Activation of the RLR/MAVS Signaling Pathway by the L Protein ofMopeia Virus

Lei-Ke Zhang, Qi-Lin Xin, Sheng-Lin Zhu, Wei-Wei Wan, Wei Wang, Gengfu Xiao

State Key Laboratory of Virology, Wuhan Institute of Virology, Chinese Academy of Sciences, Wuhan, China

ABSTRACT

The family Arenaviridae includes several important human pathogens that can cause severe hemorrhagic fever and greatlythreaten public health. As a major component of the innate immune system, the RLR/MAVS signaling pathway is involved inrecognizing viral components and initiating antiviral activity. It has been reported that arenavirus infection can suppress theinnate immune response, and NP and Z proteins of pathogenic arenaviruses can disrupt RLR/MAVS signaling, thus inhibitingproduction of type I interferon (IFN-I). However, recent studies have shown elevated IFN-I levels in certain arenavirus-infectedcells. The mechanism by which arenavirus infection induces IFN-I responses remains unclear. In this study, we determined thatthe L polymerase (Lp) of Mopeia virus (MOPV), an Old World (OW) arenavirus, can activate the RLR/MAVS pathway and thusinduce the production of IFN-I. This activation is associated with the RNA-dependent RNA polymerase activity of Lp. This studyprovides a foundation for further studies of interactions between arenaviruses and the innate immune system and for the eluci-dation of arenavirus pathogenesis.

IMPORTANCE

Distinct innate immune responses are observed when hosts are infected with different arenaviruses. It has been widely acceptedthat NP and certain Z proteins of arenaviruses inhibit the RLR/MAVS signaling pathway. The viral components responsible forthe activation of the RLR/MAVS signaling pathway remain to be determined. In the current study, we demonstrate for the firsttime that the Lp of MOPV, an OW arenavirus, can activate the RLR/MAVS signaling pathway and thus induce the production ofIFN-I. Based on our results, we proposed that dynamic interactions exist among Lp-produced RNA, NP, and the RLR/MAVS sig-naling pathway, and the outcome of these interactions may determine the final IFN-I response pattern: elevated or reduced. Ourstudy provides a possible explanation for how IFN-I can become activated during arenavirus infection and may help us gain in-sights into the interactions that form between different arenavirus components and the innate immune system.

Arenaviruses are enveloped viruses with bisegmented, nega-tive-sense, single-stranded RNA genomes comprising a larger

(L) and a smaller (S) segment. The S segment encodes the viralglycoprotein precursor (GPC) and the nucleoprotein (NP), andthe L segment encodes a small RING finger protein (Z) and theviral RNA-dependent RNA polymerase (RdRp) (L polymerase[Lp]). The GPC is posttranslationally processed into stable signalpeptide (SSP), GP1, and GP2, which form spikes on the viral sur-face and mediate cell entry via receptor-mediated endocytosis (1,2). NP, the major structural protein, is associated with viral RNA.The Z protein drives arenavirus budding (3) and can influenceviral RNA synthesis (4, 5). Lp, similar to other viral RNA-depen-dent RNA polymerases, mediates both viral genome replicationand mRNA transcription (6, 7).

The family Arenaviridae can be divided into two genera, Mam-marenavirus and Reptarenavirus (8). Mammarenavirus memberscan be classified into two groups mainly based on antigenic prop-erties and geographical distribution: Old World (OW) and NewWorld (NW) arenaviruses (8). The OW arenaviruses includeLassa virus (LASV), lymphocytic choriomeningitis virus (LCMV),and Mopeia virus (MOPV), and the NW arenaviruses includeJunin virus (JUNV) and Machupo virus (MACV). Arenavirusescause chronic and asymptomatic infections in rodents, but severalarenaviruses, such as LASV, JUNV, and MACV, cause severe hem-orrhagic fever (HF) in infected humans (9–11) and are seriousthreats to public health. There are no FDA-approved vaccines forarenaviruses. Candid#1, a JUNV live-attenuated strain, is an effec-

tive vaccine against Argentine HF (12). Another vaccine candi-date, ML29, a reassortant containing the L genomic segment ofMOPV and the S genomic segment of LASV, has exhibited prom-ising safety and efficacy profiles in animal models, including non-human primates (13–15).

The innate immune system, the first line of host defense againstvirus infection, utilizes pattern recognition receptors (PRRs) torecognize invading viruses and initiate host antiviral responses(16). Three classes of PRRs, namely, Toll-like receptors (TLRs),retinoic acid-inducible gene I (RIG-I)-like receptors (RLRs), andNOD-like receptors (NLRs), are involved in the recognition ofvirus-specific components (17). During RNA virus infection, cy-tosolic viral RNAs are initially recognized by the RLRs RIG-I andMDA5 (18). Then, RIG-I and MDA5 translocate to mitochondria,where they activate a downstream mediator, mitochondrial anti-viral signaling protein (MAVS) (also called VISA, CARDIF, or

Received 6 July 2016 Accepted 23 August 2016

Accepted manuscript posted online 7 September 2016

Citation Zhang L-K, Xin Q-L, Zhu S-L, Wan W-W, Wang W, Xiao G. 2016.Activation of the RLR/MAVS signaling pathway by the L protein of Mopeiavirus. J Virol 90:10259 –10270. doi:10.1128/JVI.01292-16.

Editor: B. Williams, Hudson Institute of Medical Research

Address correspondence to Gengfu Xiao, xiaogf@wh.iov.cn.

L.-K.Z. and Q.-L.X. contributed equally to this work.

Copyright © 2016, American Society for Microbiology. All Rights Reserved.

crossmark

November 2016 Volume 90 Number 22 jvi.asm.org 10259Journal of Virology

on July 16, 2018 by guesthttp://jvi.asm

.org/D

ownloaded from

IPS-1) (19–22). Activated MAVS triggers intracellular signalingcascades, which result in the nuclear translocation of the tran-scription factors IRF3, IRF7, and NF-�B and the subsequent pro-duction of type I interferons (IFN-I) and proinflammatory cyto-kines (23).

Distinct interferon responses are observed when hosts are in-fected with different arenaviruses in vitro (24–26). It has beenreported that multiple arenaviruses can suppress IFN-I produc-tion in infected cells (27), and this is because most, if not all,arenavirus NP and pathogenic arenavirus Z proteins can disruptthe RLR/MAVS signaling pathway (26–30). However, recent stud-ies have indicated that the NW arenaviruses JUNV and MACV canactivate IFN-I production in a RIG-I-dependent manner (24, 25,31). Considering that the NP and Z proteins possess inhibitoryfunctions, the viral components responsible for the activation ofthe RLR/MAVS signaling pathway remain to be determined. Inorder to explain the activation of IFN-I observed in LCMV-in-fected mice, Zhou et al. performed an experiment to prove thatLCMV genomic RNA strongly activates IFN-I productionthrough the RLR/MAVS signaling pathway and that this activa-tion can be blocked by NP (32). Huang et al. found activation ofIFN-I in MACV-infected cells, and based on their results, theyproposed that the activation may occur in response to a “dangersignal” associated with MACV replication rather than in responseto an immediate-early signal, such as incoming genomic RNA(25).

MOPV is closely related to LASV, sharing 75% amino acididentity (33). Although MOPV and LASV are isolated from thesame reservoir, MOPV is not pathogenic to humans (34). It hasbeen reported that human macrophages produce IFN-I in re-sponse to MOPV infection (35), although how this production isactivated remains unknown. In the current study, we demonstratefor the first time that the Lp of MOPV, an OW arenavirus, canactivate the RLR/MAVS signaling pathway and thus induce theproduction of IFN-I.

MATERIALS AND METHODSCells and viruses. BHK-21, HEK 293T, HeLa, and Vero E6 cells weregrown in Dulbecco’s modified Eagle’s medium (DMEM) (Gibco) supple-mented with 10% fetal bovine serum (FBS) (Gibco) and penicillin-strep-tomycin. Recombinant vesicular stomatitis virus-green fluorescent pro-tein (rVSV-GFP) and Sendai virus (SeV) were provided by Hong-BingShu (Wuhan University, Wuhan, China). SeV was grown in 10-day-oldembryonated eggs.

Reagents and antibodies. Mouse monoclonal antibody against theMyc tag (Sigma); mouse monoclonal antibody against double-strandedRNA (dsRNA) (J2; English & Scientific Consulting Kft); rabbit polyclonalantibody against the Myc tag (Cell Signaling Technology); rabbit poly-clonal antibodies against glyceraldehyde-3-phosphate dehydrogenase(GAPDH), lamin B1, MAVS, RIG-I, MDA5, and Flag tag (ProteinTech,Wuhan, China); and Cy5-labeled antibody to mouse IgG and DyLight488-labeled antibody to rabbit IgG (KPL) were purchased from the indicatedmanufacturers.

