 inhibits SUV-induced AP-1 activity. For the luciferase assay,JB6Pþ cells stably transfectedwith anAP-1 luciferase reporter plasmidwere cultured. After starvation for 24hours, cellswere treated for 1 hourwithADA-07 (0, 1.25, 2.5, or5 mmol/L). Cells were then exposed to SUV (60 kJ UVA/m2 and 2.9 kJ UVB/m2) and harvested 3 hours later. Luciferase activity was measured, and AP-1 activity isexpressed relative to control cells without SUV treatment. F, ADA-07 represses AP-1 activation in A431 cells, and knockdown of TOPK also suppresses AP-1 activation.Knockdown of TOPK in A431 cell line (left). Stable control or TOPK knockdown cells were cotransfected with 100 ng of the AP-1 luciferase reporter plasmid and 50 ng ofinternal control b-galactosidase plasmid. Cells were transfected using iMFectin poly DNA transfection reagent (GenDEPOT) according to the manufacturer's instructions.After 12 hours of transfection, cells were incubated with the different concentrations of ADA-07 for another 24 hours. Luciferase and b-galactosidase activities weremeasured using reagents included in the reporter assay system (right). Data are shown as mean values � SD obtained from triplicate experiments. Significantdifferences were evaluated using one-way ANOVA, and the asterisks (�) indicate a significant effect (� , P < 0.05; ��, P < 0.001; �� , P < 0.0001).






ADA-07 suppresses SUV-induced skin carcinogenesis in SKH-1hairless mice

SUV irradiation, comprising both UVA and UVB, more closelyresembles the natural environment and exerts a variety of effectson cells and tissues. To study the chemopreventive effect andpotential therapeutic value of ADA-07 in vivo, we used twodifferent SUV-induced mouse skin tumorigenesis models. Spe-cifically, we set up animal studies that included an early-stagepreventionmodel (Fig. 4; Supplementary Fig. S5) and a late-stageprevention model (Fig. 5; Supplementary Fig. S6). Topical appli-cation of ADA-07 on mouse dorsal skin had no effect on bodyweight (Supplementary Figs. S5A and S6A) but resulted in a totalinhibition of SUV-induced papilloma formation in the early-stageprevention group (Fig. 4A–C; Supplementary Fig. S5B), and asubstantial suppression of SUV-induced tumor incidence in thelate-stage prevention group (Fig. 5A; Supplementary Fig. S6B).Compared with the vehicle-treated group, although some papil-lomas were observed in the late-stage prevention study at 28weeks after SUV exposure, results indicated that topical treatmentwith 0.1 or 1mg ADA-07 significantly reduced tumor volume andmultiplicity (Fig. 5B and C). Skin cancer development is wellknown to be a multistep process, and SCCs frequently progressfrom actinic keratosis, a sun-induced keratinocyte intraepithelialneoplasia (KIN or in situ cSCC; ref. 30). Thus, to evaluate thehistopathologic differences between each group, skin and tumorsamples were processed for H&E staining at the end of the study(28 weeks). In the early-stage prevention study, results revealedthat chronic SUV irradiation induced malignant SCCs in SUV-treated and vehicle and SUV-treated groups, respectively. How-ever, treatment with 0.1 or 1 mg ADA-07 decreased SUV-inducedepidermal thickness, which represents typical changes in skinhistologic inflammation (Fig. 4D, left). Similarly, both actinickeratoses and SCCs were induced by SUV exposure in the late-stage preventionmodel. Notably, ADA-07 dramatically decreasedepidermal thickness and inhibited the formation of SCCs (Fig.5D, left). In addition, immunohistochemical data showed thatPCNA, which is a well-known marker for evaluating cell prolif-eration, was significantly increased in the SUV- or vehicle andSUV-treated groups. In contrast, the expression of PCNA wasdecreased in the ADA-07–treated groups, comparedwith the SUV-or vehicle and SUV-treated groups in both prevention models(Figs. 4D and 5D, right). Moreover, Western blot analysis ofmouse skin showed that phosphorylation of ERK1/2, p38, andJNKs induced by SUV was dramatically suppressed in the ADA-07–treated groups (Figs. 4E and 5E). Overall, these results clearlyindicated that ADA-07 exerts a strong preventive effect and alsohas potential therapeutic value against SUV-induced mouse skincarcinogenesis through its inhibition of TOPK activation.

