acemannan sponges stimulate alveolar bone, cementum and ... · periodontal ligament, cementum and...

Acemannan spongesstimulate alveolar bone,cementum and periodontalligament regeneration in acanine class II furcationdefect model

Chantarawaratit P, Sangvanich P, Banlunara W, Soontornvipart K,

Thunyakitpisal P. Acemannan sponges stimulate alveolar bone, cementum and

periodontal ligament regeneration in a canine class II furcation defect model.

J Periodont Res 2014; 49: 164–178. © 2013 John Wiley & Sons A/S. Published

by John Wiley & Sons Ltd

Background and Objective: Periodontal disease is a common infectious disease,

found worldwide, causing the destruction of the periodontium. The periodon-

tium is a complex structure composed of both soft and hard tissues, thus an

agent applied to regenerate the periodontium must be able to stimulate

periodontal ligament, cementum and alveolar bone regeneration. Recent studies

demonstrated that acemannan, a polysaccharide extracted from Aloe vera gel,

stimulated both soft and hard tissue healing. This study investigated effect

of acemannan as a bioactive molecule and scaffold for periodontal tissue

regeneration.

Material and Methods: Primary human periodontal ligament cells were treated

with acemannan in vitro. New DNA synthesis, expression of growth/differentia-

tion factor 5 and runt-related transcription factor 2, expression of vascular

endothelial growth factor, bone morphogenetic protein-2 and type I collagen,

alkaline phosphatase activity, and mineralized nodule formation were deter-

mined using [3H]-thymidine incorporation, reverse transcription–polymerase

chain reaction, enzyme-linked immunoabsorbent assay, biochemical assay and

alizarin red staining, respectively. In our in vivo study, premolar class II furca-

tion defects were made in four mongrel dogs. Acemannan sponges were applied

into the defects. Untreated defects were used as a negative control group. The

amount of new bone, cementum and periodontal ligament formation were eval-

uated 30 and 60 d after the operation.

Results: Acemannan significantly increased periodontal ligament cell prolifera-

tion, upregulation of growth/differentiation factor 5, runt-related transcription

factor 2, vascular endothelial growth factor, bone morphogenetic protein 2, type

I collagen and alkaline phosphatase activity, and mineral deposition as com-

pared with the untreated control group in vitro. Moreover, acemannan signifi-

cantly accelerated new alveolar bone, cementum and periodontal ligament

formation in class II furcation defects.

P. Chantarawaratit1,2,

P. Sangvanich3, W. Banlunara4,

K. Soontornvipart5,

P. Thunyakitpisal61Faculty of Dentistry, Dental Biomaterials

Program, Graduate School, Chulalongkorn

University, Bangkok, Thailand, 2Department of

Materials Science, Faculty of Science,

Chulalongkorn University, Bangkok, Thailand,3Department of Chemistry, Faculty of Science,

Chulalongkorn University, Bangkok, Thailand,4Department of Pathology, Faculty of

Veterinary Science, Chulalongkorn University,

Bangkok, Thailand, 5Department of Surgery,

Faculty of Veterinary Science, Chulalongkorn

University, Bangkok, Thailand and 6Research

Unit of Herbal Medicine and Natural Product for

Dental Application, Department of Anatomy,

Faculty of Dentistry, Chulalongkorn University,

Bangkok, Thailand

Pasutha Thunyakitpisal, Research Unit of

Herbal Medicine and Natural Product for Dental

Application, Department of Anatomy, Faculty of

Dentistry, Chulalongkorn University, Henri-

Dunant Rd, Patumwan, Bangkok 10330,

Thailand

Tel: +66817133311

Fax: +6622188870

e-mail: [email protected]

Key words: acemannan; animal study; class II

furcation defect model; periodontal ligament

cells; periodontal regeneration

Accepted for publication March 29, 2013

J Periodont Res 2014; 49: 164–178All rights reserved

© 2013 John Wiley & Sons A/S.

Published by John Wiley & Sons Ltd

JOURNAL OF PERIODONTAL RESEARCH

doi:10.1111/jre.12090

Conclusion: Our data suggest that acemannan could be a candidate biomolecule

for periodontal tissue regeneration.

