Active Hedgehog Signaling Regulates Renal Capsule Morphogenesis

by

Hovhannes Martirosyan

A thesis submitted in conformity with the requirements for the degree of Master of Science

Laboratory Medicine and Pathobiology University of Toronto

© Copyright by Hovhannes Martirosyan 2013

ii

Active Hedgehog Signaling Regulates Renal Capsule Morphogenesis

Hovhannes Martirosyan

Master of Science

Laboratory Medicine and Pathobiology University of Toronto

2013

The renal capsule is a flattened layer of cells which surround the kidney. Expression of

the transcription factor Foxd1 is required for normal development of the capsule.

Furthermore, current evidence suggests that during development the capsule

progenitors are in a state of active hedgehog signaling. We hypothesize that hedgehog

plays a role in modulating capsule morphogenesis in the embryonic kidney. To test the

hypothesis hedgehog signaling was inhibited in the capsule via Foxd1Cre mediated

deletion of Smoothened (Smo), the activator of the pathway. Mutant kidneys were

approximately 48% smaller in volume and had a 42% decrease in nephron number.

Furthermore, mutants displayed abnormal patterning of the capsule where regions on

the surface of the kidney had no capsule cells. The discontinuous capsule phenotype

was observed only after E13.5. Additionally, capsule cells progressively lost expression

of known markers Foxd1 and Raldh2 and their proliferative capacity was decreased by

54% at E13.5.

iii

Acknowledgments

I would like to express a great deal of gratitude to Dr. Norman Rosenblum for the

supervision he has provided me over the last 2 years. Not only did he give me the

opportunity to be a part of his wonderful lab and have a chance to work on such a new

and exciting project he was also the best scientific mentor I have ever had. Thanks to

Norm’s guidance and mentoring I had a successful grad school experience and more

importantly I am now a better scientist able to communicate my research and

knowledge with ease and clarity.

An extension of my gratitude goes out to my supervisory committee, Dr. Michael Ohh

and Dr. Herman Yeger for their time and mentorship. They have encouraged me to

continually ask questions and search for the bigger picture in all scientific research.

The group of individuals I was surrounded with everyday in the lab was the best

collection of scientists I could have asked for. Their constant assistance in the lab

setting as well as emotional help during times of trouble was irreplaceable. Not to

mention the wealth of knowledge they all provided me whenever I needed it, I could not

have finished my degree without it. I would like to express gratitude to Dr. Jason Cain,

Dr. Lin Chen, Dr. Lijun Chi, Dr. Valeria Di Giovanni, Josh Blake, Meghan Feeny,

Tayyaba Jiwani, Jinny Kim, and Joanna Smeeton. I also want to thank Doug Holmyard

at the Advanced Bioimaging Centre for SEM imaging assistance. Finally, I would like to

acknowledge the SamuelLunenfeld Research Institute's CMHD Mouse Physiology

Facility for their technical screening services (www.cmhd.ca).

Of course, last but not least I would like to thank my girlfriend Carly Willemsma for her

love and support. She gave me many many words of encouragement that gave me the

strength to finish my Master of Science degree.

I am but a seed Exploring the Milky Way, It taught me to flower.

iv

Table of Contents

Acknowledgments .......................................................................................................................... iii

Table of Contents ........................................................................................................................... iv

List of Tables ................................................................................................................................ vii

List of Figures .............................................................................................................................. viii

List of Abbreviations ...................................................................................................................... x

1. Chapter One: Introduction .......................................................................................................... 1

1.1 Overview ............................................................................................................................. 1

1.2 Mouse Kidney Development .............................................................................................. 2

1.2.1 Specification of metanephric mesenchymal ........................................................... 2

1.2.2 Ureteric bud outgrowth and branching ................................................................... 2

1.2.3 Nephrogenesis ......................................................................................................... 5

1.2.4 Development of the ureter ...................................................................................... 7

1.3 Stroma ................................................................................................................................. 8

1.3.1 Introduction ............................................................................................................. 8

1.3.2 Maintenance of outer and inner differentiation zones .......................................... 10

1.3.3 Stromal cells in branching morphogenesis ........................................................... 12

1.3.4 Vitamin A in branching morphogenesis and stromal cell patterning ................... 12

1.4 Hedgehog Signaling .......................................................................................................... 14

1.4.1 Sonic, Indian, and Desert hedgehog ..................................................................... 14

1.4.2 Signaling mechanism ............................................................................................ 14

1.5 Hedgehog Signaling is Required for Kidney Development ............................................. 17

1.6 Stromal Cells are in State of Active Hedgehog Signaling ................................................ 19

1.7 Rationale ........................................................................................................................... 21

1.8 Hypthesis ........................................................................................................................... 21

v

1.9 Model ................................................................................................................................ 21

2 . Chapter Two: Methods ............................................................................................................. 23

2.1 Mouse Breeding ................................................................................................................ 23

2.2 Tissue Preparation ............................................................................................................. 24

2.3 β-galactosidase Staining.................................................................................................... 24

2.4 Histology and Immunofluorescence ................................................................................. 25

2.5 Capsule Cell Proliferation Analysis .................................................................................. 25

2.6 In situ mRNA Hybridization ............................................................................................. 26

2.7 Kidney Volume Analysis and Total Nephron Number Count .......................................... 26

2.8 Scanning Electron Microscopy ......................................................................................... 27

2.9 Blood and Urine Collection .............................................................................................. 27

2.10 Data Analysis .................................................................................................................... 28

3 . Chapter Three: Results ............................................................................................................. 28

3.1 Smo null mutant kidneys are characterized by decreased expression of HH target gene mRNA ............................................................................................................................... 28

3.2 Patterning of the outer renal cortex is abnormal in Smo null mutant kidney .................... 29

3.3 Smo null mutant capsule appears discontinuous after E13.5 ............................................ 33

3.4 Smo null mutant kidneys are smaller in volume and have fewer nephrons than

wildtype kidneys ............................................................................................................... 37

3.5 Smo null mutant kidneys have decreased Foxd1 and Raldh2 expression ......................... 37

3.6 Proliferative capacity of mutant capsule cells is significantly decreased ......................... 42

3.7 Mutant mice do not always have a discontinuous capsule ............................................... 44

3.8 Viable mutants display normal kidney function ............................................................... 46

3.9 Gli3 deficiency improves renal patterning and capsule formation ................................... 49

4 . Chapter Four: Discussion and Future Experiments .................................................................. 49

4.1 Deleterious effects on capsule formation by decreased hedgehog signaling .................... 52

4.2 Capsule formation is required for viability ....................................................................... 53

vi

4.3 Effects of loss of capsule on renal patterning ................................................................... 54

4.4 Gli3 repressor influences renal capsule development ....................................................... 56

4.5 Future Directions .............................................................................................................. 56

5 . Chapter Five: Conclusion ......................................................................................................... 58

6 . Chapter Six: References ........................................................................................................... 60

vii

List of Tables

Table 1: Urinalysis of adult wildtype and Smo null littermate mice. ................................... 48

viii

List of Figures

Figure 1. Overview of kidney development initiation .............................................................. 3

Figure 2. Development of the metanephric kidney ................................................................. 4

Figure 3. Stromal cells express Foxd1 and Raldh2. ............................................................... 9

Figure 4. Foxd1 null mutant kidneys ....................................................................................... 11

Figure 5. Vitamin A in branching morphogenesis and stromal cell patterning ................. 13

Figure 6. Overview of hedgehog signaling ............................................................................. 16

Figure 7. Hedgehog signaling in kidney development ......................................................... 18

Figure 8. Genetic elimination of Ptc1 resulting in hydropelvis and death immediately

following birth .............................................................................................................................. 20

Figure 9. Stromal cells are characterized by active hedgehog signaling .......................... 22

Figure 10. In situ hybridization of Gli1 at E13.5..................................................................... 30

Figure 11. In situ hybridization of Ptc1 at E13.5 .................................................................... 31

Figure 12. Hematoxylin and eosin (H&E) stained P0 kidneys ............................................ 32

Figure 13. Scanning Electron Microscopy (SEM) images of E16.5 wildtype and Smo null

kidneys ......................................................................................................................................... 34

Figure 14. H&E sections of wildtype and Smo null kidneys at various embryonic stages

....................................................................................................................................................... 35

Figure 15. SEM images of E13.5 wildtype and Smo null kidneys ...................................... 36

Figure 16. Kidney volume and nephron number analysis of E18.5 kidneys ..................... 38

Figure 17. In situ and immunofluorescence of Foxd1 at various stages ........................... 40

../../../Dropbox/John/Thesis%20edits%20for%20submission_NRJan3.doc#_Toc345342789

ix

Figure 18. In situ hybridization of Raldh2 ............................................................................... 41

Figure 19. A ratio of BrDU positive (proliferative) capsule cells over total number of

capsule cells was used as an index of proliferative capacity .............................................. 43

Figure 20. H&E sections of wildtype, viable mutant, and non-viable mutant P0 kidneys 45

Figure 21. Blood biochemistry of adult wildtype and Smo null littermate mice ................ 47

Figure 22. H&E sections of wildtype, Smo null mutant, and Smo null; Gli3 heterozygous

deleted mutant P0 kidneys ....................................................................................................... 50