DiscussionSUV irradiation represents the most important environmental

risk factor that is involved in the development of skin cancer (31,32). Studies demonstrated that accumulated SUV irradiationexposure leads to an increased risk of both BCC and SCC, andnearly 90% of NMSCs are estimated to be caused by chronicexposure to SUV (33, 34). Particularly, an early sign of SUV-induced skin cancer is the development of actinic keratoses, whichhave been identified as precursors to SCC. Epidemiologic evi-dence demonstrated that approximately 0.025% to 16%of actinickeratoses progress to invasive SCCswithin 1 year,whereas approx-

imately 26% of actinic keratoses spontaneously regress within1 year (30, 35). Thus, SCC is preventable and often curable ifdetected early. An accumulation of evidence indicated that spe-cific proteins are involved in SUV-induced skin carcinogenesis.Specifically, approximately 88% of human skin cancers containp53 mutations (36), and activating RAS mutations have beenfound inUV-inducedmouse skin cancers (37). The importance ofEGFR, RSK2, ERKs, andCOX-2 inUV-induced skin carcinogenesishas also been reported in the past few years (38–41). Interestingly,TOPK, a newly identified oncogene, has been studied in a widerange of human cancers (13, 15). Although previous studiesindicated that TOPK is highly expressed inmelanoma and clinicalsamples of solar dermatitis (16, 42), only one potentialTOPK inhibitor against SUV-induced skin inflammation has beendiscovered. In the current study, we identified a novel TOPKinhibitor referred to as ADA-07 (Fig. 1A) and showed its potentialchemopreventive or therapeutic effects against SUV-induced skincarcinogenesis.

As indicated earlier, MAPK signaling pathways are activatedduring UV-induced carcinogenesis. Disturbance of the MAPKcascades by UV occurs rapidly and can lead to cellular malfunc-tion, altered gene expression, or loss of cell-cycle control, whichfurther contributes to the formation of cancer cells (4). The p38and JNKs proteins, which are subgroups of the MAPK family, arehighly expressed in solar dermatitis (42), andbothplay significantroles in SUV-induced inflammation and apoptosis (43–47).ERK1/2 are well-characterized MAP kinases. They are activatedin keratinocytes following SUV irradiation and are involved inregulating cell proliferation, differentiation, apoptosis, andtumorigenesis (48–50). TOPK is an upstream kinase of p38 andJNKs and can phosphorylate ERK1/2 (13). Abnormal levels ofTOPK can signal downstream, triggering the activation of theERK1/2, p38, or JNKs pathways. In the current study, we dem-onstrated that ERK signaling, as well as p38 MAPK and JNKsignaling, was strongly enhanced by SUV irradiation (Fig. 3A).However, our findings indicated that ADA-07 not only dramat-ically suppressed SUV-induced activation of ERK1/2, p38, or JNKsin HaCaT and JB6 Pþ cells, but also decreased MAPK signaling inskin cancer cells (Fig. 3A and B). Evidently, the activator protein-1(AP-1) transcription factor is crucial for skin cancer development(51), and the activity of AP-1 is increased by SUV exposurethrough the activation of the MAPK signaling pathways (12).Moreover, TOPK was involved in the UVB-induced JNK1–c-Jun–dependent signalingpathway leading toAP-1 activation (22).Ourdata clearly showed that SUV-induced transactivation of AP-1wasinhibited by ADA-07 dose dependently (Fig. 3E). Similarly, theAP-1 activity was significantly suppressed by ADA-07 in a dose-dependent manner in A431 cells, whereas after knockdown ofTOPK only showed a slight decrease of AP-1 activity at the highestconcentration of ADA-07 (Fig. 3F). More directly, results of an invitro kinase assay showed that ADA-07 effectively inhibited TOPKkinase activity, but notMEK1 activity (Fig. 2E and F). Collectively,our findings further suggested that the chemopreventive or ther-apeutic effects of ADA-07 against SUV-induced skin carcinogen-esis might be due to the specific inhibition of TOPK.

