active motif’s epigenetics products & services brochure · 2019-01-22 · active motif’s...

epigenetics

ChIPHistonesDNA MethylationSample PreparationEpigenetic ServicesAntibodies

products & services Enabling Epigenetics Research

www.activemotif.com

http://www.activemotif.com/

NORTH AMERICA 877 222 9543 EUROPE +32 (0)2 653 0001 JAPAN +81 (0)3 5225 3638 www.activemotif.com

Antibodies for Epigenetic Research ...................................................1

Chromatin Immunoprecipitation ChIP Products Overview ..................................................................4 Introduction to ChIP Products ......................................................5 Sonication Products ...........................................................................6 ChIP-IT® Express Shearing Kit ........................................................7 ChIP-IT® Express Enzymatic Shearing Kit ..................................7 ChIP-IT® Fixation Buffer ...................................................................7 Dounce Homogenizers .....................................................................7 ChIP-IT® Express Enzymatic ............................................................8 ChIP-IT® Express ..................................................................................9 ChIP-IT® High Sensitivity ............................................................... 10 ChIP-IT® qPCR Analysis Kit ............................................................ 10 ChIP-IT® ChIP-Seq ............................................................................. 11 ChIP-IT® PBMC ................................................................................... 12 ChIP-IT® FFPE .......................................................................................13 ChIP-IT® FFPE Chromatin Preparation Kit ................................13 Ready-to-Use ChIP Columns ....................................................... 14 ChIP-IT® Protein G Magnetic Beads .......................................... 14 Re-ChIP-IT® .......................................................................................... 15 ChIP-IT® Express HT ......................................................................... 16 RNA ChIP-IT® ...................................................................................... 17 RNA ChIP-IT® Control Kit – Human .......................................... 17 ChIP Control qPCR Primer Sets .................................................. 18 ChIP Accessory Kits and Reagents ............................................. 19 ChIP-IT® Control Kits ....................................................................... 19 Ready-to-ChIP Chromatin ............................................................. 19 Bridging Antibody for Mouse IgG ............................................. 19 Chromatin IP DNA Purification Kit ........................................... 20

Histone Peptide Array MODified™ Histone Peptide Array ............................................. 21 MODified™ Array Labeling Kit ...................................................... 21 MODified™ Protein Domain Binding Kit ................................. 22

Histone Modification ELISAs Histone H3 mono-, di- & trimethyl Lys4 ELISAs ..................23 Histone H3 acetyl, di- & trimethyl Lys9 ELISAs ....................23 Histone H3 phospho Ser10 ELISA ...............................................23 Histone H3 acetyl Lys14 ELISA .....................................................23 Histone H3 mono- & trimethyl Lys27 ELISAs ........................23 Histone H3 phospho Ser28 ELISA ..............................................23 Total Histone H3 ELISA ...................................................................23

Histone Purification Histone Purification Kit ................................................................. 24 Histone Purification Mini Kit ....................................................... 24 Histone Purification Microplate Kit .......................................... 24

Histone H3 PTM Multiplex Assay .................................................... 26

Reagents for Drug Discovery Overview ............................................................................................. 27

Recombinant Proteins Histones & Modified Histones ................................................... 28 Biotinylated Histones ..................................................................... 28 Histone Acetyltransferases & Deacetylases ......................... 28 Histone Methyltransferases & Demethylases ...................... 28 Bromodomains .................................................................................. 29 Transcription Factors ...................................................................... 29 DNA Methylation ............................................................................ 29 Ubiquitination ................................................................................... 29 Protein Kinases .................................................................................. 29

Small Molecule Compounds Inhibitors & Activators ................................................................... 30

Histone Acetylation & Deacetylation HAT Assay Kit (Fluorescent) ...........................................................31 HDAC Assay Kits (Fluorescent & Colorimetric) .....................31 Recombinant p300 protein, catalytic domain .......................31 Recombinant GCN5 protein, active ...........................................31

Histone Demethylation Histone Demethylase Assay (Fluorescent) .............................32 Recombinant LSD1 / KDM1A protein, active .........................32

Chromatin Assembly (in vitro) Chromatin Assembly Kit ................................................................33 HeLa Core Histones .........................................................................33 Nucleosome Assembly Control DNA ......................................33

NOMe-Seq .................................................................................................. 34

DNA Methylation Activity & Enrichment DNA Methylation / Demethylation Overview ....................35 Hydroxymethyl Collector™ .......................................................... 36 hMeDIP Assay & 5-hmC antibodies ..........................................37 MethylCollector™ Ultra.................................................................. 38 MeDIP Assay & 5-mC antibodies ............................................... 39 HypoMethylCollector™ .................................................................40 Bisulfite Conversion Kit .................................................................. 41 DNMT Activity / Inhibition Assay ............................................ 42

Methylated DNA Standards and Controls Methylated DNA Standard Kit ....................................................43 Fully Methylated Jurkat DNA .......................................................43 Jurkat genomic DNA ........................................................................43

5-Hydroxymethylcytosine Enzymes Recombinant Tet1 protein, active ............................................. 44 PvuRts1I restriction enzyme ........................................................ 44 b-Glucosyltransferase enzyme ................................................... 44

5-Formylcytosine (5-fC) & 5-Carboxylcytosine (5-caC) ......... 45

Epigenetic Services ................................................................................. 46

LightSwitch™ Luciferase Reporter Assays .....................................48

Table of ConTenTs


www.activemotif.com JAPAN +81 (0)3 5225 3638 EUROPE +32 (0)2 653 0001 NORTH AMERICA 877 222 9543 1

anTibodies

Antibodies for Epigenetic Researchhighly characterized antibodies to study epigenetics and gene regulation

At Active Motif, we are committed to providing the high-est quality antibodies for studying chromatin biology and epigenomics. We offer a wide range of antibodies specific for epigenetic modifications, chromatin modifiers and transcription factors. Our staff scientists use an established validation pro-

gram to qualify the suitability of our antibodies for use in vari-ous applications, such as chromatin immunoprecipitation (ChIP), ChIP-Seq, MeDIP, Western blot and immunofluorescence. For a complete list of available antibodies, please visit us at www.activemotif.com/abs.

The aCTive MoTif anTibody differenCe

• Quality first – we’d rather fail than sacrifice quality

• Highly validated – stringently tested in multiple applications

• Consistent – we minimize lot-to-lot variability

• Convenient – most antibodies are available in sample sizesAbbreviated lists of the antibodies we offer for various research areas are shown on the next 2 pages. For complete, up-to-date lists of antibodies available in each category, please visit the links below.

Histone & Histone Modifications www.activemotif.com/hismodabs Chromatin Associated Proteins www.activemotif.com/chromabs Transcription Factors www.activemotif.com/tfabs Nuclear Receptors www.activemotif.com/nrabs Stem Cell Biology www.activemotif.com/stemcellabs

F I G U R E 2 :Active Motif’s MODified Histone Peptide Array (Catalog No. 13001; see page 21) confirms Histone H3K9me3 pAb (Catalog No. 39161) specificity.

Histone H3K9me3 pAb

0

20

40

60

80

120

100

140

H3K9me3

H3K27me3

H3R2me2s

H3R2me2a

H3K4acH3K4me2

H3R8me2s

H3K4me3

H3K4me1

H3R2me2a

Spec

ificit

y Fa

ctor

F I G U R E 1 :ChIP-Seq data from control and estrogen-treated MCF-7 chromatin using anti-bodies against RNA pol II CTD phospho Ser2 (Catalog No. 61083) and against the estrogen-inducible transcription factor SRC3.

Estrogen

Estrogen

Control

Control

SRC3ChIP-Seq

Pol IIChIP-Seq

{{

RET

42,880,000 42,900,000 42,920,000 42,940,000q11.21

Not every antibody is suitable for ChIPOne of the greatest challenges for epigenetic-based research has been the lack of antibodies displaying the proper specificity that have been validated for use in techniques such as ChIP and

ChIP-Seq. The problem has been compounded by numerous antibody suppliers who do not manufacture or test the anti-bodies they sell, and who sell them to one another and then to researchers. Developing and manufacturing histone-specific antibodies is challenging because histones have multiple post-translational modifications along their “tail” portion involved in gene regulation and disease. Effective antibodies must clearly differentiate between these multiple, subtle variances and also be able to perform in demanding epigenetic techniques.

At Active Motif, we manufacture and rigorously test our histone antibodies in-house to ensure their quality and performance. We are the only company to test the specificity of our histone modification antibodies using our ground-breaking MODified™ Histone Peptide Array (Figure 2; see page 21).

5-caC 5-mC DAPI


NORTH AMERICA 877 222 9543 EUROPE +32 (0)2 653 0001 JAPAN +81 (0)3 5225 3638 www.activemotif.com2

anTibodies

Description Applications Cat. No.

HISTONES & HISTONE MODIFICATIONSHistone H1 pAb IF, WB 39707

Histone H2A pAb ChIP, WB 39235

Histone H2AT120ph pAb DB, WB 39391

Histone H2AS129ph pAb ChIP, DB, IF, IP, WB 39271

Histone macroH2A1.1 pAb IF, IHC, WB 39871

Histone macroH2A2 pAb IF, IHC, WB 39873

Histone H2A.X pAb IF, WB 39689

Histone H2A.XS139ph pAb DB, IF, WB 39117

Histone H2A.Z pAb ChIP, DB, WB 39943

Histone H2B pAb ChIP, WB 39237

Histone H2BK5ac pAb ChIP, ChC, ChS, DB, WB 39123

Histone H2BS14ph mAb IF, IP, WB 61011

Histone H2BK120ac pAb ChIP, ChC, ChS, DB, WB 39119

Histone H2BK120ub1 mAb ChIP, WB 39623

Histone H3 mAb ChIP, IF, IP, TRF, WB 39763

Histone H3, C-terminal pAb ChIP, ELISA, IP, WB 39163

Histone H3ac (pan-acetyl) pAb ChIP, DB, IP, WB 39139

Histone H3K4me1 pAb ChIP, ChC, ChS, DB, ELISA, IF, IP, WB 39297

Histone H3K4me2 pAb ChIP, ChC, ChS, DB, ELISA, IP, WB 39141


Histone H3R8me2a pAb DB, WB 39651

Histone H3K9ac pAb ChIP, ChC, ChS, DB, WB 39137

Histone H3K9me1 mAb ChIP, DB, IP, WB 39681

Histone H3K9me2 mAb ChIP, DB, IF, IP, TRF, WB 39683


Histone H3S10ph pAb ChIP, DB, IF, WB 39253

Histone H3K14ac pAb ChIP, ChC, ChS, DB, ELISA, IP, WB 39599


Histone H3K18ac pAb ChIP, ChC, ChS, DB, IF, IP, WB 39755

Histone H3K27ac pAb ChIP, ChC, ChS, DB, IF, IP, WB 39133

Histone H3K27me1 pAb DB, IF, WB 39377

Histone H3K27me2 pAb ChIP, DB, IF, WB 39245

Histone H3K27me3 pAb ChIP, ChC, ChS, DB, IF, IP, WB 39155

Histone H3S28ph mAb ELISA, IF, WB 39098

Histone H3K36ac pAb ChIP, ChC, ChS, DB, IF, WB 39379


Histone H3K36me3 pAb ChIP, ChC, ChS, DB, IP, WB 61101

Histone H3T45ph pAb DB, WB 39737

Histone H3K56ac pAb ChIP, ChC, ChS, DB, WB 39281

Histone H3K56me1 pAb DB, WB 39273

Histone H3K79me1 pAb ChIP, DB, WB 39145

Histone H3K79me2 pAb ChIP, ChC, ChS, DB, WB 39143

Histone H4 pAb ChIP, IP, WB 61299

Histone H4ac (pan-acetyl) pAb ChIP, DB, IF, WB 39243


Histone H4K5ac pAb ChIP, DB, WB 39699

Histone H4K12ac pAb ChIP, ChC, ChS, DB, IF, WB 39165

Histone H4K16ac pAb ChIP, DB, IP, WB 39167


Histone H4K20me1 mAb IF, WB 39727

Histone H4K20me2 pAb ChIP, IF, WB 39173

DNA METHYLATION3-Methylcytosine (3-mC) pAb DB 61111

5-Carboxylcytosine (5-caC) pAb DB, IF 61225

5-Formylcytosine (5-fC) pAb DB, IF 61223

5-Hydroxymethylcytosine (5-hmC) mAb DB, hMeDIP 39999

5-Hydroxymethylcytosine (5-hmC) pAb DB, IF, IHC, hMeDIP 39769

5-Methylcytosine (5-mC) mAb DB, FACS, IHC, IP, MeDIP 39649

5-Methylcytosine (5-mC) pAb DB, IP, MeDIP 61255

DNMT1 mAb ChIP, IHC, IP, WB 39204

DNMT2 pAb WB 39205

DNMT3A mAb ChIP, IF, IHC, WB 39206

DNMT3B mAb ChIP, IF, IP, WB 39207

DNMT3L pAb WB 39907

MBD1 pAb WB 39857

MBD2 pAb WB 39547

MBD3 mAb WB 39216

MBD4 pAb WB 39217

MeCP2 mAb ChIP, IF, IHC, IP, WB 61285

Uhrf1 mAb IF, IHC, IP, WB 61341

CHROMATIN MODIFIERSBRD3 pAb ChIP, ChS, WB 61489

BRD4 pAb ChIP, IP, WB 39909

CARM1 pAb WB 39251

CGBP pAb WB 39203

DOT1L pAb WB 39953

EZH2 mAb ChIP, IF, IP 39875

EZH2 pAb ChIP, ChC, ChS, WB 39901

EZH2 phospho Thr345 pAb DB, WB 61241

GCN5 mAb ELISA, IF, WB 39975

HDAC1 mAb ChIP, IF, IHC, IP, WB 39531


HDAC3 pAb ChIP, WB 40968



JARID1C / KDM5C pAb ChIP, IP, WB 39229

Jhd2 pAb WB 39263

JMJD2A mAb WB 39815

JMJD2D pAb WB 39247

LSD1 / KDM1A pAb ChIP, ChC, ChS, IP, WB 39186

MLL / HRX pAb ChIP, IP, WB 61295

MLL / HRX mAb ChIP, IP, WB 39829

MMSET / WHSC1 mAb ChIP, ChC, ChS, IF, IP, WB 39879

PARP-1 N-terminal pAb ChIP, IHC, IP, WB 39559

PARP-2 pAb ChIP, IP, WB 39743

PRMT5 pAb WB 61001



anTibodies


PRMT6 pAb WB 61003

SIRT1 mAb IF, IP, WB 39353

SIRT2 pAb IF, IP, WB 61043

SIRT6 pAb WB 39911

SUV39H1 mAb ChIP, IP, WB 39785

CHROMATIN REMODELERSAiolos pAb IF, IP, WB 39293

Boris / CTCFL pAb WB 39851

CHD1 pAb ChIP, WB 39729

CHD2 pAb WB 39363

CTCF pAb ChIP, ChC, ChS, IP, WB 61311

HIRA mAb WB 39557

HMG-2 pAb WB 39029

HMGA2 / HMGI-C pAb WB 61041

HP1a mAb ChIP, ELISA, ICC, IF, IHC 39977

HP1b mAb ELISA, IF, IHC, IP, WB 39979

HP1g mAb ELISA, ICC, IF, IHC, IP, WB 39981

Rsf1 pAb IF, IP, WB 39579

SMARCA2 / BRM mAb ChIP, IF, WB 39805

SMARCA4 / BRG1 mAb IF, WB 39807SATB1 pAb WB 39839

STEM CELLS5-Carboxylcytosine (5-caC) pAb DB, IF 61225

5-Formylcytosine (5-fC) pAb DB, IF 61223

5-Hydroxymethylcytosine (5-hmC) mAb DB, hMeDIP 39999

5-Hydroxymethylcytosine (5-hmC) pAb DB, IF, IHC, hMeDIP 39769

5-Methylcytosine (5-mC) pAb DB, IP, MeDIP 61255

Ago1/2/3 mAb ChIP, IF, IHC, IP, WB 39937

Dicer mAb WB 39817

EED mAb ChIP, ChC, ChS, IHC, WB 61203


KLF4 pAb WB 39745

LIN28A pAb ICC, IF, WB 61191

c-Myc pAb (65 kDa form) WB 39012

Nanog pAb ICC, IF, WB 61419

NKX2.5 pAb WB 61267

Notch1 mAb WB 61147

Notch3 mAb WB 61149

Oct-4 pAb ICC, IF, WB 39811

Ring1B mAb ChIP, ChC, ChS, IF, IP, WB 39663

Sox2 pAb ChIP, IF, IHC, IP, WB 39823

Sp1 pAb ChIP, IP, WB 39058

Suz12 pAb ChIP, IP, WB 39357

YY1 pAb ChIP, IP, WB 39071


CANCER5-Methylcytosine (5-mC) pAb DB, IP, MeDIP 61255

BRD4 pAb ChIP, IP, WB 39909

CHD1 pAb ChIP, WB 39729

DOT1L pAb WB 39953





Histone H3K4me2 pAb ChIP, ChC, ChS, DB, ELISA, IP, WB 39141




Histone H3K79me2 pAb ChIP, ChC, ChS, DB, WB 39143

JARID1C / KDM5C pAb ChIP, IP, WB 39229

LSD1 / KDM1A pAb ChIP, ChC, ChS, IP, WB 39186

MLL / HRX mAb ChIP, IP, WB 39829

MMSET / WHSC1 mAb ChIP, ChC, ChS, IF, IP, WB 39879

MOZ pAb WB 39867

c-Myc pAb (65 kDa form) WB 39012

PARP-1 N-terminal pAb ChIP, IHC, IP, WB 39559

PHF8 pAb WB 39711

SIRT1 mAb IF, IP, WB 39353

SIRT2 pAb IF, IP, WB 61043

ZEB1 pAb WB 61119

POLYCOMBBMI-1 mAb ChIP, IP 39993

CBX8 pAb WB 61237

EED mAb ChIP, ChC, ChS, IHC, WB 61203



PCL2 mAb WB 61153

Phc1 mAb IF, IP, WB 39723

Phc2 mAb ChIP, IF, IP 39661

Ring1B mAb ChIP, ChC, ChS, IF, IP, WB 39663

Suz12 mAb ChIP, IF, IHC, IP 39877Suz12 pAb ChIP, IP, WB 39357

ChIP Chromatin immunoprecipitation

ChC ChIP-chipChS ChIP-SeqDB Dot blotICC ImmunocytochemistryIF Immunofluorescence

IHC ImmunohistochemistryIP ImmunoprecipitationMeDIP Methyl DNA

immunoprecipitationTRF Time-resolved FRETWB Western blot

Applications Key

The antibodies shown above are only a small sample of the over 700 antibodies currently offered. For a complete, up-to-date list of all antibodies available, please visit www.activemotif.com/abs.



Products to Streamline the ChIP Assay Workflow

ChiP ProduCTs overview

Chromatin Preparation

Chromatin ImmunoprecipitationChIP Antibodies• ChIP & ChIP-Seq

validated antibodies• ChIP Antibody

Validation Services• MODified™ Histone

Peptide Array

ChIP Kits• ChIP-IT® Express• ChIP-IT® High Sensitivity• ChIP-IT® ChIP-Seq• ChIP-IT® FFPE• ChIP-IT® PBMC• Re-ChIP-IT®• RNA ChIP-IT®

Protein G Beads• Protein G Agarose Columns• Protein G Magnetic Beads

Chromatin Shearing• EpiShear™ Sonicators• ChIP-IT® Sonication &

Enzymatic Shearing Kits• Dounce Homogenizers

Pre-Made Chromatin• Ready-to-ChIP Chromatin

ChIP DNA Clean-up• Chromatin IP

DNA Purification Kit

PCR Analysis• ChIP-IT® Control Kits

qPCR Analysis• ChIP-IT® qPCR Analysis Kit• ChIP Control qPCR Primer Sets

Epigenetic Services• FactorPath™, TranscriptionPath™ and

HistonePath™ ChIP-Seq & ChIP-chip

Downstream Analysis

Cycle

DRx

n

Gene Regulation Services• Custom Cloning and Mutagenesis• Pathway Screening• Sequence Variant Assays

Luciferase Reporter Assays• LightSwitch™ Promoter Reporter

GoClone™ Collections• LightSwitch™ Stable Cell Lines• LightSwitch™ Luciferase Assays

Functional Validation

PromoterReporter Vector

Promoter Luciferase

Promoter response in vivo

Lightsignal



Active Motif offers a complete selection of validated reagents, instruments and kits to help streamline each step of the ChIP as-say workflow (see opposite page). Whether you are performing ChIP for the first time or are an expert in need of a specialized

ChIP protocol and reagents, Active Motif has the right products to meet your needs. Provided below are brief descriptions of our ChIP-IT® Kits and ChIP products to help guide you in deter-mining which ones are best suited for your specific application.

ChiP ProduCTs

Find the Right ChIP Products to Suit Your Specific Needs

Need ChIP results in a hurry?ChIP-IT Express was the first ChIP kit to use magnetic beads, which yield lower background and streamline the ChIP proto-col by eliminating many steps required in conventional agarose bead-based protocols. Washing and elution steps are also faster because centrifugation is replaced by magnetic pull-down. The result is higher sensitivity, a reduction in the input sample amount to 100,000 cells per assay, and a condensed protocol that can be completed in 1 day. ChIP-IT Express has a proven track record of success with over 500 publications and counting.