All small interfering RNA (siRNA) oligonucleotides used in the studywere synthesized by GenePharma (Suzhou, China), and the sequenceswere as follows (5=-3=): siMAVS#1, CCAGAGGAGAAUGAGUAUAAG;siMAVS#2, UUUACCAAGGGUUGGAUAUAU; siRIG-I#1, GCAAGCCUUCCAGGAUUAUAU; siRIG-I#2, AUCACGGAUUAGCGACAAAUU;siRIG-I#3, AGCACUUGUGGACGCUUUAAA; siMDA5#1, CGCAAGGAGUUCCAACCAUUU; siMDA5#2, CCAACAAAGAAGCAGUGUAUA;siMDA5#3, CCAUCGUUUGAGAACGCUCAU. All the primers used for

quantitative real-time PCR were synthesized by Sangon Biotech (Shanghai,China).

Constructs. IFN-stimulated response element (ISRE) and IFN-� pro-moter and firefly luciferase reporter plasmids (pFL-ISRE and pFL-IFN-�), a Renilla luciferase control plasmid (pRL-TK), and mammalian cellexpression plasmids for Flag-IRF3 and Flag-MAVS were provided byHong-Bing Shu (Wuhan University, Wuhan, China). The plasmid pRF42was provided by Fei Deng (Wuhan Institute of Virology, Chinese Acad-emy of Sciences, Wuhan, China).

The Lp sequences of MOPV AN20410 (NC_006575.1) and LASVstrain Josiah (HQ688672) were obtained from GenBank, and the corre-sponding cDNAs were chemically synthesized by Sangon Biotech (Shang-hai, China). The genes encoding MOPV Lp and LASV Lp (here referred toas LpMOPV and LpLASV, respectively) were subcloned into a pCAGGs ex-pression vector, and the genes encoding LpMOPV, LpLASV, NPLASV, andMAVS were subcloned into a pCMV-Myc expression vector, which has anN-terminal Myc tag. Point mutations in LpMOPV were generated by mu-tagenic PCR, and the resulting PCR products were subcloned into expres-sion vectors. The antisense S genome of LASV (HQ688672) was con-structed by recombinant PCR and subcloned into the pRF42 plasmid(pRF42-SagLASV). The GPC open reading frame (ORF) in pRF42-Sa-gLASV was then replaced with the firefly luciferase ORF in the antisenseorientation using an In-Fusion HD cloning kit (Clontech) according tothe manufacturer’s instructions to obtain pRF42-SagLASVFirefly�GPC,containing the S minigenome (MG) of LASV (see Fig. 7C). All the plas-mids were confirmed by sequence analysis.

Transfection. Cells were seeded in plates and then transfected with theindicated amounts of expression plasmids or siRNAs using Lipofectamine2000 (Invitrogen) according to the manufacturer’s instructions. In thesame experiment, empty-control plasmid or negative-control RNA inter-ference (RNAi) was added to ensure that each transfection received equiv-alent amounts of total DNA or RNAi. One or 2 days after transfection,cells were collected, and transfection efficiency was measured by Westernblotting (WB) or quantitative real-time PCR.

Reporter assays. For reporter gene assays, HEK 293T cells seeded in24-well plates were cotransfected with reporter plasmids and the indicatedamounts of expression plasmids or siRNAs. pRL-TK was added to eachtransfection mixture to normalize the transfection efficiency. One or 2days after transfection, the cells were lysed, and luciferase assays wereperformed using a dual-specific luciferase assay kit (Promega).

Replicon system assay. Our preliminary data indicated that NPLASV

and LpMOPV are sufficient to achieve replication and transcription of theLASV S genome. In this study, LASV S MG and NP were used to assess theRdRp activity of LpMOPV. BHK-21 cells seeded in 24-well plates werecotransfected with pRF42-SagLASVFirefly�GPC, pCMV-Myc-NPLASV,and pCMV-Myc-LpMOPV or mutated LpMOPV. One or 2 days after trans-fection, the cells were lysed, and luciferase assays were performed using afirefly luciferase assay kit (Promega).

Viral plaque assay. HEK 293T cells transfected with the indicatedplasmids for 24 h were infected with rVSV-GFP at a multiplicity of infec-tion (MOI) of 1, and the culture medium was changed at 1 h postinfection(p.i.). Tissue culture supernatant (TCS) was collected at 12 and 24 h p.i.and added to Vero E6 cells preseeded in 24-well plates. At 1 h p.i., 2%methylcellulose was overlaid, and the plates were incubated for 3 days.The overlay was removed, and the cells were fixed with 4% paraformal-dehyde for 30 min and then stained with 1% crystal violet for 30 min. Theresultant plaques were counted, averaged, and multiplied by the dilutionfactor to determine the viral titer as plaque-forming units (PFU) per mil-liliter.

RNA extraction and quantitative real-time PCR. Total cellular RNAwas extracted with TRIzol reagent (Invitrogen), and small RNA (20 to 200nucleotides [nt]) was extracted with RNAiso for small RNA (TaKaRa)according to the manufacturer’s instructions. Reverse transcription ofRNA was performed using a reverse transcription master mix (TaKaRa).Quantitative real-time PCR was performed with an Applied Biosystems

Zhang et al.

10260 jvi.asm.org November 2016 Volume 90 Number 22Journal of Virology

on July 16, 2018 by guesthttp://jvi.asm

.org/D

ownloaded from

Step-One real-time PCR system. SYBR green mix (TaKaRa) and gene-specific primers were used in a 20-�l volume. The intracellular mRNAlevel of a targeted protein was calculated using GAPDH as the endogenouscontrol and an untreated control sample as the reference.

Subcellular fractionation. Subcellular fractionation was performedwith a nuclear and cytoplasmic protein extraction kit (Beyotime, Shanghai,China) as described previously (36). Briefly, cells were collected and washedwith prechilled phosphate-buffered saline (PBS). The cell pellets were resus-pended in prechilled buffer A from the nuclear and cytoplasmic protein ex-traction kit and incubated on ice for 20 min. Then, buffer B was added, andthe mixture was vortexed and centrifuged at 500 � g for 5 min. The superna-tant was collected as the cytoplasmic fraction. The pellet was resuspended inbuffer C, incubated on ice for 10 min, and centrifuged at 13,200 � g for 20min. The supernatant was then collected as the nuclear fraction.

Western blot analysis. Equal amounts of protein samples were sub-jected to SDS-PAGE and transferred onto a polyvinylidene difluoride(PVDF) membrane (Millipore). After blocking with Tris-buffered saline–Tween 20 buffer (TBST) containing 5% nonfat milk, the membranes were

incubated with primary antibodies and the corresponding horseradishperoxidase-conjugated secondary antibodies (ProteinTech, Wuhan,China). Protein bands were detected by enhanced chemiluminescence(ECL) (Millipore, Billerica, MA). Band intensities were measured withQuantity One software (Thermo).

Immunofluorescence and confocal microscopy. HeLa cells grown onglass coverslips in 24-well plates were fixed in 4% formaldehyde, perme-abilized in 0.3% (vol/vol) Triton X-100 (BioSharp, Hefei, China), andblocked with 5% FBS (Gibco). The cells were then incubated with primaryantibodies for 2 h at room temperature and stained with secondary anti-bodies for 1 h at room temperature. DAPI (4=,6-diamidino-2-phenylin-dole) (Beyotime, Shanghai, China) was used to visualize cell nuclei. Imageacquisition was performed with an A1 MP� multiphoton confocal mi-croscope (Nikon).

RESULTSLpMOPV activates IFN-I production. To investigate the effect ofLpMOPV on IFN-I production, HEK 293T cells were cotransfected

FIG 1 LpMOPV activates IFN-I production. (A) HEK 293T cells (1 � 106) were transfected with pCMV-Myc (Vec), pCMV-Myc-LpMOPV, or pCMV-Myc-LpLASV