Periodontal disease is a common

chronic infectious disease causing the

destruction of the periodontium: peri-

odontal ligament (PDL), alveolar

bone and cementum. Although con-

ventional scaling and root planing

therapy can halt the progression of

this disease, and results in an increase

in clinical periodontal attachment,

this treatment is only effective in the

early phase of the disease. Following

scaling and root planing, periodontal

tissue repair frequently results in a

widened PDL space and incomplete

regeneration of cementum and alveo-

lar bone (1). Therefore, the ultimate

goal of periodontal treatment is not

only to cease and prevent further peri-

odontal tissue destruction, but also to

regenerate the periodontal apparatus

(2,3).

Both anatomically and physiologi-

cally, the periodontium is a very com-

plicated organ containing both soft

tissue and hard tissue functioning

together to support the teeth in the

jaw. Therefore, the methods and

agents used in periodontal tissue

regeneration should stimulate all peri-

odontal tissue types. Polysaccharides

such as hyaluronic acid, chitosan, algi-

nate and pectin have been proposed

for use in tissue engineering and regen-

erative medicine (4–7). These natural

materials have demonstrated biocom-

patibility, biodegradability, immuno-

modulation, antimicrobial, wound

healing and osteogenic activities (4–8).Thus, they have the potential to be

used as periodontal regenerative

agents. Polysaccharides can be pre-

pared in various forms such as gels,

films, beads, sponges and scaffolds

(4–7,9). Therefore, polysaccharides

could function as either active mole-

cules or scaffolds for periodontal

regenerative therapy.

Acemannan is a biodegradable poly-

saccharide composed of b-(1,4)-acety-lated polymannose extracted from

Aloe vera gel. Acemannan has been

shown to stimulate gingival fibroblast,

dental pulp fibroblast, cementoblast

and bone marrow stromal cell prolifer-

ation and differentiation in vitro (10–13). In vivo, acemannan enhanced oral

ulcer and oral aphthous ulcer healing,

reparative dentin formation and bone

formation (10–12,14). Based on its

bioactivity in inducing soft and hard

tissue healing, acemannan is a candi-

date for use in periodontal tissue

regeneration. However, the effect of

acemannan on the regeneration of the

periodontium has not been investi-

gated. In this study, the effect of

acemannan on the proliferation of

periodontal ligament cells (PDLCs)

and their differentiation to hard tissue

forming cells was investigated. The

effect of acemannan sponges on new

PDL, alveolar bone and cementum

formation in a canine furcation defect

model was also evaluated.

Material and methods

Isolation and characterization of

acemannan

Aloe vera (A. barbadensis Miller) was

obtained from a local herbal supplier

in Thailand. Aloe vera was identified

by Assoc. Prof. Dr. Suchada Sukrong

(Department of Pharmacognosy and

Pharmaceutical Botany, Faculty of

Pharmaceutical Sciences, Chulalongk-

orn University). The specimen (no.

051101) was deposited in the Museum

of Natural Medicines, Faculty of

Pharmaceutical Sciences, Chulalongk-

orn University (Bangkok, Thailand).

Acemannan was isolated and char-

acterized as previously described with

some modifications (11,15). Briefly,

fresh mature Aloe vera leaves were

washed and the skin removed. The

Aloe vera parenchyma were washed in

running tap water for 30 min, and

soaked in distilled water for 30 min.

The parenchyma gels were blended

using a homogenizer and centrifuged

at 18,890 g for 60 min at 4°C. The

supernatant was collected and mixed

with absolute alcohol at a 1 : 3 ratio.

The precipitated white opaque parti-

cles were collected by centrifugation

at 12,090 g for 30 min at 4°C. After

lyophilization, the pellets were ground

and kept dry until use.

The molecular weight of the ground

powder was analyzed using high-

performance liquid chromatography

connected to a reflective index detector

(RID-10A; Shimadzu, Shimadzu Cor-

poration, Tokyo, Japan). The separa-

tion was performed with a Shodex

Sugar KS-804 column and compared

with Shodex standard P-82 (Showa

Denko K.K., Yokohama, Japan). The

monosaccharide compositions were

analyzed using gas chromatography-

mass spectroscopy and 13C-NMR spec-

troscopy as previously described

(16,17). The data obtained were compa-

rable to that of previous studies, indi-

cating that the polysaccharide extracted

from freshAloe vera gel was acemannan

(15–17). The yield of acemannan

extraction was approximately 0.2%.