Figure 23. H&E sections of control, Smo null mutant, and Smo null; Gli3 null mutant

E18.5 kidneys ............................................................................................................................. 51

x

List of Abbreviations

BrDU Bromodeoxyuridine

E Embryonic day

Gdnf Glial-derived growth factor

GCPS Greig cephalopolysyndactyly syndrome

Hh Hedgehog

ISH in situ hybridization

MET Mesenchymal-to-epithelial

PHS Pallister-Hall syndrome

PFA Paraformaldehyde

Ptc Patched

PAS Periodic acid-Schiff

RA Retinoic acid

Raldh2 Retinoic acid dehydrogenase-2

Rars Retinoic acid receptors

SEM Scanning electron microscopy

Smo Smoothened

SA Surface area

UB Ureteric bud

1

1. Chapter One: Introduction

1.1 Overview

Kidneys are bilateral organs located in the posterior abdominal cavity. Their function is

essential for maintaining body fluid composition and homeostasis, filtering blood, and

excreting waste products. The nephron is the basic functional unit of the kidney. It is

composed of a glomerulus, where plasma is filtered from capillaries into Bowman’s

capsule, the proximal tubule, which reabsorbs nutrients and electrolytes from the filtered

load, the loop of Henle, where surrounding tissue and filtrate increase osmolality to

concentrate urine, and the distal convoluted tubule, which reabsorbs water and sodium.

The nephron is connected to the collecting duct, which collects urine and excretes it into

the bladder. Kidney development is initiated during the 5th week of gestation in humans

(at embryonic day 10.5 in mice). Unlike other organs, formation of the kidney includes

three phases during which transient and rudimentary kidney structures form and

degenerate until the metanephros gives rise to the complex and functional metanephric

kidney. A fully formed kidney is composed of an expansively branched collecting duct

system and a large number of nephrons ranging ~13000 (±1300) in mice and ~650000

(±200000) in humans2-4. The proper development of this complex organ relies on cell

fate decisions, cell migration, cell differentiation, and organization of cells into three-

dimensional structures. Cell communication is known to be central in nephrogenesis

and ureteric bud branching. Four families of signaling molecules have been implicated

in renal cell communication – fibroblast growth factors, wnt proteins, TFG-beta super

family factors, and hedgehog proteins. A thorough understanding of molecular signaling

2

underlying renal development will be crucial for elucidating the pathogenesis of human

kidney disorders and developing therapeutic approaches.

1.2 Mouse Kidney Development

1.2.1 Specification of metanephric mesenchyme

The mammalian kidney is derived from the intermediate mesoderm, tissue from a

neurula-stage embryo that forms the urogenital and reproductive system5. Intermediate

mesoderm gives rise to nephric precursors which detach, differentiate, and reorganize

to form an epithelial tube via a mesenchymal-to-epithelial (MET) transition6,7. This tube,

also termed the nephric duct, grows caudally until it is adjacent to the metanephric

mesenchyme (Figure 1). The specification of the metanephric mesenchyme is

independent of the presence or absence of the nephric duct. Transcription factors Eya1,

Six1/Six4, and Odd1 are the first regulators responsible for specifying the metanephric

mesenchyme from the caudal end of the intermediate mesoderm8. Odd1 is an early

molecular marker that acts in the metanephric mesenchyme upstream of Eya1 and

Six1/4 to promote its formation and survival9. Eya1 and Six1/Six4 activity is important for

upregulation of downstream genes. Eya1 and Six1/Six4 deficient embryos lose Gdnf

expression and the ureteric bud (UB) fails to invade the mesenchyme10,11.

1.2.2 Ureteric bud outgrowth and branching

At E10.5 of mouse embryonic development Glial-derived growth factor (Gdnf) is

secreted by metanephric mesenchyme cells and binds to Ret tyrosine kinase receptor

expressed on the surface of nephric duct cells12-14. In response, a subset of duct cells

emerge to form the UB, invade the mesenchyme and begin branching (Figure 2A)15.

Reciprocal signaling interactions between the UB and the metanephric mesenchyme

3

Figure 1. Overview of kidney development initiation. At embryonic day 8.5 mouse

kidney development begins with the formation of the nephric duct. The nephric duct

extends caudally and fuses with the urogenital sinus. At E10.5, the ureteric bud forms

adjacent to the metanephric mesenchyme. Reciprocal signaling stimulates the ureteric

bud to invade the mesenchyme and branch. At E11.5 a T-shaped structure is observed.

Mesonephric tubules rostral to the UB are not shown (adapted from Davidson et al.

2008)1.

4

Figure 2. Development of the metanephric kidney. (A) Ureteric bud outgrowth is

dependent on Gdnf and its receptor Ret. Gdnf released from the metanephric

mesenchyme binds to Ret receptors on the nephric duct stimulating an outgrowth which

invades and continues to branch within the mesenchyme. (B) Nephrogenesis initiates

when cells surrounding the ureteric bud tips begin to condense and form pretubular

aggregetes. The aggregates convert into renal vesicles and further mature into comma-

shaped and S-shaped bodies. The S shaped body fuses to the collecting duct and

forms mature nephron when a glomerulus develops and the proximal tubules elongate

and grow towards the medulla(adapted from Gilbert, 2006 and Davidson et al. 2008)1,5

5

result in two key processes: ureteric branching morphogenesis and formation of

metanephric derived nephrogenic precursors. Following invasion of the metanephric

mesenchyme by the UB, expression of Ret becomes restricted to UB tips while Gdnf

expression gets limited to the condensing mesenchyme surrounding the tips14,16. Gdnf-

Ret signaling triggers further generations of branching morphogenesis with eventual

formation of the collecting system of the kidney15 Gdnf expression must be tightly

regulated in the metanephric mesenchyme with both transcription activators (Eya1,

Sall1, Pax2) and repressors (Slit2, Robo2) to allow normal UB invasion and branching

without induction of ectopic UBs from portions of the nephric duct anterior to the normal

site17-20. Furthermore, the UB induces nephrogenesis, thus there is a strong correlation

between the number of UB branches and the number of nephrons in a kidney.

Disturbance of any major component of reciprocal signaling between the UB and the

metanephric mesenchyme that affects renal branching morphogenesis can cause

decreased nephron number in addition to aplasia (no kidney) or dysplasia (abnormal

kidney tissue)21,22. In the absence of renal replacement therapy immediately, renal

aplasia is lethal postnatally and dysplasia is the leading cause of chronic renal failure in

children23.

1.2.3 Nephrogenesis

Invasion of the metanephric mesenchyme by the UB at E11 induces mesenchymal cells

to condense or rearrange in a cap-like formation around the UB tip 4 – 5 cell layers thick

that are morphologically distinguishable from more peripheral ‘uninduced’ mesenchyme.

The newly formed cap-mesenchyme is morphologically distinct from uninduced

mesenchymal cells and expresses genes such as Eya1, Sall1, Pax2, Six2, and secreted

factors Gdnf and Bmp7. The cap is the source of progenitors which differentiate into

6

nephrons. Constant proliferation of these cells is critical to proper kidney development

and nephrogenesis. Signals within the cap mesenchyme promote further condensation

around UB tips, promote survival by inhibiting apoptosis, and promote proliferation to

maintain a population of progenitor cells that will become nephrons24-26. Cap-like

formation of mesenchymal cells appears dependent on Smad4 encoding an intracellular

mediator of TGF-β/BMP signaling, as conditional knockout of Smad4 in the metanephric

mesenchyme results in mesenchymal cells failing to coalesce around UB tips26,27.

Increased apoptosis of mesenchymal cells is observed in mice deficient in Pax2

demonstrating an important role for Pax2 in metanephric mesenchyme survival28. Bmp7

function is also required for metanephric mesenchyme survival as the cells that form a

cap around the UB undergo apoptosis at E13.5 in Bmp7 mutants29. Proliferation of the

cap mesenchyme is promoted by Six2, a fate mapping study has shown Six2-

expressing cap mesenchyme cells can proliferate and expand their numbers to

accommodate for numerous rounds of branching and nephrogenesis25.

Following cap mesenchyme surrounding the UB, nephron formation begins at E11.5.

Clusters of mesenchymal cells appear on either side of the UB tip and proliferate to

become aggregates of 30 cells or more30. As the UB branches and grows the pre-

tubular aggregates become located beneath the UB tips. At E12.5 the aggregates

undergo MET to form renal vesicles which undergo further proliferation and express a

variety of genes to give rise to comma shaped bodies and then S-shaped bodies

(Figure 2B). The molecules which control nephrogenesis include Wnt9b and Wnt4

which are responsible for pretubular aggregate and renal vesicle formation,

respectively27,31. Wnt9b is expressed throughout the collecting system but it only

activates aggregate formation in cap mesenchyme adjacent to the UB tips due to

7

regulatory factors such as Six2 which inhibits pretubular aggregate formation by Wnt9b

in the remainder of the cap mesenchyme25,32. Unlike Wnt9b which is a paracrine

molecule, Wnt4 is expressed in aggregates and acts in an autocrine manner to

propagate transition to renal vesicles33. Wnt9b also activates expression of Wnt4, Fgf8,

and Pax8 in the pretubular aggregate, and then Wnt4 maintains the expression of these

genes and induces Lim134-36. Conditional inactivation of Lim1 in the cap mesenchyme

has demonstrated a requirement of Lim1 for the progression of the renal vesicle to the

comma-shaped body stage35,37. Mechanisms controlling further segmentation of

nephrons are not completely clear. Some data indicates that Notch signaling is involved

in proximal-distal patterning to promote the formation of podocytes, proximal tubules,

and the loop of Henle38-40.