Transcription Factor ChIPPerforming ChIP analysis of transcription factors presents a challenge because of their low abundance in cells and their low or transient affinity to chromatin. ChIP-IT High Sensitivity was specifically designed to perform ChIP analysis of transcription factors or similar low-abundance targets. Although the protocol is lengthier than magnetic bead methods, like ChIP-IT Express, a much higher level of sensitivity is achieved using the ChIP-IT High Sensitivity Kit. This extreme sensitivity also makes the kit ideal for performing ChIP with low-affinity antibodies or with limited amounts of sample. As little as 1,000 cell equivalents for highly abundant target proteins, or 50,000 for low abundance proteins, can be used for each ChIP reaction. To achieve this level of sensitivity, the kit employs specialized protein G agarose beads and optimized reagents to minimize non-specific binding. Filtration-based washes improve capture efficiency and consistency. The kit also includes DNA purification components to streamline sample preparation for downstream analysis.

Ready-to-use ChIP columnsGot your own ChIP protocol? For researchers who routinely perform ChIP with their own opti-mized protocols, Active Motif offers pre-packed, ready-to-use, low background Protein G Agarose Columns. These columns contain the same high-affinity protein G agarose beads included in the ChIP-IT High Sensitivity Kit (above). The columns offer a faster solution to centrifugation and magnetic separation methods, and result in better yield and reproducibility between samples because no material is lost.

No sonicator? No problem!ChIP-IT Express Enzymatic was the first kit to offer the option of shearing chromatin by enzymatic digestion instead of by sonication. This user-friendly kit is identical to ChIP-IT Express with the exception of its chromatin preparation reagents. Preparation of chromatin by enzymatic shearing simplifies op-timization of fragment size, and the mild enzymatic treatment preserves chromatin and epitope integrity. Enzymatic shearing is a great choice for users who do not routinely perform ChIP and either do not own a sonicator or are not proficient in its use.

Study two binding events on the same DNA locusRe-ChIP-IT takes advantage of the same magnetic-bead based ChIP method developed for ChIP-IT Express. However, Re-ChIP-IT was designed for sequential ChIP, in which two ChIP reactions using different antibodies are performed in series on the same sample. This makes it possible to simultaneously assay for two unique binding events at the same genomic region of interest.

Sonication products for more consistent shearingFor those who want to use sonication to achieve more consis-tent results from chromatin preparation, Active Motif offers both the EpiShear™ Probe Sonicator for direct sonication of samples and the Q800R® Sonicator for multi-sample prepara-tion of chromatin. These are the same sonicators that our own ChIP Assay Experts™ routinely use to prepare chromatin for ChIP.

ChIP to study non-coding RNA interactionsNon-coding RNAs play important roles in chromatin structure and transcriptional silencing. RNA ChIP-IT uses our magnetic-bead based ChIP method to enable the study of RNA-protein interactions in chromatin. All components are optimized to recover RNA from ChIP for downstream analysis.

Headed straight into Next Generation Sequencing?ChIP-IT ChIP-Seq is designed for performing ChIP-Seq analysis on the Illumina® sequencing platforms. It combines the ChIP-IT High Sensitivity Kit (left), the ChIP-IT qPCR Analysis Kit for validation of ChIP DNA (see page 10), and a set of library construction reagents suitable for the preparation of 10 Next Generation sequencing libraries.



ChiP saMPle PreParaTion insTruMenTs

Sonication Productsreproducible sample preparation ensures consistent results

Precise probe positioning enhances reproducibilityThe EpiShear Cooled Sonication Platform used in combination with the EpiShear Probe Sonicator greatly increases reproduc-ibility between samples by enabling you to precisely position the depth of the microtip probe in your sample. The platform allows for precise recreation of parameters for optimal depth settings. The platform is mounted inside a sound enclosure and includes a Tube Cooler (available for microfuge, 15 ml and 50 ml tubes) to keep the sample cold during sonication. For more information, please visit www.activemotif.com/platform.

Great results start with reliable sample preparation. Whether you are preparing chromatin for ChIP or DNA for methylation studies and Next Generation sequencing, Active Motif’s EpiShear™ Probe

Sonicator, Cooled Sonication Platform and Q800R Sonicator® provide reproducible sonication conditions to ensure better consistency between sample preparations and experiments.

Experience the versatility of probe sonicationThe EpiShear Probe Sonicator (Figure 1) is ideal for shearing chromatin, DNA and RNA, or for cell disruption and homog-enization. With a variety of microtip probe sizes available, you can process samples rang-ing from 200 µl to 50 ml. In addition, the EpiShear Probe Sonicator offers adjustable amplitude, adjustable pulse and a programmable timer to allow modification of sonication conditions to determine the optimal settings for your sample and application. Each unit is supplied with a 1/8" microtip probe and is backed by a two-year warranty. For more information, visit www.activemotif.com/probe.

Product Cat. No.

EpiShear™ Probe Sonicator 53051

EpiShear™ 5/64" (2 mm) Sonicator Probe 53056

EpiShear™ 1/4" (6.4 mm) Sonicator Probe 56057

EpiShear™ Cooled Sonication Platform 53080

Sound Enclosure 53060

Support Stand / Converter Clamp 53054

Q800R Sonicator® 53062

Eliminate variability with multi-sample processingDirect sonication is problematic and time-consuming for high-throughput processing or for processing small sample volumes where a probe causes foaming or aerosolization. The Q800R Sonicator utilizes a high-intensity ultrasonic horn for indirect high-throughput sonication of chromatin, DNA and other biological, pharmaceutical and industrial sample types. The unit contains an 8-sample tube holder that accommodates up to eight samples simultaneously (50 µl - 1.2 ml sample per vial) in sealed 1.5 ml polysty-rene tubes to prevent cross-contamination and foaming. The sam-ples are continuously rotated during process-ing to further reduce sample variability. The unit also includes a fully programmable, digitally controlled generator, a compact sound enclosure to house the ultrasonic cup horn and water bath, and a chiller for continuous cooling of the samples (Figure 2). For more information, please visit www.activemotif.com/q800r.

Control IgG Control IgG

EpiShear Probe Q800R Sonicator

RNA pol II RNA pol II

% D

NA

Reco

vere

d

0.000%

0.020%

0.040%

0.060%

0.008%

0.100%

0.140%

0.120%

0.160%

0.180%

F I G U R E 3 :HeLa chromatin was sheared with the EpiShear Probe and Q800R Sonicators and analyzed by ChIP using the ChIP-IT® Express Kit (Catalog No. 53008, see page 9).

F I G U R E 1 :The EpiShear Probe Sonicator.

F I G U R E 2 :The Q800R Sonicator.



ChiP saMPle PreParaTion KiTs

ChIP-IT® Express Shearing Kitsoptimize your shearing before starting ChIP

Chromatin preparation from different cell and tissue types can be challenging. Conditions must often be optimized for each specific sample type, causing you to burn quickly through kit reagents. To address this issue, Active Motif offers our ChIP-IT

Express Shearing Kits, which contain the same chromatin prepara-tion components found in our ChIP-IT Express Kits in quantities sufficient to optimize the sonication or enzymatic shearing con-ditions prior to preparing chromatin from your samples for ChIP.

Dounce homogenization improves chromatin yieldWhen preparing sheared chromatin samples, efficient cell lysis is critical to ensure the highest yields and most consistent results. Whether you are performing sonication or enzymatic shearing, we strongly recommend the use of a Dounce Homogenizer, which shears the cell mem-brane without disrupting the nuclei. Active Motif’s Dounce Homogenizers are available in 1 ml and 15 ml sizes for small and large sample preparations, and they include both a tight and loose pestle, enabling you to select the appropriate degree of cell disruption (Figure 2).

F I G U R E 2 :Dounce homogenizer, tight & loose pestle.

Product Format Cat. No.

ChIP-IT® Express Shearing 10 rxns 53032

ChIP-IT® Express Enzymatic Shearing 10 rxns 53035

ChIP-IT® Fixation Buffer 3 ml 53038

Dounce Homogenizer 1 ml15 ml

4040140415

Reagents to optimize shearing by sonicationThe first step in successful ChIP is shearing the chromatin into 200-1000 bp fragments. This can be difficult when using sonication where conditions have to be highly optimized to produce the correct frequency and amplitude of ultrasonic pulses to achieve the correct fragment size. Despite the chal-lenges, the advantage of sonication is that it produces more consistent preparation of sheared chromatin. For research-ers using sonication for chromatin preparation who are either performing chromatin immunoprecipitations in high volume or are optimizing shearing conditions, the ChIP-IT Shearing Kit provides the identical components for chromatin preparation from our ChIP-IT Express Kit (page 9) to ensure you do not run out of reagents. The ChIP-IT Shearing Kit can be used with Active Motif’s EpiShear Probe Sonicator (page 6) to prepare your chromatin samples for use with our ChIP-IT Express Kits (Figure 1A) as well as with other ChIP methods.

Sonication-free shearing with enzymatic digestionNo sonicator? No problem! Not everybody owns a sonicator or wishes to become proficient in its use. For new users, issues such as emulsification and overheating make it difficult to optimize sonication. Because sonication can be challenging, and even intimidating, Active Motif has developed an extremely user-friendly method to shear chromatin for ChIP by enzymatic digestion. The ChIP-IT Enzymatic Shearing Kit uses a propri-etary Enzymatic Shearing Cocktail that quickly and gently shears DNA (Figure 1B) while preserving its integrity and modifications. Because enzymatic shearing is solely time and temperature de-pendent, the issues associated with sonication are eliminated.

Our optimized ChIP-IT Fixation Buffer can be used in the form-aldehyde cross-linking step of chromatin fixation to reduce pH effects and improve consistency of sample preparation.

F I G U R E 1 :Sheared chromatin prepared using either (A) the ChIP-IT Express Shearing Kit and the EpiShear Probe Sonicator or (B) the ChIP-IT Express Enzymatic Shearing Kit.

What’s in the box?The ChIP-IT Shearing and Enzymatic Shearing Kits contain sufficient shearing components to make 10 chromatin preparations from three 15 cm plates (4.5 x 107 cells); each chromatin preparation will yield enough material to perform approximately 6 ChIP reactions.



ChIP-IT® Express Enzymaticno sonicator? no problem with our enzymatic ChIP kit

The biggest obstacle to initiating your first ChIP experiment is the requirement of sonication equipment for chromatin prepara-tion. In response, Active Motif developed the first sonication-free ChIP kit. The ChIP-IT Express Enzymatic Kit uses a propri-

etary enzymatic digestion method to simplify the DNA shearing step of our highly popular 1-day ChIP-IT Express protocol, making it easier than ever to get started on your first ChIP. For complete details, please visit us at www.activemotif.com/chipitexpress.

ChIP without sonicationChromatin shearing is most commonly done by sonication. However, many laboratories are not equipped with sonicators; sonication can also be challenging to optimize, making it intimidating for first-time users. Because of this, Active Motif developed the ChIP-IT Express Enzymatic Kit, the first sonica-tion-free ChIP kit. It provides a robust, user-friendly method for targeted gene enrichment by utilizing enzymatic digestion, rather than traditional sonication, to shear chromatin in prepara-tion for ChIP. The enzymatic method is designed for simplicity to give even the most inexperienced ChIP user the ability to prepare chromatin and perform ChIP.

soniCaTion-free ChiP

ChiP-iT exPress enzyMaTiC advanTages

• No sonication required

• User-friendly protocol

• Simplifies optimization of fragment size

• Mild enzyme treatment preserves modifications

• Perform ChIP in just 1 day

How does it work? The ChIP-IT Express Enzymatic Kit uses a proprietary Enzymatic Shearing Cocktail and Digestion Buffer that quickly shears chromatin into 200-1000 bp fragments (see page 7, Figure 1B). Because enzymatic shearing is solely time and temperature dependent, problems associated with sonication, such as over-heating and emulsification, are eliminated. Enzymatic shearing is not only simpler, but it also makes it easier to optimize shearing conditions and get more reproducible DNA fragmentation from sample to sample, improving your ChIP results.

The components and protocol for ChIP are identical to those found in our highly popular ChIP-IT Express Kit (page 9), which utilizes magnetic beads to provide an extremely streamlined and efficient method to perform ChIP analysis in just 1 day.

What’s in the box?ChIP-IT Express Enzymatic Kits provide sufficient components to perform 25 ChIP reactions. Sufficient shearing reagents are included to perform 2 shearing optimizations and then make 5 preparations of sheared chromatin from three 15 cm plates (4.5 x 107 cells); each of these chromatin preparations yield enough material to perform approximately 6 ChIP reactions.

Complementary products• We recommend that you use a ChIP-IT Control Kit (page 19)

appropriate for your sample type, as the use of controls can help with troubleshooting, interpreting your results and vali-dating antibodies for use in ChIP.

• If you need to shear more chromatin, the stand-alone ChIP-IT Express Shearing Kit (page 7) provides reagents to perform and optimize the shearing portion of the protocol.

• Validated ChIP Control qPCR primer sets (page 18) are also available for use as positive and negative controls for many of the more common ChIP targets.


ChIP-IT® Express Enzymatic 25 rxns 53009




ChIP-IT® Express 25 rxns 53008

why use ChiP-iT exPress?• Complete Solution – includes all necessary components

for performing ChIP

• Get results in just 1 day – 4-hour immunoprecipitation and easy-to-follow streamlined protocol

• No need to optimize – Reagents and protocols are already optimized for superior sensitivity

• Ideal for abundant proteins or validated antibodies

• Sensitive – as few as 100,000 cells needed per ChIP reaction

Single day ChIPFor those who want to achieve robust, reproducible results from ChIP but do not want the hassle of optimizing reagents and conditions, we have the solution. Active Motif’s ChIP-IT Express Kits provide a complete set of highly optimized reagents and protocols to perform ChIP. The ChIP-IT Express method (Figure 1) improves on traditional ChIP by reducing or eliminating several time-consuming steps. These kits utilize protein G magnetic beads, which have much lower background binding than traditional agarose beads. This reduced background has made it possible to eliminate some of the steps required in more conventional protocols like pre-clearing and blocking. Washing is much easier because the spin steps have been replaced by rapid magnetic pull-down. Collectively, all of the improvements included in ChIP-IT Express give you the capabil-ity to perform your reactions in PCR tubes with a multi-channel pipettor, which reduces your effort and improves consistency.

Conventional ChIP requires at least two million cells as starting material, which can be labor-intensive to obtain and problemat-ic with some cell lines. ChIP-IT Express Kits have been optimized to provide superior target gene enrichment using minimal sample input. The kits can routinely produce excellent results with chromatin prepared from as few as 100,000 cells.

F I G U R E 1 :Schematic of chromatin immunoprecipitation using ChIP-IT Express.

Cross-link protein to DNA in living cells with formaldehyde.

Break open cells and shear DNA by Sonication or Enzymatic Shearing.

Reverse cross-links, digest withProteinase K, then stop reaction.

DNA is ready for analysis.

Elute chromatin, pellet beadswith magnet and transfer

supernatant to a fresh tube.

Add primary antibody of interest.

Capture antibody-boundprotein/DNA complexes and wash using Magnetic Beads.

F I G U R E 2 :The ChIP-IT Express Kit was used to perform ChIP using MCF-7 chromatin and Histone H3K4me3 antibody (Catalog No. 39915). qPCR analysis of enriched DNA using Negative Control Primer Set 1 (Catalog No. 71001), primers specific to a gene desert and Positive Control Primer Set GAPDH-2 (Catalog No. 71006) show enrich-ment of H3K4me3 at GAPDH promoters but not at gene deserts, as expected.

0

100

200

300

400

500

600

Bind

ing e

vent

s det

ecte

d pe

r 100

0 ce

lls

Negative Primer Set 1

NegativeGene Desert

Positive Primer SetGAPDH-2

ChIP-IT® Expressmagnetic beads make ChIP fast, easy & more reproducible

Active Motif’s ChIP-IT Express Kit provides a highly optimized and streamlined method that enables users to perform ChIP analysis in just 1 day. The kit was the first to utilize magnetic beads for faster and more efficient sample processing, reduced background and minimal sample loss. This results in superior

sensitivity and reproducibility as compared to traditional ChIP methods. Successful ChIP results are routinely achieved with chromatin starting from as few as 100,000 cells. Learn why ChIP-IT Express is the most published ChIP kit on the market. For more information, visit www.activemotif.com/chipitexpress.

ChiP wiTh soniCaTion



perform ChIP on low abundance transcription factor targetsChIP-IT® High Sensitivity

TransCriPTion faCTor ChiP

Performing ChIP on low abundance transcription factors is technically challenging. Active Motif’s ChIP-IT High Sensitivity Kit is designed to provide superior sensitivity through the use of optimized reagents that minimize sample loss and reduce background. This enables successful detection of transcription

factor targets from as few as 50,000 cell equivalents, or as few as 1,000 cell equivalents when working with higher abundance targets. The ChIP-IT High Sensitivity method has been validated with successful performance in qPCR and ChIP-Seq applications using hundreds of samples and antibodies.

Benefits of ChIP-IT High SensitivityThe ChIP-IT High Sensitivity Kit utilizes specially formulated buffers for preparation of high-quality chromatin from minimal amounts of cells or tissue. During the immunoprecipitation reaction, low-background protein G agarose beads and an antibody blocker are used to reduce non-specific binding. Specialized ChIP buffers are designed to enhance enrichment and reduce the presence of non-specific DNA. ChIP filtration columns are used for faster, easier and more consistent capture and wash steps. The result is a kit that is capable of delivering both higher signals and reduced background levels as compared with other commercially available ChIP kits (Figure 1). These features enable you to perform successful ChIP reactions on low abundance transcription factors, or starting with limited sample material or antibodies with low-affinity to their targets. The high quality ChIP-enriched DNA is ready for use in down-stream applications such as ChIP-Seq, ChIP-chip and qPCR.


ChIP-IT® High Sensitivity 16 rxns 53040

ChIP-IT® qPCR Analysis Kit 10 rxns 53029

ChiP-iT high sensiTiviTy advanTages

• Ideal for ChIP on low abundance transcription factors

• Optimized reagents minimize background signal

• Sensitive enrichment from as little as 1,000 cell equivalents per immunoprecipitation reaction

• Extensively tested across multiple sample types and anti-bodies with proven performance for ChIP-Seq & qPCR

ChIP Kits Targeting Low Abundance Transcription Factors

0

10

20

30

Neg Ctrlprimers

ESRRAprimers

Neg Ctrlprimers

ESRRAprimers

Neg Ctrlprimers

ESRRAprimers

Neg Ctrlprimers

ESRRAprimers

ChIP-IT® HS Competitor M Competitor I Competitor D

Bind

ing

even

ts d

etec

ted

/ 1,0

00 ce

lls

NCOA2 antibodyNeg Ctrl IgG

No enrichment

High background

Non-specific binding

F I G U R E 1 :ChIP-IT High Sensitivity is the only ChIP kit to successfully enrich for low abundance transcription factor proteins while minimizing background signal.

F I G U R E 2 :ChIP-Seq data showing peaks from transcriptional co-factor NCOA2 in the promoters of two genes. ChIP was performed using the ChIP-IT High Sensitivity Kit, confirmed with the ChIP-IT qPCR Analysis Kit and followed by sequencing on the Illumina Next-Gen sequencing platform.

Have confidence in your ChIP-SeqBefore investing time and money into expensive Next Genera-tion sequencing, it is recommended to validate the quality of your ChIP-enriched DNA. Using our years of experience with testing hundreds of samples and antibodies, Active Motif has developed the ChIP-IT qPCR Analysis Kit, which can be used in combination with the ChIP-IT High Sensitivity Kit to confirm the quality of the ChIP-enriched DNA.

The ChIP-IT qPCR Analysis Kit includes DNA standards and con-trol primer sets with recommendations for data interpretation to evaluate the success of the ChIP reactions. Following these recommendations will enable you to verify that the ChIP DNA is suitable for sequencing. To learn more about the ChIP-IT qPCR analysis Kit, please visit www.activemotif.com/qPCRanalysis.



ChIP-IT® ChIP-Seqstreamlined genome-wide ChIP workflow for Next Generation sequencing

ChiP-seq

The combination of ChIP with genome-wide analysis using Next Generation sequencing (ChIP-Seq) is a powerful approach that can provide insights into gene regulation, the impact of chromatin modifications on gene expression and signaling path-way mechanisms. The ChIP method enriches for protein-DNA

complexes using an antibody against a protein of interest. Oligo-nucleotide adapters are then ligated to the ChIP-enriched DNA before the size-selected library is amplified and purified for use in Next Generation sequencing. Analysis of the sequencing data will identify the global binding sites for the protein of interest.

ChIP for Next Generation sequencingActive Motif’s ChIP-IT ChIP-Seq Kit provides proven reagents, streamlined protocols and validation controls to ensure suc-cessful ChIP-Seq using the Illumina® sequencing platforms. The assay utilizes a highly consistent and robust chromatin immunoprecipitation and purification procedure that is sensi-tive enough for use with challenging antibodies and transcrip-tion factors. The kit also includes Active Motif’s ChIP-IT qPCR Analysis Kit which was developed based on our years of experi-ence testing hundreds of samples and antibodies to establish guidelines to validate the quality of the ChIP DNA. The kit also includes a set of library construction reagents suitable for the preparation of ten Next-Gen sequencing libraries* (Diagram 1).


ChIP-IT® ChIP-Seq 10 libraries 53041

F I G U R E 1 :ChIP-IT ChIP-Seq was performed using a Histone H3K4me3 pAb (Catalog No. 39159) on mouse livers. The data shows the presence of H3K4me3 at the transcription start sites of several Zfp genes.

whaT’s in The box?• Optimized protocol and buffers to perform ChIP starting

from fresh or frozen cells or tissues

• Purification reagents to clean up ChIP-enriched DNA

• ChIP-IT qPCR Analysis Kit to confirm the quality of the ChIP-enriched DNA prior to sequencing

• Library construction reagents and protocol for the preparation of ten NGS libraries * Adapter sequences to generate single end, paired end or barcoded libraries are not

included in the kit and must be purchased separately.