(2 �g each). At 24 h posttransfection, the cells were lysed, and cytosol proteins were subjected to WB analysis. Expression of Myc-LpLASV or Myc-LpMOPV wasdetected with a mouse monoclonal antibody against the Myc tag (Sigma). (B) HEK 293T cells (1 � 105) were transfected with pFL-IFN-� (100 ng); pFL-TK (50ng); and pCMV-Myc (Vec), pCMV-Myc-LpMOPV, pCMV-Myc-LpLASV, pCMV-Myc-MAVS, or pCMV-Myc-EGFP (200 ng each). At 24 h posttransfection, thecells were lysed. The intracellular luciferase activity was measured, and the relative IFN-� promoter activity was calculated. The expression of Myc-LpMOPV andMyc-LpLASV was confirmed by Western blotting. (C) Myc-LpMOPV activates the IFN-� promoter in a dose-dependent manner. HEK 293T cells (1 � 105) weretransfected with pFL-IFN-� (100 ng), pFL-TK (50 ng), and pCMV-Myc (Vec) or the indicated amount of pCMV-Myc-LpMOPV. At 24 h posttransfection, the cellswere lysed to measure intracellular luciferase activity. (D) Myc-LpMOPV increases the intracellular mRNA level of IFNB1. HEK 293T cells (1 � 105) weretransfected with pCMV-Myc (Vec), pCMV-Myc-LpMOPV, or LpLASV (200 ng each), and at 24 h posttransfection, the cells were collected and intracellular mRNAswere extracted and subjected to reverse transcription. The relative intracellular mRNA level of IFNB1 was measured by quantitative real-time PCR and calculatedusing GAPDH as the endogenous control. (E) LpMOPV activates the IFN-� promoter. HEK 293T cells (1 � 105) were transfected with pFL-IFN-� (100 ng),pFL-TK (50 ng), and the indicated pCAGGs plasmids (200 ng each). At 24 h posttransfection, the cells were lysed to measure intracellular luciferase activity. (Fand G) The IFN-� promoter was not activated in Mycstop-LpMOPV-transfected cells. (F) Schematic presentation of pCMV-Myc-LpMOPV and its mutant,pCMV-Mycstop-LpMOPV. HEK 293T cells (1 � 105) were transfected with pFL-IFN-� (100 ng), pFL-TK (50 ng), and the indicated pCMV-Myc plasmids (200 ngeach). (G) At 24 h posttransfection, cells were lysed to measure intracellular luciferase activity. All experiments were performed at least three times, and the valuesrepresent the means and standard deviations (SD) of three replicates. *, P � 0.05; **, P � 0.01.

Lp of MOPV Activates RLR/MAVS Signaling Pathway

November 2016 Volume 90 Number 22 jvi.asm.org 10261Journal of Virology

on July 16, 2018 by guesthttp://jvi.asm

.org/D

ownloaded from

with pFL-IFN-� and pCMV-Myc-LpMOPV or pCMV-Myc-LpLASV. At 24 h after transfection, the cells were lysed to measureintracellular luciferase activity. The expression of LpMOPV andLpLASV was confirmed by Western blotting (Fig. 1A), and asshown in Fig. 1B, the expression of Myc-LpMOPV activated theIFN-� promoter, while the expression of Myc-LpLASV did not.Additionally, Myc-LpMOPV activated the IFN-� promoter in adose-dependent manner (Fig. 1C). Furthermore, HEK 293T cellswere transfected with pCMV-Myc-LpMOPV, and the intracellularmRNA level of IFNB1 was measured by quantitative real-timePCR. As shown in Fig. 1D, expression of Myc-LpMOPV increasedthe intracellular IFNB1 mRNA level. These results indicate thatintracellular expression of Myc-LpMOPV activates IFN-I produc-tion.

The above-described experiments were performed with Myc-tagged LpMOPV. To confirm our results, we performed the sameexperiment with wild-type LpMOPV using pCAGGs-LpMOPV.Again, we observed activation of the IFN-� promoter in LpMOPV-expressing cells (Fig. 1E). To exclude the possibility that the acti-vation was caused by Lp mRNA, we constructed the mutant plas-mid Mycstop-LpMOPV, which contains a stop codon localized 12 bpdownstream of the Myc start codon (Fig. 1F). Transfection of thisplasmid leads to the production of mRNA containing LpMOPV

mRNA without producing the LpMOPV protein. As shown in Fig.1G, the IFN-� promoter was not activated in the Mycstop-LpMOPV-transfected cells, suggesting that IFN-I production is activated byLp protein but not Lp mRNA.

LpMOPV activates ISGs and promotes antiviral activity. Afterbeing produced, IFN-I is secreted and then binds to the cell surface

receptor IFNAR to initiate a signaling cascade that subsequentlyinduces expression of interferon-stimulated gene (ISG) expres-sion, which is regulated by ISRE sites in the promoter (37). Wefound that ISRE promoter activity was higher in HEK 293T cellsexpressing LpMOPV (Fig. 2A), indicating that LpMOPV can activatethe ISRE promoter. We then performed quantitative real-timePCR to assess the relative intracellular mRNA levels of severalISGs. As shown in Fig. 2B, intracellular mRNA levels of ISG15,ISG56, and OASL were higher in cells expressing LpMOPV, indicat-ing that LpMOPV can activate ISGs.

To further explore whether the elevated IFN-I levels are corre-lated with antiviral activity, we performed virus inhibition assayswith VSV. To accomplish this, Myc-LpMOPV-expressing HEK293T cells were infected with rVSV-GFP. At 12 h p.i., we foundonly low GFP intensity in LpMOPV-expressing cells (Fig. 2C), sug-gesting that VSV replication was inhibited. The cell supernatantswere collected at 12 and 24 h p.i., and the virus titer in TCS wasdetermined with a plaque assay. As shown in Fig. 2D, the VSV titerin TCS was significantly reduced in cells expressing LpMOPV, sug-gesting that LpMOPV promotes antiviral activity.

LpMOPV activates the RLR/MAVS signaling pathway viaMAVS, RIG-I, and MDA5. Arenavirus NP inhibits the activationof the RLR/MAVS signaling pathway and therefore blocks nucleartranslocation of IRF3 (38), which is a prerequisite for the activa-tion of the IFN-I promoter. We therefore examined whetherLpMOPV can activate RLR/MAVS signaling by measuring the nu-clear translocation of IRF3. First, HEK 293T cells were cotrans-fected with Flag-IRF3 and pCMV-Myc-LpMOPV and then col-lected at 36 h posttransfection. The collected cells were then

FIG 2 LpMOPV activates the ISRE promoter, ISGs, and antiviral activity. (A) LpMOPV activates the ISRE promoter. HEK 293T cells (1 � 105) were transfected withpFL-ISRE (100 ng), pFL-TK (50 ng), and the indicated pCMV-Myc plasmids (200 ng each). At 24 h posttransfection, the cells were lysed to measure intracellularluciferase activity, and the relative ISRE promoter activity was calculated. (B) LpMOPV activates ISGs. HEK 293T cells (1 � 105) were transfected with pCMV-Myc(Vec) or pCMV-Myc-LpMOPV (200 ng), and at 24 h posttransfection, the cells were collected and intracellular mRNAs were extracted and subjected to reversetranscription. The relative intracellular mRNA levels of ISG15, 1SG56, and OASL were measured by quantitative real-time PCR and calculated using GAPDH asthe endogenous control. (C and D) LpMOPV promotes antiviral activity. HEK 293T cells (1 � 105) were transfected with pCMV-Myc (Vec), pCMV-Myc-LpMOPV,or NPLASV (200 ng each), and at 24 h posttransfection, the cells were infected with rVSV-GFP at an MOI of 1. (C) At 12 h p.i., GFP (green) expressed in cells wasanalyzed by fluorescence microscopy, and TCS was collected. (D) At 24 h p.i., TCS was also collected, and the virus titer in the TCS was measured by plaque assayin Vero E6 cells. All experiments were performed at least three times, and the values represent the means and SD of three replicates. **, P � 0.01.

Zhang et al.

10262 jvi.asm.org November 2016 Volume 90 Number 22Journal of Virology

on July 16, 2018 by guesthttp://jvi.asm

.org/D

ownloaded from

fractionated into nuclear and cytoplasmic fractions and analyzedby Western blotting. As shown in Fig. 3A, the intensity of IRF3 inthe nuclear fraction was much higher in the cells expressing Lp-

MOPV. We also monitored the nuclear translocation of IRF3 usingimmunofluorescence analysis (IFA). To accomplish this, HeLacells were transfected with Flag-IRF3 and pCMV-Myc-LpMOPV,and 36 h posttransfection, the cells were fixed and the subcellularlocalization patterns of IRF3 (green) and Lp (red) were detectedby IFA. As shown in Fig. 3B, accumulation of IRF3 was detected inthe nuclei of cells expressing Myc-LpMOPV. Both WB and IFAindicated that LpMOPV promotes the nuclear translocation ofIRF3.