1.2.4 Development of the ureter

The ureter which is derived from the initial portion of the UB is the tube which propels

urine from kidneys to the bladder. It is a multi-layered structure and it uses peristaltic

machinery to function. Inductive signaling from tail bud mesenchyme to the UB initiates

maturation of the first UB segment to form the ureter. At E12.5 the distal end of the UB

separates from the nephric duct41. Inductive signaling from ret expression, retinoic acid

receptors α/β, and vitamin A mediate formation of a connection between the ureter and

the bladder42. At E15.5 the epithelium of the ureter differentiates into the urothelium

giving the ureter the capacity to resist the toxicity of the urine produced from E16.5

onwards43. The mesenchyme surrounding the ureter originates from tail bud

mesenchyme and it is marked by transcription factor T-box 18 (Tbx18) as early as

E11.544. This mesenchyme differentiates into smooth-muscle cells that form layers with

longitudinal and transverse orientation at E14.545. Deficiency in Tbx18 leads to a

8

decrease in Bmp4 expression and results in defective differentiation of smooth-muscle

cells44. The peristaltic machinery required to move urine from the pelvis to the bladder

gets established at the ureter-pelvis junction by E18.5 ensuring full functionality at

birth44.

1.3 Stroma

1.3.1 Introduction

Renal stroma is a small population of cells in the metanephric mesenchyme that in

contrast to other metanephric cells are not nephrogenic progenitors. The stromal

population can be broken down into 3 layers which are clearly visible by E14.5: the

renal capsule (a continuous layer of 1 to 3 cells thick, flattened and localized to the edge

of the kidney), cortical stroma (cells surrounding the cap mesenchyme and UB tips),

and medullary stroma46. The capsule and cortical stroma selectively express Foxd1 and

Raldh2 (Figure 3)47. Originally, the capsule was thought to have mainly a supportive role

in renal development48. More recently, data has surfaced implicating FoxD1 and

capsule formation in spatial and temporal patterning of nephrons47.

It has been reported that Foxd1-expressing cells are initially observed in a concentrated

cap-like cluster that is localized just anterior to the metanephric mesenchyme. As

development progresses, these cells are observed in progressively posterior positions,

becoming integrated into the periphery of the kidney to form the cortical stroma49.

Deletion of Foxd1 in mice results in renal malformations including impaired branching

morphogenesis and nephron differentiation and defects in renal capsule morphology50.

Furthermore, the defects in capsule formation prevent kidneys from detaching from the

9

Figure 3. Stromal cells express Foxd1 and Raldh2. (A) E14 embryonic kidney. The ureteric bud and bud tips are green, cortical and medullary stroma is pink (B) High magnification of the boxed area in (A). The capsule is visible as a flattened layer of cells surrounding the kidney. (C) and (D) Foxd1 and Raldh2 expression in cortical stroma (stc). Foxd1 is restricted more to capsule cells (adapted from Levinson et al. 2003)51.

10

body wall resulting in fused kidneys which remain in the pelvis rather than ascending to

the lumbar region (Figure 4AB)47,50. Unlike wildtype kidneys, without Foxd1 the capsule

layer surrounding the kidney is thicker and populated with ectopic Bmp4-expressing

cells (Figure 4CD)47. Improper signaling from these cells causes aberrant patterning in

the nephrogenic compartment which results in mispatterning of the ureteric tree and

delayed and disorganized nephrogenesis47.

1.3.2 Maintenance of outer and inner differentiation zones

The nephrogenic zone is the domain beneath the renal capsule and is defined as the

region in which branching of the ureter and nephron formation occurs. The nephrogenic

zone is located between a more interior layer of differentiating nephrons, branches and

medullary stroma and an outer layer of renal capsule cells. In mice the nephrogenic

zone is active until the first week of post-natal life. It is unknown how the boundaries of

the nephrogenic zone are established and maintained. The presence of two different

environments on either side of the zone suggests that extrinsic factors released from

the capsule on cortical side and the more differentiated cell types on the medullary side

might determine the boundaries. Similar examples can be found in the gut and genital

tract where stromal mesenchyme generates signals that control differentiation of their

underlying epithelia into diverse cell types for various functions52-54. This data supports

the possibility that capsule signaling is important for kidney development of cell types

adjacent to the capsule or even deep within the organ.

11

Figure 4. Foxd1 null mutant kidneys. (A) E16.5 wild-type kidney displaying glomeruli

(gl) and proximal tubules (pt) in the juxtamedullary region, just below the nephrogenic

zone. (B) Mutant E16.5 Foxd1 null kidneys are fused and lack a discrete nephrogenic

zone. (C) and (D) Bmp4lacZ expression is present in the midline of both Foxd1 null and

heterozygous tissue at E12.5 but there is a wider distribution of expression around the

kidneys in the mutant. Expression of GFP and lacZ did not overlap. (E) At E18.5

wildtype branches of the ureteric bud (ub) have bifurcated numerous times. (F) In the

mutant the branches elongate but bifurcate very infrequently (adapted from Levinson et

al. 2005)47.

12

1.3.3 Stromal cells in branching morphogenesis

FoxD1 is required for correct morphology and cellular composition of the renal

capsule47. Foxd1 null mutants have a disorganized nephrogenic compartment as a

result of an improperly matured capsule layer47. Furthermore, FoxD1 null mutant mice

also display abnormal ureteric bud branching47. The mutant kidneys display a decrease

in the number of branches as well as a change in branch patterning. The mutant

branches become severely elongated with few ampula near the surface suggesting that

mutant branches lost the ability to bifurcate, but not elongate (Figure 4EF)47. Kidney

rudiments that are treated with Bmp4 display a similar branching phenotype supporting

the concept that abnormal patterning of the nephrogenic zone in Foxd1 null mutants

was caused by ectopic Bmp4-expressing cells present in the renal capsule55.

1.3.4 Vitamin A in branching morphogenesis and stromal cell patterning

Vitamin A is required for morphogenesis of kidneys as well as most other fetal

tissue56,57. Vitamin A, also known as retinol, is ingested via the diet and is irreversibly

oxidized into retinoic acid (RA). RA is a secreted molecule and its signaling is mediated

by retinoic acid receptors (Rars). The RA-synthesizing enzyme found in the kidney is

retinoic acid dehydrogenase-2 (Raldh2), the expression of which is restricted to the

renal capsule and cortical stroma58. Recent studies have demonstrated a key role for

Vitamin A in renal branching morphogenesis16,59,60. Kidney explants cultured in the

absence of RA display a significant decrease in branching61. Kidneys with impaired

branching pattern also lose expression of Ret in the UB tips (Figure 5A-D)61. Consistent

with these observations, mice deficient in retinoic acid receptors a and b2 (Rarab2)

display loss of Ret expression and impaired ureteric branching16,59. Interestingly,

13

Figure 5. Vitamin A in branching morphogenesis and stromal cell patterning.

Hoxb7-GFP kidney rudiments cultured in serum-free medium with (A) and without (B)

added retinoids. Ret is strongly expressed in the ureteric bud tips of rudiments cultured

with retinoids, and downregulated in those grown without added retinoids. (C) and (D)

GFP expression in the ureteric bud of E12 Hoxb7-GFP kidneys. Embryonic kidneys

grown with retinoids had significantly more ureteric bud branches than counterparts

grown in the absence of retinoids. (E), (F), and (G) Hoxb7-Ret transgene rescues renal

development in Rarab2 mutants. (A) Wildtype kidneys have normal nephrogenic zone

and developing glomeruli. (B) Rarab2 mutant kidneys have few branches or glomeruli.

(C) Rarab2 mutant with Ret expressed in the ureteric bud (Hoxb7-Ret transgene) is

rescued and looks morphologically similar to wildtype (adapted from Levinson et al.

2003)51.

14

Rarab2 deficient kidneys are also characterized by a thick outer capsule. In Rarab2

mutant kidneys where Ret expression was forced in the ureteric bud, all malformations

were rescued including the stroma surrounding the kidney (Figure 5E-F)62. This

suggests that Ret expression is important for not only branching morphogenesis of the

kidney but for normal stromal patterning as well. In summary, Vitamin A is converted

into RA in the renal capsule and gets secreted to the rest of the kidney where it

upregulates Ret expression in UB tips. Ret signaling from the UB then induces

branching morphogenesis and supports cortical stromal cell patterning.