D I AG R A M 1 :Flow chart of the ChIP-IT ChIP-Seq method.



PbMC ChiP

ChIP-IT® PBMC

For researchers working with primary cells who want to do ChIP, PBMCs make it difficult to extract quality chromatin because they resist lysis under conditions normally suitable for other cell types. Active Motif’s ChIP-IT PBMC Kit offers a complete

solution for ChIP including specialized reagents and protocols to enable the extraction of high-quality chromatin from PBMCs and integrated components and protocols for ChIP and DNA purifi-cation from our highly popular ChIP-IT High Sensitivity Kit.

The challenge of performing ChIP on PBMCsPBMCs, such as lymphocytes (T cells, B cells & NK cells), dendritic cells and monocytes are a critical component of the peripheral immune system. These primary cells serve as popular model systems for various clinical applications and in studies of immunology, infectious disease and cancer.

However, for researchers who want to perform ChIP and ChIP-Seq analysis, extracting quality chromatin from these notoriously difficult-to-lyse cells presents a challenge. Active Motif leveraged its years of experience working with these difficult-to-lyse cell types into devel-oping a kit to finally enable researchers to perform the entire ChIP workflow, from sample preparation to DNA purification, using PBMCs as the starting material.

H3K9ac ChIP on CD8+ T cells

0

100

200

300

400

500

600

Negative Primer Set 1

Positive Primer SetACTB-2

Positive Primer SetGAPDH-2

Bind

ing

even

ts d

etec

ted

per 1

000

cells

T cell population 1T cell population 2

ChIP-IT PBMC: a complete solution for ChIPActive Motif’s ChIP-IT PBMC Kit offers a complete solution for performing chromatin immunoprecipitation from myeloid and lymphoid cells. The kit includes specially formulated reagents and protocols to enable extraction of high-quality chromatin from difficult-to-lyse PBMCs. Also included in the kit are components and protocols for performing ChIP and DNA purification from our highly popular ChIP-IT High Sensitivity Kit (page 10). These components are designed to work with limited sample amounts to significantly reduce background and sample loss. Combined, these reagents help you achieve better ChIP data by improving sensitivity and consistency so you get the best results from chromatin enrichment of your PBMC-extracted chromatin.

What’s in the box?The ChIP-IT PBMC Kit contains all the necessary reagents to perform 16 chromatin preparation reactions and 16 ChIP reac-tions. It is recommended to start with a minimum of 1 x 107 cells for chromatin preparation. DNA purification reagents are also provided for clean-up of eluted DNA for downstream applica-tions. For highly sensitive applications such as Next Generation sequencing, the ChIP-IT qPCR Analysis Kit (page 10) is recom-mended to evaluate the quality of the ChIP-enriched DNA.

F I G U R E 2 :ChIP-Seq data for Histone H3K4me2 antibody (Catalog No. 39141) using chromatin from mouse primary T cells. ChIP was performed using the ChIP-IT PBMC Kit, confirmed with the ChIP-IT qPCR Analysis Kit and followed by sequencing on the Illumina Next-Gen sequencing platform.


ChIP-IT® PBMC 16 rxns 53042


F I G U R E 1 :ChIP-IT PBMC was used to perform ChIP using H3K9ac antibody and chromatin from CD8+ T cells. The data shows H3K9ac enrichment at ACTB and GAPDH promoters.

complete solution for ChIP from B and T cells



perform ChIP on FFPE samplesChIP-IT® FFPE

Active Motif has a long history of innovation in chromatin immunoprecipitation assays. Active Motif has leveraged its expertise with high sensitivity ChIP to develop the first com-mercially available kit to perform ChIP from FFPE samples for

use in Next Generation sequencing. The ChIP-IT FFPE Chromatin Preparation Kit and the ChIP-IT FFPE Kit are first-of-their-kind products that enable extraction and ChIP analysis of chromatin from FFPE histological slides or sections from tissue blocks.

Perform ChIP on FFPE samples for NGSFormalin-fixed paraffin-embedded (FFPE) tissue serves as the gold standard for the preservation of pathology samples. These samples harbor valuable information about the epigenetic state of normal vs. diseased tissues that can be used in disease, diagnostic and biomarker discovery research. Traditionally, it has not been possible to perform ChIP on FFPE samples because it is difficult to extract high-quality chromatin from such limited material. In addition, the formalin fixation process often causes degradation and loss of antigenicity. Active Motif’s ChIP-IT FFPE Chromatin Preparation Kit enables chromatin extraction from FFPE samples to use in conjunction with our ChIP-IT FFPE Kit for chromatin immunoprecipitation to generate high quality ChIP-enriched DNA for downstream analysis by qPCR or Next Generation sequencing (Figure 1).

Enrich for low or high abundance targetsActive Motif’s ChIP-IT FFPE Kit is the only ChIP kit available that can enrich for ChIP DNA from both low abundance targets (transcription factors) or high abundance targets (histones) us-ing FFPE starting material. Other ChIP kits do not provide the level of sensitivity and minimal background that are required for specific enrichment from such compromised and limited starting material. The ChIP-IT FFPE Kit includes components for performing the ChIP reaction and a positive control antibody to validate success of the procedure. It is designed to be used in conjunction with our ChIP-IT FFPE Chromatin Preparation Kit that provides components for the chromatin extraction procedure.


ChIP-IT® FFPE 16 rxns 53045

ChIP-IT® FFPE Chromatin Preparation Kit 5 rxns 53030


Prepare chromatin from virtually any FFPE sample typeTo perform chromatin extraction from FFPE samples requires the use of the our ChIP-IT FFPE Chromatin Preparation Kit. This kit provides optimized reagents and a comprehensive protocol to extract ChIP-grade chromatin from preserved human, mouse or rat samples. These include reagents for removal of paraffin, hydration of FFPE samples, chromatin shearing and purification, along with DNA standards and primer sets as controls to assess chromatin quality. Table 1 lists examples of the sample material we have successfully validated with the ChIP-IT FFPE Chromatin Preparation method. While the quality of the extracted chromatin is dependent upon fixation and storage conditions, we have successfully extracted ChIP-grade chromatin from normal and tumor human colon FFPE blocks that were stored over 10 years under less than ideal conditions.

ffPe ChiP

FFPE sample Sample used per chromatin prep

Human colon Tissue block – five 20 µm sections

Human kidney Tissue block – twenty-five 20 µm sections

Human lung Tissue block – two 20 µm sections

Rat whole brain 5 slides – two 5 µm sections per slide

Rat hippocampus 25 slides – two 5 µm sections per slide

TA B L E 1 :Examples of FFPE samples successfully used with the ChIP-IT FFPE Kit.

F I G U R E 1 :Histone H3K4me3 ChIP-IT FFPE ChIP-Seq results from normal and tumor FFPE colon samples, and YY1 ChIP-Seq from a normal FFPE colon sample.

YY1 ChIPNormalColon

H3K4me3 ChIPNormalColon

H3K4me3 ChIPTumorColon



improve the quality and consistency of your own ChIP protocolReady-to-Use ChIP Columns

Active Motif’s Protein G Agarose Columns provide the perfect solution for labs that routinely perform ChIP that want to im-prove the quality and consistency of their own optimized ChIP protocol. The columns’ protein G agarose beads are specifically

formulated to strongly bind IgG and reduce non-specific binding during incubation of your ChIP reaction. For wash steps, the col-umn filtration method provides a faster alternative to centrifu-gation and prevents any sample loss for better reproducibility.

Protein G Agarose ColumnsActive Motif’s ready-to-use Protein G Agarose Columns contain the same high-affinity protein G agarose beads included in our highly popular ChIP-IT® High Sensitivity Kit (page 10). The beads have been spe-cifically engineered to bind IgG with high affinity and eliminate non-specific binding, making them a better option for ChIP than traditional agarose or protein G mag-netic beads. The protein G agarose beads supplied in each column have a binding capacity of 10 µg IgG/µl bead and can be adapted to work with any ChIP protocol.

Prevent sample loss and improve reproducibility of your own optimized ChIP protocolThe beads have been pre-washed and loaded into filtration columns. Simply add the ChIP reaction to the columns and use the cap to seal. The incubation and wash steps are all performed on the column, which streamlines the process and prevents the loss of any material. This provides a faster solu-tion than centrifugation or magnetic separation methods, and results in better reproducibility between samples.

In addition to ChIP, the Protein G Agarose Columns can also be used for co-immunoprecipitation (Co-IP) experiments. The columns have been validated using Active Motif’s Nuclear Com-plex Co-IP Kit (Catalog No. 54001), where the strong binding affinity and reduced background of the protein G agarose make these columns an ideal tool for antibody capture during Co-IP. For more information, visit www.activemotif.com/protein-g.

What’s in the box?Protein G Agarose Columns contain 30 µl of protein G agarose beads per column and have a binding capacity of 10 µg IgG/µl bead. They are available in pack sizes of 5 or 30 columns.


Protein G Agarose Columns 30 rxns5 rxns

5303953037

ChIP-IT® Fixation Buffer 3 ml 53038

ChIP-IT® Protein G Magnetic Beads 25 rxns 53014

ProTein g ColuMn advanTages

• Ready-to-use – the beads have been pre-washed and loaded into the column

• No pre-blocking needed – the protein G agarose beads have been engineered to eliminate non-specific binding

• Eliminate sample loss – the column ensures complete retention of the beads to prevent sample loss

• Versatile – use them for both ChIP and Co-IP experiments

ChIP-IT® Protein G Magnetic BeadsFor researchers looking to use a magnetic pull-down protocol to reduce background, speed up processing time and decrease sample loss, Active Motif offers the ChIP-IT Protein G Magnetic Beads. These are the same Protein G magnetic beads that are included in the ChIP-IT® Express Kits (pages 8-9) that enable ChIP to be performed in just 1 day.

Complementary products• Active Motif’s ChIP-IT Fixation Buffer is available as a stand-

alone reagent. This specially formulated buffer is used during the formaldehyde fixation step of chromatin preparation. Its use provides more consistent ChIP results by helping to eliminate pH effects during chromatin preparation.

• For co-immunoprecipitation, the Nuclear Complex Co-IP Kit (Catalog No. 54001) provides high quality reagents for both nuclear extract preparation and immunoprecipitation. The use of Protein G Agarose Columns in conjunction with the kit improves the efficiency of the capture of the IP complex.

ChiP ColuMns & MagneTiC beads



Re-ChIP-IT®analyze co-occupation of a locus with sequential ChIP

sequenTial ChiP

Cross-link protein to DNA in living cells with formaldehyde

Reverse protein/DNA cross-links, treat with

Proteinase K, and purify DNA

Break open cells and shear DNA

Add second primary antibody of interest

Collect antibody-boundprotein/DNA complexes using

Magnetic Beads

Add first primary antibody of interest

Collect antibody-boundprotein/DNA complexes using

Magnetic Beads

Analyze purified DNA

F I G U R E 1 :Schematic representation of the Re-ChIP-IT procedure.

F I G U R E 2 :Sequential chromatin immunoprecipitation performed using Re-ChIP-IT.

Sequential ChIP kit to analyze protein co-localization at genomic lociDNA regulatory elements direct changes in gene expression through their varied combination of interactions with transcrip-tion factors, cofactors and post-translational histone modifica-tions. Re-ChIP enables you to perform sequential chromatin immunoprecipitations using different antibodies in series on the same sample (Figure 1). This enables the analysis of the in vivo co-localization of two proteins and/or histone modifications that converge at the same genomic region of interest.

Sequential ChIP was technically challenging and difficult, until now. Active Motif’s Re-ChIP-IT Kit has adapted the ChIP-IT Express protocol for this technique to provide highly optimized reagents and a streamlined protocol, making it fast and easy to perform sequential ChIP (Figure 2). For complete information, visit www.activemotif.com/rechipit.

What’s in the box?The Re-ChIP-IT Kit provides sufficient reagents, buffers, columns and beads to perform 25 Re-ChIP reactions and PCR buffer/DNA loading dye to analyze Re-ChIP-enriched DNA by endpoint or qPCR. The Re-ChIP-IT Kit does not include the shearing components. However, ChIP-IT Express Shearing Kits (page 7), which provide the components needed to perform the shearing portion of the protocol, can be purchased separately.


Re-ChIP-IT® 25 rxns 53016

Active Motif’s Re-ChIP-IT Kit provides a simple, fast and robust method to analyze in vivo co-occupation of epigenetic modifi-cations, transcription factors and regulatory proteins at the same DNA regulatory sequence. The method integrates protocols and

reagents from our ground breaking ChIP-IT Express Kits into a sequential ChIP protocol, providing researchers with the fastest, most convenient method to assay two proteins or distinct histone modifications at the same genomic region of interest.

Complementary productsRe-ChIP DNA can be analyzed downstream using our ChIP Control qPCR Primer Sets for use as positive and negative controls for many of the more common ChIP targets (page 18), as well as with our ChIP-IT Control Kits (page 19).



ChIP-IT® Express HTthe speed and efficiency of ChIP-IT Express in a convenient 96-well format

F I G U R E 2 :ChIP was performed on HeLa chromatin with ChIP-IT Express HT. Data shows PCR analysis results us-ing primers specific for GAPDH. Lanes 1-4: RNA pol II antibody. Lanes 5-8: Mouse IgG negative control. Lane 9: no DNA control. Lane 10: input DNA control.

F I G U R E 1 :With the efficient plate-based protocol of ChIP-IT Express HT, you can process up to 96 ChIP reactions at a time for true high-throughput ChIP.

high-ThroughPuT ChiP

High-throughput ChIP for conducting large-scale disease genomics studiesPerforming chromatin immunoprecipitation followed by high-throughput sequencing to study the effects of DNA-protein interactions or epigenetic marks on gene expression has become the gold standard. However, for researchers who need to perform ChIP analysis at a large scale to look at the influence of genetic variation or disease states across large cohorts, efficiency and reproducibility can be a challenge. That is why Active Motif developed ChIP-IT Express HT. The kit combines the speed and efficiency developed in the creation of our ground breaking magnetic bead-based ChIP-IT Express Kits with a 96-well plate-based format, enabling the rapid and efficient processing of a large number of ChIP reactions. Now it is possible to perform the time-saving ChIP-IT Express protocol in high throughput (Figures 1 & 2), with everything optimized to the level and quality you have come to expect from Active Motif’s ChIP-IT Express line of products.


ChIP-IT® Express HT 96 rxns 53018

106 842 95 731

For researchers conducting large-scale ChIP studies to character-ize disease genomics, simplicity, speed, and reproducibility are of the utmost importance. To meet these needs, Active Motif adapted its highly popular ChIP-IT Express magnetic bead-based

protocol to a 96-well plate format to develop the ChIP-IT Express HT Kit. Now the simplicity, speed and reproducibility of ChIP-IT Express is available in a high-throughput format to enrich DNA for use in downstream ChIP-chip and ChIP-Seq analysis.

How does it work?The ChIP-IT Express HT Kit contains sufficient components to perform 96 ChIP reactions. The included LSV (Low Sample Vol-ume) Protein G-coated magnetic beads are provided ready-to-use. These beads have a high binding capacity for IgG, enabling them to be utilized in smaller volumes that reduce non-specific binding. Because of this lower non-specific binding, magnetic beads require fewer washing steps than agarose beads, and it is not necessary to pre-clear the chromatin. The magnetic beads are readily pelleted with commercially available 96-well magnetic stands. Magnetic beads pellet much more quickly than agarose beads, which are pelleted by centrifugation. This pelleting method also makes it easy to remove buffers without disturb-ing the beads, so washing can be performed using multi-channel pipettors. This dramatically reduces hands-on time and ensures sample-to-sample consistency. The LSV Protein G coated mag-netic beads are also optimized for use in the small sample size of a microplate well. The overall effect is a more efficient and streamlined protocol for faster, more reproducible ChIP results. To learn more, visit www.activemotif.com/htchip.

What’s in the box?The ChIP-IT Express HT Kit contains magnetic beads, purification columns, ChIP Buffers, reagents for immunoprecipitation, and a 96-well microplate and capstrips. Sufficient components are provided to perform 96 ChIP reactions. The ChIP-IT Express HT Kit does not include the shearing components found in the ChIP-IT Express Kits.

Complementary productsChIP-IT Express HT is compatible with chromatin prepared using our enzymatic or sonication-based shearing kits (page 7) for chromatin preparation, as well as with our ChIP-IT Control Kits (page 19).



The RNA ChIP-IT methodThe RNA ChIP-IT Kit offers a quick, reliable and user-friendly RNA-optimized method to perform ChIP for functional stud-ies of in vivo RNA associations with chromatin. In contrast to RNA immunoprecipitation (RIP) techniques designed to study RNA-protein associations with nuclear or cytoplasmic proteins in ribonucleoprotein (RNP) complexes, the RNA ChIP-IT method is specifically designed to isolate and identify RNAs associated with protein in a chromatin context (Figure 1).

RNA ChIP-IT uses a modified ChIP protocol that is optimized for extraction of endogenous chromatin, removal of DNA contaminants and preservation of RNA integrity. The protocol is simple and straightforward. Formaldehyde fixation is used to cross-link RNA to bound proteins. Chromatin shearing is com-bined with DNase treatment to yield DNA-free RNA-protein complexes that are then immunoprecipitated using antibodies specific to protein target(s) of interest. Cross-linking is reversed and RNA is recovered and treated a second time with DNase to ensure the absence of DNA. This generates a highly clean enriched RNA-ChIP sample for downstream analysis to ensure your results are attributable to RNA alone. For complete information, visit www.activemotif.com/rnachip.

Optimized RNA-ChIPActive Motif adapted the highly efficient magnetic bead-based protocol used in its ChIP-IT Express Kits to develop the first-of-its kind kit for RNA-ChIP. The RNA ChIP-IT Kit is specifically formulated for optimal immunoprecipitation and recovery of chromatin-associated non-coding RNA for downstream identifi-cation by various methods including qPCR. Because it utilizes a similar magnetic bead protocol to ChIP-IT Express, the kit offers the added advantages of ease of use, improved sensitivity, and reduced time and effort.


RNA ChIP-IT® 25 rxns 53024

RNA ChIP-IT® Control Kit – Human 5 rxns 53025

0

0.4

0.8

1.2

% in

put r

ecov

ery

Suz12 Normal Rabbit IgG

lincSFPQ locus

1.6

2.0

F I G U R E 1 :The RNA ChIP-IT Kit was used on DNase I-treated HeLa chromatin with Suz12 antibody (Catalog No. 39357) and Normal Rabbit IgG control. Amplification plot (top) and % input recovery (bottom) data generated from RT qPCR analysis using primers for the lincRNA SFPQ locus show a 141-fold enrichment of the lincSFPQ region with Suz12 antibody.

rna ChiP-iT advanTages

• Specifically tailored to study chromatin-associated RNA

• Designed to remove DNA while maintaining RNA integrity

• Step-by-step protocols for fixation, sonication and immunoprecipitation of chromatin, all optimized for RNA preservation

• Includes all RNase and protease inhibitors at precise concentrations

• Separate control kit available with positive and negative control antibodies, and primers for the lincSFPQ locus

RNA ChIP-IT®for the study of RNA interactions with chromatin

rna ChroMaTin iMMunoPreCiPiTaTion

Nucleic acids purified from chromatin are 2-5% RNA. However, we are just beginning to unravel the role of non-coding RNAs in orchestrating chromatin architecture and gene expression. For example, long non-coding RNAs (lncRNAs) typically associated

with silent chromatin are now known to play a role in mainte-nance of active chromatin. Active Motif used its ChIP expertise to develop a unique RNA ChIP assay specifically designed to en-able researchers to study RNA associations in a chromatin context.



ChIP Control qPCR Primer Setsvalidated qPCR primers for use as ChIP controls

ChiP ConTrol PriMer seTs

Active Motif offers a large variety of qPCR primer sets for use as positive and negative controls for many of the more common ChIP targets. Use of our primer sets will save you the time and effort required to design, synthesize and test your own species/

gene-specific control primers. Each primer set has been tested in multiple cell lines for various proteins or histone modifications, and proven to work in both qPCR and endpoint PCR. They are also used routinely by our own Epigenetic Services division.

help, Active Motif provides species-specific qPCR primer sets validated for human and mouse (see below) as well as for rat, zebrafish, Drosophila and budding yeast. For an up-to-date list of all available qPCR primer sets, visit www.activemotif.com/qpcr.

Description Gene Control for Cat. No.