The observed promotion of the nuclear translocation of IRF3suggests that LpMOPV acts upstream of IRF3. As an importantadaptor protein, MAVS is located upstream of IRF3 in the RLR/MAVS signaling pathway (19). We then examined the effects ofknockdown or overexpression of MAVS on LpMOPV-mediatedIFN-I activation. Two siRNAs against MAVS were designed andshown to decrease intracellular protein expression levels of MAVSand therefore were used in subsequent analyses (Fig. 4A). Wefound that knockdown of MAVS reduced IFN-� promoter activ-ity in SeV-infected cells (Fig. 4B). Next, HEK 293T cells werecotransfected with plasmids expressing LpMOPV and siRNAsagainst MAVS. At 24 h p.i., knockdown of MAVS blocked

LpMOPV-mediated activation of the IFN-� promoter (Fig. 4C) andreduced intracellular mRNA levels of IFNB1 in LpMOPV-express-ing cells (Fig. 4D), while overexpression of MAVS increasedIFN-� promoter activity in cells expressing LpMOPV (Fig. 4E), sug-gesting that MAVS is important for LpMOPV-mediated activationof IFN-I. However, no direct interaction between Myc-LpMOPV

and Flag-MAVS was observed in our coimmunoprecipitation ex-periment. The activation of IFN-� promoter activity by IRF3 orIKK-ε was unaffected by MAVS knockdown (Fig. 4F), possiblybecause IRF3 and IKK-ε are located downstream of MAVS inthe RLR/MAVS signaling pathway. The need for MAVS in theLpMOPV-mediated activation of IFN-I suggests that LpMOPV mayhave a function upstream of MAVS.

Next, we examined whether RIG-I and MDA5, two proteinsupstream of MAVS in the RLR/MAVS signaling pathway, influ-ence IFN-I activation mediated by LpMOPV. First, siRNAs againstRIG-I were designed and tested for their knockdown efficiencies(Fig. 5A). We found that knockdown of RIG-I can reduce SeV-induced IFN-� promoter activity (Fig. 5B). Then, HEK 293T cellswere cotransfected with plasmids expressing LpMOPV and siRNAsagainst RIG-I. Activation of IFN-I was assessed by measuring therelative intracellular mRNA levels of IFNB1 and IFN-� promoteractivity. As shown in Fig. 5C and D, the knockdown of RIG-Iinhibited the LpMOPV-mediated activation of IFN-I production.We also observed that knockdown of MDA5 inhibited LpMOPV-mediated activation of IFN-I production (Fig. 5E to H).

Activation of IFN-I by LpMOPV is associated with its RdRpactivity. Our results shown above indicate that both RIG-I andMDA5 play important roles in the LpMOPV-mediated activation ofIFN-I, suggesting that LpMOPV may function upstream of bothRIG-I and MDA5. MDA5 detects long dsRNA, a typical interme-diate formed during the replication of single-stranded RNA vi-ruses, whereas RIG-I detects short, blunt-ended dsRNA and the5=-triphosphate moiety of viral RNAs (39–42). We therefore ex-plored whether the intracellular expression of LpMOPV alone canproduce interferon-inducing RNAs. Both total RNAs and smallRNAs were isolated from LpMOPV-expressing cells. We found thatthe amounts of RNAs that were extracted from LpMOPV-express-ing cells and the control cells were virtually identical. The smallRNAs extracted from LpMOPV-expressing cells may contain smallRNAs produced by Lp and cell factors, while small RNAs extractedfrom vector-transfected cells may contain only small RNAs pro-duced by cell factors. Then, equal amounts of RNA were trans-fected into HEK 293T cells. As shown in Fig. 6A, in the small-RNA-transfected group, IFN-� promoter activity was muchhigher in LpMOPV-expressing cells but not in LpLASV-expressingcells, suggesting that small RNAs generated in LpMOPV-expressingcells can activate the production of IFN-I. However, in the total-RNA-transfected group, no significant activation of the IFN-�promoter was observed in LpMOPV-expressing cells, and this maybe because, among the total RNAs transfected, the level of theinterferon-inducing small RNAs was not high enough to triggersignificant levels of IFN-I production.

Because both RIG-I and MDA5 recognize dsRNAs, we nextdetermined whether endogenous dsRNA was present in LpMOPV-expressing cells. HeLa cells were transfected with plasmids ex-pressing LpMOPV, fixed, and incubated with anti-dsRNA J2 anti-body, a commercial antibody widely used to detect dsRNA (43).dsRNAs are reportedly difficult to detect in negative-strand RNAvirus-infected cells (44), and the dsRNA signal detected by IFA

FIG 3 LpMOPV promotes the nuclear translocation of IRF3. (A) HEK 293Tcells were cotransfected with Flag-IRF3 and pCMV-Myc (Vec), pCMV-Myc-NPLASV (NP), or pCMV-Myc-LpMOPV (Lp). At 40 h posttransfection, the cellswere collected and then fractionated into nuclear and cytoplasmic fractions.Equal amounts of protein from the cytoplasmic fraction and nuclear fractionwere separated by SDS-PAGE and transferred to PVDF membranes. Themembranes were then probed with antibodies, and the bands were visualized.Band intensities were measured with Quantity One software. To normalizeIRF3 protein intensity, GAPDH and lamin B1 were used as the cytoplasmicand nuclear endogenous loading controls, respectively. (B) HeLa cells werecotransfected with Flag-IRF3 and pCMV-Myc (Vec) or pCMV-Myc-LpMOPV

(Lp). At 36 h posttransfection, the cells were fixed and incubated with theanti-Flag rabbit polyclonal antibody, followed by a DyLight488-labeled anti-body to rabbit IgG to detect Flag-IRF3 (green) and the anti-Myc mouse mono-clonal antibody followed by a Cy5-labeled antibody to mouse IgG to detectMyc-Lp (red). Next, the cells were stained with DAPI (blue) to visualize nuclei.Cells with Flag-IRF3 signals are indicated by arrows. Immunofluorescenceanalysis was performed with an A1 MP� multiphoton confocal microscope(Nikon).

Lp of MOPV Activates RLR/MAVS Signaling Pathway

November 2016 Volume 90 Number 22 jvi.asm.org 10263Journal of Virology

on July 16, 2018 by guesthttp://jvi.asm

.org/D

ownloaded from

was very weak in LCMV-infected Vero B6 cells (45). As shown inFig. 6B, the dsRNA signal was weak in LpMOPV-expressing cells,suggesting that the dsRNAs produced by RdRp proteins of are-naviruses may not be easily recognized by the anti-dsRNA an-tibody or the level of dsRNA may be low. However, the detec-tion of dsRNAs here suggests that expression of LpMOPV alonemay result in the production of dsRNAs, even in the absence ofviral genomic RNA.

The production of viral RNA during RNA virus replicationrequires the RdRp activity of the viral polymerase. We thereforeexplored whether the RdRp activity of LpMOPV is essential for theactivation of IFN-I. Three mutants of LpMOPV, D1349A, E1400A,and G1409A, were constructed (Fig. 7A). Western blot analysisindicated that the three mutations did not affect LpMOPV expres-sion (Fig. 7B). The D1349 residue in the SSDD sequence is highlyconserved and vital for RdRp activity (46, 47). Alignment of theRdRp domains of LpMOPV and LpLASV indicated that LpMOPV

E1400 corresponds to LpLASV E1385, whereas G1409 correspondsto LpLASV G1394 (Fig. 7A), and both LpLASV E1385A and G1394Acan reduce RdRp activity (47). To determine if LpMOPV D1349A,E1400A, and G1409A affect RdRp activity, we constructed a LASVS MG in the antisense orientation with GPC deleted, denotedpRF42-SagLASVFirefly�GPC, in which the GPC gene was replacedby a negative-sense copy of the firefly luciferase reporter gene

(Fig. 7C). Our unpublished data indicate that LpMOPV and NPLASV

are sufficient for the replication and transcription of the LASV Sgenome. To confirm the RdRp activity of LpMOPV, BHK-21 cellswere cotransfected with plasmids expressing the LASV S MG(pRF42-SagLASVFirefly�GPC), NPLASV, and LpMOPV or LpMOPV

mutants, and at 24 h posttransfection, the cells were lysed to mea-sure intracellular firefly luciferase activity. As shown in Fig. 7D,firefly luciferase activity was detected in cells expressing wild-typeLpMOPV, whereas firefly luciferase activity was much lower in thecells transfected with the LpMOPV E1400A or LpMOPV G1409A mu-tant, and no activity was detected in LpMOPV D1349A-expressingcells. These results suggest that both the E1400A and G1409A mu-tations reduce the RdRp activity of LpMOPV, while the D1349Amutation abolishes RdRp activity.