Evidence indicated that only three TOPK inhibitors, HI-TOPK-032, OTS514, and cefradine have been discovered (17, 18, 42).However, the chemopreventive or therapeutic effects of thesecompounds against SUV-induced skin carcinogenesis have notyet been studied. Importantly, our in vivo results showed thatADA-07 was an effective chemopreventive agent and a potential

Gao et al.





No vehicl

e/no SUV

No vehicl

e/SUV

Vehicl

e/no SUV

Vehicl

e/SUV

1 mg ADA-07

/no SUV

No v

ehic

le/n

o SU

V

No v

ehic

le/S

UV

Vehi

cle/

no S

UV

Vehi

cle/

SUV

1 m

g AD

A-07

/no

SUV

1 m

g AD

A-07

/SUV

0.1

mg

ADA-

07/S

UV

0.1 m

g ADA-07/SUV

1 mg ADA-07

/SUV

No vehicle/no SUV

160

100

200

300

Tum

or v

olum

e(m

m3 )

400

A

B C

D

E

No vehicle + no SUVVehicle + no SUV

Vehicle

0.1 1.0

+++

+++

-

- -

+0

2

4

6

8

No.

of t

umor

spe

r mou

se

10

Vehicle + SUVNo vehicle + SUV

0.1 mg ADA-07 + SUV1 mg ADA-07 + SUV

1 mg ADA-07 + no SUV

18 20 22 24 26 28Weeks

No vehicle/SUVp-ERK1/2

ERK1/2

p-p38

p38

p-JNKs

JNKs

b-Actin

Vehicle/SUV

Vehicle/no SUV

1 mg ADA-07/no SUV

0.1 mg ADA-07/SUV

1 mg ADA-07/SUV

H&E30

20

Sum

IOD

(¥10

5 )

10

0

PCNA

No vehicle/no SUV

No vehicle/SUVVehicle/SUV

Vehicle/no SUV1 mg ADA-07/no SUV

0.1 mg ADA-07/SUV1 mg ADA-07/SUV

SUV

ADA-07 (mg)

Figure 4.

ADA-07 suppresses SUV-induced skin carcinogenesis in an SKH-1 hairless mouse early-stage prevention model. SKH-1 hairless mice were treated as described in Materialsand Methods. The respective doses of vehicle with or without ADA-07 were applied topically to the dorsal area 1 hour before SUV exposure. Mice were exposed toSUV 3 times a week for 15 weeks, and tumor incidence and multiplicity were recorded weekly until the end of the experiment at week 28. A, External appearance oftumors. B,ADA-07 suppresses SUV-induced tumor volume. Tumor volume was calculated according to the following formula: tumor volume (mm3)¼ length� width�height�0.52.C,ADA-07suppresses theaveragenumberofSUV-inducedtumorsatweek28.BandC,Dataare representedasmeanvalues�SD,andsignificantdifferencesweredeterminedbyone-wayANOVA.Theasterisk (�) indicatesasignificantdecreasecomparedwith theSUVonlyor thevehicleandSUV-treatedgroups (�� ,P<0.001).D,ADA-07 inhibitsSUV-inducedskincarcinogenesis inmouseskinepidermal tissue.Dorsal trunkskinsampleswereharvestedandstainedwithH&E(left)orwithanantibody todetect PCNA (right). Representative staining shows the pathologic changes in the epidermis from each of the groups (scale bar, 100 mm). Expression of PCNA wasquantified using Image-Pro Plus software and stained cells were counted from five separate areas on each slide (bottom). An average of three samples was calculated pergroup. Data are expressed as mean percent of control � SD, and the asterisks indicate a significant difference in PCNA expression (�� , P < 0.001). E, ADA-07 inhibitsSUV-induced phosphorylation of ERK1/2, p38, and JNKs inmouse skin. The expression levels of phosphorylated and total proteinswere analyzed byWestern blot analysis.