HUMAN

Negative Control Primer Set 1 Gene desert on chromosome 12Transcription factors, LSD1, RNA pol II, 5-mC (MeDIP), H3K9ac, H3K14ac, H3K27ac, H3K4me1, H3K4me2, H3K4me3, H3K36me3, H4K5ac, H4K8ac, H4K12ac, H4K16ac

71001

Negative Control Primer Set 2 Gene desert on chromosome 4Transcription factors, RNA pol II, 5-mC (MeDIP), H3K9ac, H3K14ac, H3K27ac, H3K4me1, H3K4me2, H3K4me3, H3K36me3, H4K5ac, H4K8ac, H4K12ac, H4K16ac

71002

Negative Control Primer Set 3 ACTB promoter H3K27me3, EZH2 71023

Positive Control Primer Set ACTB-1 ACTB intron 3 RNA pol II phospho Ser2, H3K36me3 71003

Positive Control Primer Set GAPDH-1 GAPDH intron 7 RNA pol II phospho Ser2, H3K36me3 71004

Positive Control Primer Set ACTB-2 ACTB promoterH3K9ac, H3K14ac, H3K4me2, H3K4me3, H4K5ac, H4K8ac, H4K12ac, H4K16ac, HDAC1, LSD1, Total RNA pol II, RNA pol II phospho Ser5

71005

Positive Control Primer Set GAPDH-2 GAPDH intron 1H3K9ac, H3K14ac, H3K4me2, H3K4me3, H4K5ac, H4K8ac, H4K12ac, H4K16ac, Total RNA pol II, RNA pol II phospho Ser5

71006

Positive Control Primer Set MYT1 MYT1 promoter H3K27me3, EZH2 71007

Positive Control Primer Set CCND2 CCND2 promoter H3K27me3, EZH2, Suz12 71008

Positive Control Primer Set ZC3H13 ZC3H13 exon 8 5-mC (MeDIP) 71009Positive Control Primer Set GEMIN4 Region 3́ of GEMIN4 5-mC (MeDIP) 71010

MOUSE


71011


71012

Negative Control Primer Set 3 Actb promoter H3K27me3, EZH2 71013

Negative Control Primer Set 4 Gapdh promoter H3K27me3, EZH2 71014

Positive Control Primer Set Actb-1 Actb intron 3 RNA pol II phospho Ser2, H3K36me3 71015

Positive Control Primer Set Gapdh-1 Gapdh intron 2 RNA pol II phospho Ser2, H3K36me3 71016

Positive Control Primer Set Actb-2 Actb promoterH3K9ac, H3K14ac, H3K4me2, H3K4me3, H4K5ac, H4K8ac, H4K12ac, H4K16ac, HDAC1, LSD1, Total RNA pol II, RNA pol II phospho Ser5

71017

Positive Control Primer Set Gapdh-2 Gapdh promoterH3K9ac, H3K14ac, H3K4me2, H3K4me3, H4K5ac, H4K8ac, H4K12ac, H4K16ac, Total RNA pol II, RNA pol II phospho Ser5

71018

Positive Control Primer Set Hoxc10 Hoxc10 intron 1 H3K27me3, EZH2 71019

Positive Control Primer Set Pax-2 Region 5́ to Pax-2 H3K27me3, EZH2 71020

Positive Control Primer Set Grik3 Grik3 intron 8 5-mC (MeDIP) 71021Positive Control Primer Set Zc3h13 Zc3h13 exon 10 5-mC (MeDIP) 71022

Positive & negative controls for common ChIP targetsDesigning primer sets for use as positive & negative ChIP controls can be difficult because the sites for transcription factor binding and epigenetic modifications vary from species to species. To



tools for better chromatin IP resultsChIP Accessory Kits and Reagents

ChiP aCCessories

F I G U R E 1 :ChIP was performed on Ready-to-ChIP HeLa Chromatin (Cat. No. 53015) with RNA pol II mouse mAb (Cat. No. 39097) alone or with the Bridging Antibody for Mouse IgG (Cat. No. 53017). Use of Bridging Antibody improves ChIP results.

0

100

200

300

400

500

600

RNA pol II mAb alone

Fold

Enric

hmen

t

550

4 162

RNA pol II mAb & Bridging Ab

Bridging Abalone

IgG alone

ChIP-IT® Control KitsAs ChIP is a DNA enrichment, not a purification, ChIPs are unavoidably contaminated with non-specific chromatin. This can lead to false positive PCR products that make data inter-pretation difficult. To solve this problem, Active Motif offers species-specific (human, mouse and rat) control kits for real-time or endpoint PCR to confirm the successful execution of the chromatin preparation and immunoprecipitation procedures and to assess the quality of your antibody and PCR reactions.

ChIP-IT Control qPCR Kits enable you to assess the quality and success of your ChIP procedure by real-time PCR analysis. They include a positive control RNA pol II antibody, a Bridging Antibody to enhance the binding affinity of mouse monoclonal antibodies, a negative control IgG antibody to assess non-spe-cific binding, and species-specific positive and negative control qPCR primers. The positive control primers detect ChIP enrich-ment of RNA pol II-DNA interactions at actively transcribed promoter regions, enabling you to assess the success or failure of your ChIP procedure. The negative control primers detect DNA sequences within “gene deserts” that lack any structural genes and, therefore, are devoid of RNA pol II interactions with DNA regulatory sequences. These primers serve to establish baseline non-specific enrichment so you can determine background binding levels within the same ChIP reaction.

ChIP-IT Control Kits are designed for assessment of your ChIP procedure by endpoint PCR. Each kit provides positive and negative control antibodies, a Bridging Antibody and a positive control PCR primer set. Unlike the ChIP-IT Control qPCR Kits, negative control primers are not included with the endpoint PCR control kits. A convenient PCR buffer/DNA loading dye is also included to make your PCR reactions gel-ready straight out of the thermocycler.

For details and a complete, up-to-date list of all available ChIP control products, visit www.activemotif.com/chipcontrols.

Ready-to-ChIP ChromatinReady-to-ChIP Chromatin is offered from a number of ENCODE cell lines that have been optimally sheared by sonication and validated in ChIP as a control or test sample. As a result, you can more easily validate your own antibodies and primer sets. The chromatin can be used with all of the ChIP-IT Express Kits and controls, so you can be certain that the only variable in validating a new antibody for ChIP is the antibody itself. For details, please visit www.activemotif.com/chipready.

Enhance ChIP and IP when using mouse antibodiesLow antibody binding can greatly reduce the quality of ChIP results. For improved ChIP when using mouse IgG antibodies, Active Motif offers the Bridging Antibody for Mouse IgG. This anti-mouse IgG binds with high affinity to both mouse primary IgG antibody and protein G-conjugated beads. As this greatly increases capture efficiency, ChIP results are markedly improved (Figure 1); Bridging Antibody also improves standard IP and Co-IP.

The permutations in ChIP experiments are numerous. We’ve been listening to your feedback for more than 10 years now and understand that, for example, you must often optimize sonication conditions before performing ChIP. Or, you may

be unsure of your chromatin quality, or the suitability of your antibody or primers for use in ChIP. To make your ChIP experi-ments more successful, we offer a line of accessories designed to make it easier to troubleshoot and validate your ChIP results.


Ready-to-ChIP HeLa Chromatin 10 rxns 53015

Ready-to-ChIP Hep G2 Chromatin 10 rxns 53019

Ready-to-ChIP K-562 Chromatin 10 rxns 53020

Ready-to-ChIP NIH/3T3 Chromatin 10 rxns 53021

Bridging Antibody for Mouse IgG 500 µg 53017



Chromatin IP DNA Purification Kitrapid, simplified purification of your ChIP DNA samples

F I G U R E 2 :The Chromatin IP DNA Purification Kit enables efficient recovery of DNA fragments as small as 50 base pairs. DNA molecular weight markers (10 base pair ladder) were purified with the Chromatin IP DNA Purification Kit, run on a 5% agarose gel and stained with ethidium bromide to visualize the recovered DNA fragments.

Lane 1: DNA not purified.Lane 2: DNA after purification.

DNA that is larger than 50 base pairs is repre-sented equally in the purified and non-purified DNA samples. DNA fragments that are smaller than 50 base pairs (bracket) are not efficiently purified, and thus are not represented in the purified DNA sample (Lane 2, bracket).

F I G U R E 1 :The DNA Purification Binding Buffer has a pH indicator dye so the pH of the solution can be easily determined.

dna PurifiCaTion

Rapid method for use with many sample typesOnce your ChIP experiments are complete, DNA purification can be started immediately. The Chromatin IP DNA Purifica-tion Kit is compatible with samples from all of Active Motif’s ChIP-IT® Kits, or from any standard chromatin IP kit or pro-cedure. You can use your choice of mechanical or enzymatic shearing of chromatin, and either agarose or magnetic beads for upstream ChIP. The entire procedure takes only five to ten minutes, depending upon the number of samples to purify. The kit can also be used to purify methylated DNA samples en-riched using other Active Motif kits, including MethylCollector™ Ultra, HypoMethylCollector™, and the hMeDIP and MeDIP Kits. The Chromatin IP DNA Purification Kit is designed for use with a microcentrifuge for sample processing, but can also be used with a vacuum manifold.

Suitable for use in Next Generation sequencingThe purified DNA is suitable for use in many downstream analysis techniques, including PCR (endpoint & quantitative), microarray analysis & Next Generation sequencing. DNA can be successfully recovered from ChIP performed with as few as 10,000 cells. Depending upon the amount of chromatin used in ChIP, DNA recovery will range from 100 ng to 1 µg. The Chromatin IP DNA Purification Kit enables 85-100% recovery of DNA frag-ments greater than 50 base pairs in length (Figure 2); this is ideal for ChIP experiments as they usually require chromatin that has been sheared to 200-1500 bp.

How does it work?After your ChIP is complete, the ChIP DNA samples are mixed with the kit’s DNA Purification Binding Buffer. Because binding to the included purification columns is pH dependent, the Binding Buffer contains a convenient pH indicator dye (Figure 1). This enables you to see the pH of your samples before apply-ing them to the columns, helping ensure successful purification of your ChIP DNA. After binding, the DNA on the column is washed and then eluted using the included Elution Buffer.


Chromatin IP DNA Purification Kit 50 rxns 58002

ChIP combined with genome-wide analysis can yield tremendous amounts of information about the distribution of transcription factors and epigenetic modifications. But many downstream analysis techniques require DNA that is free of contaminants

present in an eluted ChIP sample. Active Motif’s Chromatin IP DNA Purification Kit enables you to quickly clean up your ChIP DNA in preparation for analysis, without the need for labor-intensive, time-consuming phenol/chloroform extractions.

ChroMaTin iP dna PurifiCaTion KiT advanTages

• 85-100% recovery of purified DNA

• Start with as few as 10,000 cells

• Enables recovery of DNA fragments as small as 50 bp

• Use with Active Motif or other manufacturer’s ChIP kits

• Can also be used to purify DNA from our hMeDIP, MeDIP, MethylCollector Ultra & HypoMethylCollector Kits prior to MeDIP-Seq or qPCR

21

100 bp

50 bp



hisTone PePTide array

MODified™ Histone Peptide Array

Active Motif’s MODified Histone Peptide Array enables screen-ing of the binding specificity and cross-reactivity of antibodies or proteins to histone modifications using a simple Western blot-like detection method. Multiple modifications are repre-

sented on each peptide to enable studies of contextual effects of nearby modifications. The array features the most extensive coverage of histone modifications available from a commercial array for the most accurate assessment of cross-reactivity.

broadest coverage of modifications for screening of binding specificity

MODified Histone Peptide ArrayThe MODified Histone Peptide Array* is a valuable research tool that can be used to screen antibodies, proteins and enzymes for interactions with histones and their post-translational modi-fications. Each array contains 384 different histone modification combinations in duplicate. Modifications include acetylation, methylation, phosphorylation and citrullination on the N-terminal tails of histones H2A, H2B, H3 and H4.

This unique histone array contains up to four modifications per 19mer peptide to study not only individual modifications, but also to determine if the presence of neighboring modifica-tions alter site recognition and binding. The MODified Histone Peptide Array can be used to screen antibodies for cross-reac-tivity, as in Figure 1, or to study protein and enzyme interactions (page 22). The simple array protocol works like a Western blot. Either ECL-based or colorimetric detection systems can be used. The image is then captured using film or a CCD camera.

MODified Array Labeling KitFor a complete solution, the MODified™ Array Labeling Kit contains the buffers and reagents needed for easy labeling and chemiluminescent detection of the MODified Histone Peptide Array. The MODified Array Labeling Kit contains blocking buf-fer, wash buffer, rabbit and mouse HRP-conjugated antibodies and ECL reagents for chemiluminescent detection. For added convenience, a positive control c-Myc antibody is included to recognize the array’s control c-Myc tag. Sufficient reagents are provided for the detection of five MODified Histone Arrays.

Free software for analysisActive Motif’s Array Analyze Software is a free program de-signed for use with the MODified Histone Peptide Array. This PC-compatible software analyzes the spot intensities from the MODified array and generates a graphical analysis of the histone modification interactions (Figure 1). Information about spot intensity, averages and errors can be saved in Excel-compatible files. For added convenience, up to three individual modifica-tions can be displayed in superposition to the experimental data, enabling better visualization of neighboring effects.

F I G U R E 1 :The MODified Histone Peptide Array was used with the MODified Array Labeling Kit to screen Active Motif’s Histone H3K9me3 pAb (Catalog No. 39161) for cross-reactivity.

Histone H3K9me3 pAb

0

20

40

60

80

120

100

140

H3K9me3

H3K27me3

H3R2me2s

H3R2me2a

H3K4acH3K4me2

H3R8me2s

H3K4me3

H3K4me1

H3R2me2a

Spec

ificit

y Fa

ctor


MODified™ Histone Peptide Array 1 array 5 arrays

13001 13005

MODified™ Array Labeling Kit 5 rxns 13006

Modified array advanTages

• Most extensive coverage – 59 histone modifications represented in 384 unique combinations

• Study neighboring effects – each peptide contains up to four modification combinations, enabling analysis of the effects of neighboring modifications

• Detects like a Western blot – fast and easy to use; works with either ECL-based or colorimetric detection

To learn more about the MODified Histone Peptide Arrays, MODified Array Labeling Kit, or to download the free Array Analyze Software, please visit www.activemotif.com/modified.

* CelluSpots™ arrays are manufactured under license by INTAVIS Bioanalytical Instruments AG and sold through Active Motif as MODified™ Histone Peptide Array.



hisTone PePTide array

screen protein domains for reactivity with histone modificationsMODified™ Protein Domain Binding Kit

Histone modifications are recognized and bound by specific proteins termed “writers”, “readers” and “erasers”. These pro-teins contain highly conserved binding domains, including bromodomains, chromodomains and Tudor domains (Table 1),

that mediate interactions with histones. Active Motif’s MODified Protein Domain Binding Kit is designed to be used with Active Motif’s MODified Histone Peptide Array to screen protein domains for interactions with histones and their modifications.


MODified™ Protein Domain Binding Kit 5 rxns 13007

Domain Binding Site Function Examples

Bromo Acetylated lysine residues

Regulates chromatin structure and gene expression as part of HATs or chromatin remodeling factors

TAFII250,

PCAF, GCN5

Chromo Methylated lysine residues

Associated with the assembly of protein complexes on chromatin

HP1b, MPP8, CHD1

Tudor Methylated lysine or arginine residues

It may be involved in RNA binding, DNA damage response and chromatin modification

JMJD2A, 53BP1, SMN

MBT Methylated lysine residues

Unknown, but MBT often appears as repeats in proteins associated with transcriptional repression

L(3)MBTL, CGI-72

How does it work?The MODified Protein Domain Binding Kit contains optimized buffers and reagents to analyze binding of His-tagged protein domains to histone modifications using the MODified Histone Peptide Array (page 21). Also included are reagents for chemiluminescent detection for imaging and analysis of the binding events using Active Motif’s free Array Analyze Software.

The simple assay works like a Western blot. The array is incubated in blocking buffer. Then, your His-tagged protein domain of interest is added to the array followed by detection via an anti-His6-tag antibody and an HRP-conjugated secondary antibody. ECL detection is used to produce a chemiluminescent signal that is captured using a CCD camera or film (Figure 1A). The array image is then analyzed using the Array Analyze Software (page 21) program to quantify each spot’s intensity and to determine how the presence or absence of neighboring modifications affect binding of the protein domain to a given modification of interest. For example, JMJD2A binding at H3K27me3 is not impacted by modifications at R26, but is greatly inhibited by the co-occurrence of S28ph (Figure 1B).

What’s in the box?The MODified Protein Domain Binding Kit contains interaction buffer, wash buffer, anti-His6-tag antibody, HRP-conjugated secondary antibody and ECL reagents for chemiluminescent detection. For added convenience, His-tagged recombinant G9a protein, which is a known histone methyltransferase that targets lysine 9 on Histone H3, is included for use as a positive control.

Sufficient components are provided to perform up to 5 reac-tions. MODified Histone Peptide Arrays are not included in the MODified Protein Domain Binding Kit; arrays must be purchased separately. See page 21 for details and ordering information.

TA B L E 1 :Examples of common protein domains and their binding specificity and function.

F I G U R E 1 :Shown are (A) a representative image of a developed MODified Peptide Array and (B) data produced by the Array Analyze Software to analyze the binding specifici-ties of the JMJD2A protein domain to various histone modifications using the MODified Protein Domain Binding Kit and the Modified Histone Array.

Binding Specificity of JMJD2A

0

0.2

0.4

0.6

0.8

1.0

H4 unm

odH4 K

20me3

H4 K16a

cH4 K

12ac

H4 K16a

c K20

me3

H4 K12a

c K16a

c K20

me3H3 u

nmod

H3 K27m

e3H3 R

26me2

sH3 R

26me2

aH3 R

26Citr

H3 R26

me2s K

27me3

H3 R26

me2a K

27me3

H3 R26

Citr K27m

e3

H3 K27m

e3 S2

8ph

H3 R26

me2s K

27me3

S28p

h

H3 R26

me2a K

27me3

S28p

h

MODified™ Array Peptide Identity

Aver

age

Inte

nsity

Addition of S28ph inhibits binding

Addition of modifications at R26have little effect on binding at K27me3

Single K27me3modification

A

B



hisTone ModifiCaTion quanTiTaTion

Histone Modification ELISAsmeasure global cellular changes in histone modifications

Active Motif’s Histone Modification ELISA Kits provide a sensi-tive, high-throughput method for quantifying global changes in the level of specific histone modifications, such as lysine methylation and acetylation, or phosphorylation of serine.

Active Motif has applied our histone modification antibody expertise to identify optimal antibody pairs for the detection of specific histone modifications and provided them in a simple sandwich ELISA format for your convenience and ease of use.

Assay cellular response by quantifying changes in the levels of specific histone modificationsFor researchers who want to determine the effects of com-pound treatment, disease state or other conditions on a spe-cific epigenetic modification, the Histone Modification ELISA Kits provide a simple-to-use high throughput assay for this purpose. The highly sensitive assay enables researchers to evalu-ate small changes in the levels of specific histone modifications from purified core histones (see page 24), or histones isolated by acid extraction.

How does it work?These easy-to use kits are sandwich ELISAs that utilize a capture antibody against histone H3 and a detecting antibody specific to the modification of interest. Assays are available for various acetyl, methyl and phosphoryl histone modifications as well as for Total Histone H3. An HRP-conjugated secondary antibody and developing solutions provide a sensitive colorimetric read-out in less than 3 hours. The assay is performed in a convenient 96-stripwell plate, enabling low or high throughput screening.

hisTone ModifiCaTion elisa advanTages

• Sensitive – works with purified core histones or acid extracted samples (Figure 1)

• Fast – assay can be completed in less than 3 hours

• Scalable – stripwell plates enable screening of 1 to 96 samples in a single experiment

• Quantitation controls – recombinant methylated and acetylated histones are included for quantitation of samples

• Colorimetric detection – results are easily quantified by spectrophotometry at 450 nm

F I G U R E 1 :The Histone H3 trimethyl Lys27 ELISA was used to assay H3K27me3 levels in purified HeLa core histones and HeLa acid extract. Control Recombinant Histone H3K27me3 protein provided in the kit was assayed as a reference standard curve.

Histone H3 Trimethyl Lys27 ELISA

0

0.2

0.4

0.6

0.8

1.0

1.2

1.4

1.6

0 3.125 6.25 12.5 25 50 100 125 250 5,000 10,000

Recombinant Histone H3 trimethyl Lys27 protein (provided positive control)

Purified CoreHistones

HeLa Acid

Sample (ng/well)

Extract

His

tone

H3

trim

ethy

l Lys

27 (O

D 4

50nm

)

Recombinant histone controls enable quantitationEach kit includes validated modification-specific recombinant protein controls synthesized using Active Motif’s patented technology. The methylated and acetylated recombinant histone controls can be used to generate a standard curve to quantify the amount of modified histone in each sample (Figure 1). The Total Histone H3 ELISA can be used to normalize the amount of histone modification in your samples when run in parallel with the methylated or acetylated Histone ELISAs. Untreated and paclitaxel-treated acid extracts are provided in the phosphorylated Histone ELISAs to serve as qualitative controls.

For an up-to-date list of available Histone Modification ELISAs, please visit www.activemotif.com/hiselisa.


Histone H3 monomethyl Lys4 ELISA 96 rxns 53101

Histone H3 dimethyl Lys4 ELISA 96 rxns 53112

Histone H3 trimethyl Lys4 ELISA 96 rxns 53113

Histone H3 acetyl Lys9 ELISA 96 rxns 53114

Histone H3 dimethyl Lys9 ELISA 96 rxns 53108


Histone H3 phospho Ser10 ELISA 96 rxns 53111

Histone H3 acetyl Lys14 ELISA 96 rxns 53115

Histone H3 monomethyl Lys27 ELISA 96 rxns 53104


Histone H3 phospho Ser28 ELISA 96 rxns 53100

Total Histone H3 ELISA 96 rxns 53110



hisTone PurifiCaTion

Histone Purification Kitsobtain the purest core histones samples for analysis

Achieving the best results is highly reliant on the quality of your input samples. Active Motif’s Histone Purification Kits provide researchers with the ability to obtain the purest, highest quality histones from virtually any cell or tissue sample for use in down-

stream analysis. We are the only company to offer a method for purification of core histones. Our proprietary technique yields the highest quality samples by improving purity and preserving native modifications better than crude acid extraction methods.