Cell culture

All study protocols were approved by

the Human Research Ethics Commit-

tee of the Faculty of Dentistry, Chul-

alongkorn University. PDLCs were

isolated from third molars extracted

from healthy young donors. The teeth

were washed 3 9 with phosphate-

buffered saline (PBS). PDL tissue was

removed using sterile surgical blades

from the middle one-third of the root

surface to avoid gingival and apical

tissue contamination (18,19). The iso-

lated tissue was cut into 1–2 mm3

pieces, placed into 60 mm culture

dishes, and incubated with growth

medium (Dulbecco’s modified Eagle’s

medium supplemented with 10% fetal

bovine serum, 10,000 IU/mL penicil-

lin G sodium, 100,000 lg/mL strepto-

mycin sulfate, 25 lg/mL amphotericin

B and 1% L-glutamine) at 37°C, in an

atmosphere containing 5% CO2. The

growth medium was replaced every

Acemannan and periodontal regeneration 165

other day. When the outgrown cells

reached confluence, the cells were sub-

cultured using 0.25% trypsin-EDTA

solution. All experiments were per-

formed using cells from the third to

the fifth passage. All cell culture

media were purchased from Gibco

BRLTM (InvitrogenTM, Grand Island,

NY, USA).

DNA synthesis assay

New DNA synthesis was investigated

using an [3H]-thymidine incorporation

assay (20). Briefly, PDLCs (5 9 104

cells/well) were seeded into 24-well

cell culture plates and cultured in

growth medium for 16 h. The growth

medium was then removed and the

cells were cultured in serum-free

growth medium for 3 h, and treated

with 0.25, 0.5, 1.0, 2.0 or 4.0 mg/mL

acemannan for 24 h. After 20 h, the

cells were labeled with 0.25 lCi/wellof [3H]-thymidine (Amersham Bio-

sciences, Little Chalfont, UK). Cells

treated with the same volume of med-

ium without acemannan served as a

control group. After 24 h, the cells

were washed 3 9 with PBS, fixed with

10% trichloroacetic acid, washed with

5% trichloroacetic acid twice, and sol-

ubilized in 0.5 M NaOH overnight.

After neutralization with 0.5 M HCl,

the lysate was thoroughly mixed with

2 mL of scintillation fluid (Opti-

PhaseHiSafe; Fisher Scientific, Milton

Keynes, UK). The amount of beta

radiation was determined using a

liquid scintillation counter (Wallac,

Turku, Finland). The assay was

carried out in three independent

experiments.

RNA isolation and RT-PCR analysis

PDLCs were cultured in osteogenic

medium (growth medium supple-

mented with 50 lg/mL L-ascorbic acid,

10 mM glycerophosphate, and 100 nM

dexamethasone) with acemannan at

the concentrations described above for

24 h. Cells treated with osteogenic

medium without acemannan were

included as a control group. After

24 h, total cellular RNA was collected

(Total RNA mini kit; Geneaid, Taipei,

China). Total RNA (5 lg) was

converted to cDNA. Then the target

cDNA was amplified (Prime RT Pre-

mix and Prime Taq Premix; Genet Bio,

Chungnam, Korea). The sense and

antisense primer sequences used for

GAPDH, growth/differentiation factor

5 (GDF-5) and runt-related transcrip-

tion factor 2 (Runx2) are shown in

Table 1.

The amplification cycles were com-

posed of 94°C for 30 s, 56°C for 30 s

and 72°C for 1 min. After 30 cycles,

the PCR products were separated by

electrophoresis on 1.5% agarose gel

(570 bp for GDF-5, 229 bp for

Runx2 and 307 bp for GADPH).

Vascular endothelial growth factor,

bone morphogenetic protein 2 and

type I collagen measurement

Vascular endothelial growth factor

(VEGF), bone morphogenetic protein

2 (BMP-2), and type I collagen levels

were measured according to the

manufacturers’ instructions (VEGF

and BMP-2; R&D Systems, Minne-

apolis, MN, USA; type I collagen;

Takara Bio Inc., Shiga, Japan).

Briefly, PDLCs (5 9 104 cells) were

seeded in 24-well plates and grown

to 80% confluence. Then the

medium was replaced by osteogenic

medium containing the same concen-

trations of acemannan as described

above. Cells treated with medium

without acemannan were included as

a control group. Culture supernatant

was collected for VEGF, BMP-2 and

type I collagen level determination.