No vehicl

e/no SUV

Vehicl

e/no SUV

Vehicl

e/SUV

1 mg ADA-07

/no SUV

0.1 m

g ADA-07/SUV

1 mg ADA-07

/SUV

No vehicle + no SUVVehicle/no SUV

Vehicle/SUV0.1 mg ADA-07/SUV1 mg ADA-07/SUV

1 mg ADA-07/no SUV

160

100

150

200

A

B C

Tum

or v

olum

e(m

m3 )

18 20 22 24 26 28Weeks

No vehicle/no SUV

Vehicle/SUV

Vehicle/no SUV

1 mg ADA-07/no SUV

0.1 mg ADA-07/SUV

1 mg ADA-07/SUV

H&E PCNA

30

20

Sum

IOD

(¥10

5 )

10

0

No vehicle/no SUV

Vehicle/SUV

Vehicle/no SUV1 mg ADA-07/no SUV

0.1 mg ADA-07/SUV1 mg ADA-07/SUV

No v

ehic

le/n

o SU

VVe

hicl

e/no

SUV

Vehi

cle/

SUV

1 m

g AD

A-07

/no

SUV

1 m

g AD

A-07

/SUV

0.1

mg

ADA-

07/S

UV

p-ERK1/2

ERK1/2

p-p38

p38

p-JNKs

JNKs

b-Actin

Vehicle

0.1 1.0

+++

+++

-

0

2

4

6

8

No.

of t

umor

spe

r mou

se

10

12

SUVADA-07 (mg)D

E

Figure 5.

ADA-07suppressesSUV-inducedskincarcinogenesis inanSKH-1hairlessmouse late-stagepreventionmodel. SKH-1hairlessmicewere treatedasdescribed inMaterials andMethods. Mice were exposed to SUV for 15 weeks, and then, treatment with vehicle with or without ADA-07 was applied topically to the dorsal area for an additional13 weeks. Tumor incidence and multiplicity were recorded weekly until the end of the experiment at week 28. A, External appearance of tumors. B, ADA-07 suppressesSUV-induced tumor volume. Tumor volume was calculated according to the following formula: tumor volume (mm3) ¼ length � width � height � 0.52. C, ADA-07decreases the average number of SUV-induced tumors at week 28. B and C, Data are represented as mean values � SD, and differences were determined by one-wayANOVA. The asterisk (�) indicates a significant decrease comparedwith the group exposed to SUV only or the group treatedwith vehicle followed by SUV (�� , P < 0.001).D,ADA-07 inhibitsSUV-inducedskincarcinogenesis inmouseskinepidermal tissue.Dorsal trunkskinsampleswereharvestedandstainedwithH&E(left)orwithanantibodyto detect PCNA (right). Representative staining shows the pathologic changes in the epidermis from each of the groups (scale bar, 100 mm). Expression of PCNAwas quantifiedusing Image-Pro Plus software, and stained cellswere counted from five separate areas on each slide (bottom). An average of three sampleswas calculatedper group. Data are expressed as mean percent of control� SD, and the asterisks indicate a significant difference in PCNA expression (�� , P < 0.001). E, ADA-07 inhibitsSUV-induced phosphorylation of ERK1/2, p38, and JNKs inmouse skin. The expression levels of phosphorylated and total proteinswere analyzed byWestern blot analysis.

Gao et al.





therapeutic agent against SUV-induced skin tumorigenesis. TheSKH-1 hairlessmouse iswidely considered to be themost suitablemodel for studies of SUV-induced carcinogenesis and also is veryuseful for the study of topical compounds that alter SUV-inducedskin cancer development (38, 52). Generally, skin tumors areinduced inmice by chronic exposure to SUV, and tumors progressfrom foci of epithelial hyperplasia to premalignant papillomasand ultimately into a malignant SCC (52). In this study, oursystem of SUV irradiation mimics natural sunlight that includesboth UVA and UVB spectrums. Results indicated that SCCs weresuccessfully induced by 15 weeks of SUV exposure (3 times aweek) in our SKH-1 hairless mouse models. Importantly, thetopical application of ADA-07 completely suppressed the inci-dence of SUV-induced skin cancer development in an early-stageprevention study (Fig. 4; Supplementary Fig. S5). In addition, weshowed that SKH-1mice exposed to SUV and treated with topicalADA-07 displayed a significantly decreased tumor incidence,multiplicity, volume, and malignancy rate compared with vehi-cle-treated mice in the late-stage prevention study (Fig. 5; Sup-plementary Fig. S6). These data support the idea that cumulativelength of SUV exposure is a risk factor for SUV-inducedNMSCandhighlights the fact that ADA-07 might ultimately decrease skincarcinogenesis through its direct inhibition of TOPK.