1.4 Hedgehog Signaling

1.4.1 Sonic, Indian, and Desert hedgehog

The hedgehog signaling pathway is highly conserved and controls tissue

morphogenesis during embryogenesis63. First discovered in 1980 in Drosophila

malanogaster, the hedgehog gene (hh) was found to encode a secreted protein with an

important role in segment polarity64. There are three proteins in the mammalian

hedgehog signaling pathway, Sonic (Shh), Indian (Ihh), and Desert (Dhh). Shh is most

studied for its role in patterning of the neural tube. Ihh is very active in skeletal bone

formation while Dhh activity seems restricted to the testis65-68. The hedgehog ligand

functions as a morphogen, a molecule which establishes a concentration gradient and

affects cell differentiation differently depending on the location of a cell in reference to

the gradient. Of the three members Shh and Ihh are expressed in the kidney22,69.

1.4.2 Signaling mechanism

Patched (Ptc) is a 12 transmembrane domain receptor of the hedgehog ligand70,71. This

tumour suppressor protein is an obligate negative regulator of the hedgehog signaling

15

pathway72. Invertebrates have two patched receptors, Ptc1 and Ptc273. They share 73%

amino acid similarity but the transmembrane domains 6 and 7 are significantly different.

Ptc2 has been shown to have a compensatory role when Ptc1 is lost. Unlike global Ptc1

deletion, Ptc2 loss is not embryonic lethal suggesting that Ptc1 is the primary receptor

important in embryo development and survival74.

In the absence of the hedgehog ligand, Ptc1 inhibits the activity of another

transmembrane protein Smoothened (Smo) by inhibiting its localization to the cilium75.

When inhibited, Smo cannot interact with an intracellular proteolytic complex, allowing

the complex to bind and cleave full-length Gli proteins75. Truncated Gli proteins localize

to the nucleus and act as repressors of hedgehog signaling target genes. When

hedgehog ligand is present it binds and inhibits Ptc1, allowing Smo to localize to the

cilium and trigger full-length Gli translocation to the nucleus to activate gene

transcription (Figure 6)75. Dysregulation of hedgehog signaling during embryogenesis

results in various congenital abnormalities and in adults unrestrained hedgehog

signaling is associated with cancer development76-80.

In mammals there are three known Gli homologs: Gli1, Gli2, and Gli381. Gli1 and Gli2

are primarily transcriptional activators and Gli3 can act as both an activator and a

repressor. The Glis have DNA binding zinc finger domains which can attach to a

consensus region on a target gene81. Genes activated by Gli transcription factors

include N-myc, CyclinD1, Gli1, Gli2, and Ptc1 as well as genes in renal patterning and

morphogenesis such as Pax2 and Sall182. Mutations in the Gli family have been

associated with human pathologies including Greig cephalopolysyndactyly syndrome

(GCPS) and Pallister-Hall syndrome (PHS)83,84. GCPS is an autosomal dominant

16

Figure 6. Overview of hedgehog signaling. (A) In the absence of the hedgehog

ligand transmembrane protein Patched (Ptc) inhibits Smoothened (Smo) and Gli is

processed to a truncated form by a proteolytic complex. Truncated Gli acts as a

transcription repressor. (B) When present, hedgehog ligand binds Ptc abrogating the

inhibition of Smo. Active Smo prevents formation of a proteolytic complex. Full length

Gli transcription factors translocate into the nucleus and upregulate genes such as

Pax2, Sall1, N-myc, CyclinD1, Gli1, Gli2, and Ptc1 (adopted from Rosenblum, 2008)23.

17

syndrome caused by loss of function mutations in the GLI3. Individuals with GCPS

suffer from hypertelorism, macrocephaly with frontal bossing, and polydactyly83. Most

commonly GCPS is caused by mutations that lead to haploinsufficiency for GLI3,

however not all patients with GCPS have GLI3 mutations suggesting other genes in the

GLI-hedgehog pathway could cause such a phenotype83. PHS is an autosomal

dominant disorder characterized by multi-tissue abnormalities including renal agenesis

or dysplasia, renal hypoplasia and hydronephrosis 85-87. PHS is caused by frameshift

and splicing mutations of the GLI3 gene that generate a truncated protein similar in size

to GLI3 repressor 84,88.Mutant mice that carry Gli3 mutant alleles which terminate at

amino acid position 699 have been generated to model the frame shift mutation and

constitutively express Gli3 repressor89. The allele is called ∆699 and it is a unique tool

for studying the role of Gli repressor and hedgehog signaling in kidney development.

1.5 Hedgehog Signaling is Required for Kidney Development

In 2006 Hu et al demonstrated that germ line homozygous Shh deletion causes renal

aplasia or the formation of a single ectopic dysplastic kidney (Figure 7A)22. Analysis of

the dysplastic kidney tissue revealed decreased levels of full length Gli1, Gli2, and Gli3

protein (transcriptional activators) an increase in the ratio of Gli3 transcriptional

repressor to Gli3 transcriptional activator (Figure 7B)22. The mutant kidney also

displayed a decrease in expression of known kidney patterning genes Pax2 and Sall1

and of cell cycle genes N-myc and CyclinD122. Further investigation of Gli3 in Shh

mutant mice revealed that homozygous deficiency of Gli3 in Shh-/- mice rescued renal

malformations22. These data suggest that a balance between Gli activator and Gli

18

Figure 7. Hedgehog signaling in kidney development. (A) Gross anatomical features

of kidneys in wild-type and Shh–/– mice at E18.5. Shh–/– mice exhibit either absence of

both kidneys or the presence of a single ectopic kidney located in the pelvis. (B)

Western analysis of E14.5 kidney tissue from wild-type and Shh–/– mice. Shh

deficiency decreases GLI1 and GLI2. GLI3 activator (190 kDa) is also decreased, but

GLI3 repressor (89 kDa) is unaffected compared with wild type. The ratio of GLI3

activator to GLI3 repressor is decreased from 3.25 in wild type to 0.23 in Shh–/– mice. K

– kidney, G - gonad (adapted from Hu et al. 2006)22.

19

repressor proteins is required for normal kidney development and when there is an

imbalance towards the repressor it leads to renal maldevelopment.

In the embryonic kidney Shh is exclusively expressed in the distal ureteric epithelium90.

During kidney development hedgehog activity is restricted to ureter and medullary

regions but is absent from the renal cortex91. To further delineate how hedgehog

signaling controls kidney development, ectopic hedgehog activity in renal cortex was

examined. Rarβ2Cre is a mouse line where expression of Cre recombinase becomes

active at E9.5 in the metanephric mesenchyme but not in the nephric duct epithelium35.

Genetic elimination of Ptc1 using the Rarβ2Cre mouseline resulted in hydropelvis and

thinning of the renal cortex (Figure 8AB). Another interesting observation in mutant

kidneys was increased spatial expression of Foxd1 in the cortex (Figure 8CD). Thus, in

the context of increased hedgehog activity in the renal cortex, the Foxd1 positive

capsule and cortical stromal cell population increased while the overall cortex domain

was reduced in size. These data suggested that capsule cells and cortical stroma may

already be in a state of active hedgehog signaling unlike the remainder of the renal

cortex. This was a novel finding because hedgehog activity was thought to be restricted

to the ureter and medulla of a kidney.

1.6 Stromal Cells are in State of Active Hedgehog Signaling

Ptc1 LacZ reporter mice can be utilized to assess cells and domain-specific hedgehog

activity in the embryonic kidney. Since Ptc1 is a downstream target of hedgehog

signaling its expression is indicative of hedgehog responsive cells (blue). Using a Ptc1

LacZ reporter, E15.5 mouse kidneys are observed to have LacZ positive cells in the

20

Figure 8. Genetic elimination of Ptc1 resulting in hydropelvis and death

immediately following birth. (A) and (B) H&E sections of E18.5 kidneys. The Ptc1

mutants are characterized by thin renal cortex and severe hydropelvis. (C) and (D)

Foxd1 in situ hybridization of E13.5 kidneys. The Ptc1 mutants have increased spatial

expression of Foxd1 in the cortex (J. Cain and M. Staite unpublished).

21

capsule and cortical stroma (Figure 9AB). This suggests that there is a low level of

hedgehog activity in the capsule and cortical stroma.

Furthermore, in situ hybridization (ISH) experiment for Gli1 illustrates that the gene is

expressed in the capsule of E14.5 embryonic kidney. Gli1, another hedgehog

downstream target gene provides further evidence that hedgehog signaling is active in

the capsule. Lastly, the renal capsule displays prominent expression of Ihh, a member

of the mammalian hedgehog family (Figure 9CD).

1.7 Rationale

The morphological and cellular composition defects caused by Foxd1 deficiency

illustrate that the capsule and cortical stroma is important to the overall development

and patterning of the kidney. Proper cortical stromal differentiation mediated by Foxd1

defines the nephrogenic zone and its boundaries with correct positioning of nephrogenic

units and ureteric bud tips beneath the renal capsule. However, the molecular signals

that control formation of the capsule are largely undefined. While hedgehog signaling is

active in the capsule, its function in this domain is unknown. Further understanding of

hedgehog signaling in the renal capsule will provide insight into hedgehog function in

renal capsule and capsule function during kidney organogenesis.

1.8 Hypthesis

Hedgehog signaling is required for capsule morphogenesis in the embryonic kidney.

1.9 Model

FoxD1Cre; Smo-/loxP mice (termed Smo null mutant) were used in experiments.