The sensitivities of the ELISA kits

for VEGF, BMP-2 and type I colla-

gen are 5 pg/mL, 11 pg/mL and

10 ng/mL, respectively. The assay

was carried out in three independent

experiments.

Alkaline phosphatase activity assay

PDLCs were prepared and treated

with acemannan as described above.

Alkaline phosphatase (ALPase) activ-

ity was determined after 72 h. The

cells were washed 3 9 with PBS, and

incubated with glycine buffer (100 mM

glycine, 2 mM MgCl2, pH 10.5) con-

taining 0.35 mg/mL p-nitrophenyl-

phosphate (Sigma-Aldrich, St. Louis,

MO, USA) at 30°C for 30 min. The

reaction was terminated with 1 M

NaOH. ALPase activity was reported

in terms of p-nitrophenol production

which was measured at 405 nm and

normalized to total cellular protein

(nmol p-nitrophenol/min per lg) (21).

Mineralization staining

PDLCs were prepared and treated

with acemannan as described above.

Mineral deposition by cultured

PDLCs was determined by alizarin

red (AR) staining after 9 and 18 d.

The cells were washed 3 9 with PBS,

fixed with 70% ethanol, and stained

with 2% AR (pH 4; Wako Pure

Chemical Industries, Osaka, Japan).

After photographing the staining

results, the stained mineral nodules

were destained with 100 mM cetylpy-

ridinium chloride for 15 min. The

absorbance of the released stain was

measured at 570 nm (12,22).

Preparation of acemannan sponges

Acemannan sponges were prepared by

direct lyophilization as previously

described (23). Briefly, 5% and 10%

acemannan solutions (w/v) were fro-

zen at �80°C for 16 h, lyophilized for

16 h and exposed to ultraviolet light

for 1 h. The 5% and 10% acemannan

Table 1. Nucleotide sequence of sense and antisense primers of GAPDH, GDF-5 and

Runx2

Gene Company name Primer

GAPDH Bio Basic Inc. forward GTCATCCATGACAACTTTGG

reverse GGAAGGCCATGCCAGTGACG

GDF-5 Sigma Genosys forward CTCCTCACTTTCTTGCTTTGG

reverse CCTCCAACTTCACGCTGCTGT

Runx2 Bio Basic Inc forward TCTTCACAAATCCTCCCC

reverse TGGATTAAAAGGACTTGGTG

166 Chantarawaratit et al.

solutions generated 10 mg and 20 mg

acemannan sponges, respectively. The

sponges were kept in a desiccator at

room temperature until used.

Scanning electron microscopy and

pore size analysis

Acemannan spongeswere sputter coated

with gold-palladium and analyzed under

scanning electron microscopy (SEM;

JSM-5410LV; JEOL, Tokyo, Japan).

Samples were analyzed in both longitu-

dinal and transverse planes. Thirty pores

were randomly selected. Pore diameter,

circularity and pore size were mea-

sured using the IMAGE PRO-PLUS pro-

gram, version 6.0 (MediaCybernetics,

Rockville, MD, USA). Because the

pore shapes were predominantly ellip-

tical, the pore diameter was calcu-

lated by the average of the longest

and shortest axis of each pore. Circu-

larity was the ratio between the short-

est and the longest axis of each pore

(24).

Biocompatibility evaluation

According to ISO, both extract test

and direct contact assays were used as

in vitro cytotoxicity tests (25,26). For

the extract test, acemannan sponges

were incubated in growth medium

(1 sponge/2 mL) at 37°C with gentle

agitation. The conditioned media were

collected at 1 and 3 d of immersion.

PDLCs (5 9 104 cells) were seeded

in 24-well plates and incubated until

80% confluent. The growth medium

was removed and the cells were washed

with PBS. The cells were then incu-

bated with conditioned media for 72 h.

Cells incubated with growth medium

were used as a control group. Subse-

quently an 3-[4,5-dimethylthiazol-2-

yl]-2,5-diphenyl tetrazolium bromide

(MTT) viability test was performed as

described (27). Briefly, the cells were

washed twice with PBS and incubated

with 0.5 mg/mL MTT solution for

10 min. The formazan crystals were

dissolved in dimethyl sulfoxide and the

optical density was determined by

measuring the light absorbance at

570 nm. The background absorbance

of dimethyl sulfoxide was subtracted

from the sample absorbance (26).