We then analyzed the effects of LpMOPV D1349A, E1400A, andG1409A on the activation of IFN-I. Cells were transfected with theLp mutants, and activation of IFN-I was assessed by measuring therelative intracellular mRNA levels of IFNB1 and the extent ofIFN-� promoter activity. As shown in Fig. 7E and F, compared towild-type LpMOPV, the activation of IFN-I was blocked by theLpMOPV mutation D1349A and was reduced by mutations E1400Aand G1409A. We also assessed the effects of the Lp mutants on theactivity of the ISRE promoter and on several ISGs and observedthat D1349A blocked both ISRE promoter activity and intracellu-

FIG 4 Activation of IFN-I production by LpMOPV requires MAVS. (A) Knockdown efficiencies of siRNAs against MAVS. HEK 293T cells were transfected withnegative-control siRNA (NC) or siRNA against MAVS. At 24 h posttransfection, the cells were collected. Intracellular mRNAs were extracted and subjected toreverse transcription. The relative intracellular mRNA level of MAVS was measured by quantitative real-time PCR and calculated using GAPDH as theendogenous control. The intracellular expression level of MAVS protein was analyzed by WB using a polyclonal rabbit antibody for MAVS. (B) Knockdown ofMAVS reduces IFN-� promoter activity in SeV-infected cells. HEK 293T cells were transfected with reporter plasmids and the indicated siRNAs and infected withSeV at 24 h posttransfection. At 10 h p.i., the cells were lysed to measure intracellular luciferase activity. (C and D) Knockdown of MAVS reduces both IFN-�promoter activity and intracellular mRNA levels of IFNB1 in LpMOPV-expressing cells. (C) HEK 293T cells were transfected with the indicated plasmids andsiRNAs. At 24 h posttransfection, the cells were collected. To assess IFN-� promoter activity, the cells were lysed to measure intracellular luciferase activity. (D)Intracellular mRNAs were also extracted and subjected to reverse transcription. The relative intracellular mRNA levels of IFNB1 were measured by quantitativereal-time PCR and calculated using GAPDH as the endogenous control. (E) Overexpression of MAVS activates the IFN-� promoter in LpMOPV-expressing cells.HEK 293T cells were transfected with the indicated plasmids, and 24 h posttransfection, the cells were lysed to measure intracellular luciferase activity. (F)Knockdown of MAVS does not affect IFN-� promoter activity in cells overexpressing IRF3 and IKK-ε. HEK 293T cells were transfected with the indicatedplasmids and siRNAs, and 24 h posttransfection, the cells were lysed to measure intracellular luciferase activity. All experiments were performed at least threetimes, and the values represent the means and SD of three replicates. *, P � 0.05; **, P � 0.01.

Zhang et al.

10264 jvi.asm.org November 2016 Volume 90 Number 22Journal of Virology

on July 16, 2018 by guesthttp://jvi.asm

.org/D

ownloaded from

FIG 5 Both RIG-I and MDA5 play roles in the LpMOPV-mediated activation of IFN-I. (A) Knockdown efficiencies of siRNAs against RIG-I. HEK 293T cellswere transfected with negative-control siRNA (NC) or siRNA against RIG-I. The cells were collected at 24 h posttransfection. Intracellular mRNAs wereextracted and subjected to reverse transcription. The relative intracellular mRNA level of DDX58 was measured by quantitative real-time PCR andcalculated using GAPDH as the endogenous control. The intracellular expression level of RIG-I protein was analyzed by WB using a polyclonal rabbitantibody for RIG-I. (B) Knockdown of RIG-I reduces IFN-� promoter activity in SeV-infected cells. HEK 293T cells were transfected with reporterplasmids and the indicated siRNAs and infected with SeV at 24 h posttransfection. At 10 h p.i., the cells were lysed to measure intracellular luciferaseactivity. (C and D) Knockdown of RIG-I reduces both IFN-� promoter activity and intracellular mRNA levels of IFNB1 in LpMOPV-expressing cells. HEK293T cells were transfected with the indicated plasmids and siRNAs. The cells were collected at 24 h posttransfection. To assess IFN-� promoter activity,the cells were lysed to measure intracellular luciferase activity. Intracellular mRNAs were also extracted and subjected to reverse transcription. The relativeintracellular mRNA levels of IFNB1 were measured by quantitative real-time PCR and calculated using GAPDH as the endogenous control. (E)Knockdown efficiencies of siRNAs against MDA5. The knockdown efficiencies of siRNAs against MDA5 were evaluated using the method described forRIG-I. (F) Knockdown of MDA5 reduces IFN-� promoter activity in SeV-infected cells. (G and H) Knockdown of MDA5 reduces both IFN-� promoteractivity and intracellular mRNA levels of IFNB1 in LpMOPV-expressing cells. The effects of the knockdown of MDA5 were evaluated using the methoddescribed for RIG-I. All experiments were performed at least three times, and the values represent the means and SD of three replicates. *, P � 0.05; **,P � 0.01.

Lp of MOPV Activates RLR/MAVS Signaling Pathway

November 2016 Volume 90 Number 22 jvi.asm.org 10265Journal of Virology

on July 16, 2018 by guesthttp://jvi.asm

.org/D

ownloaded from

lar mRNA levels of ISG15, ISG56, and OASL, while E1400A andG1409A significantly decreased these parameters (Fig. 7G and H).These results suggest that the activation of IFN-I and downstreameffectors by LpMOPV is associated with its RdRp activity.

DISCUSSION

Interactions between arenaviruses and the innate immune systemare complex. Distinct innate immune responses are observedwhen hosts are infected with different arenaviruses (25, 35, 48,49). In patients with severe symptoms, LASV infections are gen-erally immunosuppressive without activated IFN-I responses (25,50, 51), whereas elevated IFN-I production is observed in JUNV-infected patients. JUNV infection reportedly induces the IFN-Iresponse in a RIG-I-dependent manner in vitro (31). The mecha-nisms by which arenavirus infection induces distinct IFN-I re-sponses remain unclear. It has been widely accepted that NP andcertain Z proteins of arenaviruses inhibit the RLR/MAVS signal-ing pathway and decrease IFN-I production during infection.However, this seems to contradict previous observations of ele-vated IFN-I levels in cells or mice infected with certain arenavi-ruses, such as JUNV (31), MACV (25), LCMV (32), and MOPV(35). To explain the IFN-I activation that has been observed inLCMV-infected mice, Zhou et al. performed experiments to provethat LCMV genomic RNA can promote IFN-I production via theRLR/MAVS signaling pathway and that this genomic-RNA-medi-ated activation of IFN-I production can be inhibited by LCMV NP(32). In the above-mentioned study, it was proposed that dynamicinteractions existed among LCMV genomic RNA, NP, and host

IFN-I modulators, including MDA5 and RIG-I, and that theseinteractions could determine the final pattern of IFN-I response.

Viral RdRp proteins, which are the largest proteins encoded byviral genomes in most RNA viruses, mainly participate in viralgenome replication and mRNA transcription. In recent years, vi-ral RdRp proteins have also been reported to participate in mul-tiple processes other than RNA synthesis. For example, in nearlyall flaviviruses, NS5, the flaviviral RdRp protein, can inhibit path-ways associated with IFN-I induction or signaling (52, 53), whilethe Japanese encephalitis virus (JEV) NS5 protein can interactwith the mitochondrial trifunctional protein and impairs fattyacid �-oxidation (54). Studies since the 1990s have indicated thatexpression of viral RdRp can activate the immune system andconfer resistance to viral infection on plant cells (55–57). Severalresearch groups have recently reported that expression of viralRdRps can also activate the innate immune system in mammaliancells (28, 58, 59). The RdRps of hepatitis C virus (HCV), SemlikiForest virus (SFV), and Theiler’s murine encephalitis virus(TMEV) produce dsRNAs in transfected cells even in the absenceof viral genomic RNA, and these dsRNAs, as pathogen-associatedmolecular patterns (PAMPs), are recognized by PRRs, which thentrigger RLR/MAVS signaling pathway activation and induceIFN-I production.

In this study, we performed experiments to demonstrate thatthe Lp of MOPV, an OW arenavirus, can activate the RLR/MAVSsignaling pathway and induce IFN-I production. We also deter-mined that both MDA5 and RIG-I play important roles in thisactivation and found that the activation was associated with Lp

FIG 6 LpMOPV generates IFN-I-inducing RNAs. (A) Influence of total RNAs and small RNAs on IFN-� promoter activity. HEK 293T cells were transfected withthe indicated plasmids. At 48 h posttransfection, the cells were collected, and intracellular total RNAs and small RNAs were extracted. Then, equal amounts ofdistinct RNAs were cotransfected with pFL-IFN-� and pFL-TK, and 24 h posttransfection, the cells were lysed to measure intracellular luciferase activity. Allexperiments were performed at least three times, and the values represent the means and SD of three replicates. *, P � 0.05. (B) Immunofluorescence analysis ofdsRNA in LpMOPV-expressing cells. HeLa cells were transfected with pCMV-Myc, pCMV-Myc-LpMOPV, or pCMV-Mycstop-LpMOPV. At 36 h posttransfection, thecells were fixed and incubated with the anti-Myc rabbit polyclonal antibody followed by a DyLight488-labeled antibody to rabbit IgG to detect Myc-Lp (green)and the anti-dsRNA antibody J2 followed by a Cy5-labeled antibody to mouse IgG to detect dsRNA (red). Next, the cells were stained with DAPI (blue) tovisualize nuclei. The dsRNA signal is indicated by an arrow. Immunofluorescence analysis was performed with an A1 MP� multiphoton confocal microscope(Nikon).

Zhang et al.