22

Figure 9. Stromal cells are characterized by active hedgehog signaling. Ptc1LacZ

expression demonstrates regions of the kidney with hedgehog signaling activity. (A)

Strong expression of Ptc1LacZ is observed in the ureter and medullary stroma. (B) A high

resolution image of area in (A) demarcated with a rectangle. Weak expression is

observed in cortical stroma and capsule of the kidney. In situ hybridization of Gli1 (C)

and Ihh (D) in E14.5 kidneys suggest hedgehog activity in the capsule (J. Blake and

http://www.eurexpress.org/ee/)

23

2 . Chapter Two: Methods

2.1 Mouse Breeding

All mice used in experiments were housed at The Toronto Centre for Phenogenomics

(TCP) animal facility (Toronto, Canada). The ethics committee at The Hospital for Sick

Children has approved all animal experiments. FoxD1Cre mice were mated to Smo+/-

mice to generate FoxD1Cre; Smo+/-. These mice were mated with homozygous Smo

conditional (SmoloxP/loxP)92 mice to generate FoxD1Cre; Smo-/loxP embryos in which Smo

was specifically removed from the renal capsule and cortical stroma lineage in kidneys.

These kidneys are referred to as Smo null mutant kidneys.

FoxD1Cre; Smo+/- and SmoloxP/loxP mice were mated with Gli3+/-93 to generate FoxD1Cre;

Smo+/-; Gli3+/- and SmoloxP/loxP; Gli3+/- progeny respectively. These two mouse lines were

then mated with one another to ultimately generate FoxD1Cre; Smo-/loxP; Gli3+/- embryos

(termed Gli3 rescue mice). Polymerase chain reaction (PCR) genotyping for each allele

was performed as previously described94. The following primers were used for

genotyping mice. For the Smo deleted allele the forward primer was

GGCCTGCGCTGCTCAACATGG and the reverse primer was

CCATCACGTCGAACTCCTGGC95. The forward and reverse primers for the Smo LoxP

allele were ATGGCCGCTGGCCGCCCCGTG and GGCGCTACCGGTGGATGTGG

respectively96. Cre allele was detected using the forward primer

GAAACAGGGGCAATGGTGCGCCTGCTG and the reverse primer

AGGAGGACGCTGGGTTGGTCCGATACT35. The Ptc1 LacZ allele was detected using

the forward primer TGTCTGTGTGTCTCCTGAATCAC and the reverse primer

TGGGGTGGGATTAGATAAATGCC94. The Gli3 deleted allele was detected using 2

24

forward and 2 reverse primers which are able to identify homozygote and heterozygote

embryos. Homozygotes and heterozygotes can be distinguished from wildtype siblings

with forward primer TACCCCAGCAGGAGACTCAGATTAG and reverse primer

AAACCCGTGCAGGACAAG that span the deletion breakpoint in combination with a

primer set (forward: GGCCCAAACATCTACCAACACATAG and reverse:

GTTGGCTGCTGCATGAAGACTGAC) located within the deletion93. Littermates were

used for all experiments in which wildtype (WT) and mutant embryos were compared.

2.2 Tissue Preparation

Sacrifice of experimental animals was achieved using methods approved by the ethics

committee at The Hospital for Sick Children (Toronto, Canada). Pregnant mice were

sacrificed via cervical dislocation in order to isolate embryos from timed pregnancies.

Embryonic day 0.5 (E0.5) was considered to be noon on the date of observation of

vaginal plug. Embryonic kidneys were dissected at any time between E11.5 and E18.5

and fixed in 4% paraformaldehyde (PFA) for at least 24 hours. Kidneys were then

embedded in paraffin for sagittal sectioning of tissue by The Centre for Modeling Human

Disease’s (CMHD) Core Pathology Lab at TCP using standard methods.

2.3 β-galactosidase Staining

Whole kidneys were briefly fixed in LacZ fix solution (25% glutaraldehyde, 100 nM

EGTA, 1 M MgCl2, 0.1M sodium phosphate) and rinsed in wash buffer (0.1 M sodium

phosphate buffer, 2% nonidet-P40, 1M MgCl2). Kidneys were then placed in LacZ

staining solution (25 mg/mL X-gal, potassium ferrocyanide, potassium ferricyanide) at

37°C overnight in the dark. Once staining had occurred the reaction was terminated in

wash buffer and post-fixed in 10% buffered formalin at 4°C. Whole kidneys were

25

photographed using a Leica EZ4D dissecting microscope, processed for embedding in

paraffin wax, and then sectioned at 5 µm. Sections were counterstained with nuclear

fast red.

2.4 Histology and Immunofluorescence

Paraffin-embedded kidney sections were stained with hematoxylin and eosin (HE) by

The CMHD’s Core Pathology Lab at TCP. Immunofluorescence staining was

performed90 on formalin fixed, paraffin-embedded kidney sections using anti-FoxD1 (a

gift provided by Dr. Andrew McMahon, 1:100 dilution), anti-lotus tetragonolobus lectin

(LTL – Vector Laboratories, 1:100 dilution), anti-pan cytokeratin (Sigma, 1:100 dilution),

anti-NCAM (Sigma 1:200 dilution), anti-BrDU (Roche, 1:100 dilution), and anti-Six2

(Roche, 1:200 dilution). Alexa 488 goat anti-mouse and Alexa 568 goat anti-rabbit

(Molecular Probes, 1:1000 dilution) were used as secondary antibodies. Whole mount

immunofluorescence was performed as described with anti-calbindin-D28K (Sigma,

1:200 dilution; secondary is Alexa 488 goat anti-mouse, Molecular Probes, 1:100

dilution).

2.5 Capsule Cell Proliferation Analysis

Pregnant mothers were injected with Bromodeoxyuridine (BrDU) (100 mg/Kg) and

tissue of E11.5 and E13.5 embryos was harvested 2 hours after injection. Harvested

kidneys were stained with a fluorescent anti-BrDU antibody to identify cells that

incorporated BrDU. Since mutant capsule cells could not be counterstained with a

fluorescent FoxD1 antibody, capsule cells were identified, disticnt from mesenchymal

cells by their morphology. In order to count every capsule cell in the kidney several

criteria were established to aid the counting process. These criteria were: 1) capsule

26

cells are on the outer edge of the kidney, 2) capsule cells have a flattened appearance,

3) capsule cells are a maximum 3 cell layers away from the edge of the kidney, and 4)

capsule cells are not marked by a fluorescent Six2 marker (some sections were

counterstained with a Six2 antibody). Using these 4 criteria and the fluorescent BrDU

stain a ratio of proliferative capsule cells over total number of capsule cells was

calculated.

2.6 In situ mRNA Hybridization

Whole mount embryos were fixed in 4% PFA in PBS for 16 hours at 4°C. In situ

hybridization was performed on paraffin-embedded sections using DIG-labeled cDNA

probes encoding Bmp4, Foxd1, Gdnf, Gli1, Ptc1, Raldh2, ret, Wnt4, and Wnt11 as

previously described97.

2.7 Kidney Volume Analysis and Total Nephron Number Count

Whole E18.5 harvested kidneys were fixed in 4% PFA in PBS for 16 hours at 4°C. The

kidneys were paraffin embedded and sagittaly sectioned by the CMHD’s Core

Pathology Lab at TCP according to the following instructions: the first 100 µm of tissue

was discarded, then a slide with 4 sections, each 5 µm thick, was prepared and the next

80 µm were discarded again98. These steps were repeated throughout the entire

volume of each kidney. All the sections were then stained with Periodic acid-Schiff

(PAS) stain. The best section of each slide was imaged and using Adobe Photoshop

CS5.1 the surface area (SA) was calculated. The kidney volume was calculated by

multiplying 100 µm to each section’s SA value and adding up all the individual volumes.

27

The PAS stain highlights the basement membranes of glomerular capillary loops, thus

the glomeruli were very visible in each section. The best section of each slide was again

utilized to tally all mature glomeruli with a visible Bowman’s space. The sum of all the

sections making up the kidney was used as the total nephron number per kidney.

2.8 Scanning Electron Microscopy

Whole E16.5 kidneys and E13.5 embryos were harvested and fixed in 2%

glutaraldehyde in 0.1M sodium cacodylate buffer pH 7.3 overnight at 4°C. The samples

were given to The Advanced Bioimaging Centre at Mount Sinai Hospital (Toronto,

Canada) to be dehydrated, dried, and gold sputter-coated. The prepared samples were

imaged at the Bioimaging Centre with a FEI XL30 ESEM microscope.

2.9 Blood and Urine Collection

Blood and urine collection was performed according to the protocol provided by CMHD.

Conscious mice were restrained in an uncapped 50 mL Falcon tube with air holes drilled

in the closed end. The left or the right leg was extended and fixed firmly by holding the

fold of the skin between the tail and the thigh. Enough hair was then removed from the

surface of the fixed leg to expose and visualize the saphenous vein. The exposed skin

was then wiped clean with 70% ethanol and dried with a piece of gauze. A small

amount of Vaseline was applied on the shaved skin to reduce clotting and help prevent

the blood from collecting in the remaining hair on the leg. Using a 25 gauge needle the

vein was punctured. As a drop of blood appeared on the surface of the leg a capillary

tube held on a 45° angle was used to collect the blood and dispense into a 0.5 mL

microtube. The tube was capped and mixed by flicking the side of the tube and stored

on crushed ice for biochemistry analysis. Approximately 100 µL of blood was collected

28

from each mouse. Once enough blood was collected the mouse’s foot was flexed to

reduce flow of blood to the puncture site and a gauze compress was applied to stop

bleeding. The blood biochemistry analysis was performed by the CMHD Mouse

Physiology Facility.