For the direct contact assay,

sponges were soaked in growth med-

ium for 4 h. Then the sponges were

placed in center of each well in 12-

well culture plates. PDLCs (8 9 104)

were seeded around the sponges. Cell

morphology was observed under the

phase contrast microscope at 0, 4, 24,

48 and 72 h after seeding (25).

In vivo study

Four young adult mongrel dogs (12 mo

of age) were obtained from the Faculty

of Veterinary Science, Chulalongkorn

University, Bangkok, Thailand. The

protocol for the animal study was

approved by the Animal Ethics Com-

mittee of the Faculty of Veterinary

Science, Chulalongkorn University.

The animals were adapted to a 12-h

light/12-h dark cycle for 2 wk before

the operation. During the experiment,

the animals had access to food and

water ad libitum. Two weeks before

the operation, all subjects received

scaling and root planing. Cefazolin

(first generation cephalosporin) 25

mg/kg IV was used for pre-

operative antibiotics prophylaxis.

Sedation was achieved using propofol

1–4 mg/kg and maintained with iso-

flurane (2% in 100% oxygen). The

operation area was locally anesthe-

tized using 2% lidocaine with

1 : 100,000 norepinephrine.

Class II furcation defects were cre-

ated in the furcation areas of the

maxillary and mandibular second and

third premolars (P2 and P3) of each

dog for a total of 32 defects (28,29).

Briefly, a mucoperiosteal flap was

raised. The alveolar crest in the

furcation area was vertically reduced

5 mm from the cemento-enamel junc-

tion using atraumatic osteotomy. The

mesial and distal roots served as

the mesial and distal walls of the

defect, respectively. The bucco-lingual

depth of the defect was approximately

two-thirds the diameter of the tooth

crown. The average width and depth

of the defects was 5 and 3 mm,

respectively. All PDL tissue and

cementum were removed from the

root surface of the defect area using

a curette. Reference notches were

placed in the mesial and distal roots

at the base of the defect using a

0.25 mm diameter round bur

(Fig. 1A).

In each dog, the defects randomly

received one of the following treat-

ments: (i) blood clot in an untreated

defect (negative control); (ii) 10 mg

acemannan sponge (5% w/v); (iii)

20 mg acemannan sponge (10% w/v);

and (iv) sham/no operation as a refer-

ence of the normal anatomy of the

periodontium. The flap was reposi-

tioned and sutured with absorbable

sutures (FSSB, Jestetten, Germany).

The animals received postoperative

antibiotic and analgesic treatment

twice a day using cefazolin 12.5 mg/kg

and carprofen 2.2 mg/kg, respectively.

Two dogs were killed 30 and 60 d

after the operation. Jaw blocks of the

premolar regions, including bone, teeth

and soft tissue, were removed, fixed in

10% neutral formalin buffer, and

demineralized with 4% nitric acid in

10% neutral formalin buffer. Tissue

dehydration was carried out using

ethanol–acetone dehydration and sam-

ples were routinely embedded in paraf-

fin. Five micrometer sections were

prepared from each tissue block in a

lingual–buccal direction.

Histomorphometric analysis

Histomorphometric analysis was per-

formed following the method of

Kosen et al. (30) with some modifica-

tions. Five sections were selected from

each specimen. The first section was

from the mid-point of the furcation

defect and the rest were obtained

every 120 lm in a buccal direction

from the initial section. The selected

sections were stained with hematoxy-

lin and eosin and photographed using

the OLIVIA program (Olympus, Tokyo,

Japan).

The following five histomorphomet-

ric measurements were determined for

each stained section using the IMAGE

PRO-PLUS program, version 6 (Media-

Cybernetics, Rockville, MD, USA)

(Fig. 1C).

1. Defect area: the total area from

the furcation to the apical border

of the notches on the mesial and

distal roots.


2. New bone: the percentage of newly

formed alveolar bone area in rela-

tion to the defect area (a).

3. Defect length: the length of the

root surface located between the

notches on the mesial and the dis-

tal roots (b).

4. New cementum: the percentage of

the length of the newly formed

amorphous substance, cementoid-

like tissue or cementum-like tissue

on the root surface in relation to

the defect length (c, d).

5. New PDL length: the percentage

of the length of fibrous tissue

between newly formed cementum

and alveolar bone in relation to

the defect length (e, f).

Statistical analysis

The data were collected and analyzed

using the SPSS program for Windows,

version 17.0 (SPSS, Chicago, IL,

USA). The results were expressed as

mean � standard error. One-way

analysis of variance and Dunnett

multiple comparisons were performed

in this study. Values of p < 0.05 were

considered as statistically significant.