Overall, this study suggests that TOPK is an importantmediatorof SUV-induced skin carcinogenesis. The novel compound, ADA-07, inhibited TOPK by blocking its kinase activity, thereby sup-pressing ERK1/2, p38, JNKs, and AP-1 activation. The chemo-preventive effect and potential therapeutic value of ADA-07 wasconfirmed in the SKH-1 hairless mouse models. Therefore, ADA-07 is a promising chemopreventive and potential therapeuticagent that might be applied to human skin malignancies.

Disclosure of Potential Conflicts of InterestNo potential conflicts of interest were disclosed.

Authors' ContributionsConception and design: G. Gao, T. Zhang, Q. Wang, S.E. Dickinson, Z. DongDevelopment of methodology: G. Gao, K. Yao, T. Zykova, Z. DongAcquisition of data (provided animals, acquired and managed patients,provided facilities, etc.): G. Gao, T. Zhang, Q. Wang, K. Wang, C. Curiel-LewandrowskiAnalysis and interpretation of data (e.g., statistical analysis, biostatistics,computational analysis): G. Gao, T. Zhang, Q. Wang, H. Chen, K. Wang,T. Zykova, C. Curiel-Lewandrowski, D. Alberts, A.M. BodeWriting, review, and/or revision of the manuscript: G. Gao, T. Zhang, K. Yao,C. Curiel-Lewandrowski, A.M. BodeAdministrative, technical, or material support (i.e., reporting or organizingdata, constructing databases): Q. Wang, E. Roh, W. Ma, J. Ryu, D. AlbertsStudy supervision: T. Zhang, Q. Wang, D. Alberts, A.M. Bode, Y. Xing, Z. DongOther (synthesis of chemicals): K. Reddy

AcknowledgmentsThe authors thankTodd Schuster for supporting experiments, Tara Adams for

supporting animal experiments, and Nicki Brickman for assistance in submit-ting our manuscript (The Hormel Institute, University of Minnesota).

Grant SupportThis work was funded by The Hormel Foundation and NIH grants

CA027502, CA166011, CA187027, and CA196639 (to Z. Dong).The costs of publication of this articlewere defrayed inpart by the payment of

page charges. This article must therefore be hereby marked advertisement inaccordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Received March 7, 2017; revised May 12, 2017; accepted June 13, 2017;published OnlineFirst June 27, 2017.

References1. Stern RS. Prevalence of a history of skin cancer in 2007: results of an

incidence-based model. Arch Dermatol 2010;146:279–82.2. Rogers HW, Weinstock MA, Feldman SR, Coldiron BM. Incidence estimate

of nonmelanoma skin cancer (Keratinocyte Carcinomas) in the U.S.Population, 2012. JAMA Dermatol 2015;151:1081–6.

3. Samarasinghe V,MadanV, Lear JT.Management of high-risk squamous cellcarcinoma of the skin. Exp Rev Anticancer Ther 2011;11:763–9.

4. de Gruijl FR, van Kranen HJ, Mullenders LH. UV-induced DNA damage,repair, mutations and oncogenic pathways in skin cancer. J PhotochemPhotobiol B 2001;63:19–27.

5. Lopez-Camarillo C, Ocampo EA, Casamichana ML, Perez-Plasencia C,Alvarez-Sanchez E, Marchat LA. Protein kinases and transcription factorsactivation in response to UV-radiation of skin: implications for carcino-genesis. Int J Mol Sci 2012;13:142–72.