How does it work?Active Motif’s Histone Purification, Histone Purification Mini and Histone Purification Microplate Kits are the only commer-cially available assays for isolating purified core histones. The assays were designed to overcome the limitations of crude acid extraction methods for isolation of core histones. Our Histone Purification Kits use a unique purification resin and a series of proprietary elution buffers to isolate extremely pure fractions of histones from any cell or tissue sample. The results are im-proved yields, purity, and preservation of modifications above what is achievable with crude acid extraction. Purification of histones eliminates contaminating acid-insoluble cellular proteins that are left behind with standard acid extraction protocols. Removal of these impurities prevents additional enzymatic alterations to histone modifications, ensuring you have the highest quality histone samples for use in your downstream analysis (Figure 1).

Better substrate for downstream assaysPurified histones are ready for downstream analysis with Active Motif’s collection of histone modification antibodies (pages 2-3), or they can be used as substrates in functional assays, such as Active Motif’s Histone Modification ELISAs (page 23) and Chromatin Assembly Kit (page 33).

Which kit is right for you?Active Motif’s Histone Purification Kits are available in multiple formats so you can choose the one that best fits the needs of your assay. Use Table 1 below to determine which kit is right for you. To learn more, please visit www.activemotif.com/histonepur.

F I G U R E 1 :Acetyl, methyl & phosphoryl post-translational modifications are preserved as well or better with Histone Purification compared to acid precipitation methods.

Acetylation

Methylation

Phosphorylation

Kit Application Format Elution Capacity Purifications

Histone Purification Kit

• Low throughput

• Large sample quantities

Gravity Flow Separate H2A/H2B & H3/H4 fractions 0.5-2.5 mg 10

Spin Column H2A, H2B, H3 & H4 in a single fraction 0.5-2.5 mg 10

Histone Purification Mini Kit

• Medium throughput

• Mid-range sample quantities

Mini Spin Column H2A, H2B, H3 & H4 in a single fraction 0.1-0.5 mg 20

Histone Purification Microplate Kit

• High throughput

• Low sample quantities96 Stripwell Plate

Spin ColumnH2A, H2B, H3 & H4 in a single fraction < 0.48 mg 96

TA B L E 1 :Specifications for Active Motif’s Histone Purification Kits.



hisTone PurifiCaTion

which kit format best suits your histone purification needs?Histone Purification Kits, cont.

hisTone PurifiCaTion MeThod advanTages

• Exclusivity – only commercial kits available for histone purification

• Quality – enhanced histone purity and preservation of histone modifications

• Scalability – 3 throughput formats available to suit your needs

• Flexibility – works with cell or tissue samples

Histone Purification Kits for quality sample prepImprove the consistency and reliability of your analysis of histones and their post-translational modifications by using purified histone samples. Our proprietary histone purification method is available in three different format options to suit the throughput needs of your downstream analysis.

Histone Purification KitThe Histone Purification Kit enables you to isolate core histones from any cell culture or tissue sample. It was designed for larger sample amounts; the kit contains 10 columns, each with a capacity of 0.5-2.5 mg. Two options are available for purification – the core histones may be purified using the convenient spin column format as one total population containing H2A, H2B, H3 and H4, or further purified into separate fractions of H2A/H2B dimers and H3/H4 tetramers by using the efficient gravity flow protocol (Figure 1).


Histone Purification Kit 10 rxns 40025

Histone Purification Mini Kit 20 rxns 40026

Histone Purification Microplate Kit 96 rxns 40027

Histone Purification Mini KitThe Histone Purification Mini Kit offers the same proprietary purification protocol as the original Histone Purification Kit, but was designed to process smaller samples. It uses a more conve-nient mini spin column-based format, each with a capacity of 0.1-0.5 mg. This kit enables 20 purifications and allows for extrac-tion of the core histones as one total population. However, unlike the original kit, the Mini Kit cannot be used to separate histones into discrete H2A/H2B and H3/H4 fractions.

Histone Purification Microplate KitThe Histone Purification Microplate Kit offers the same propri-etary purification protocol as the original Histone Purification Kit, but uses a convenient plate-based format for high-throughput processing of small sample volumes. This kit is ideal for research-ers with limited starting material or who are seeking a method to readily transition their samples to downstream 96-well plate-based screening or profiling assays, such as our Histone Modifi-cation ELISAs (Figure 2, page 23) and Luminex® Histone H3 PTM Multiplex Assays (page 26). Similar to the Mini Kit, the Histone Purification Microplate Kit purifies core histones as one total (H2A, H2B, H3 and H4) population; it cannot fractionate the histones into discrete H2A/H2B and H3/H4 fractions.

F I G U R E 1 :SDS-PAGE of histone fractions purified using the Histone Purification Kit.

Total Histone H3 ELISA

0

0.5

1.0

1.5

2.0

2.5

3.0

3.5

40 20 10 5 2.5 1.25 .625 BlankAM Mini Kit

AM Microplate Kit

Crude Extraction

OD

450

nm

Recombinant H3 protein (ng/well)

F I G U R E 2 :Active Motif’s Histone Purification Mini and Microplate kits show improved histone yield over crude acid extraction as measured using the Total Histone H3 ELISA Kit (Cat. No. 53110, page 23).



MulTiPlex hisTone analysis

screen histone H3 post-translational modifications in multiplexHistone H3 PTM Multiplex Assay

Active Motif partnered with Luminex®, the industry leader in mul-tiplexing, to develop the Histone H3 PTM Multiplex Assay, the first epigenetic assay with multiplexing capability for high-throughput analysis of histone modifications. The assay is designed for use

with MAGPIX®, Luminex® 200™ or FLEXMAP 3D® instruments and can be completed in only 3 hours. Now it is possible to get more histone data using smaller sample amounts, in less time and at a lower cost than traditional methods, such as Western blot or IF.

How does it work?Active Motif’s Histone H3 PTM Multiplex Assay comes in a con-venient 96-well plate-based format for high-throughput screen-ing. It requires only nanogram sample amounts of either purified histones (learn about our Histone Purification Microplate Kit on page 25) or crude acid extracts, and is configured as a sandwich “ELISA” that takes place on a bead. Histones are captured us-ing fluorescent-labeled magnetic beads that are conjugated to antibodies recognizing specific post-translational modifications (PTMs) in histone tails. Each bead emits a unique fluorescent signal to enable the multiplexing of multiple analytes within the same sample. A biotinylated H3 C-terminal antibody is used to capture histones. Streptavidin-phycoerythrin is then added to bind the biotinylated antibody to provide a signal of the binding events (Figure 1). The Luminex instrument then deciphers both the identity of the bead and the number of binding events.

Streptavidin-phycoerythrin

BiotinylatedHistone H3 Ab

Histone containing apost-translational

modification (PTM)

PTM Antibody-conjugated bead

Ac

H3

SA-PE

Biotin

Me3

H3H3

SA-PE

Biotin

SA-PE

Biotin

P

F I G U R E 1 :Schematic of the Histone H3 PTM Multiplex Assay.

Simultaneously screen specific & off-target effectsThe Histone H3 PTM Multiplex assay is ideal for high through-put screening of changes in histone modification levels of clinical samples or compounds treatments for disease or drug discovery research. The multiplexing ability of the assay means that you can simultaneously analyze specific effects, off-target effects and unaffected targets all in a single well (Figure 2).

Post-screening, individual histone modifications can be analyzed using our Histone Modification ELISAs (page 23).

Specific Effects

No Effect

Off-target Effects

F I G U R E 2 :The Histone H3 PTM Multiplex Assay enables simultaneous analysis of increased histone acetylation, as well as off-target effects and unaffected tar-gets in HeLa cells occurring in response to SAHA-mediated HDAC inhibition.

whaT do i need for The assay?

• The Histone H3 PTM Multiplex Kit (Catalog No. 33115) contains buffers and reagents for performing the assay.

• Ab-conjugated Beads for the individual PTMs are sold separately to enable customizing of target selection. For an up-to-date list of available PTM targets, visit us at www.activemotif.com/luminex.

• Inclusion of Histone H3 Total Ab-conjugated Beads (Catalog No. 33116) in your multiplex enables you to normalize values and compare relative amounts of PTMs across samples.


Histone PTM Multiplex Kit 96 rxns 33115



reagenTs for drug disCovery

Drug discovery and development programs focused on epigenetics have attracted much attention and investment in recent years. This is driven by the potential to develop novel therapeutic strategies that can reverse transcriptional and epigenetic abnor-

malities. Active Motif is a leading provider of innovative technol-ogies for epigenetics and gene regulation research. Our assays, reagents and services can be easily integrated into your research to streamline the drug discovery workflow.

Tools to Streamline Epigenetic Drug Research

Biologically relevant assay substratesThe outcome of your in vitro biochemical assays are vastly improved when the system mimics actual cellular biology. To provide you the best choice of substrate for use in your assay, Active Motif offers over 60 different recombinant full-length modified H3 and H4 histones that are engineered using pat-ented technology to have structural and functional similarity to their native counterparts. These can be used as stand-alone substrates or assembled along with recombinant H2A and H2B to generate nucleosomes and oligonucleosomes. By choosing the most biologically relevant substrate, you can ensure the most accurate results.

To analyze epigenetic modifications or protein interactions in a chromatin context, Active Motif’s Chromatin Assembly Kit pro-vides an end-to-end solution for designing your own chromatin. The technique involves an ATP-dependent process to produce a chromatin substrate that mimics native in vivo chromatin structure. The assembled chromatin is ready to use in down-stream assays such as in vitro transcription assays, chromatin immunoprecipitation and enzyme activity assays.

Assay-ready proteins, enzymes and domainsThere is no need to waste valuable time and resources generating proteins for assay development. With Active Motif’s compre-hensive portfolio of over 300 purified assay-ready recombinant proteins – including transcription factors, histones, DNA and histone modifying enzymes, and bromodomains – you are sure to find what you need to develop more efficient assays for your drug discovery and development program.

Assays for enzymatic activityActive Motif offers a variety of robust, sensitive, high-through-put assays for quick and easy screening and profiling of cellular changes in the activity of histone modifying enzymes. These include our HAT Assay Kit to measure the activity of histone acetylases, the HDAC Assay Kits to analyze histone deacetylase activity and our Histone Demethylase Assay to analyze the lysine demethylase activity of LSD1.

Small molecule inhibitors and activatorsActive Motif has an expanding collection of small molecule compounds that target epigenetic modifiers of DNA methylation and chromatin remodeling for use in lead genera-tion and assay development. These include targets to DNA Methyltransferases (DNMTs), Histone Acetyltransferases (HATs), Histone Deacetylases (HDACs), Histone Methyltransferases (HMTs), Histone Demethylases (HDMs), and bromodomains.

Choosing the correct histone substrate for assay development is key to achieving the best results. Opinion leaders in epigenetics recognize the power of reconstituting recombinant chromatin for creating biologically relevant substrates.

WHICH HISTONE SUBSTRATE IS RIGHT FOR YOUR ASSAY?



reCoMbinanT ProTeins

Description Expressed In Format Cat. No.

HISTONES & MODIFIED HISTONESHistone H2A E. coli 50 µg 31251

Histone H2A.Z Synthetic 25 µg 31293

Histone H2B E. coli 50 µg 31252

Histone H3 (C110A) E. coli 100 µg 31207

Histone H3 pan-acetyl Synthetic 25 µg 31289

Histone H3T3ph E. coli 25 µg 31274

Histone H3K4ac E. coli 25 µg 31275

Histone H3K4me1 E. coli 50 µg 31208







Histone H3S10ph E. coli 25 µg 31272







Histone H3K27ac Synthetic 25 µg 31290










Histone H4 E. coli 50 µg 31223

Histone H4R3me2a Synthetic 25 µg 31291



Histone H4K16ac Synthetic 25 µg 31292





BIOTINYLATED HISTONESHistone H3 biotinylated E. coli 25 µg 31271

Histone H3K4me1 biotinylated E. coli 25 µg 31284






HISTONE ACETYLTRANSFERASES & DEACETYLASESHDAC1 protein Baculovirus 25 µg 31342

HDAC2 protein Baculovirus 25 µg 31343

HDAC3 complex Baculovirus 50 µg 31349

HDAC6 protein E. coli 10 µg 31346

HDAC7 protein Baculovirus 10 µg 31352

p300 protein Baculovirus 4 µg 31124

p300 protein, catalytic domain Baculovirus 5 µg 31205

SIRT1 protein E. coli 10 µg 31340

SIRT6 protein E. coli 25 µg 31336

HISTONE METHYLTRANSFERASES & DEMETHYLASESCARM1 protein Baculovirus 10 µg 31347

EZH2 protein complex Baculovirus 25 µg 31337

G9a protein Baculovirus 20 µg 31410

G9a-SET protein E. coli 20 µg 31425

GCN5 protein E. coli 5 µg 31204

FBXL10 / KDM2B protein Baculovirus 20 µg 31455

JMJD1A / KDM3A protein Baculovirus 20 µg 31456

JMJD2A / KDM4A protein Baculovirus 20 µg 31457

JMJD2C / KDM4C protein Baculovirus 20 µg 31458

JMJD2D / KDM4D protein Baculovirus 20 µg 31459

LSD1 / KDM1A protein Baculovirus 50 µg 31334

MECOM / PRDM3 protein Baculovirus 20 µg 31398

MLL / HRX - SET E. coli 20 µg 31419

MLL2-SET E. coli 20 µg 31420

MLL4-SET E. coli 20 µg 31422

MMSET / WHSC1 protein Baculovirus 20 µg 31453

PRC2 Complex Baculovirus 20 µg 31387

PRC2 EZH2(A677G) Complex Baculovirus 20 µg 31391

PRC2 EZH2(Y641C) Complex Baculovirus 20 µg 31389

PRC2 EZH2(Y641F) Complex Baculovirus 20 µg 31388

PRC2 EZH2(Y641N) Complex Baculovirus 20 µg 31390

PRDM10 protein Baculovirus 20 µg 31396

PRMT1 protein Baculovirus 20 µg 31411

PRMT2 protein Baculovirus 20 µg 31392

PRMT5 complex Baculovirus 20 µg 31356

Set2 protein E. coli 50 µg 31358


Set8 D338A protein E. coli 10 µg 31322


SETDB1 protein Baculovirus 20 µg 31452

SETMAR protein Baculovirus 20 µg 31454

Smyd1 protein Baculovirus 20 µg 31405

Smyd2 protein E. coli 10 µg 31323

Smyd5 protein Baculovirus 20 µg 31409

SUV39H1 protein E. coli 25 µg 31339

SUV420H1 protein E. coli 50 µg 31360UTX / KDM6A protein Baculovirus 20 µg 31460



reCoMbinanT ProTeins


BROMODOMAINSASH1L (2407-2579) E. coli 100 µg 31445

ATAD2 (981-1108) E. coli 100 µg 31376

BAZ1B (1340-1457) E. coli 100 µg 31444

BPTF / FALZ (2791-2911) E. coli 100 µg 31447

BRD1 (556-688) E. coli 100 µg 31438

BRD2 (344-455) E. coli 100 µg 31378

BRD3 (306-416) E. coli 100 µg 31377

BRD4 (44-168) E. coli 100 µg 31380

BRD7 (129-236) E. coli 100 µg 31381

BRD9 (130-259) E. coli 100 µg 31382

BRDT (21-137) E. coli 100 µg 31450

BRPF1 (627-746) E. coli 100 µg 31375

BRWD3 (1295-1443) E. coli 100 µg 31443

CREBBP (1081-1197) E. coli 100 µg 31373

GCN5 (726-837) E. coli 100 µg 31371

PBRM1 (23-156) E. coli 100 µg 31383

PBRM1 (464-605) E. coli 100 µg 31384

PCAF (715-829) E. coli 100 µg 31370

SMARCA2 / BRM (1367-1511) E. coli 100 µg 31449

SP140 (688-862) E. coli 100 µg 31448

TAF1 (1398-1524) E. coli 100 µg 31403

TAF1 (1522-1656) E. coli 100 µg 31439

TRIM24 (862-980) E. coli 100 µg 31368

TRIM33 (959-1069) E. coli 100 µg 31367

TRANSCRIPTION FACTORSER protein Baculovirus 4 µg 31119

c-Fos protein Baculovirus 5 µg 31115

FXR protein E. coli 10 µg 31120

GR protein Baculovirus 5 µg 31121

c-Jun protein Baculovirus 5 µg 31116

LXRa protein E. coli 10 µg 31122

MAD1 protein E. coli 10 µg 31329

MAD4 protein E. coli 10 µg 31248

MAX protein E. coli 10 µg 31244

c-Myc protein E. coli 5 µg 31117

NFκB p50 protein E. coli 15 µg 31301

NFκB p65 protein E. coli 15 µg 31302

p53 protein Baculovirus 5 µg 31103

PARP-1 protein Baculovirus 10 µg 31238

PPARa protein E. coli 10 µg 31125

PPARb(δ) protein E. coli 10 µg 31126

PPARg protein E. coli 10 µg 31127

RAR-a protein Baculovirus 5 µg 31130

RAR-b protein Baculovirus 5 µg 31131


pRb protein Baculovirus 5 µg 31128

RXR-a protein E. coli 10 µg 31133

RXR-b protein E. coli 5 µg 31134

RXR-LBD protein E. coli 10 µg 31135

Purified Sp1 protein HeLa cells 2 µg 31137

Recombinant Sp1 protein Baculovirus 5 µg 31136

Spt16 / FACT p140 protein Baculovirus 10 µg 31344

SSRP1 / FACT p80 protein Baculovirus 10 µg 31345

STAT3 protein E. coli 10 µg 31140

TBP protein E. coli 10 µg 31246

TFIIA2 protein E. coli 10 µg 31249

TFIIE a protein E. coli 10 µg 31241

TRa1 protein Baculovirus 10 µg 31138

TRb1 protein E. coli 10 µg 31139

USF1 protein E. coli 10 µg 31333YY1 protein E. coli 10 µg 31332

DNA METHYLATIONDNMT1 protein Baculovirus 10 µg 31335b-Glucosyltransferase enzyme E. coli 500 Units 55012PvuRts1 I restriction enzyme E. coli 50 Units 55011Tet1 protein E. coli 25 µg 31363

UBIQUITINATIONUBA1 protein E. coli 10 µg 31227UBC4 protein E. coli 10 µg 31228UBCH6 protein E. coli 100 µg 31362UBE2D2 protein E. coli 10 µg 31229UBE2D3 protein E. coli 10 µg 31230Ubiquitin protein E. coli 10 µg 31231Ubiquitin G76A protein E. coli 10 µg 31232

PROTEIN KINASESAKT1 protein Baculovirus 20 µg 31145AKT2 protein Baculovirus 100 µg 31146AKT3 protein Baculovirus 20 µg 31147EGFR protein Baculovirus 10 µg 31165ERK1 protein E. coli 10 µg 31152ERK2 protein E. coli 5 µg 31153FAK protein Baculovirus 10 µg 31168IKKb protein Baculovirus 10 µg 31176IKKε protein Baculovirus 10 µg 31177JAK2 protein Baculovirus 10 µg 31181Myelin Basic Protein, dephosphorylated Bovine 5 mg 31314PKA protein E. coli 50 µg 31158Src protein Baculovirus 10 µg 31195SYK protein Baculovirus 10 µg 31196

The recombinant proteins shown above are only a small sample of the over 300 recombinant proteins currently offered. For a complete, up-to-date list of all recombinant proteins available, please visit www.activemotif.com/proteins.



Inhibitors & Activators

Active Motif has an expanding collection of small-molecule epigenetic modulators (activators and inhibitors) that target changes to DNA methylation and chromatin remodeling proteins, such as histones. These include targets to DNA Methyltransferases (DNMTs), Histone Acetyltransferases (HATs),

Histone Deacetylases (HDACs), Histone Methyltransferases (HMTs), Histone Demethylases (HDMs), and the BET family bromodomains. As epigenetic aberrations are implicated in many diseases, these modulators are important tools for researchers in their assay development and drug discovery initiatives.

small molecules to modulate epigenetic processes

sMall MoleCule CoMPounds

Description Target Format Cat. No.