Results

Acemannan-induced periodontal

ligament cell proliferation and

mRNA expression of runt-related

transcription factor 2 and growth/

differentiation factor 5

The [3H]-thymidine incorporation

assay showed that after 24 h, aceman-

nan at concentrations of 2 and 4 mg/

mL significantly increased new DNA

synthesis in PDLCs compared with

the negative control group (p < 0.05;

Fig. 2A). Acemannan at a concentra-

tion of 4 mg/mL exhibited the maxi-

mum effect on DNA synthesis, which

was approximately three-fold that of

the untreated group.

Acemannan at concentrations of 1, 2

and 4 mg/mL significantly upregulated

the mRNA level of Runx2 1.18, 1.17

and 1.25-fold, respectively, compared

with the untreated group (Fig. 2B).

Acemannan also significantly increased

the mRNA level of GDF-5. Aceman-

nan at 1 mg/mL showed the maximum

effect, an approximately 1.48-fold

increase compared with the negative

control group (Fig. 2C).

Acemannan enhanced vascular

endothelial growth factor, type I

collagen and bone morphogenetic

protein 2 expression

After 24 h of incubation, acemannan

at concentrations of 2 and 4 mg/mL

significantly increased the expression

of VEGF 1.93- and 1.72-fold, respec-

tively, compared with the control

group, while slightly increasing the

expression of BMP-2 and type I colla-

gen. However, after 48 and 72 h,

acemannan significantly enhanced

expression of type I collagen and

BMP-2, respectively, compared with

the control group. Acemannan exhib-

ited a dose-dependent upregulation of

type I collagen and BMP-2. Aceman-

nan at concentrations of 2 and 4 mg/

mL exhibited the maximum effect on

BMP-2 and type I collagen expres-

sion, respectively (Fig. 3).

Acemannan stimulated alkaline

phosphatase activity and mineral

deposition

After 72 h of treatment, acemannan at

concentrations of 2 and 4 mg/mL sig-

nificantly enhanced PDLC ALPase

activity 1.39- and 1.63-fold, respectively

(Fig. 4A). AR staining indicated that,

by 9 and 18 d, acemannan induced

mineral deposition by PDLCs. More

intense AR staining was observed in

the acemannan-treated groups com-

pared with the negative control group.

The increase in mineralized nodules

occurred in a dose-dependent manner.

The greatest mineralization was

observed at a concentration of 4 mg/

mL (Fig. 4B and 4C).

Characterization and

biocompatibility of acemannan

sponges

SEM evaluation revealed that the

concentration of acemannan used in

A

C

D

B

Fig. 1. Class II furcation defect. Schematic illustration of the class II furcation defects (A).

A defect created at the premolar furcation area (B). Histomorphometric measurements

performed in hematoxylin and eosin sections (C). The formulas used to calculate new

cementum formation, new bone formation, and PDL length (D). (a) New bone; (b) defect

length; (c, d) new cementum; and (e, f) new PDL. PDL, periodontal ligament.


the preparation of acemannan sponges

determined their pore diameter and

pore size. Increased concentration of

acemannan resulted in larger pore

diameters and pore areas (Fig. 5A).

The pore geometry of both the 5%

and 10% acemannan sponges was

generally elliptical (Table 2). TheMTT

assay and direct contact assay results

indicated that the acemannan sponges

were biocompatible with PDLCs. The

acemannan sponge extracts signifi-

cantly enhanced cell proliferation com-

pared with the control group (Fig. 5B).

Moreover, the direct contact test

showed that PDLs migrated towards,

and proliferated around, the aceman-

nan sponges (Fig. 5C).

Acemannan-induced periodontal

regeneration in a class II furcation

defect model

Following surgery, all dogs recovered

uneventfully and gained weight over

the experimental period (data not

shown). The animals were examined

for inflammation and foreign body

interaction 30 and 60 d after the oper-

ation, and neither was detected in

either control or acemannan-treated

groups.