10266 jvi.asm.org November 2016 Volume 90 Number 22Journal of Virology

on July 16, 2018 by guesthttp://jvi.asm

.org/D

ownloaded from

FIG 7 The activation of IFN-I by Lp requires its RdRp activity. (A) Alignment of the L proteins of MOPV AN20410, LCMV JN872494, and LASV strain Josiah. Aminoacid residues are numbered according to their positions in the L protein of MOPV. Amino acids identical in three proteins are shown with a dark gray background, whileamino acids identical in two proteins are shown with a light gray background. Residues 1349, 1400, and 1409 in MOPV are labeled because a previous study demonstratedthat the D-to-A mutation at residue 1334 in LpLASV, similar to 1400 in LpMOPV, abolishes Lp RdRp activity, whereas the E-to-A mutation at residue 1385 in LpLASV,similar to 1400 in LpMOPV, and the G-to-A mutation at residue 1394 in LpLASV, similar to 1409 in LpMOPV, reduce Lp RdRp activity (47). (B) WB analysis of Lp and Lpmutants. HEK 293T cells (1 � 106) were transfected with pCMV-Myc (Vec), pCMV-Myc-LpMOPV, or mutants (2 �g each). At 24 h posttransfection, the cells were lysedand cytosol proteins were subjected to WB analysis. Expression of Myc-LpMOPV or mutants was detected by mouse monoclonal antibody against the Myc tag (Sigma).(C) Schematic diagram of the pRF42 plasmid encoding SagLASVFirefly�GPC RNA (LASV S MG). pRF42-SagLASVFirefly�GPC was constructed by combining thefollowing elements: the polymerase I (Pol-I) RNA polymerase promoter followed by an extra G residue, the 5= untranslated region (UTR) of the LASV S antigenome,DNA encoding full-length NPLASV, the IGR of the LASV S antigenome, DNA encoding the full-length firefly luciferase ORF in the antisense orientation, and the 3=UTRof the LASV S antigenome. (D) Lp mutants affect RdRp activity. BHK-21 cells were cotransfected with plasmids expressing the LASV S MG and the indicated proteins.At 24 h posttransfection, the cells were lysed to measure intracellular luciferase activity. The relative firefly luciferase activity in cells without LpMOPV was set as 1. (E andF) The LpMOPV-mediated activation of IFN-I is blocked by mutant D1349A and reduced by the mutants E1400A and G1409A. HEK 293T cells were transfected with theindicated plasmids, and 24 h posttransfection, the cells were collected and lysed to measure intracellular luciferase activity. Intracellular mRNAs were extracted andsubjected to reverse transcription. The relative intracellular mRNA level of IFNB1 was measured by quantitative real-time PCR and calculated using GAPDH as theendogenous control. (G and H) The influence of Lp mutants on the activation of the ISRE promoter and ISGs. HEK 293T cells were transfected with the indicatedplasmids, and 24 h posttransfection, cells were collected and lysed to measure intracellular luciferase activity. Intracellular mRNAs were extracted and subjected to reversetranscription. The relative intracellular mRNA levels of ISG15, ISG56, and OASL were measured by quantitative real-time PCR and calculated using GAPDH as theendogenous control. All experiments were performed at least three times, and the values represent the means and SD of three replicates. *, P � 0.05; **, P � 0.01.

November 2016 Volume 90 Number 22 jvi.asm.org 10267Journal of Virology

on July 16, 2018 by guesthttp://jvi.asm

.org/D

ownloaded from

RdRp activity (Fig. 5 and 7). We hypothesize that, in the absence ofviral genomic RNA and NP, Lp is recruited by host transcriptionfactors or certain host mRNA structures to perform RNA-depen-dent RNA synthesis, resulting in the production of “abnormalRNAs,” which are subsequently recognized by PRRs. Our furtherexperiments indicated that small RNAs extracted from Lp-ex-pressing cells can activate IFN-I production (Fig. 6). Similar re-sults were observed in a previous study, which reported that HCVRdRp used host RNAs as templates to produce IFN-I-inducingRNAs and subsequently induced an inflammatory response andliver damage (60). This study analyzed the IFN-I-inducing RNAsby deep sequencing and found that the sequences of these RNAsare distinct among replicates, suggesting the templates of theRNAs were not specific.

During arenavirus infection, a viral replication-transcriptioncomplex (RTC) is formed, which is composed of viral RNA, NP,and host cell factors. Lp is then recruited to the RTC to performRNA synthesis. The abnormal RNAs described here can be syn-thesized by Lp in the absence of NP and viral RNA, the essentialcomponents of the arenavirus RTC. These abnormal RNAs maythen be recognized by host cells as a “danger signal,” which wasproposed by Huang et al., that can activate IFN-I production andwas associated with MACV replication rather than with an imme-diate-early signal (25). However, whether these RNAs are pro-duced during MOPV infection remains to be determined, andfurther studies are needed to explain how these RNAs are pro-duced.

It has been reported that human macrophages produced IFN-Iin response to MOPV infection. Our preliminary data showed thatintracellular expression of MOPV Z and GPC did not affect IFN-Iproduction, suggesting that the activation of IFN-I may be due tothe presence of Lp and genomic RNA. As the most abundant viralprotein, NP employs multiple strategies to disrupt the RLR/MAVSsignaling pathway and inhibit IFN-I production (61–63). Al-though Lp expression is low in infected cells, the levels of RNAsthat can be produced by Lp, including genomic RNA or abnormalRNAs proposed here, have not been determined to date. TheseRNAs can be recognized by host cells and can subsequently acti-vate the RLR/MAVS signaling pathway and induce IFN-I produc-tion. The dynamic interactions that exist among Lp-producedRNA molecules, NP, and the RLR/MAVS signaling pathway maydetermine the final IFN-I response pattern: elevated or reduced.

In conclusion, this study is the first to demonstrate that Lp ofthe MOPV arenavirus can activate the RLR/MAVS signaling path-ways and promote IFN-I production. Our results will promotefurther investigations of the interactions between arenavirusesand the innate immune system and should help facilitate the elu-cidation of arenavirus pathogenesis.

ACKNOWLEDGMENTS

We thank Yan-Yi Wang and Peng Gong (Wuhan Institute of Virology,Chinese Academy of Sciences, Wuhan, China) for assistance with dataanalysis.

We acknowledge financial support from the Ministry of Science andTechnology of China (2016YFC1200400), the Chinese Academy of Sci-ences (ZDRW-ZS-2016-4), and the National Natural Science Foundationof China (31500144 to L.-K.Z.).

REFERENCES1. Wright KE, Spiro RC, Burns JW, Buchmeier MJ. 1990. Post-

translational processing of the glycoproteins of lymphocytic chorio-

meningitis virus. Virology 177:175–183. http://dx.doi.org/10.1016/0042-6822(90)90471-3.

2. Urata S, Yasuda J. 2012. Molecular mechanism of arenavirus assemblyand budding. Viruses 4:2049 –2079. http://dx.doi.org/10.3390/v4102049.

3. Perez M, Craven RC, de la Torre JC. 2003. The small RING fingerprotein Z drives arenavirus budding: implications for antiviral strategies.Proc Natl Acad Sci U S A 100:12978 –12983. http://dx.doi.org/10.1073/pnas.2133782100.

4. Cornu TI, de la Torre JC. 2001. RING finger Z protein of lymphocyticchoriomeningitis virus (LCMV) inhibits transcription and RNA replica-tion of an LCMV S-segment minigenome. J Virol 75:9415–9426. http://dx.doi.org/10.1128/JVI.75.19.9415-9426.2001.

5. Jacamo R, Lopez N, Wilda M, Franze-Fernandez MT. 2003. Tacaribevirus Z protein interacts with the L polymerase protein to inhibit viralRNA synthesis. J Virol 77:10383–10393. http://dx.doi.org/10.1128/JVI.77.19.10383-10393.2003.

6. Salvato M, Shimomaye E, Oldstone MB. 1989. The primary structureof the lymphocytic choriomeningitis virus L gene encodes a putativeRNA polymerase. Virology 169:377–384. http://dx.doi.org/10.1016/0042-6822(89)90163-3.

7. Lee KJ, Novella IS, Teng MN, Oldstone MB, de La Torre JC. 2000. NPand L proteins of lymphocytic choriomeningitis virus (LCMV) are suffi-cient for efficient transcription and replication of LCMV genomic RNAanalogs. J Virol 74:3470 –3477. http://dx.doi.org/10.1128/JVI.74.8.3470-3477.2000.

8. Radoshitzky SR, Bao Y, Buchmeier MJ, Charrel RN, Clawson AN, CleggCS, DeRisi JL, Emonet S, Gonzalez JP, Kuhn JH, Lukashevich IS, PetersCJ, Romanowski V, Salvato MS, Stenglein MD, de la Torre JC. 2015.Past, present, and future of arenavirus taxonomy. Arch Virol 160:1851–1874. http://dx.doi.org/10.1007/s00705-015-2418-y.