HISTONE DEACETYLASEApicidin HDAC inhibitor 1 mg

5 mg14041 14040

BML-210 HDAC inhibitor 5 mg 25 mg

14049 14048

CUDC-101 HDAC inhibitor 5 mg 25 mg

14061 14060

HPA (Hexyl-4-pentynoic acid) HDAC inhibitor 10 mg 50 mg

14035 14034

MS-275 HDAC inhibitor 5 mg 25 mg

14043 14042

Panobinostat HDAC inhibitor 5 mg 25 mg

14045 14044

Phenylbutyrate Na HDAC inhibitor 1 g 14033

Romidepsin HDAC inhibitor 1 mg 14083

Sodium Valproate HDAC inhibitor 5 g 14021

Splitomycin Sir2p inhibitor 5 mg 25 mg

14087 14086

Trichostatin A HDAC inhibitor 1 mg 5 mg

14039 14038

Tubastatin A HDAC inhibitor 1 mg 5 mg

14085 14084

Vorinostat (SAHA) HDAC inhibitor 10 mg 50 mg

14027 14026


LYSINE METHYLTRANSFERASE & LYSINE DEMETHYLASEBIX-01294 HMT inhibitor 5 mg

25 mg14073 14072

Chaetocin HMT inhibitor 200 µg 14051

Daminozide HDM inhibitor 50 mg 250 mg

14059 14058

DMOG HDM inhibitor 10 mg 50 mg

14063 14062

GSK-J1 (cell impermeable) HDM inhibitor 5 mg 25 mg

14069 14068

GSK-J4 (cell permeable) HDM inhibitor 5 mg 25 mg

14071 14070

IOX1 HDM inhibitor 5 mg 25 mg

14057 14056

ML-324 HDM inhibitor 5 mg 25 mg

14079 14078

Tranylcypromine hemisulfate HDM inhibitor 50 mg 250 mg

14047 14046


SIRTUINAK-7 SIRT2 inhibitor 5 mg

25 mg14055 14054

BML-278 SIRT1 activator 5 mg 25 mg

14025 14024

EX-527 SIRT1 inhibitor 5 mg 25 mg

14029 14028

Piceatannol SIRT1 activator 5 mg 25 mg

14037 14036

Resveratrol SIRT1 activator 100 mg 500 mg

14023 14022

SirtAct SIRT1 activator 5 mg 25 mg

14081 14080

Sirtinol SIRT2 inhibitor 5 mg 25 mg

14075 14074


METHYLATION5-Azacytidine DNA methyltransferase

inhibitor50 mg 250 mg

14103 14102

Decitabine (5-Aza-2́ -deoxycytidine)

DNA methyltransferase inhibitor

10 mg 50 mg

14101 14100

RG108 DNA methyltransferase inhibitor

5 mg 25 mg

14105 14104

Sinefungin Methylation inhibitor 1 mg 14089


BROMODOMAINJQ1 (racemic) Bromodomain inhibitor 5 mg

25 mg14067 14066


OTHERFK-866 HCl NAD biosynthesis inhibitor 5 mg

25 mg14031 14030


HISTONE ACETYLTRANSFERASEC646 HAT inhibitor 5 mg

25 mg14053 14052

CTPB HAT activator 5 mg 25 mg

14065 14064

Garcinol HAT inhibitor 10 mg 50 mg

14077 14076



hisTone aCeTylaTion & deaCeTylaTion

HAT & HDAC Assay Kits

Active Motif’s HAT & HDAC Assay Kits are easy-to-use, sensi-tive assays to analyze the activity of histone acetyltransferases and histone deacetylases in your cell and nuclear extracts, immunoprecipitates and purified enzymes, as well as to screen

the effects of potential inhibitor compounds. The HAT Assay Kit uses a fluorescent readout, while HDAC Assay Kits are available in both fluorescent and colorimetric formats.

rapid, sensitive assays for HAT & HDAC activity and inhibitor compounds

The HAT FamilyHistone acetyltransferases (HAT) are enzymes that acetylate conserved lysine amino acids on histones. Generally, histone acetylation is associated with the activation of gene expression, as hyperacetylated chromatin is transcriptionally active. Histone deacetylases (HDAC) remove these acetyl groups from histones. Their action is opposite to that of histone acetyltransferases, as hypoacetylated chromatin is silent. Because of the link between histone deacetylation and cell-static effects, there has been a surge in the interest of pharmaceutical companies in HDACs and their inhibition as possible strategies for therapeutic intervention.

How do the HDAC Assay Kits work?The HDAC Assay Kits utilize a peptide substrate that contains an acetylated lysine residue that can be deacetylated by Class I, IIB and IV HDAC enzymes. (Class III HDAC enzymes, or the Sirtuins, require the addition of the NAD+ cofactor in the assay.) Once the substrate is deacetylated, the lysine reacts with the Developing Solution to produce either a colorimetric or fluo-rescent product. The colorimetric product absorbs maximally at 405 nm; the fluorescent product can be read with an excita-tion wavelength of 360 nm and emission wavelength of 460 nm (Figure 2). A deacetylated assay standard is provided in each kit to enable calculation of HDAC activity in pmol/min/mg.

F I G U R E 1 :The HAT assay was used to analyze the effect of anacardic acid, a HAT inhibitor, on p300 activity.

0

5K

10K

15K

20K

25K

30K

35K

40K

Background p300 Anacardic Acid

p300 Activity

Histone H3 peptide

Histone H4 peptide

Arb

itra

ry F

luor

esce

nce

Uni

ts (A

FU)

F I G U R E 2 :Untreated and Trichostatin A-treated HeLa nuclear extracts were assayed for HDAC activity using the fluorescent version of the HDAC Assay Kit.

0

10000

20000

30000

40000

50000

UntreatedTrichostatin A

HeLa Nuclear Extract (µg)

Fluo

resc

ence

Inte

nsity

5 2.5 1.25 0.625 0.312 0.156 010


HAT Assay Kit (Fluorescent) 1 x 96 rxns 56100

Recombinant p300 protein, catalytic domain 5 µg 31205

Recombinant GCN5 protein, active 5 µg 31204

HDAC Assay Kit (Fluorescent) 1 x 96 rxns 56200

HDAC Assay Kit (Colorimetric) 1 x 96 rxns 56210

How does the HAT Assay Kit work?The HAT Assay Kit is a quick and sensitive method to de-termine the activity of your own source of purified histone acetyltransferases, or to screen for potential inhibitors of HAT activity. HATs will catalyze the transfer of acetyl groups from the provided acetyl-CoA to generate an acetylated peptide and CoA-SH. After stopping the reaction with stop solution, a developer is added that reacts with the free sulfhydryl groups on CoA-SH to give a fluorescent signal (Figure 1).

This fluorescent 96-well plate assay includes N-terminal histone H3 and H4 substrate peptides for screening HAT enzymes and a positive control p300 catalytic domain protein to screen for inhibitors. Anacardic acid is also provided for use as a control, as it is a potent HAT inhibitor. A standard curve can be generated with either b-mercaptoethanol or Coenzyme A in order to relate the fluorescence of your HAT to pmol/min/µg specific activity.



hisTone deMeThylaTion

Histone Demethylase Assay

Histone methylation is central to many biological processes, including transcriptional regulation and chromatin remodeling. LSD1 specifically demethylates H3K4 and H3K9 and regulates gene silencing during these processes. Active Motif’s Histone

Demethylase Assay provides a simple, high-throughput and accurate method to screen LSD1 demethylase activity. The assay employs a recombinant Histone H3K4me2 substrate that mimics native substrate to more closely resemble in vivo conditions.

screen LSD1 for histone demethylase activity

How does it work?The fluorescent Histone Demethylase Assay is a simple way to analyze the efficiency of lysine specific demethylase enzyme (LSD1, also known as KDM1) samples, or to screen inhibitor compounds that change histone demethylation activity. The Histone Demethylase Assay is designed to detect the formal-dehyde released from the reaction of LSD1 with a methylated substrate. As the LSD1 enzyme demethylates the recombinant histone substrate, formaldehyde is released as a by-product, which then reacts with the Detection Reagent to generate a fluorescent signal equivalent to the overall production of formaldehyde (Figure 1).

Better substrate for more accurate resultsThe provided Recombinant Histone H3K4me2 substrate mimics a native histone substrate for results that more closely resemble in vivo conditions. As shown in Figure 2, the LSD1 enzyme is able to more efficiently demethylate the included recombinant histone H3K4me2 protein than a histone H3K4me2 peptide sub-strate. Because the recombinant histone more closely resembles a native histone, the Histone Demethylase Assay enables more accurate analysis of histone demethylation activity.

What’s in the box?The Histone Demethylase Assay contains a Recombinant Histone H3K4me2 substrate, optimized buffers and black 96-well half area microplates to perform the assay. For added convenience, a Demethylation Standard, which can be used to quantify the amount of formaldehyde released, and an aliquot of LSD1 enzyme are included as controls. For more complete details, please visit www.activemotif.com/lsd1.


Histone Demethylase Assay (Fluorescent) 48 rxns 53200

Recombinant LSD1 / KDM1A protein, active 50 µg 31334

F I G U R E 1 :Fluorescence detection of LSD1 demethylase activity using the Histone Demethylase assay.

LSD1 Demethylase Activity

0

2K

4K

6K

8K

10K

12K

Blank LSD1 Background LSD1 + H3K4me2

Rela

tive

fluor

esce

nce

F I G U R E 2 :The Histone Demethylase Assay was used to compare LSD1 demethylase efficiency using different histone substrates. Results show that LSD1 demethylates H3K4me2 protein substrate more efficiently than H3K4me2 peptide.

Comparison of Methylated Histone Substrates

0%

10%

20%

30%

40%

50%

60%

70%

80%

LSD1 + H3K4me2 peptide LSD1 + Recombinant H3K4me2 protein

Form

alde

hyde

conv

ersio

n ef

ficie

ncy

14%

73%

hisTone deMeThylase assay advanTages

• The recombinant histone H3K4me2 substrate mimics a na-tive substrate to more closely resemble in vivo conditions

• Includes a Demethylation Standard for formaldehyde quantification and LSD1 enzyme for use as a positive control

• Simple, easy fluorescent assay for detection of the formaldehyde by-product



ChroMaTin asseMbly

Chromatin Assembly Kitthe most biologically relevant substrate for downstream success

Active Motif’s Chromatin Assembly Kit provides an easy and complete solution for chromatin reconstitution to produce a substrate that closely mimics native chromatin for downstream assays. In general, there are ATP-dependent and ATP-independent methods for reconstituting or assembling chromatin in vitro. The ATP-independent method results in a

random arrangement of histones on the DNA that does not accurately reflect the native core nucleosome. The Chromatin Assembly Kit is designed to assemble chromatin using an ATP-dependent process to generate an extended array of ordered nucleosomes on a length of DNA greater than 250 bp to produce the most biologically relevant substrate.

The Chromatin Assembly Kit advantageWith Active Motif’s Chromatin Assembly Kit, you can design your own chromatin. Using an ATP-dependent method, the included purified HeLa core histones are combined with the histone chaperone NAP-1 (h-NAP-1) in a high-salt buffer, which is ideal for proper histone configuration. Purified recombinant human chromatin assembly complex ACF and sample DNA are then added with the complete ATP regeneration system for in vitro assembly of extended, regularly ordered, periodic arrays of nucleosomes.

The resulting chromatin closely resembles natural in vivo chromatin, enabling studies of histone modifications and associ-ated proteins that are crucial to regulation of the target DNA sequence. The assembled chromatin is ready to use in down-stream assays such as in vitro transcription assays, chromatin immunoprecipitation and histone acetyltransferase (HAT) assays. Chromatin assembly is verified by partial digestion with the provided Enzymatic Shearing Cocktail and analyzed by gel electrophoresis. High-quality chromatin should yield six or more distinct bands (Figure 1). For your convenience, supercoiled DNA is provided as a positive control. For details on the Chromatin Assembly Kit, go to www.activemotif.com/chromassembly.

Nucleosome Assembly Control DNAThe Nucleosome Assembly Control DNA will prove to be a key component of your in vitro chromatin assembly reac-tions. The 187 bp double-stranded DNA containing the well-characterized 601 sequence was selected based on its ability to bind to histone octamers with high affinity. It can be directly added to your purified histones or histone extracts resulting in mononucleosome formation that can be easily visualized on a gel by mobility shift. The Nucleosome Assembly Control DNA can be used as a control to validate the proper assembly of the components of your in vitro chromatin assembly reactions. Alternatively, the Nucleosome Assembly Control DNA can be used as a template to monitor assembly kinetics in the presence or absence of chromatin-interacting proteins or compounds. For details on the Nucleosome Assembly Control DNA, please visit us at www.activemotif.com/nucleosomeDNA.

F I G U R E 1 : .Chromatin assembled from samples of circular DNA (Lanes 1 & 2) and linear DNA (Lanes 3 & 4) were digested for 2 and 4 minutes, respectively, deproteinated, phenol/chloroform extracted and run on an agarose gel. Each sample type processed with the Chromatin Assembly Kit resulted in regularly spaced nucleosomes.


Chromatin Assembly Kit 10 rxns 53500

HeLa Core Histones 36 µg 53501

Nucleosome Assembly Control DNA 50 µg 53502

why use The ChroMaTin asseMbly KiT?• Generate chromatin from linear or supercoiled DNA

• ATP-dependent method results in an extended array of regularly spaced nucleosomes

• The most biologically relevant substrate for your assays

• Easy protocol – simply incubate the supplied components with your DNA



NOMe-Seq

Active Motif’s NOMe-Seq Kit is the first commercially available assay that can be used to study the relationship between mul-tiple epigenetic modifications on the same DNA molecule. It is a high-resolution, single-molecule Nucleosome Occupancy and Methylome Sequencing kit that provides both a nucleosome footprint and a DNA methylation profile for the same DNA strand. While currently used research methods can determine

nucleosome occupancy or DNA methylation independently, NOMe-Seq is the first technique capable of providing simul-taneous information on both. This provides a means to better understand the different states of chromatin and their effects on gene regulation, and enables researchers to study the role of nucleosome and transcription factor occupancy in the context of DNA methylation for their specific gene of interest.

simultaneous analysis of nucleosome occupancy and DNA methylation profiles

ChroMaTin analysis

CpG sites

CpG sites

GpC sites

CpG sites

CpG sites

GpC sites

CpG sites

GpC sites

Fix cells & shear chromatin by sonication to > 1 kb

Treat with GpC Methyltransferase

Reverse cross-links/DNA purificationBisulfite conversion

PCR amplification/cloning, followed by sequencing

Unmethylated Methylated Nucleosome Bound transcription factor

≥ 147 bpNucleosome


10-80 bpProtein


NOMe-Seq Method

F I G U R E 1 :The NOMe-Seq method.NOMe-Seq begins with a formaldehyde fixation of cells that preserves nucleosome position as well as protein/DNA binding interactions. After sonication, the fragmented chromatin is enzymatically treated with a GpC methyltransferase to artificially methylate GpC residues that are not protected by bound nucleosomes or proteins. Following reversal of cross-links and DNA purification, bisulfite conversion is performed to identify the methylated cytosines on each DNA strand. For gene-specific analysis, the regions of interest are PCR amplified, cloned and sequenced. The GpC methylation profile will determine the nucleosome or protein binding site positions, while the CpG methylation reveals the endogenous methylation pattern of the gene of interest.

noMe-seq advanTages

• Simultaneous analysis of nucleosome occupancy and CpG methylation on the same DNA strand

• Provides a spatiotemporal relationship between nucleosome occupancy and DNA methylation

• Sensitive enough to detect even subtle changes in nucleosome position

• Lacks nucleosome occupancy bias that is seen when using nuclease digestion techniques

• Chromatin fixation also provides information regarding transcription factor binding sites

How does NOMe-Seq work?NOMe-Seq was developed by the Peter A. Jones laboratory to study the relationship between nucleosome occupancy, tran-scription factor binding and DNA methylation at specific gene loci.1-4 It begins with formaldehyde fixation of cells to preserve nucleosome position and protein/DNA binding interactions, followed by sonication. The fixed chromatin fragments are then treated with a GpC methyltransferase enzyme to artificially methylate GpC dinucleotides not protected by nucleosomes or other DNA-bound proteins. Because GpC residues are highly abundant, this method provides a high-resolution nucleosome occupancy footprint that can detect even subtle changes in nucleosome position. Following bisulfite conversion, gene-specific loci are sequenced to establish a DNA methylation profile for a single DNA strand. As GpC dinucleotides are not methylated in mammalian genomes, the sequencing results can be mapped to compare the artificially methylated GpC and the endogenously methylated CpG residues. A region of GpC sequence data containing unmethylated cytosines spanning 147 bp or larger represents the position of a nucleosome, while smaller unmethylated regions of 10-80 bp represent sites of transcription factor binding. By overlaying sequencing data for the artificial (GpC) and endogenous (CpG) methylation profiles, a spatiotemporal relationship between nucleosome occupancy and DNA methylation can be achieved for a single DNA strand. To learn more, please visit www.activemotif.com/nome-seq.


NOMe-Seq 10 rxns 54000

REFERENCES1. You, J.S. et al. (2011) Proc. Natl. Acad. Sci. 108(35): 14497-14502.2. Wolff, E.M. et al. (2010) PLoS Genetics 6(4): e1000917.3. Kelly, T.K. et al. (2010) Molecular Cell 39(6): 901-911.4. Kelly, T.K. et al. (2012) Genome Research doi:10.1101/gr.143008.112.



DNA Methylation / Demethylation Overview

The identification of 5-hydroxymethylcytosine (5-hmC), a derivative of the well-characterized 5-methylcytosine (5-mC) epigenetic mark, established a precedent for the role of Tet enzymes in catalyzing DNA demethylation as a mechanism for epigenetic reprogramming. Recent studies reveal that the path-way of demethylation may involve further oxidation of 5-hmC to 5-formylcytosine (5-fC) and 5-carboxylcytosine (5-caC) during

cell differentiation and development. To aid in the study of how DNA methylation and demethylation work in concert to regu-late gene expression, development, and stem cell identity, Active Motif has developed an expansive line of products and technol-ogies to address the most current and cutting edge areas in DNA methylation research. Let our antibodies, assays, enzymes and contract research services assist in your research efforts.

tools to analyze all aspects of DNA methylation

dna MeThylaTion ProduCTs

• CGBP Antibody (p. 2)• Methylated DNA Standard Kit (p. 43)

• Recombinant Tet1 Protein (p. 44)

• 5-fC Antibody (p. 45)


Tet

DNMT

Dec

arbo

xyla

se

Tet

Tet


• 5-caC Antibody (p. 45)• 5-Carboxylcytosine DNA Standard (p. 45)

• DNMT Activity/Inhibition Assay (p. 42)• DNMT Antibodies (p. 2)• Recombinant DNMT1 Protein (p. 29)• HP1 Antibodies (p. 3)• MBD Antibodies (p. 2)• MeCP2 Antibodies (p. 2)• Uhrf1 Antibody (p. 2)

• MethylCollector Ultra™ (p. 38)• HypoMethylCollector™ (p. 40)• MeDIP Assay (p. 39)• Bisulfite Conversion (p. 41)• 5-mC Antibodies (p. 39)• Methylated DNA

Standard Kit (p. 43)

• Hydroxymethyl Collector™ (p. 36)• hMeDIP Assay (p. 37)• PvuRts1I enzyme (p. 44)• b-Glucosyltransferase (p. 44)• 5-hmC Antibodies (p. 37)• Methylated DNA

Standard Kit (p. 43)

F I G U R E 1 :Schematic representation of the oxidation of 5-methylcytosine by Tet enzymes and related products.Tet enzymes catalyze the conversion of 5-methylcytosine (5-mC) to 5-hydroxymethylcytosine (5-hmC), 5-formylcytosine (5-fC), and 5-carboxylcytosine (5-caC) via oxidation of the methyl group at the 5-position on the cytosine ring. The schematic depicts the demethylation pathway and the various Active Motif products associated with each of the individual steps of the reaction.



Hydroxymethyl Collector™

The Hydroxymethyl Collector Kit is designed for the highly specific capture of DNA fragments that contain 5-hydroxymethyl-cytosine (5-hmC) residues. The method takes advantage of an efficient chemical labeling procedure that enables the enriched

samples to be collected as double-stranded DNA fragments. This makes it easy to prepare libraries for various downstream applications, including Next Generation sequencing (Figure 1). Please visit www.activemotif.com/hydroxy-mc for more details.

biotin-based magnetic bead enrichment of 5-hydroxymethylcytosine

5-hydroxyMeThylCyTosine dna enriChMenT

How does it work?The Hydroxymethyl Collector method utilizes a b-glucosyltransferase enzyme to transfer a modified glucose moiety to 5-hmC residues in double-stranded DNA. This modified glucose is then used to chemically attach a biotin conjugate for capture and enrichment using streptavidin-coated magnetic beads and a magnet (Diagram 1).

What’s in the box?The Hydroxymethyl Collector Kit contains reagents to per-form the glucosylation reaction, biotin conjugation, streptavidin capture, elution and purification of enriched DNA. For added convenience, positive control 5-hmC DNA and PCR primers are also included to confirm the efficiency of the enrichment.

Why use Hydroxymethyl Collector?Hydroxymethyl Collector is extremely specific in its capture of hydroxymethylated DNA fragments. Utilizing chemical label-ing of 5-hmC residues ensures no cross-reactivity with 5-mC, and the method is not limited by the specific properties or consensus sequences that constrain traditional methods, such as glucosyl-sensitive restriction enzyme digestion. Streptavidin magnetic beads are used to enable the quick and efficient recovery of enriched 5-hmC DNA in less than 4 hours. The high affinity of the biotin-streptavidin capture allows more stringent binding and wash conditions to enable enrichment of 5-hmC resi-dues that cannot be detected by antibody immunoprecipitation methods. The result is reduced background and increased sensi-tivity, enabling enrichment of DNA fragments containing as few as two 5-hmC residues. Enriched DNA can be used in the analysis of individual genes by PCR and qPCR, or with microarrays and sequencing for genome-wide analysis.

N

N

NH2O

O

HO

OH

HOHO

N3

Biotin

N

N

NH2O

O

HO

OH

HOHO

N3

N

N

NH2OH

HO

β-Glucosyltransferase + UDP-Azide-Glucose

(1 hr at 37°C)

Biotin Conjugate Solution

(1 hr at 37°C)

Magnetic Streptavidin

Beads (30 min at RT)

Elute the DNA from the Biotin(30 min at RT)

1. Fragmented DNA containing 5-hmC

Enriched DNA containing 5-hmC

is ready for analysis.5. Eluted DNA is purified using the included reagents.

2. Modified Glucosyl-5-hmC

3. Biotinylated Glucosyl-5-hmC

4. DNA is captured for washing and elution.

N

N

NH2O

O

HO

OH

HOHO

N3

N

N

NH2O

O

HO

OH

HOHO

N3

BiotinSA

D I AG R A M 1 :Flow chart of the Hydroxymethyl Collector method.F I G U R E 1 :

Human tiling array data showing enrichment of 5-hmC across the entire length of the JARID2 gene in chromosome 6 using human brain DNA that was enriched with Hydroxymethyl Collector.