6. Burns EM, Tober KL, Riggenbach JA, Kusewitt DF, Young GS, OberyszynTM. Extended UVB exposures alter tumorigenesis and treatment efficacy ina murine model of cutaneous squamous cell carcinoma. J Skin Cancer2013;2013:246848.

7. Marks R. An overview of skin cancers. Incidence and causation. Cancer1995;75:607–12.

8. Sarasin A. The molecular pathways of ultraviolet-induced carcinogenesis.Mutat Res 1999;428:5–10.

9. Jung SK, Lee KW, Byun S, Kang NJ, Lim SH, Heo YS, et al. Myricetinsuppresses UVB-induced skin cancer by targeting Fyn. Cancer Res 2008;68:6021–9.

10. Cooper SJ, Bowden GT. Ultraviolet B regulation of transcription factorfamilies: roles of nuclear factor-kappa B (NF-kappaB) and activator pro-tein-1 (AP-1) in UVB-induced skin carcinogenesis. Curr Cancer DrugTargets 2007;7:325–34.

11. de Gruijl FR. Photocarcinogenesis: UVA vs UVB. Methods Enzymol 2000;319:359–66.

12. Bode AM, Dong Z. Mitogen-activated protein kinase activation in UV-induced signal transduction. Sci STKE 2003;2003:Re2.

13. Zhu F, Zykova TA, Kang BS, Wang Z, Ebeling MC, Abe Y, et al.Bidirectional signals transduced by TOPK-ERK interaction increasetumorigenesis of HCT116 colorectal cancer cells. Gastroenterology2007;133:219–31.

14. Ayllon V, O'Connor R. PBK/TOPK promotes tumour cell proliferationthrough p38 MAPK activity and regulation of the DNA damage response.Oncogene 2007;26:3451–61.

15. Hu F, Gartenhaus RB, EichbergD, Liu Z, FangHB, Rapoport AP. PBK/TOPKinteracts with the DBD domain of tumor suppressor p53 and modulatesexpression of transcriptional targets including p21. Oncogene 2010;29:5464–74.

16. Zykova TA, Zhu F, Vakorina TI, Zhang J, Higgins LA, Urusova DV, et al.T-LAK cell-originated protein kinase (TOPK) phosphorylation of Prx1 atSer-32 prevents UVB-induced apoptosis in RPMI7951 melanoma cellsthrough the regulation of Prx1 peroxidase activity. J Biol Chem 2010;285:29138–46.

17. Kim DJ, Li Y, Reddy K, Lee MH, Kim MO, Cho YY, et al. Novel TOPKinhibitor HI-TOPK-032 effectively suppresses colon cancer growth. CancerRes 2012;72:3060–8.

18. Matsuo Y, Park JH, Miyamoto T, Yamamoto S, Hisada S, Alachkar H, et al.TOPK inhibitor induces complete tumor regression in xenograft modelsof human cancer through inhibition of cytokinesis. Sci Translat Med2014;6:259ra145.

19. Nakano H, Gasparro FP, Uitto J. UVA-340 as energy source, mimickingnatural sunlight, activates the transcription factor AP-1 in cultured fibro-blasts: evidence for involvement of protein kinase-C. Photochem Photo-biol 2001;74:274–82.

20. Schr€odinger. Schr€odinger Suite 2015. New York, NY: Schr€odinger, LLC;2015.






21. Wright TI, Spencer JM, Flowers FP. Chemoprevention of nonmelanomaskin cancer. J Am Acad Dermatol 2006;54:933–46.

22. Oh SM, Zhu F, Cho YY, Lee KW, Kang BS, Kim HG, et al. T-lymphokine-activated killer cell-originated protein kinase functions as a positive reg-ulator of c-Jun-NH2-kinase 1 signaling and H-Ras-induced cell transfor-mation. Cancer Res 2007;67:5186–94.

23. Liu K, Yu D, Cho YY, Bode AM, Ma W, Yao K, et al. Sunlight UV-inducedskin cancer relies upon activation of the p38alpha signaling pathway.Cancer Res 2013;73:2181–8.