9. Ogbu O, Ajuluchukwu E, Uneke CJ. 2007. Lassa fever in West Africansub-region: an overview. J Vector Borne Dis 44:1–11.

10. Grant A, Seregin A, Huang C, Kolokoltsova O, Brasier A, Peters C,Paessler S. 2012. Junin virus pathogenesis and virus replication. Viruses4:2317–2339. http://dx.doi.org/10.3390/v4102317.

11. Bray M. 2005. Pathogenesis of viral hemorrhagic fever. Curr Opin Immu-nol 17:399 – 403. http://dx.doi.org/10.1016/j.coi.2005.05.001.

12. Goni SE, Iserte JA, Ambrosio AM, Romanowski V, Ghiringhelli PD,Lozano ME. 2006. Genomic features of attenuated Junin virus vaccinestrain candidate. Virus Genes 32:37– 41. http://dx.doi.org/10.1007/s11262-005-5843-2.

13. Lukashevich IS, Vasiuchkov AD, Stel’makh TA, Scheslenok EP, Sha-banov AG. 1991. The isolation and characteristics of reassortants betweenthe Lassa and Mopeia arenaviruses. Vopr Virusol 36:146 –150. (In Rus-sian.)

14. Lukashevich IS, Carrion R, Jr, Salvato MS, Mansfield K, Brasky K,Zapata J, Cairo C, Goicochea M, Hoosien GE, Ticer A, Bryant J, DavisH, Hammamieh R, Mayda M, Jett M, Patterson J. 2008. Safety, immu-nogenicity, and efficacy of the ML29 reassortant vaccine for Lassa fever insmall non-human primates. Vaccine 26:5246 –5254. http://dx.doi.org/10.1016/j.vaccine.2008.07.057.

15. Cheng BY, Ortiz-Riano E, de la Torre JC, Martinez-Sobrido L. 2015.Arenavirus genome rearrangement for the development of live attenuatedvaccines. J Virol 89:7373–7384. http://dx.doi.org/10.1128/JVI.00307-15.

16. Wu J, Chen ZJ. 2014. Innate immune sensing and signaling of cytosolicnucleic acids. Annu Rev Immunol 32:461– 488. http://dx.doi.org/10.1146/annurev-immunol-032713-120156.

17. Takeuchi O, Akira S. 2009. Innate immunity to virus infection. ImmunolRev 227:75– 86. http://dx.doi.org/10.1111/j.1600-065X.2008.00737.x.

18. Loo YM, Gale M, Jr. 2011. Immune signaling by RIG-I-like receptors.Immunity 34:680 – 692. http://dx.doi.org/10.1016/j.immuni.2011.05.003.

19. Seth RB, Sun L, Ea CK, Chen ZJ. 2005. Identification and characteriza-tion of MAVS, a mitochondrial antiviral signaling protein that activatesNF-kappaB and IRF 3. Cell 122:669 – 682. http://dx.doi.org/10.1016/j.cell.2005.08.012.

20. Xu LG, Wang YY, Han KJ, Li LY, Zhai Z, Shu HB. 2005. VISA is anadapter protein required for virus-triggered IFN-beta signaling. Mol Cell19:727–740. http://dx.doi.org/10.1016/j.molcel.2005.08.014.

21. Meylan E, Curran J, Hofmann K, Moradpour D, Binder M, Barten-schlager R, Tschopp J. 2005. Cardif is an adaptor protein in the RIG-Iantiviral pathway and is targeted by hepatitis C virus. Nature 437:1167–1172. http://dx.doi.org/10.1038/nature04193.

22. Kawai T, Takahashi K, Sato S, Coban C, Kumar H, Kato H, Ishii KJ,

Zhang et al.

10268 jvi.asm.org November 2016 Volume 90 Number 22Journal of Virology

on July 16, 2018 by guesthttp://jvi.asm

.org/D

ownloaded from

Takeuchi O, Akira S. 2005. IPS-1, an adaptor triggering RIG-I- andMda5-mediated type I interferon induction. Nat Immunol 6:981–988.http://dx.doi.org/10.1038/ni1243.

23. Nan Y, Nan G, Zhang YJ. 2014. Interferon induction by RNA viruses andantagonism by viral pathogens. Viruses 6:4999 –5027. http://dx.doi.org/10.3390/v6124999.

24. Koma T, Huang C, Kolokoltsova OA, Brasier AR, Paessler S. 2013.Innate immune response to arenaviral infection: a focus on the highlypathogenic New World hemorrhagic arenaviruses. J Mol Biol 425:4893–4903. http://dx.doi.org/10.1016/j.jmb.2013.09.028.

25. Huang C, Kolokoltsova OA, Yun NE, Seregin AV, Ronca S, Koma T,Paessler S. 2015. Highly pathogenic New World and Old World humanarenaviruses induce distinct interferon responses in human cells. J Virol89:7079 –7088. http://dx.doi.org/10.1128/JVI.00526-15.

26. Meyer B, Ly H. 2016. Inhibition of innate immune responses is key topathogenesis by arenaviruses. J Virol 90:3810 –3818. http://dx.doi.org/10.1128/JVI.03049-15.

27. Borrow P, Martinez-Sobrido L, de la Torre JC. 2010. Inhibition of thetype I interferon antiviral response during arenavirus infection. Viruses2:2443–2480. http://dx.doi.org/10.3390/v2112443.

28. Nikonov A, Molder T, Sikut R, Kiiver K, Mannik A, Toots U, Lulla A,Lulla V, Utt A, Merits A, Ustav M. 2013. RIG-I and MDA-5 detection ofviral RNA-dependent RNA polymerase activity restricts positive-strandRNA virus replication. PLoS Pathog 9:e1003610. http://dx.doi.org/10.1371/journal.ppat.1003610.

29. Fan L, Briese T, Lipkin WI. 2010. Z proteins of New World arenavirusesbind RIG-I and interfere with type I interferon induction. J Virol 84:1785–1791. http://dx.doi.org/10.1128/JVI.01362-09.

30. Xing J, Ly H, Liang Y. 2015. The Z proteins of pathogenic but notnonpathogenic arenaviruses inhibit RIG-I-like receptor-dependent inter-feron production. J Virol 89:2944 –2955. http://dx.doi.org/10.1128/JVI.03349-14.

31. Huang C, Kolokoltsova OA, Yun NE, Seregin AV, Poussard AL, WalkerAG, Brasier AR, Zhao Y, Tian B, de la Torre JC, Paessler S. 2012. Juninvirus infection activates the type I interferon pathway in a RIG-I-dependent manner. PLoS Negl Trop Dis 6:e1659. http://dx.doi.org/10.1371/journal.pntd.0001659.

32. Zhou S, Cerny AM, Zacharia A, Fitzgerald KA, Kurt-Jones EA, FinbergRW. 2010. Induction and inhibition of type I interferon responses bydistinct components of lymphocytic choriomeningitis virus. J Virol 84:9452–9462. http://dx.doi.org/10.1128/JVI.00155-10.

33. Bowen MD, Peters CJ, Nichol ST. 1997. Phylogenetic analysis of theArenaviridae: patterns of virus evolution and evidence for cospeciationbetween arenaviruses and their rodent hosts. Mol Phylogenet Evol 8:301–316. http://dx.doi.org/10.1006/mpev.1997.0436.

34. Kiley MP, Lange JV, Johnson KM. 1979. Protection of rhesus monkeysfrom Lassa virus by immunisation with closely related Arenavirus. Lancetii:738.

35. Pannetier D, Faure C, Georges-Courbot MC, Deubel V, Baize S. 2004.Highly pathogenic New World and Old World human arenaviruses in-duce distinct interferon responses in human cells. J Virol 78:10516 –10524. http://dx.doi.org/10.1128/JVI.78.19.10516-10524.2004.

36. Chai F, Li HY, Wang W, Zhu XJ, Li Y, Wang S, Guo L, Zhang LK, XiaoG. 2015. Subcellular quantitative proteomic analysis reveals host proteinsinvolved in human cytomegalovirus infection. Biochim Biophys Acta1854:967–978. http://dx.doi.org/10.1016/j.bbapap.2015.04.016.

37. Schneider WM, Chevillotte MD, Rice CM. 2014. Interferon-stimulatedgenes: a complex web of host defenses. Annu Rev Immunol 32:513–545.http://dx.doi.org/10.1146/annurev-immunol-032713-120231.

38. Martinez-Sobrido L, Giannakas P, Cubitt B, Garcia-Sastre A, de laTorre JC. 2007. Differential inhibition of type I interferon induction byarenavirus nucleoproteins. J Virol 81:12696 –12703. http://dx.doi.org/10.1128/JVI.00882-07.