Hydroxymethyl Collector™ 25 rxns 55013

hydroxyMeThyl ColleCTor advanTages

• Chemical labeling ensures specific modification of 5-hmC DNA without cross-reactivity of 5-mC sites

• Biotin-streptavidin binding enables more stringent binding and wash conditions, which reduces non-specific background without compromising assay sensitivity

• Use of dsDNA throughout the procedure makes it easier to prepare libraries for Next-Gen sequencing



hMeDIP

An alternative form of DNA methylation, 5-hydroxymethylcytosine (5-hmC), results from the enzymatic conversion of 5-methylcytosine (5-mC) into 5-hmC by the TET family of cytosine oxygenases. While its precise function has yet to be determined, it is postulated that 5-hmC, along with methylation variants 5-fC and 5-caC (see page 45), could represent a pathway to demethylate DNA. Active Motif’s hMeDIP Assay is specific

for the enrichment of DNA containing the 5-hmC residue and enables researchers to isolate 5-hmC DNA separate from 5-mC DNA to study the specific effects of 5-hmC on gene regulation (Figure 1). The hMeDIP Assay’s ability to distinguish between the two types of DNA methylation is highly advantageous as most common methods to analyze DNA methylation, such as bisulfite conversion, do not distinguish between 5-mC and 5-hmC residues.

easily obtain 5-hydroxymethylcytosine-specific DNA fragments

5-hMC dna iMMunoPreCiPiTaTion

How does it work?The hMeDIP assay is designed to isolate and enrich for DNA fragments containing 5-hydroxymethylcytosine. The assay contains a highly specific purified 5-hydroxymethylcytosine antibody and the necessary buffers to perform hydroxymethylated DNA immunoprecipitation (hMeDIP). The hMeDIP Assay starts with either double-stranded or single-stranded genomic DNA fragments. Following an overnight incubation with the 5-hydroxymethylcytosine antibody, and a 2 hour incubation with protein G magnetic beads, the included magnet is used to capture, wash and elute the immunoprecipitated 5-hmC DNA. The fast, magnetic protocol streamlines the number of wash and incubation steps needed, saving you valuable time.

What’s in the box?The hMeDIP Kit contains 5-hmC antibody, buffers, Protein G magnetic beads and a bar magnet for the immunoprecipitation, separation and elution of DNA fragments containing 5-hmC. Protocols are provided for DNA fragmentation all the way through to analysis by real-time PCR.

For added convenience, the kit also includes a negative control rabbit IgG antibody as well as DNA standards that can be used as spike-in controls to confirm the efficiency of the hMeDIP en-richment by qPCR with the provided PCR primer mix (Figure 1).

Antibodies for 5-hydroxymethylcytosine detectionIn addition to the complete hMeDIP Assay, Active Motif also offers both monoclonal and polyclonal antibodies for the study of 5-hydroxymethylcytosine. Each antibody has been validated for use in multiple applications, including dot blot and methyl-DNA immunoprecipitation (Figure 2). The polyclonal antibody is available in two formats depending on your preference: whole rabbit serum (Catalog No. 39769) and purified IgG (Catalog No. 39791). For more information about 5-hydroxymethylcytosine antibodies and assays, please visit www.activemotif.com/hmc.

genes + strand

Elevated signal in gene bodies

F I G U R E 2 :5-hMeDIP-chip performed on human brain DNA shows that 5-hmC is enriched primarily in the coding region of genes, rather than the promoter or regulatory regions.


hMeDIP Assay 10 rxns 55010

5-Hydroxymethylcytosine (5-hmC) antibody mAb 100 µg 39999

5-Hydroxymethylcytosine (5-hmC) antibody pAb 100 µl 39769

5-Hydroxymethylcytosine (5-hmC) antibody pAb (IgG) 100 µg 39791

hMeDIP-Seq servicesActive Motif also offers hMeDIP-Seq as a custom service. See page 47 or visit us at www.activemotif.com/services for details.

0

2K

4K

6K

8K

unDNA meDNA hmeDNA Neg Ctrl Rabbit IgG

Fold

enr

ichm

ent

F I G U R E 1 :Real-time PCR results of hMeDIP assay performed on Mse I digested human genomic DNA spiked with the included unmethylated, methylated or hydroxymethylated DNA standard controls.



5-MeThylCyTosine dna enriChMenT

MethylCollector™ Ultra

Active Motif’s MethylCollector Ultra Kit* provides improved enrichment of CpG-methylated DNA compared to alter-native methyl-binding domain protein (MBD) or antibody

immunoprecipitation methods. Enriched DNA is suitable for use in various downstream applications such as PCR, bisulfite con-version, or amplification and labeling for microarray analysis.

fast magnetic assay for specific enrichment of CpG-methylated DNA

Why use MethylCollector Ultra?Active Motif’s MethylCollector Ultra Kit improves the enrichment of CpG-methylated DNA by incorporating the Methylated CpG Island Recovery Assay (MIRA), which uses a combination of methyl-binding proteins (MBD2b and MBD3L1) to increase the affinity for methylated DNA fragments.1 This unique protein complex provides greater specificity for methylated CpG dinucleotides than alternative MBD or antibody immunoprecipitation (MeDIP) methods, in less than half the time. The kit also includes positive control human, male genomic DNA and methylation-specific PCR primers to validate your results.

What’s in the box?The MethylCollector Ultra Kit contains all necessary components for enrichment of CpG-methylated DNA including His-MBD2b/MBD3L1 protein complex, binding and elution buffers, and magnetic nickel beads. Control Mse I digested genomic DNA, PCR primer mixes and reagents are also included to confirm the efficiency of the enrichment by real-time PCR.


MethylCollector™ Ultra 30 rxns 55005* Technology covered under U.S. Patent No. 7,425,415.

F I G U R E 2 :Real-time PCR analysis of methylated, SNRPN (red), and unmethylated, FOXD2 (blue), promoters validates MethylCollector Ultra specificity.

His-MBD2b/MBD3L1 Capture(MethylCollector™ Ultra)

8

7

6

5

4

3

2

1

12 16 20 24 28 32 36 40

Cycle

SNRPNFOXD2

Rn

Break open cells and shearDNA by Sonication orEnzymatic Shearing.

methylatedDNA

Incubate sheared DNA withHis-tagged MBD2b/MBD3L1

protein complexes.

The purified, methylatedDNA is ready

for PCR analysis.

Elute the bound, methylatedDNA, while simultaneously

degrading the protein complexes.

Capture the methylated protein-DNA complexes with nickel-coated magnetic beads.

Wash to remove the unmethylated

DNA fragments.

F I G U R E 1 :Flow chart of the MethylCollector Ultra process.

REFERENCES1. Rauch, T. and Pfeifer, G. (2005) Lab. Investigation 85: 1172-1180.

MeThylColleCTor ulTra advanTages

• Improved efficiency – provides greater enrichment of CpG-methylated DNA than other MBD capture or antibody immunoprecipitation (MeDIP) methods

• Faster procedure – magnetic protocol can be completed in less than 3 hours

• Uses minimal sample material – requires as little as 1 ng of DNA fragmented by sonication or enzymatic digestion

• Controls ensure success – includes positive control DNA and methylation-specific PCR primers

MethylCollector Ultra-Seq (MIRA-Seq) servicesMethylCollector Ultra-Seq is also offered as a custom service by Active Motif’s Epigenetic Services. Customers can submit their cells or DNA and receive fully analyzed genome-wide methylation data in just weeks. For more complete details, see page 47 or visit us at www.activemotif.com/services.



why use The MediP assay?• Works efficiently with 100 ng – 1 µg of fragmented,

single-stranded DNA

• Includes 5-mC and Bridging antibodies for methylated DNA enrichment, and a negative control mouse IgG antibody

• Positive control human genomic DNA and PCR primers are provided to verify the efficiency of the enrichment

• Fast magnetic protocol minimizes the number of wash and incubation steps, saving you valuable time

• Enriched DNA can be used for downstream applications including real-time PCR and Next Generation sequencing

MeDIP

Methylated DNA Immunoprecipitation (MeDIP) is an immuno-capture technique in which an antibody specific for 5-methylcy-tosine is used to immunoprecipitate methylated DNA fragments from the rest of the sample population. One advantage of using the MeDIP antibody capture approach over methyl-binding

protein capture is that the MeDIP antibody is not limited to the study of DNA methylation in the context of CpG dinucleotides. The antibody can also immunoprecipitate DNA fragments that contain CpA or CpT methylation, which has been reported to exist in embryonic stem cells.

How does it work?The MeDIP assay utilizes a highly specific monoclonal antibody that recognizes 5-methylcytosine (5-mC) to immunoprecipitate and enrich for methylated DNA. The assay begins by heat de-naturing fragmented genomic DNA to generate single-stranded fragments. This step is critical because the 5-Methylcytosine antibody does not recognize 5-mC on double-stranded DNA, as shown in Figure 1. The 5-Methylcytosine antibody is then added to the DNA in the presence of a Bridging Antibody and protein G magnetic beads. The reactions undergo an overnight incuba-tion before the included magnet is used to capture, wash and elute the 5-methylcytosine containing DNA from the protein G beads. For added convenience, the kit also includes a negative control mouse IgG antibody, positive control Mse I digested human genomic DNA and real-time PCR primers that can be used to verify the efficiency of the MeDIP enrichment.

specific enrichment of 5-mC DNA using antibody immunoprecipitation

5-MC dna iMMunoPreCiPiTaTion

F I G U R E 2 :Next-Gen sequencing data of human PBMC DNA enriched by MeDIP shows enriched regions correlate well with CpG density.

Antibodies for 5-methylcytosine detectionIn addition to the MeDIP Assay, the 5-mC and Bridging antibodies can be purchased separately. The 5-Methylcytosine antibody is a mouse monoclonal antibody, Clone 33D3, that has been validated for applications such as MeDIP, IP, flow cytometry, IHC and dot blot. A polyclonal 5-mC antibody is also available.

Bridging Antibody can be used to improve immunoprecipitation reactions. Some isotypes of mouse IgG antibodies do not bind well to protein G-conjugated agarose/magnetic beads. The inclusion of a Bridging Antibody into the reaction can increase capture efficiency due to the Bridging Antibody’s strong affinity to both the protein G beads and the mouse IgG (Figure 2).


MeDIP Assay 10 rxns 55009

5-Methylcytosine (5-mC) antibody mAb (Clone 33D3) 50 µg 39649

5-Methylcytosine (5-mC) antibody pAb 100 µg 61255

Bridging Antibody for Mouse IgG 500 µg 53017

F I G U R E 1 :Dot blot analysis of DNA methylation antibody binding specificity.Unmethylated (DNA), 5-meth-ylcytosine (5-mC) and 5-hydroxymethylcytosine (5-hmC) DNA from the Methylated DNA Standard Kit (Catalog No. 55008) was probed with 5-Methylcytosine antibody (Catalog No. 39649) (Top panel) and 5-Hydroxymethylcytosine antibody (Catalog No. 39769) (Bottom panel). Lane 1: single-stranded DNA. Lane 2: double-stranded DNA.

MeDIP-Seq servicesActive Motif now offers MeDIP-Seq as a custom service. See page 47 or visit us at www.activemotif.com/services for details.

To learn more about Active Motif’s DNA methylation antibod-ies and assays, please visit www.activemotif.com/dnamt.

MeDIP CpG Density



unMeThylaTed dna enriChMenT

HypoMethylCollector™for enrichment of hypomethylated DNA regions

Active Motif’s HypoMethylCollector Kit is a novel assay for the specific enrichment of hypomethylated DNA from cell or tissue samples. The HypoMethylCollector Kit utilizes the CXXC do-main from mouse methyl binding protein, MBD1, to specifically capture DNA fragments lacking CpG methylation. The method

is capable of binding DNA fragments that contain only a single unmethylated CpG dinucleotide, while methylated DNA remains unbound. The kit also includes optimized buffers, magnetic beads for convenient wash and elution steps, control DNA, and PCR primers suitable for use in endpoint or qPCR analysis.

Why use HypoMethylCollector?Methylation at the fifth-carbon of cytosine in a CpG dinucleotide is an extremely important DNA modification in eukaryotes. While CpG islands, short CG-rich regions, are found only in approxi-mately 1% of the genome, more than 60% of human promoters contain CpG islands. Normally, CpG islands are unmethylated; in cases where methylation does occur, the associated gene is silenced. Due to the importance of methylation in the context of disease, Active Motif’s HypoMethylCollector Kit provides a simple method for enhanced analysis of CpG island methylation in normal and diseased samples. The HypoMethylCollector Kit makes it possible to identify hypomethylated promoters and to study the effects of inhibitor compounds with a positive readout.


HypoMethylCollector™ 30 rxns 55004

How does it work?The HypoMethylCollector Kit uses a recombinant His-CXXC protein to specifically bind unmethylated CpG sites. The kit provides two binding buffers: a low-salt buffer for use with samples containing less than 5 CpG dinucleotides and a higher salt buffer for efficient binding of samples with a large number of CpGs. Nickel-coated magnetic beads capture the protein-DNA complexes, which are separated from the rest of the genomic DNA using the included magnet. Following clean up, the eluted DNA is ready for use in PCR analysis, sequencing or other downstream applications.

Specificity of the HypoMethylCollector technique for hypomethylated DNA fragments has been validated using both a side-by-side comparison of fractions obtained from HypoMethylCollector and MethylCollector™ Ultra Kits across multiple loci (Figure 1), and by bisulfite sequencing analysis (Figure 2).

What’s in the box?The HypoMethylCollector Kit includes His-CXXC protein to bind unmethylated CpG sites, optimized buffers, reagents and beads for capture of protein-DNA complexes, as well as control PCR primers and Mse I digested genomic DNA to validate your results prior to downstream analysis.

F I G U R E 1 :Direct comparison of HypoMethylCollector and MethylCollector Ultra using real-time PCR illustrates each kit’s unique specificity. HypoMethylCollector clearly captures the unmethylated GAPDH locus, while MethylCollector Ultra enriches for the methylated Xist promoter.

0%

20%

40%

60%

80%

100%

120%

140%

Unbound Eluted

Low Salt Binding Conditions

Enric

hmen

t

GAPDH (unmethylated) Xist (methylated)

HypoMethylCollector™

0%

20%

40%

60%

80%

100%

120%

Unbound Eluted

Low Salt Binding Conditions

Enric

hmen

t

GAPDH (unmethylated)

Xist (methylated)

MethylCollector™ Ultra

12345678

Bisulfite sequence results for APC (19 CpGs)

Methylated CpG

Unmethylated CpG

F I G U R E 2 :HypoMethylCollector was used to enrich for unmethylated DNA fragments. DNA was bisulfite treated (see page 41 for details) to confirm the specificity of HypoMethylCollector.



Bisulfite Conversion Kitsimplified bisulfite conversion of DNA with easily verified results

bisulfiTe Conversion

Bisulfite conversion followed by DNA sequencing is considered the gold standard in DNA methylation analysis as it provides single-base-pair resolution of the DNA methylation profile. The conversion reaction occurs as a three-step deamination of

cytosine residues into uracil (Figure 1). As only unmethylated cytosine residues are susceptible to bisulfite conversion, the original methylation state of the DNA can be determined. For more details, please visit www.activemotif.com/bis-conv.

Bisulfite Conversion Kit advantagesThe Bisulfite Conversion Kit simplifies the bisulfite treatment of DNA while minimizing DNA fragmentation, degradation and sample loss during the procedure and cleanup steps. A thermal cycler is used to denature the DNA and perform bisulfite con-version in as little as 1.5 hours.

Using a thermal cycling approach gives an added advantage as it has been shown that using a fixed temperature halts the con-version reaction, whereas temperature cycling during the reac-tion improves the overall efficiency of the conversion reaction. The included spin columns combine desulfonation and DNA purification into a single step. The purified, converted DNA is ideal for PCR amplification and sequencing, endonuclease diges-tion and other downstream applications (Figure 2).


Bisulfite Conversion Kit 50 rxns 55016

What’s in the box?Each Bisulfite Conversion Kit contains proteinase K for pre-treatment of the DNA, optimized conversion and purification reagents, an easy-to-use protocol and conversion-specific PCR primers suitable for use with human and mouse samples. Because the conversion-specific primer pair produces a PCR product only if conversion has occurred, the primers can be used to validate the results before starting sequencing or other analysis methods.

Bisulfite sequencing servicesActive Motif Epigenetic Services team now offers both Targeted Next-Gen Bisulfite Sequencing and traditional Sanger Bisulfite Sequencing. The bisulfite sequencing services includes primer design and testing, isolation of DNA from cells, bisulfite conversion of DNA, PCR amplification and gel analysis of PCR products, gel purification of PCR products, cloning of PCR products, amplification of cloned inserts, sequencing and data analysis. For more information, see page 47 or go to www.activemotif.com/services.

KiT highlighTs

• Rapid conversion of DNA in as little as 1.5 hours

• Minimal DNA fragmentation, degradation and loss

• Thermal cycling approach for better conversion efficiency

• Reproducible assay consistently provides 99% conversion efficiency of unmethylated cytosines

• Easily convert 200 pg – 2 µg DNA

• Conversion-specific PCR primers included to validate results

GATCGAUGATCGGAGUGTAGGTACGAUGTT

GATCGACGATCGGAGCGTAGGTACGACGTT

Me MeMe

GATCGATGATCGGAGTGTAGGTACGATGTT

Bisulfite Conversion

PCR Amplification

F I G U R E 1 :Example of bisulfite treatment modifying unmethylated cytosine residues into uracil, which are then converted to thymines following PCR amplifica-tion. Methylated cytosines remain unchanged.

-20 0 20 40 60 80 100 120 140 160 180 200 220 240 260 280 300

Unmethylated CpGMethylated CpG

F I G U R E 2 :Bisulfite sequencing results for the CCND2 locus in PC-9 human lung adenocarcinoma cells. Red circles are methylated CpGs and blue circles are unmethylated CpGs.



In mammals and other vertebrates, DNA methylation occurs at the 5 position of cytosine (5-mC), mostly within CpG dinucleotides. Modifications at these sequences by DNA methyltransferase enzymes (DNMTs) can have profound effects

on transcription. Active Motif’s DNMT Activity / Inhibition Assay is a fast, user-friendly assay to simplify the measurement of DNA methyltransferase activity or the efficacy of DNMT inhibitors without the need for radioisotopes or expensive equipment.

non-radioactive assay to screen for DNA methyltransferase activity

Unique method enhances sensitivityThe DNMT Activity / Inhibition Assay is a non-radioactive assay to measure the activity or inhibition of DNA methyltransferases. The assay employs a unique and sensitive ELISA-based method that utilizes a methyl-CpG binding domain (MBD) protein to detect methyltransferase activity. In the assay, a universal CpG-enriched DNA substrate has been immobilized on a 96-stripwell plate. Purified DNMTs or DNMT activities from nuclear extracts are added, which catalyze the transfer of meth-yl groups from the provided AdoMet reagent to the coated DNA substrate. The resulting methylated DNA is recognized and bound by the recombinant MBD2b protein. MBD proteins are capable of binding methylated DNA with a higher affinity than antibodies, increasing the sensitivity of the assay relative to antibody-based methods. Addition of a polyHistidine antibody conjugated to horseradish peroxidase (HRP) and developing solution provides a sensitive colorimetric readout that is easily quantified by spectrophotometry. With this method, activity can be detected from as little as 0.5 ng of purified enzyme or 0.5 µg of nuclear extract (Figure 1). The DNMT assay can also be used to screen for DNA methyltransferase inhibitors (Figure 2). For more complete information on the DNMT Activity / Inhibi-tion Assay and DNMT-related products, please visit us at www.activemotif.com/dnmt.


DNMT Activity / Inhibition Assay 1 x 96 rxns 55006

F I G U R E 1 :The DNMT Activity / Inhibition Assay range of detection is demonstrated with increasing concentrations of Jurkat nuclear extracts prepared using Active Motif’s Nuclear Extract Kit (Catalog No. 40010).

DNMT Activity from Nuclear Extracts

0

0.2

0.4

0.6

0.8

1.0

Blank 0.625 1.25 2.5 5 10

Jurkat Nuclear Extracts (µg/well)

OD

450

nm

F I G U R E 2 :The DNMT Activity / Inhibition Assay was used to show DNMT inhibition in MCF-7 cells treated with procaine versus untreated cells.

DNMT Activity / Inhibition Assay

0

0.2

0.4

0.6

0.8

1

1.2

1.4

0.313 0.625 1.25 2.5 5 10

Extract (µg/well)

OD

450

nm

MCF-7 Untreated

MCF-7 + 5 mM Procaine

dna MeThylTransferases (dnMT)

DNMT Activity / Inhibition Assay

dnMT assay advanTages

• Non-radioactive – colorimetric assay is easily quantified by spectrophotometry on a microplate reader at 450 nm

• Sensitive – unique MBD protein approach enhances the sensitivity of detection from both purified proteins (DNMT1, DNMT3a & DNMT3b) and nuclear extracts

• Fast – assay can be completed in less than 3 hours

• Flexible – stripwell plate allows screening in low or high throughput

What’s in the box?The DNMT Activity / Inhibition Assay provides all the opti-mized buffers and reagents needed to measure activity of recombinant DNMT enzymes or nuclear extract samples, including substrate-coated plates for DNMT capture, AdoMet, His-MBD2b protein and anti-polyHis-HRP antibody for detection. A CpG Methyltransferase is also included as a positive control.



Methylated DNA Standards

Active Motif understands the importance of using appropriate controls to validate experimental results. That is why Active Motif offers a Methylated DNA Standard Kit, which can be used to study unmethylated DNA, 5-methylcytosine methylated DNA

and 5-hydroxymethylcytosine methylated DNA. And, for those researchers who require the study of DNA in a genomic con-text, Active Motif also offers both fully methylated and Jurkat genomic DNA.