24. Kim Y, He YY. Ultraviolet radiation-induced non-melanoma skin cancer:regulationofDNAdamage repair and inflammation.GenDis2014;1:188–98.

25. Kyriakis JM, Avruch J. Mammalianmitogen-activated protein kinase signaltransduction pathways activated by stress and inflammation. Physiol Rev2001;81:807–69.

26. Englaro W, Derijard B, Ortonne JP, Ballotti R. Solar ultraviolet lightactivates extracellular signal-regulated kinases and the ternary complexfactor in human normal keratinocytes. Oncogene 1998;16:661–4.

27. Park JH, Nishidate T, Nakamura Y, Katagiri T. Critical roles of T-LAK cell-originated protein kinase in cytokinesis. Cancer Sci 2010;101:403–11.

28. Wang J, Ouyang W, Li J, Wei L, Ma Q, Zhang Z, et al. Loss of tumorsuppressor p53 decreases PTEN expression and enhances signaling path-ways leading to activation of activator protein 1 and nuclear factor kappaBinduced by UV radiation. Cancer Res 2005;65:6601–11.

29. Huang C, Ma WY, Dong Z. The extracellular-signal-regulated proteinkinases (Erks) are required for UV-induced AP-1 activation in JB6 cells.Oncogene 1999;18:2828–35.

30. GlogauRG. The risk of progression to invasive disease. J AmAcadDermatol2000;42:23–4.

31. Bowden GT. Prevention of non-melanoma skin cancer by targeting ultra-violet-B-light signalling. Nat Rev Cancer 2004;4:23–35.

32. Leiter U, Garbe C. Epidemiology of melanoma and nonmelanoma skincancer–the role of sunlight. Adv Exp Med Biol 2008;624:89–103.

33. Seebode C, Lehmann J, Emmert S. Photocarcinogenesis and skin cancerprevention strategies. Anticancer Res 2016;36:1371–8.

34. Pleasance ED, Cheetham RK, Stephens PJ, McBride DJ, Humphray SJ,Greenman CD, et al. A comprehensive catalogue of somatic mutationsfrom a human cancer genome. Nature 2010;463:191–6.

35. Marks R, Rennie G, Selwood TS. Malignant transformation of solar kera-toses to squamous cell carcinoma. Lancet 1988;1:795–7.

36. Kanjilal S, Strom SS, Clayman GL, Weber RS, el-Naggar AK, Kapur V, et al.p53 mutations in nonmelanoma skin cancer of the head and neck:molecular evidence for field cancerization. Cancer Res 1995;55:3604–9.

37. PierceallWE, KripkeML, AnanthaswamyHN.N-rasmutation in ultravioletradiation-induced murine skin cancers. Cancer Res 1992;52:3946–51.

38. OiN,ChenH,OkKimM, Lubet RA, BodeAM,DongZ. Taxifolin suppressesUV-induced skin carcinogenesis by targeting EGFR and PI3K. Cancer PrevRes 2012;5:1103–14.

39. YaoK, ChenH, LiuK, Langfald A, YangG, Zhang Y, et al. Kaempferol targetsRSK2 andMSK1 to suppressUV radiation-induced skin cancer. Cancer PrevRes 2014;7:958–67.

40. Yang G, Fu Y, Malakhova M, Kurinov I, Zhu F, Yao K, et al. Caffeic aciddirectly targets ERK1/2 to attenuate solar UV-induced skin carcinogenesis.Cancer Prev Res 2014;7:1056–66.

41. Fischer SM, Lo HH, Gordon GB, Seibert K, Kelloff G, Lubet RA, et al.Chemopreventive activity of celecoxib, a specific cyclooxygenase-2 inhib-itor, and indomethacin against ultraviolet light-induced skin carcinogen-esis. Mol Carcinogen 1999;25:231–40.

42. Fan X, Duan Q, Ke C, Zhang G, Xiao J, Wu D, et al. Cefradineblocks solar-ultraviolet induced skin inflammation through directinhibition of T-LAK cell-originated protein kinase. Oncotarget 2016;7:24633–45.