Mouse urine was collected in 1.5 mL microtubes from conscious, restrained mice. The

mouse was picked up and held by the excess skin at the base of the neck. The

microtube was held at the point of urination and the bladder of the mouse was gently

massaged. Any expelled urine was collected in the microtube. The urine in the tube was

thoroughly mixed and given to the CMHD Mouse Physiology Facility for urinalysis.

Urinalysis was performed using Chemstrip 4MD test strips (Roche Diagnostics).

2.10 Data Analysis

Statistical analysis was performed using GraphPad Prism software (version 5.0). Data

were analysed using a unpaired Student’s t-test. A probability of less than 0.05 was

considered to indicate statistical significance.

3 . Chapter Three: Results

3.1 Smo null mutant kidneys are characterized by decreased expression of HH target gene mRNA

To begin to investigate the functions of the hedgehog signaling pathway in capsule and

cortical stromal cells, mice were generated with deficiency of Smo specifically using

Cre-recombinase directed by a Foxd1 promoter element. These kidneys are referred to

as Smo null mutant kidneys. If Foxd1Cre is efficient and Smo is successfully deleted in

the capsule then hedgehog activity should be diminished in this structure. mRNA levels

of Ptc1 and Gli1 were used as reporters of hedgehog activity.

29

E13.5 embryos were sectioned and ISH was performed to study the expression of Gli1

and Ptc1. In wildtype embryos Gli1 expression is widespread both in the cortex and

parts of the medulla of kidneys (Figure 10ABC). In the Smo null mutant, Gli1 expression

was lost in the capsular region but was maintained in the remainder of kidney tissue

(Figure 10DEF). Similarly, ISH revealed that Ptc1 expression is completely lost in the

Smo null mutant capsule whereas the wildtype mouse displayed faint expression in the

same region (Figure 11). Together, these data demonstrate that Smo deletion was

specific to the capsule and that hedgehog activity was deactivated only in that region.

3.2 Patterning of the outer renal cortex is abnormal in Smo null mutant kidney

To investigate the phenotype of the Smo null mutant, whole P0 kidneys from wildtype

and Smo null mutant littermates were collected and fixed in PFA. Following sectioning

of kidneys and staining with HE, the Smo null kidneys were analyzed by microscopy.

They were observed to have unusual patterning and were slightly smaller. In wildtype

kidneys there is a distinct renal capsule, comprised of a layer of flattened cells that are

just above the cortex, which contains the nephrogenic zone (Figure 12AC). The outer

cortex made up of the nephrogenic zone contains condensing mesenchyme with

nephron precursors while the inner cortex is composed of older generations of mature

nephrons and tubule structures. The Smo null mutant kidneys display different

morphology. The capsule around the Smo null kidneys does not surround the entire

kidney. There are regions on the outer edge of the kidney where no capsular cells are

present. Furthermore, the cortex underneath these regions is made up of mature

glomeruli and tubules rather than a nephrogenic zone (Figure 12BD).

30

Figure 10. In situ hybridization of Gli1 at E13.5. (A) In wildtype kidneys Gli1

expression is observed in both the cortex and medulla. (B) In the medulla Gli1 is

strongly expressed in the ureter (U) of a wildtype kidney. (C) In the cortex, Gli1

expression is widespread and can be observed in the capsule (C) as well as some

ureteric tips and mesenchymal cells. (D) The domain of Gli1 expression in kidneys of

FoxD1Cre; Smo-/loxP (Smo null) mice was similar to wildtype mice except the capsule.

(E) In the ureter Gli1 expression was maintained. (F) Gli1 expression was not detected

in the capsule, however other cortical structures that displayed Gli1 expression in

wildtype mice maintained it in the mutant. U – ureteric branch, C – capsule.

31

Figure 11. In situ hybridization of Ptc1 at E13.5. (A) Weak Ptc1 expression is

detected in the capsule (C) of wildtype kidneys.(B) In Smo null kidney, Ptc1 expression

was absent in the capsule, however expression was still present in the ureter (U) of

mutant kidneys. C – capsule, U – ureter.

32

Figure 12. Hematoxylin and eosin (H&E) stained P0 kidneys. (A) The wildtype

kidney has an outer cortex (O.C. consists of the capsule, cortical stroma and the

nephrogenic zone), an inner cortex (I.C. consists of tubules and mature glomeruli) and a

medulla (M consists of ureteric branches and medullary stroma) (C) Wildtype kidney

has a distinct renal capsule (C) and well defined a nephrogenic zone (NZ). (B) and (D)

The Smo null kidney appears to have a discontinuous capsule and the nephrogenic

zone is disrupted by tubules and mature glomeruli. I.C. – inner cortex, O.C. – outer

cortex, M – medulla, C – capsule, NZ – nephrogenic zone.

33

To define the structure of the capsule scanning electron microscopy (SEM) was utilized

to observe the surface of kidneys. E16.5 kidneys of wildtype and Smo null embryos

were dissected and fixed in 2.5% glutaraldehyde and sent to Advanced Bioimaging

Centre at Mount Sinai Hospital. SEM imaging illustrated that the capsule cells on the

surface of the wildtype kidney surround the entire organ and endow the kidney a flat

and smooth appearance (Figure 13AD). In contrast the Smo null mutant kidney at this

time point displayed a discontinuous layer of capsule cells (Figure 13BCE). The Smo

null mutant kidneys exhibited various regions on the surface where capsule cells were

absent and instead round mesenchymal cells were visible giving the kidney a rough

appearance.

3.3 Smo null mutant capsule appears discontinuous after E13.5

In order to ascertain at what stage in kidney development the capsule of the Smo null

mutants becomes discontinuous histological sectioning was utilized. Time points from

the latest (E18.5) to earlier developmental stages were examined until a time point was

discovered where the capsule of the mutant did not appear discontinuous. HE sections

of wildtype and mutant kidneys at E18.5, E15.5 and E13.5 were imaged and analyzed.

The images revealed that mutant kidneys at E18.5 and E15.5 definitively displayed the

discontinuous capsule phenotype. However, HE sections of E13.5 wildtype and mutant

kidneys had intact capsule and cortical stroma which were indistinguishable from one

another (Figure 14). This result suggested that the discontinuous capsule phenotype

presents after E13.5. This was further confirmed with SEM imaging which showed that

at E13.5 flat capsule cells on the surface of both wildtype and Smo null mutant kidneys

surrounded the entire organ (Figure 15).

34

Figure 13. Scanning Electron Microscopy (SEM) images of E16.5 wildtype and

Smo null kidneys. (A) and (D) A flattened layer of capsule cells enveloping the

wildtype kidney gives it a smooth appearance. (B), (C), and (E) The mutant kidney

appears to have a segmented capsule with the regions that have exposed cells that

normally underlie the capsule.

35

Figure 14. H&E sections of wildtype and Smo null kidneys at various embryonic

stages. The discontinuous capsule phenotype is observed in mutant kidneys of E18.5

(F) and E15.5 (E) embryos. (A) and (D) However at E13.5 the kidneys look fairly similar.

C – capsule.

36

Figure 15. SEM images of E13.5 wildtype and Smo null kidneys. Capsule cells on

the surface of both wildtype (A) and Smo null kidneys (B) surrounded the entire kidney.

A flattened layer of cells enveloping the kidney gives it a smooth appearance.

37

3.4 Smo null mutant kidneys are smaller in volume and have fewer nephrons than wildtype kidneys

Kidney volume was estimated to establish if there was a significant change in kidney

size. Smaller kidneys also may indicate lower number of nephrons, therefore the total

number of glomeruli was quantified as well.

Kidneys of E18.5 wildtype and mutant littermates were serially sectioned every 100 µm

(diameter of a mouse glomerulus is approximately 100 µm). The surface area of each

section was determined using an analytical tool in Adobe Photoshop CS5.1. By

multiplying each surface area value by 100 µm the total volume of the kidney was

estimated. The average volume of 8 wildtype and 8 mutant kidneys were found to be

2.97 mm3 and 1.53 mm3 respectively (Figure 16A). There was approximately a 48%

decrease in volume of Smo null kidneys. The count of glomeruli was performed on 6

wildtype and 6 mutant kidneys. Glomeruli tallied in the count had to be surrounded by

Bowman’s space and have visible basement membranes, as highlighted by the PAS

stain. The final count resulted in an average of 238 glomeruli in wildtype kidneys and

139 in mutants, signifying a 42% decrease (Figure 16B). While the mutant kidneys had

fewer glomeruli, the morphology of those that were present was the same as those

found in wildtype kidneys (Figure 16CD).

3.5 Smo null mutant kidneys have decreased Foxd1 and Raldh2 expression

The loss of Smo in capsule cells results in abnormalities in the morphology of the

capsule, thus further investigation was done to explore if the defect correlates with

alterations in the cellular composition and activity of the capsule.