Methylated DNA Standard KitThe methylation of cytosine residues at CpG dinucleotides is an important event that regulates gene expression and genome organization. To better understand the implications of DNA methylation on gene regulation and disease, Active Motif offers the Methylated DNA Standard Kit, which contains positive control DNA oligonucleotides for each of the three cytosine methylation states: unmethylated, 5-methylcytosine and 5-hydroxymethylcytosine. The kit is ideal for use as a control in experiments utilizing antibodies specific to the different types of DNA methylation.

The Methylated DNA Standard Kit includes three recombinant DNA standards derived from the APC gene promoter. Each standard is 338 base pairs and contains multiple cytosine resi-dues in both CpG and non-CpG contexts. Each oligonucleotide is generated to be 100% unmethylated, 5-methylcytosine meth-ylated or 5-hydroxymethylcytosine methylated. In addition to the DNA standards, PCR primers specific to the APC promoter are also provided. The identity of the methylated standards are confirmed by dot blot antibody detection (Figure 1).

DNA standards for studying different types of methylation


Methylated DNA Standard Kit 3 x 2.5 µg 55008

Fully Methylated Jurkat DNA 10 µg 55003

Jurkat genomic DNA 10 µg 55007

F I G U R E 1 :Dot blot analysis of Methylated DNA Standard Kit samples.Fifty nanograms of the DNA standards included in the Methylated DNA Standard Kit were spotted onto a positively charged nylon membrane: DNA (unmethylated DNA), 5-mC (5-methylcytosine methylated DNA), 5-hmC (5-hydroxymethylcytosine methylated DNA). Top panel: Dot blot probed with 5-Methylcytosine antibody (Catalog No. 39649). Bottom panel: Dot blot probed with 5-Hydroxymethylcytosine antibody (Catalog No. 39769). Lane 1: single-stranded DNA. Lane 2: double-stranded DNA.

Fully Methylated Jurkat DNAActive Motif offers Fully Methylated Jurkat DNA for use as a control in your DNA methylation applications. Whether you are performing bisulfite sequencing, methylation-specific PCR (MSP), MeDIP or using our MethylCollector™ Ultra or MethylDetector™ Kits, Fully Methylated Jurkat DNA is a con-venient positive control for investigating CpG dinucleotide methylation.

Fully Methylated Jurkat DNA is supplied with a BRCA1 primer set. As native Jurkat DNA is not methylated at the BRCA1 locus, this primer set is ideal for use as a control in methylation-specific experiments with Fully Methylated Jurkat DNA. Jurkat genomic DNA is also available.

MeThylaTed dna sTandard KiT advanTages

• Enables inclusion of controls in experiments involving both forms of DNA methylation, 5-methylcytosine and 5-hydroxymethylcytosine

• Includes primers that enable detection of the control DNA using endpoint or real-time PCR

• Validated for use in MeDIP, hMeDIP (See pages 37-39) and dot blot experiments

• DNA is methylated at both CpG and non-CpG sites

Active Motif offers a broad range of antibodies and assays for the study of DNA methylation. To learn more about the antibodies available for the detection of 5-methylcytosine and 5-hydroxymethylcytosine, please see pages 37 & 39.

For a complete list of available DNA methylation assays, please visit us at www.activemotif.com/dnamt.

MeThylaTed dna sTandards



5-Hydroxymethylcytosine Enzymes

To assist researchers working to elucidate the functions of 5-hydroxymethylcytosine in gene regulation, Active Motif is pleased to offer enzymes to study not only the mecha-nism by which 5-methylcytosine (5-mC) is converted into 5-hydroxymethylcytosine (5-hmC), but also enzymes that can

differentiate between these two forms of DNA methylation. We offer our Tet1 enzyme to study the mechanism of conversion, our b-glucosyltransferase enzyme for the addition of glucose to hydroxymethylcytosine and our novel PvuRts1I enzyme for the direct discrimination of hydroxymethylated DNA.

additional offerings for the study of hydroxymethylated DNA

5-hydroxyMeThylCyTosine aCCessories

F I G U R E 2 :Specificity of PvuRts1I enzymatic digestion of 5-hmC DNA is shown by unmethylated (Un), 5-methylcytosine (mC) or 5-hydroxymethylcytosine (hmC) Methylated DNA Standards (Catalog No. 55008, see page 43 for complete details) that were incubated in the absence (–) or presence (+) of PvuRts1I.

F I G U R E 1 :Dot blot of double-stranded DNA containing 5-methylcytosine that was incubated with 5 µg of recombinant Tet1 enzyme (+Tet1) or without Tet1 (-Tet1) shows the conversion of 5-methylcytosine into 5-hydroxymethylcytosine by Tet1.

b-Glucosyltransferase modification of 5-hmCThe recent identification that the TET family of dioxygenases can convert 5-methylcytosine (5-mC) into 5-hydroxymethylcytosine (5-hmC) has raised questions about the functional relevance of 5-hmC in mammalian genomes. b-glucosyltransferase serves as a valuable tool to analyze 5-hmC because this enzyme is capable of modifying 5-hydroxymethylcytosine with the addition of a glucose moiety. This glucosylated residue can easily be distinguished from tradi-tional 5-methylcytosine by the use of glucosyl-sensitive restric-tion enzymes. Alternatively, use of the b-glucosyltransferase enzyme in combination with a radiolabeled UDP-glucose donor allows for direct labeling of hydroxymethylated residues.


Recombinant Tet1 protein, active 25 µg 31363

PvuRts1I restriction enzyme 50 Units 55011

b-Glucosyltransferase enzyme 500 Units 55012

Tet1 enzyme converts 5-mC DNA into 5-hmC DNATet1 (Ten-eleven Translocation Gene Protein 1) is a member of the TET family of cytosine oxygenases that convert 5-meth-ylcytosine (5-mC) into 5-hydroxymethylcytosine (5-hmC). For researchers interested in studying the mechanism of how 5-hydroxymethylcytosine is generated, our Recombinant Tet1 protein is an active enzyme that can be used to convert 5-mC containing DNA into 5-hmC containing DNA (Figure 1).

Direct digestion of 5-hydroxymethylcytosineWhile glucosyl-sensitive restriction enzymes offer a method to enzymatically differentiate between 5-mC and 5-hmC, they require the prior addition of a glucose moiety to the 5-hydroxymethylcytosine residue. Active Motif’s novel PvuRts1I restriction enzyme, however, is able to bypass this intermedi-ary step and directly differentiate between 5-mC and 5-hmC residues. PvuRts1I directly cleaves hydroxymethylated DNA in its non-glucosylated form, but will not digest 5-methylcytosine or unmethylated cytosine residues (Figure 2). The enzyme also cleaves glucosylated-5-hmC DNA, but at a lower efficiency. To learn more about this unique enzyme’s digestion properties, please visit www.activemotif.com/hmc.



F I G U R E 3 :Dot blot analysis of varying amounts of DNA from the 5-Carboxylcytosine DNA Standard Kit that were spotted onto a nylon membrane shows specificity of Active Motif’s 5-Carboxylcytosine antibody (Catalog No. 61225) for 5-caC.

F I G U R E 2 :Representative confocal images of fertilized oocytes co-stained with Active Motif’s 5-Formylcytosine (5-fC) and 5-Carboxylcytosine (5-caC) antibodies (red, Catalog Nos. 61223 and 61225, respectively), and a 5-methylcytosine (5-mC) antibody (green) (Inoue et al.*).

F I G U R E 1 :Shown are representative immunofluorescent images of mitotic chromosome spreads that have been co-stained with Active Motif’s 5-Formylcytosine (left) or 5-Carboxylcytosine (right) antibodies (red, Catalog Nos. 61223 and 61225, respectively), a 5-methylcytosine (5-mC) antibody (green) and DAPI (blue) at the two-cell stage of mouse preimplantation development. The images reveal that, at the two-cell stage, only one of the two sister chromatids is enriched for 5-fC and 5-caC, consistent with findings that 5-fC and 5-caC levels are diminished by half in blastomeres with each round of DNA replication (Inoue et al.*).

5-Formylcytosine (5-fC) & 5-Carboxylcytosine (5-caC)antibodies to study alternative forms of cytosine methylation

The TET family of cytosine oxygenases, which convert 5-methyl-cytosine (5-mC) into 5-hydroxymethylcytosine (5-hmC), further oxidize 5-hmC into 5-formylcytosine (5-fC) and 5-carboxylcytosine (5-caC). These two novel DNA modifications have been found to exist in many vertebrate cell types, includ-ing embryonic stem cells. 5-fC and 5-caC appear in the paternal pronucleus after fertilization (Figure 2), concomitant with the

disappearance of 5-mC. The levels of 5-fC and 5-caC are gradual-ly diluted out by DNA replication, rather than being enzymatical-ly removed (Figure 1). While this pathway may represent a mecha-nism by which 5-mC methylation is removed, these variants may also serve unique functions in pre-implantation development. Active Motif offers 5-fC and 5-caC antibodies and a 5-caC DNA Standard Kit (Figure 3) to study these novel modifications.

dna MeThylaTion varianTs (5-fC & 5-CaC)


5-Formylcytosine (5-fC) antibody (pAb) 100 µl 61223

5-Formylcytosine (5-fC) antibody (pAb) 100 µg 61227

5-Carboxylcytosine (5-caC) antibody (pAb) 100 µl 61225

5-Carboxylcytosine (5-caC) antibody (pAb) 100 µg 61229

5-Carboxylcytosine DNA Standard Kit 0.5 µg 55014

5-fCpAb

5-mCpAb

Merge

5-caCpAb

5-mCpAb

Merge

5-caC Modified DNA Standard

Unmodified DNA Standard

ss ssds ds

5-fC 5-mC DAPI

5-caC 5-mC DAPI

* The images above were kindly provided by the laboratory of Yi Zhang, HHMI Investigator at the University of North Carolina at Chapel Hill. The data is described in detail in Inoue et al. (2011) Cell Research 21(12): 1670-1676.



ChIP Servicesutilize our experienced research team for your epigenetics studies

Chromatin immunoprecipitation (ChIP) is a powerful tool for studying protein/DNA interactions. ChIP-Seq takes ChIP a step further by combining it with Next Generation sequencing in order to generate whole-genome data sets. However, the various technical and bioinformatic challenges associated with ChIP-Seq present a barrier to many researchers in need of this data. To

overcome this barrier, researchers can utilize our expertise to facilitate their research into transcription factor binding, transcriptional regulation and histone distribution. Active Motif’s Epigenetic Services team has over 9 years of success providing a wide variety of ChIP services. For complete details, please give us a call or visit us at www.activemotif.com/services.

Contact us about our ChIP antibody validation service.

F I G U R E 1 :ChIP-Seq of chromatin of small molecule inhibitor-treated CD34+ cells using antibodies against a histone acetyltransferase (HAT) and its corresponding histone modification shows reduction in the occupancy of HAT at the promoter of the RBBP4 gene but not at other genes. As expected, the corresponding histone tail acetylation was also reduced at the RBBP4 gene.

F I G U R E 2 :ChIP-Seq was performed using chromatin from control and estrogen- treated MCF-7 cells using antibodies against RNA pol II and SRC3. The estrogen-induced SRC3 binding observed at the promoter and gene body of the RET gene (top panel) correlates with induced transcription of the RET gene as measured by RNA pol II occupancy (bottom panel).

ChIP-Seq ServicesSeveral types of ChIP-Seq are offered; ChIP is performed on different types of targets to answer different questions:

• FactorPath™ ChIP-Seq – discover, identify and quantitate transcription factor and cofactor binding sites

• HistonePath™ ChIP-Seq – map histone modifications or histone modifying enzymes across the genome

• TranscriptionPath™ ChIP-Seq – measure transcription rates globally as a function of RNA pol II occupancy

In addition, we offer MethylPath™ MeDIP-Seq and a number of other services for DNA methylation research (see page 47).

Active Motif Epigenetic Services

• Experience – thousands of genome-wide data sets generated

• Quality – QC steps ensure high-quality whole-genome data

• Support – all services include bioinformatics analysis

Customer fixes cell lines or freezes tissue samples.

1

Chromatin preparation is quantified and sized.

Antibody is ChIP Qualified prior to ChIP-Seq ChIP rxns.

qPCR is used to validate success of the ChIP rxns.

QC by qPCR, quantification of yield and library size.

Sequencing to yield≥ 30 million tags.

Active Motif prepares chromatin and sonicates.

2

Active Motif performs the ChIP reactions.

3

Active Motif constructsChIP-Seq libraries.

4

Libraries sequenced usingIllumina HiSeq.

5

Analysis and Data Delivery.6

ChIP-Seq ServicesProcess Steps

ChIP-Seq Quality Control

+ Inhibitor

Vehicle

+ Inhibitor

Vehicle

Reduced Acetyltransferase Occupancy

HATChIP-Seq

AcetylatedHistone

ChIP-Seq

{{

ZBTB80S SYNC

Reduced Histone Acetylation

33,220,00033,200,00033,180,00033,160,00033,140,00033,120,00033,100,00080,000

KIAA1522RBBP4

Estrogen

Estrogen

Control

Control

SRC3ChIP-Seq

Pol IIChIP-Seq

{{

RET

42,880,000 42,900,000 42,920,000 42,940,000q11.21

ePigeneTiC serviCes



ePigeneTiC serviCes

DNA Methylation Research Services

Determining the impact of differential DNA methylation across multiple samples is important to understanding the underlying mechanisms of development and disease. Our DNA methylation

services give customers access to the state-of-the-art technolo-gies that make a real impact on this ever expanding field. For details, please visit us at www.activemotif.com/services.

utilize our experienced research team to study DNA methylation patterns

0 10050

172

24

1

48

2 3 4 5 6 7 8 9

Normal Patients

Diseased Patients

Disease ModelCell Lines

% DNA Methylation

CpG

Site

CellType 1

CellType 2

1234567

1234567

F I G U R E 3 :Targeted Next-Gen Bisulfite Sequencing was performed using 9 separate samples and 10 different primer pairs. All 90 amplicons were sequenced in a single Next Genera-tion sequencing run. This heat map shows methylation data from one of the ten primer pairs across the population of 9 samples.

F I G U R E 4 :Bisulfite sequencing reveals differen-tial methylation in two cell lines.Sanger bisulfite sequencing was performed on customer-selected genomic locations. This data compares the methylation state of a region with 24 CpGs in two different cell lines. Seven clones from each of the cell lines were sequenced.

F I G U R E 1 :Next Generation sequencing was performed on DNA enriched from human PBMC DNA using MethylCollector™ Ultra, and tags were mapped to generate a whole-genome DNA methylation profile. Data show DNA methylation is detected at CpG shores rather than in the CpG island itself.

F I G U R E 2 :DNA was enriched by MeDIP from adaptor-ligated human PBMC DNA. Next Generation sequencing was performed and tags were mapped to generate a whole-genome DNA methylation profile. The image above shows that the enriched regions correlate well with CpG density.

MethylCollector™ Ultra-SeqCpG Density

MeDIP CpG Density

Genome-wide DNA Methylation Services

• MeDIP-Seq – enrichment of methylated DNA with a highly specific 5-methylcytosine antibody

• MethylCollector™ Ultra-Seq – based on the patented MIRA (Methylated CpG Island Recovery Assay) technology

• hMeDIP-Seq – enrichment using the most specific, highly cited 5-hydroxymethylcytosine antibody

• fC & caC genome-wide profiling – enrichment using a 5-formylcytosine or a 5-carboxylcytosine antibody, followed by Next Generation sequencing

The Genome-wide DNA methylation Services include:

– DNA isolation from cells or tissues, followed by enrichment of methylated DNA

– qPCR analysis of positive and negative control sites

– Next-Gen Library generation

– Sequencing of ≥ 30 million tags using the Illumina HiSeq

– Analysis: mapping, peak calling, visualization files and Excel output

Bisulfite Sequencing ServicesBisulfite Sequencing is the only method that enables detection of the methylation status of individual cytosines at single-base-pair resolution. Active Motif Epigenetic Services offers two Bisulfite Sequencing options:

Targeted Next-Gen Bisulfite Sequencing

• Multiplex many samples and multiple amplicons into a single Next-Gen sequencing reaction

• 100X to 10,000X coverage of each amplicon

• No cloning bias

• Multiplexing makes large experiments cost-effective

Sanger Bisulfite SequencingThis traditional bisulfite approach requires cloning of bisulfite converted amplicons and sequencing of 8 to 16 clones.

• Service includes all steps from primer design to analysis

• Recommended for small-scale experiments of < 5 samples



LightSwitch™ Luciferase Assay System

The LightSwitch Luciferase Assay System is a complete solution for performing transcriptional & post-transcriptional gene regulation studies in living mammalian cells. It is particularly well-suited for use in functional validation of protein binding events detected by ChIP. With over 18,000 human promoters &

12,000 3́ UTRs available as transfection-ready GoClone™ reporter vectors, you can perform your assays immediately, without the need to clone or prepare DNA. Optimized assay & transfection reagents and protocols for every step of the process make the entire procedure faster and simpler than with other methods.

directly measure the functional impact of binding at promoters and 3́ UTRs

rePorTer ConsTruCTs, assays & serviCes

F I G U R E 2 :Use our convenient online tool to quickly find pre-cloned regulatory elements for your genes of interest. Simply enter your gene’s name, accession number or other identifier, then click one of the buttons. In this example, a search was performed to find both promoter and 3́ UTR constructs of DNMT3A and DNMT3B.

F I G U R E 1 :After choosing a LightSwitch construct and transfecting, the cells are treated (if desired) and then assayed. The luciferase produced oxidizes the assay substrate and produces light, which is proportional to the effect of the cloned promoter.

SEARCH BY GENE IDENTIFIER

Search for:

In the box below, type or paste in a list of one or more gene identifiers on separate lines. Click on one of the buttons below to search.

DNMT3ADNMT3B

Promoter 3ÚTR Both

Prod ID Gene Symbol Type Seq. of Cloned Elements FormatS709833 DNMT3A PROMOTER Sequence and Clone Info 5 µgS709808 DNMT3B PROMOTER Sequence and Clone Info 5 µgS808608 DNMT3A 3ÚTR Sequence and Clone Info 5 µgS809202 DNMT3B 3ÚTR Sequence and Clone Info 5 µg

PromoterPre-cloned into

a Reporter Vector

2. Treat with compounds, pathogens, or growth conditions to induce expression.

3. Measure luciferase activity to determine the functional effects of TF binding, treatments and/or sequence variations.

RenSPLuciferase

LightSwitch™PromoterReporter

Gene of interest

Human genome

1. Transfect vector.

LightSignal

lighTswiTCh aPPliCaTions

• Assess the functional consequences of binding events detected through ChIP, or monitor promoter activity in response to variations in transcription factor function

• Generate dose response curves to various test compounds or growth conditions

• Dissect transcription factor binding motifs using mutagenesis and naturally occurring sequence variants

• Validate miRNA targets, and study post-transcriptional regulation mediated through miRNA-3́ UTR interactions

Quickly determine if binding imparts functionWhile ChIP and ChIP-Seq can be used to map the genome-wide binding sites of transcription factors, the functional conse-quences of binding must still be determined. A transcription factor may bind at hundreds of sites in the genome, sometimes in proximal promoter regions far away from genes, and it may act as an activator or a repressor, or it may have no effect at all. So, binding alone does not predict the functional outcome.

The LightSwitch System simplifies this task by providing over 18,000 pre-cloned human promoters and a fast, easy-to-use optimized assay. So, you can quickly determine if your binding event has any functional consequence by testing it in live cells.

Comprehensive system to study gene regulationThe LightSwitch System also includes validated stable cell lines, miRNA mimics & inhibitors, and collections of cloned synthetic regulatory elements that can provide greater sensitivity than their endogenous counterparts. In addition, our services team offers custom cloning, mutagenesis, pathway screening, miRNA target validation and sequence variant analysis. For more infor-mation, please visit www.activemotif.com/lightswitch.


More Tools for Epigenetics Research

Get any (or all) of our product information by mail or by downloadIn addition to this product profile, Active Motif has created profiles that describe our products in other areas of epigenetics and gene regulation. These detailed brochures can be downloaded or requested by mail at www.activemotif.com/info. Product manuals and technical data sheets are also available on our website.

ChIP-IT® Products for Chromatin IP

Products for Histone Analysis

Products for DNA Methylation

Stem Cell Epigenetics

Antibodies for Epigenetics and Gene Regulation

Tools for Drug Discovery

LightSwitch™ Reporters for Gene Regulation

Histone ModificationsGuide

Epigenetic Services

Enabling Epigenetics Research

http://www.activemotif.com/documents/83.pdf










UNITED STATES

1914 Palomar Oaks Way, Suite 150Carlsbad, CA 92008 USAToll Free: 1 877 222 9543

Direct: 1 760 431 1263Fax: 1 760 431 1351

[email protected]

EUROPE

Office Park NysdamAvenue Reine Astrid, 92B-1310 La Hulpe, Belgium

Germany Free Phone: 0800/181 99 10France Free Phone: 0800/90 99 79

UK Free Phone: 0800/169 31 47 Other Countries, Direct: +32 (0)2 653 0001

Fax: +32 (0)2 653 0050 [email protected]

JAPAN

Azuma Bldg. 7th Floor2-21 Ageba-Cho, Shinjuku-Ku

Tokyo, 162-0824, JapanDirect: +81 (0)3 5225 3638

Fax: +81 (0)3 5261 [email protected]

Enabling Epigenetics Research


active motif’s epigenetics products & services brochure · 2019-01-22 · active motif’s...

Documents