43. Chouinard N, Valerie K, Rouabhia M, Huot J. UVB-mediated activation ofp38 mitogen-activated protein kinase enhances resistance of normalhuman keratinocytes to apoptosis by stabilizing cytoplasmic p53. BiochemJ 2002;365:133–45.

44. Hildesheim J, Awwad RT, Fornace AJ Jr.p38 Mitogen-activated proteinkinase inhibitor protects the epidermis against the acute damaging effectsof ultraviolet irradiation by blocking apoptosis and inflammatoryresponses. J Invest Dermatol 2004;122:497–502.

45. Chen YR, Wang X, Templeton D, Davis RJ, Tan TH. The role of c-Jun N-terminal kinase (JNK) in apoptosis induced by ultraviolet C and gammaradiation. Duration of JNK activation may determine cell death andproliferation. J Biol Chem 1996;271:31929–36.

46. Hochedlinger K, Wagner EF, Sabapathy K. Differential effects of JNK1 andJNK2 on signal specific induction of apoptosis. Oncogene 2002;21:2441–5.

47. Tournier C, Hess P, Yang DD, Xu J, Turner TK, Nimnual A, et al. Require-ment of JNK for stress-induced activation of the cytochrome c-mediateddeath pathway. Science 2000;288:870–4.

48. He YY, Huang JL, Chignell CF. Delayed and sustained activationof extracellular signal-regulated kinase in human keratinocytesby UVA: implications in carcinogenesis. J Biol Chem 2004;279:53867–74.

49. Kim HH, Shin CM, Park CH, Kim KH, Cho KH, Eun HC, et al. Eicosa-pentaenoic acid inhibits UV-inducedMMP-1 expression in human dermalfibroblasts. J Lipid Res 2005;46:1712–20.

50. Muthusamy V, Piva TJ. The UV response of the skin: a review of the MAPK,NFkappaB andTNFalpha signal transductionpathways. ArchDermatol Res2010;302:5–17.

51. Eckert RL, Adhikary G, Young CA, Jans R, Crish JF, Xu W, et al. AP1transcription factors in epidermal differentiation and skin cancer. J SkinCancer 2013;2013:537028.

52. Benavides F, Oberyszyn TM, VanBuskirk AM, Reeve VE, Kusewitt DF. Thehairless mouse in skin research. J Dermatol Sci 2009;53:10–8.


Gao et al.




2017;16:1843-1854. Published OnlineFirst June 27, 2017.Mol Cancer Ther Ge Gao, Tianshun Zhang, Qiushi Wang, et al. by Directly Inhibiting TOPK

Induced Skin Carcinogenesis−ADA-07 Suppresses Solar Ultraviolet

Updated version

10.1158/1535-7163.MCT-17-0212doi:

Access the most recent version of this article at:

Material

Supplementary

http://mct.aacrjournals.org/content/suppl/2017/06/27/1535-7163.MCT-17-0212.DC1

Access the most recent supplemental material at:

Cited articles

http://mct.aacrjournals.org/content/16/9/1843.full#ref-list-1

This article cites 51 articles, 16 of which you can access for free at:

Citing articles

http://mct.aacrjournals.org/content/16/9/1843.full#related-urls

This article has been cited by 2 HighWire-hosted articles. Access the articles at:

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected]

To order reprints of this article or to subscribe to the journal, contact the AACR Publications Department at

Permissions

Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://mct.aacrjournals.org/content/16/9/1843To request permission to re-use all or part of this article, use this link



http://mct.aacrjournals.org/lookup/doi/10.1158/1535-7163.MCT-17-0212

http://mct.aacrjournals.org/content/suppl/2017/06/27/1535-7163.MCT-17-0212.DC1

http://mct.aacrjournals.org/content/16/9/1843.full#ref-list-1

http://mct.aacrjournals.org/content/16/9/1843.full#related-urls

http://mct.aacrjournals.org/cgi/alerts

mailto:[email protected]

http://mct.aacrjournals.org/content/16/9/1843


ada-07 suppresses solar ultraviolet induced skin carcinogenesis by directly inhibiting ... · small...

Documents