38

Figure 16. Kidney volume and nephron number analysis of E18.5 kidneys. (A) The

average volume of 8 wildtype and 8 mutant kidneys were found to be 2.97 mm3 and

1.53 mm3 respectively. There was approximately a 48% decrease in volume of Smo null

kidneys. (B) The average total number of nephrons counted in control and Smo null

kidneys were 238 and 139 respectively, a 42% decrease in the mutant. (C) and (D)

Morphology of glomeruli in wildtype and mutant kidneys are similar.

C D

39

The expression of renal capsule molecular markers, Foxd1 and Raldh2, examined by

ISH at time points after the Cre recombinase becomes active. At E11.5 in wildtype

kidneys Foxd1 expression was limited to the outer edge of the kidney where the capsule

progenitors are situated. Conversely, Foxd1 expression in Smo null mutant kidneys was

still present in the same region but diminished compared to wildtype when examined by

ISH. The decrease in Foxd1 expression was persistent and more pronounced by E13.5.

To demonstrate that Foxd1 protein levels correlates to expression detected by ISH, an

immunofluorescence stain of Foxd1 at E15.5 did not detect the protein in mutant

kidneys (Figure 17EF). This data indicates that Foxd1 expression is perturbed and

decreased in a model of decreased hedgehog signaling in Foxd1 progenitors.

A similar result was observed with Raldh2 expression. At E13.5 Raldh2 expression was

limited to the capsule of the kidney and the cortical stroma which slightly penetrates into

the cortex. In the Smo null mutant Raldh2 expression was present in the same regions

as the wildtype kidney, however the signal was not as intense. Raldh2 expression was

almost undetected in E15.5 mutant kidneys, while remained robust in wildtype (Figure

18).

Together these data show that molecular markers normally expressed in the capsule

are not detected at the same levels throughout development in the mutant kidney. This

suggests that hedgehog activity may be required for either establishing or maintaining

normal cellular activity in the capsule to allow proper maturation.

40

Figure 17. In situ and immunofluorescence of Foxd1 at various stages. Foxd1 is

expressed on the outer edge of E11.5 (A), E13.5 (C) and E15.5 (E) wildtype kidneys.

Conversely, Foxd1 expression in Smo null kidneys is still present in the same region but

appears diminished compared to wildtype at E11.5 (B) and E13.5 (D). At E15.5, no

Foxd1 protein is observed (F).

41

Figure 18. In situ hybridization of Raldh2. Raldh2 is expressed in the capsule and

cortical stromal cells of E13.5 (A) and E15.5 (C) wildtype kidneys. Conversely, Raldh2

expression in the E13.5 Smo null kidneys (B) was greatly diminished compared to

wildtype and in the E15.5 Smo null kidney was hardly detected (D).

42

3.6 Proliferative capacity of mutant capsule cells is significantly decreased

The Smo null mutant capsule looks fairly normal at early embryonic stages but appears

increasingly segmented throughout development. Does this occur because capsular

cells at an early embryonic age do not proliferate as well, resulting in not enough cells to

be able to surround a larger kidney?

To investigate this question, proliferation was quantified in the renal capsule by BrDU

injection of pregnant mothers for two hours at E11.5 and E13.5. Harvested kidneys

were stained with a fluorescent anti-BrDU antibody to visualize cells that were dividing.

Utilizing the identifiable morphology of capsule cells a ratio of proliferative capsule cells

over total number of capsule cells was calculated.

At E11.5 the ratios of wildtype and mutant kidneys were 0.275 and 0.222 respectively.

There was a significant 20% decrease in the proliferative capacity of mutant capsule

cells. The effect was more prominent by E13.5 when the ratios of wildtype and mutant

kidneys were 0.268 and 0.124 which corresponded to a 54% decrease in proliferative

capacity (Figure 19).

This experiment showed that Smo deletion in capsular stroma causes a decrease in the

rate of proliferation of capsule cells. Discontinuity of the mutant capsule is likely a result

of the loss of proliferative capacity in capsule cells.

43

Figure 19. A ratio of BrDU positive (proliferative) capsule cells over total number

of capsule cells was used as an index of proliferative capacity. (A) Kidney stained

with a Six2 (red) and BrDU (green) antibody and DAPI (blue). All capsule cells (C) were

separately counted from mesenchymal cells (M) by morphology and location. The white

segmented line represents the outer edge of the kidney where capsule cells are located.

(B) At E11.5 the proliferative index of wildtype and mutant kidneys were 0.275 and

0.222 respectively. There was a 20% statistically significant (P

44

3.7 Mutant mice do not always have a discontinuous capsule

The deletion of Smo in Foxd1 progenitors has a significant impact on the morphology of

the kidney. Are mutants viable and if so does this phenotype affect kidney function?

Pregnant mice were permitted to undergo a full term pregnancy and give birth to their

pups to examine the viability of mutants. The first litter examined was immediately after

birth.

A litter of six P0 pups was harvested of which three were discovered to be deceased.

Genotyping analysis revealed that all three deceased pups were mutants, while the

three viable pups were a mix of mutant and wildtype alleles. HE sections of kidneys

from wildtype, viable mutant, and non-viable mutant kidneys revealed that viable mutant

kidneys looked similar in structure to wildtype kidneys. Viable mutants had an intact

capsule which surrounded the whole renal organ. Non-viable mutant kidneys displayed

the discontinuous capsule phenotype and had mature nephrons near the surface as

described previously (Figure 20).

These data indicate that deletion of Smo in Foxd1 progenitors has a variable phenotypic

outcome. Some mutants have a continuous capsule and an ample number of cortical

stroma cells surrounding the mesenchyme regardless of the Smo deletion. Further,

investigation needs to be done to determine the proliferative index of capsule cells of

mutant viable mice. If mutant mice have a normal capsule, there may not be a

significant decrease in the rate of proliferation of capsule cells in those mice. Future

evidence found to support this hypothesis will imply the presence of another signal that

stimulates cell division in the absence of hedgehog signaling.

45

Figure 20. H&E sections of wildtype, viable mutant, and non-viable mutant P0

kidneys. Viable mutant kidneys (BE) look similar in structure to wildtype kidneys (AD).

Viable mutants have an intact capsule which surrounds the whole renal organ. Non-

viable mutant kidneys (CF) display the discontinuous capsule phenotype and have

mature nephrons near the surface.

46

3.8 Viable mutants display normal kidney function

Urinalysis and blood biochemistry was performed on adult mutant mice to ascertain if

Smo deletion has an effect on kidney function. To obtain an index of renal function,

there are a number of quick and non-invasive or minimally invasive measures that can

be performed.

Two of the most fundamental indicators of renal function that can be measured from a

mouse blood sample are plasma creatinine and blood urea nitrogen (BUN). The body’s

excretion of creatinine and BUN is a primarily dependent on glomerular filtration,

therefore an elevation of either of these in the blood indicates reduced renal filtration

capacity and may point to an underlying renal disease. Another marker of renal function

is uric acid as 70% of its disposal occurs via the kidneys, and in 5-25% of humans,

impaired renal excretion leads to hyperuricemia99. Blood levels of creatinine, urea, and

uric acid in mutant mice were not significantly different from their wildtype littermates

suggesting normal filtration capacity (Figure 21).

Another non-invasive method for assessing renal function is to measure albumin or total

protein excretion in the urine. Healthy kidneys excrete minimal amounts of protein, thus

proteinuria is commonly used as a sign of kidney damage. The protein levels in the

urine of all mice were normal further indicating no change in kidney function. Additional

testing did not detect any blood in all urine samples and glucose concentration was also

normal in almost all samples (Table 1).

47

Figure 21. Blood biochemistry of adult wildtype and Smo null littermate mice.

Blood levels of creatinine, urea, and uric acid in mutant mice were not significantly

different from their wildtype littermates suggesting normal filtration capacity (P>0.05 for

all metabolites).

48

Table 1: Urinalysis of adult wildtype and Smo null littermate mice.

49

3.9 Gli3 deficiency improves renal patterning and capsule formation

The work of Hu et al, 200622 demonstrated that the ratio of Gli3 activator and repressor

is very important to proper development of the kidney. Furthermore, at low levels of

hedgehog signaling, as is the case in the renal capsule, Gli3 does not get cleaved to a

repressor form and the repressor targets are expressed. However, hedgehog signaling

is absent in the capsule of the Smo null mutants which may result in Gli3 being

proteolytically processed to the repressor form. To investigate Gli3 activity in capsule

development, Gli3 alleles were removed to preclude formation of the Gli3 repressor.

Analysis of HE stained sections showed that with the loss of even one Gli3 allele the

patterning of Smo null mutant kidney structures were restored and appeared to be

similar to wildtype(Figure 22 and 23). The capsule of Smo null mutants with one or both

Gli3 alleles deleted was no longer discontinuous and enveloped the entire kidney

surface. However, there was a lack of cortical stroma present beneath the capsule

which surrounds and supports condensing mesenchyme resulting in the surface of

kidneys not having a flat and smooth appearance as in wildtype kidneys (Figure 22).

When both Gli3 alleles are deleted, kidneys have smoother appearance as cortical

stroma cells are present in regions between condensing mesenchyme. The capsule

layer while present in both Gli3 mutants appears thinner when compared to wildtype

kidneys.