39. Kato H, Takeuchi O, Sato S, Yoneyama M, Yamamoto M, Matsui K,Uematsu S, Jung A, Kawai T, Ishii KJ, Yamaguchi O, Otsu K, TsujimuraT, Koh CS, Reis e Sousa C, Matsuura Y, Fujita T, Akira S. 2006.Differential roles of MDA5 and RIG-I helicases in the recognition of RNAviruses. Nature 441:101–105. http://dx.doi.org/10.1038/nature04734.

40. Schlee M, Roth A, Hornung V, Hagmann CA, Wimmenauer V, BarchetW, Coch C, Janke M, Mihailovic A, Wardle G, Juranek S, Kato H,Kawai T, Poeck H, Fitzgerald KA, Takeuchi O, Akira S, Tuschl T, LatzE, Ludwig J, Hartmann G. 2009. Recognition of 5= triphosphate by RIG-Ihelicase requires short blunt double-stranded RNA as contained in pan-

handle of negative-strand virus. Immunity 31:25–34. http://dx.doi.org/10.1016/j.immuni.2009.05.008.

41. Pichlmair A, Schulz O, Tan CP, Naslund TI, Liljestrom P, Weber F,Reis e Sousa C. 2006. RIG-I-mediated antiviral responses to single-stranded RNA bearing 5=-phosphates. Science 314:997–1001. http://dx.doi.org/10.1126/science.1132998.

42. Ablasser A, Bauernfeind F, Hartmann G, Latz E, Fitzgerald KA, Hor-nung V. 2009. RIG-I-dependent sensing of poly(dA:dT) through the in-duction of an RNA polymerase III-transcribed RNA intermediate. NatImmunol 10:1065–1072. http://dx.doi.org/10.1038/ni.1779.

43. Schonborn J, Oberstrass J, Breyel E, Tittgen J, Schumacher J, Lukacs N.1991. Monoclonal antibodies to double-stranded RNA as probes of RNAstructure in crude nucleic acid extracts. Nucleic Acids Res 19:2993–3000.http://dx.doi.org/10.1093/nar/19.11.2993.

44. Weber F, Wagner V, Rasmussen SB, Hartmann R, Paludan SR. 2006.Double-stranded RNA is produced by positive-strand RNA viruses andDNA viruses but not in detectable amounts by negative-strand RNA vi-ruses. J Virol 80:5059 –5064. http://dx.doi.org/10.1128/JVI.80.10.5059-5064.2006.

45. Son KN, Liang Z, Lipton HL. 2015. Double-stranded RNA is detected byimmunofluorescence analysis in RNA and DNA virus infections, includ-ing those by negative-stranded RNA viruses. J Virol 89:9383–9392. http://dx.doi.org/10.1128/JVI.01299-15.

46. Poch O, Sauvaget I, Delarue M, Tordo N. 1989. Identification of fourconserved motifs among the RNA-dependent polymerase encoding ele-ments. EMBO J 8:3867–3874.

47. Hass M, Lelke M, Busch C, Becker-Ziaja B, Gunther S. 2008. Mutationalevidence for a structural model of the Lassa virus RNA polymerase domainand identification of two residues, Gly1394 and Asp1395, that are criticalfor transcription but not replication of the genome. J Virol 82:10207–10217. http://dx.doi.org/10.1128/JVI.00220-08.

48. Lee LN, Burke S, Montoya M, Borrow P. 2009. Multiple mechanismscontribute to impairment of type 1 interferon production during chroniclymphocytic choriomeningitis virus infection of mice. J Immunol 182:7178 –7189. http://dx.doi.org/10.4049/jimmunol.0802526.

49. Zapata JC, Carrion R, Jr, Patterson JL, Crasta O, Zhang Y, Mani S, JettM, Poonia B, Djavani M, White DM, Lukashevich IS, Salvato MS. 2013.Transcriptome analysis of human peripheral blood mononuclear cells ex-posed to Lassa virus and to the attenuated Mopeia/Lassa reassortant 29(ML29), a vaccine candidate. PLoS Negl Trop Dis 7:e2406. http://dx.doi.org/10.1371/journal.pntd.0002406.

50. Walker DH, McCormick JB, Johnson KM, Webb PA, Komba-Kono G,Elliott LH, Gardner JJ. 1982. Pathologic and virologic study of fatal Lassafever in man. Am J Pathol 107:349 –356.

51. Russier M, Pannetier D, Baize S. 2012. Immune responses and Lassa virusinfection. Viruses 4:2766–2785. http://dx.doi.org/10.3390/v4112766.

52. Shi PY. 2014. Flavivirus NS5 prevents the inSTATement of IFN. CellHost Microbe 16:269 –271. http://dx.doi.org/10.1016/j.chom.2014.08.011.

53. Grant A, Ponia SS, Tripathi S, Balasubramaniam V, Miorin L, Souris-seau M, Schwarz MC, Sanchez-Seco MP, Evans MJ, Best SM, Garcia-Sastre A. 2016. Zika virus targets human STAT2 to inhibit type I inter-feron signaling. Cell Host Microbe 19:882– 890. http://dx.doi.org/10.1016/j.chom.2016.05.009.

54. Kao YT, Chang BL, Liang JJ, Tsai HJ, Lee YL, Lin RJ, Lin YL. 2015.Japanese encephalitis virus nonstructural protein NS5 interacts withmitochondrial trifunctional protein and impairs fatty acid beta-oxidation. PLoS Pathog 11:e1004750. http://dx.doi.org/10.1371/journal.ppat.1004750.

55. Golemboski DB, Lomonossoff GP, Zaitlin M. 1990. Plants transformedwith a tobacco mosaic virus nonstructural gene sequence are resistant tothe virus. Proc Natl Acad Sci U S A 87:6311– 6315. http://dx.doi.org/10.1073/pnas.87.16.6311.

56. Donson J, Kearney CM, Turpen TH, Khan IA, Kurath G, Turpen AM,Jones GE, Dawson WO, Lewandowski DJ. 1993. Broad resistance totobamoviruses is mediated by a modified tobacco mosaic virus replicasetransgene. Mol Plant Microbe Interact 6:635– 642. http://dx.doi.org/10.1094/MPMI-6-635.

57. Goregaoker SP, Eckhardt LG, Culver JN. 2000. Tobacco mosaic virusreplicase-mediated cross-protection: contributions of RNA and protein-derived mechanisms. Virology 273:267–275. http://dx.doi.org/10.1006/viro.2000.0430.

58. Kerkvliet J, Papke L, Rodriguez M. 2011. Antiviral effects of a transgenic

Lp of MOPV Activates RLR/MAVS Signaling Pathway

November 2016 Volume 90 Number 22 jvi.asm.org 10269Journal of Virology

on July 16, 2018 by guesthttp://jvi.asm

.org/D

ownloaded from

RNA-dependent RNA polymerase. J Virol 85:621– 625. http://dx.doi.org/10.1128/JVI.01626-10.

59. Painter MM, Morrison JH, Zoecklein LJ, Rinkoski TA, Watzlawik JO,Papke LM, Warrington AE, Bieber AJ, Matchett WE, Turkowski KL,Poeschla EM, Rodriguez M. 2015. Antiviral protection via RdRP-mediated stable activation of innate immunity. PLoS Pathog 11:e1005311.http://dx.doi.org/10.1371/journal.ppat.1005311.

60. Yu GY, He G, Li CY, Tang M, Grivennikov S, Tsai WT, Wu MS, HsuCW, Tsai Y, Wang LH, Karin M. 2012. Hepatic expression of HCVRNA-dependent RNA polymerase triggers innate immune signaling andcytokine production. Mol Cell 48:313–321. http://dx.doi.org/10.1016/j.molcel.2012.07.032.

61. Pythoud C, Rodrigo WW, Pasqual G, Rothenberger S, Martinez-Sobrido L, de la Torre JC, Kunz S. 2012. Arenavirus nucleoproteintargets interferon regulatory factor-activating kinase IKKepsilon. J Virol86:7728 –7738. http://dx.doi.org/10.1128/JVI.00187-12.

62. Rodrigo WW, Ortiz-Riano E, Pythoud C, Kunz S, de la Torre JC,Martinez-Sobrido L. 2012. Arenavirus nucleoproteins prevent activationof nuclear factor kappa B. J Virol 86:8185– 8197. http://dx.doi.org/10.1128/JVI.07240-11.

63. Jiang X, Huang Q, Wang W, Dong H, Ly H, Liang Y, Dong C. 2013.Structures of arenaviral nucleoproteins with triphosphate dsRNA reveal aunique mechanism of immune suppression. J Biol Chem 288:16949 –16959. http://dx.doi.org/10.1074/jbc.M112.420521.

Zhang et al.

10270 jvi.asm.org November 2016 Volume 90 Number 22Journal of Virology

on July 16, 2018 by guesthttp://jvi.asm

.org/D

ownloaded from