4 . Chapter Four: Discussion and Future Experiments

The renal capsule is an important structure not only in shaping the kidney but also in the

overall normal patterning of the kidney. Current evidence suggests that a developing

kidney has a delicate balance of signals which are imparted from the capsule and

50

Figure 22. H&E sections of wildtype, Smo null mutant, and Smo null; Gli3

heterozygous deleted mutant P0 kidneys. (A) and (D) The wildtype kidney has a

distinct renal capsule and well defined a nephrogenic zone as expected. The arrows in

(D) point out cortical stroma which surround and support cap mesenchyme. (B) and (E)

The Smo null kidney has a discontinuous capsule and disrupted nephrogenic zone as

previously described. (C) and (F) A FoxD1Cre; Smo-/loxP;Gli3+/- (Smo null; Gli3 het)

mutant has normal tissue patterning comparable to the control kidney. The nephrogenic

zone is not disrupted and the capsule layer surrounds the entire kidney. Arrows indicate

regions where more cortical stroma should be to present to surround cap mesenchyme.

The surface of the kidney does not appear smooth like the wildtype.

51

Figure 23. H&E sections of control, Smo null mutant, and Smo null; Gli3 null

mutant E18.5 kidneys. (A) and (D) The control kidney is FoxD1Cre; Smo+/loxP. No

wildtype embryos were harvested in this litter. With the loss of one Smo allele in the

capsule the kidney still has an intact renal capsule and well defined a nephrogenic

zone. The capsule layer is thinner than what is normally observed in wildtype kidneys.

(B) and (E) The Smo null kidney has a discontinuous capsule and disrupted

nephrogenic zone as previously described. (C) and (F) A FoxD1Cre; Smo-/loxP;Gli3-/-

(Smo null; Gli3 null) mutant has normal tissue patterning comparable to the control.

Furthermore, the nephrogenic zone is not disrupted and the capsule layer surrounds the

entire kidney. The capsule layer is thin like in the control.

52

cortical stroma and from the interior to pattern the nephrogenic and ureteric

compartments of the nephrogenic zone51. Taken together these signals allow for

controlled radial expansion of the kidney and maintain proper compartmentalization.

4.1 Deleterious effects on capsule formation by decreased hedgehog signaling

Hedgehog signaling has never been previously implicated in renal capsule

development. The Smo null mutant mice had a significant phenotype which is never

observed in any wildtype mice or mice with the Foxd1Cre allele, highlighting the

importance of the signaling pathway in capsule formation. Foxd1Cre mediated deletion

of Smo renders capsule cells in an inactive state regardless of the presence of a

hedgehog ligand. The specific loss of expression of Ptc1 and Gli1, genes normally

upregulated by hedgehog signaling, in the capsule area strongly suggest that these

mice are a good model to study capsule development in the context of inactive

hedgehog signaling. Smo null mutant kidney capsule cells do not proliferate as

frequently, consistent with previous knowledge that the hedgehog pathway activates cell

cycling genes N-myc and CyclinD1. The mouse metanephros at E11.5 is composed of

approximately 1000 mesenchymal cells which go on to differentiate and give rise to a

large number of nephrons (~13000) and other structures that comprise the kidney1.

There is considerable change in size and volume that is associated with the

development of the kidney from 1000 mesenchymal cells to a mature organ. The

capsule cells must continuously proliferate and maintain a high cell population in order

to be able to surround kidney as it becomes larger. Loss of hedgehog signaling in these

cells has a significant impact on proliferative capacity as measured by BrDU

incorporation. While the cells are still able to divide, the rate of proliferation is

53

considerably lower and is outmatched by the rate of increase in kidney volume. The

result is a discontinuous capsule phenotype where regions of the surface of the kidney

are not coated with capsule cells due to a lack of availability.

In addition to loss of proliferative capacity, deactivated hedgehog signaling also resulted

in gradual decrease of normal capsule markers Foxd1 and Raldh2. Foxd1 expression

was not immediately lost, therefore the resulting phenotype was not the same as what

was observed in Foxd1 null mice from Levinson et al, 2005. Foxd1 null mice have

kidneys which fuse to one another at the midline and do not detach from the dorsal

body wall47. While levels of Foxd1 were diminished as early as E11.5 in the Smo null

mutant, the outcome was not similar to the Foxd1 mutant, kidneys separated from one

another and the surrounding body wall by E15.5. Similar to the Foxd1 null mice as

Foxd1 expression diminished, Raldh2 was also lost. This data suggests hedgehog

signaling is at least indirectly responsible for maintaining expression of these capsule

markers. Further experiments exploring hedgehog inactivity at earlier time points will

determine whether hedgehog signaling is required to initiate Foxd1 and Raldh2

expression as well.

4.2 Capsule formation is required for viability

Capsule formation is not only important for kidney development, but also for embryo

viability as highlighted by the Smo null mutant mice not being viable. However, there is

a caveat that if embryos with Smo deficiency can form a capsule that envelops the

entire kidney, they become viable and grow to adulthood with normal kidney function.

How can they form a full capsule layer? It is possible that the viable mice are

characterized by incomplete excision of Smo resulting in only partial loss of hedgehog

54

signaling. The BrDU injections demonstrate that capsule cells continue to proliferate;

only the rate is decreased. Partial hedgehog activity may be able to maintain the

proliferative index of capsule cells so that the capsule does not become discontinuous.

If excision of Smo is complete and hedgehog signaling is inactive, there must be other

active pathways that stimulate capsule cells proliferation. It is possible that in viable

mutants, other pathways get upregulated to compensate for the deactivated hedgehog

pathway. If an alternative pathway can promote capsule cell proliferation, the

upregulation of that pathway may be inconsistent. This may be evidenced by the

observation that non-viable mutants with a discontinuous capsule display variability in

the severity of the phenotype. Specifically, some kidneys have exposed regions in the

capsule every 100 µm around the entire organ while less severely affected kidneys

have few sections on the surface where the capsule is discontinuous. Weak or strong

upregulation of an alternate pathway may result in a less severely affected non-viable

mutant or an unaffected viable mutant respectively. Surprisingly the presence of the

capsule is sufficient to correct for other renal patterning issues and kidney function

remains unaffected. This may suggest that signals which are imparted from the capsule

and help establish the nephrogenic zone are independent of hedgehog signaling.

4.3 Effects of loss of capsule on renal patterning

Although, expression of capsule markers of E13.5 wildtype and Smo null mutant

kidneys is dissimilar, histological sections of the two are indistinguishable. Past E13.5,

the capsule of mutant kidneys becomes discontinuous exposing areas on the surface

that would otherwise lie beneath the capsule. Patterning within Smo null mutant kidneys

looks dysplastic as the capsule becomes discontinuous. Exposed regions, no longer

55

covered by capsule cells, are not patterned like the remainder of the outer cortex.

Components of the outer cortex, including cortical stroma, ureteric bud tips, and

aggregates of nephron progenitors, are not observed in exposed regions of mutant

kidneys. Structures which compose the inner cortex such as mature glomeruli and

tubules are instead present on the surface.

Although the deletion of Smo is specific to capsule cells, a deleterious effect on the

nephrogenic zone where capsule cells are lacking is also observed. The corresponding

loss of the nephrogenic zone to the loss of capsule cells suggests that capsule cells

play an important role in nephrogenic zone maintenance. In wildtype mice, glomerular

units are not observed near the surface where the nephrogenic zone is. The presence

of morphologically normal glomerular units near the surface where capsule cells are

absent suggests that signaling molecules that differentiate nephrogenic units are

maintained while signals that control their localization are absent. Therefore, capsule

cells may generate signals which define and maintain the nephrogenic zone preserve

the boundary between nephrogenic and medullary zones and their respective cell types.

Previous work by Yallowitz et al, 201149 demonstrated that continued expression of key

nephrogenic mesenchymal markers is dependent on proper integration of Foxd1-

expressing capsule cells around metanephric mesenchyme.

The balance between the capsule layer, the nephrogenic zone, and the medullary zone

is perturbed when capsule cells do not surround condensing mesenchyme. The

importance of capsule cells signaling in renal development is distinctly apparent when it

is absent and controlled radial expansion of kidneys gets disrupted. The disturbance of

56

signals that establish the nephrogenic zone is most likely the largest contributor to the

large decrease in kidney volume and nephron number observed in the mutants.

4.4 Gli repressor influences renal capsule development

In Smo null mutant mice hedgehog signaling is inactivated in capsule cells. It is difficult

to interpret in this model whether the phenotypes associated with this mutant are

caused by too much repressor or too little activator in the capsule. In order to consider

these possibilities, compound mutants were generated that had decreased or no Gli

repressor. The results illustrated that Gli repressor has a significant role in capsule

formation. The capsule was not discontinuous and patterning of structures within the

cortex and medulla was normal in Gli3 rescue mice even though the kidneys remained

hypoplastic. However, Gli3 deficient kidneys are known to be reduced in volume by

15%91. This data suggests that active hedgehog signaling in capsule cells prevents Gli

repressor activity. Furthermore, this data does not rule out the possibility that insufficient

Gli activators are