Histological analysis revealed that

30 d after treatment, the defects were

partly filled with alveolar bone. The

negative control and acemannan-

treated groups all demonstrated new

alveolar bone, cementum and PDL

formation (Fig. 6A–C). These tissues

extended from the pre-existing bone,

cementum and PDL at the base of the

defect. However, the amount of new

bone and cementum was much greater

in the acemannan-treated groups than

in the control group. Serial histologi-

cal sections demonstrated that bone

formation progressed from the mid-

point of the furcation defect in a buc-

cal direction. Sixty days post-surgery,

all groups demonstrated more alveo-

lar bone, cementum and PDL forma-

tion than that seen after 30 d

(Fig. 6D–F). Marked periodontal

regeneration, including new bone,

cementum, and PDL, was detected in

the acemannan-treated groups.

Examining the newly formed bone

at 30 d post-surgery more closely

revealed woven bone with narrow tra-

beculae lined with osteoblasts. The tra-

beculae contained irregularly arranged

osteocytes (Fig. 7A–C). Sixty days

post-surgery, more new lamellar bone

formation containing osteons and

Haversian canal patterns was observed

in the control and acemannan-treated

groups (Fig. 7D–F). Thin cellular

cementum and cementoid-like tissue

partially covered the root surface after

30 d (Fig. 8A, a–c). The newly formed

PDL was characterized by a cell-rich

and vascularized dense connective

tissue between the root surface and

new bone. The PDL fibers were loose,

A

B

C

Fig. 2. Acemannan-induced PDLC proliferation and the Runx2 and GDF-5 mRNA

expression in PDLCs after 24 h. Acemannan significantly enhanced PDLC proliferation at

concentrations of 2 and 4 mg/mL (A). Acemannan at concentrations of 1, 2 and 4 mg/mL

significantly upregulated mRNA expression of Runx2 (B). Acemannan at concentrations

of 0.25, 0.5, 1, 2 and 4 mg/mL significantly upregulated mRNA level of GDF-5 (C). GAP-

DH served as internal control. *Compared with the untreated group; p < 0.05, n = 3.

GDF-5, growth/differentiation factor 5; PDLC, periodontal ligament cell; Runx2, runt-

related transcription factor 2.


poorly organized and irregularly orien-

tated (Fig. 8B, a–c). Sharpey’s fibers

inserted into both the new cementum

and alveolar bone were observed in

some specimens by 30 d after the oper-

ation (Fig. 8B, b). At 60 d post-

treatment, the width and length of the

cementum in the acemannan-treated

groups was greater than that of the

untreated group (8A, d–f). The PDL

fibers were denser and better organized

compared with the specimens at 30 d

(8B, d–f). However, the PDL space of

all groups was wider than that of the

pre-existing space.

The histomorphometric analysis

indicated that the application of

acemannan to the furcation defects

induced greater periodontal tissue

regeneration than in the control group

(Fig. 9). There were significant differ-

ences in the mean percentage of new

bone formation between the aceman-

nan-treated groups and untreated

control group at 30 and 60 d post-

implantation (Fig. 9A). Acemannan

also significantly induced cementum

and PDL formation after 60 d of

treatment (Fig. 9B and 9C). At 60 d

post-surgery, the values of new bone,

cementum, and PDL length formation

found in the 10 mg acemannan

sponge-treated group were slightly

higher than those of the 20 mg group.

Discussion

Tissue engineering and regenerative

medicine in combination with peri-

odontal therapy can be used to over-

come the limitations of conventional

treatment and regenerate new peri-

odontal tissue. The PDL is a fibrous

connective tissue connecting the alve-

olar bone and tooth root cementum.

In addition to anchoring the teeth

in the jaw, the PDL is a key contribu-

tor of the cells involved in periodon-

tal regeneration (31). Many studies

have demonstrated that the PDL con-

tains stem cells that participate in

periodontal tissue homeostasis and

regeneration. These cell populations

contain progenitors of the fibroblast

and osteoblast/cementoblast cell lin-

eages, which are involved in periodon-

tium regeneration. Under suitable

inductive conditions, PDLCs prolifer-

ate and differentiate to osteoblast-like

and cementoblast-like cells, express

bone-associated protein markers and

generate mineralized nodules and

ectopic hard tissue (32,33). These data

suggest that PDLCs have the poten-

tial to regenerate all types of peri-

odontal tissues.

In the present study, acemannan

functioned as a bioactive molecule,

stimulating PDLC proliferation, expres-

sion of Runx2, GDF-5, BMP-2,

VEGF, type I collagen, ALPase activ-

ity, and mineral deposition. Runx2 is

a transcription factor considered to

be a regulator of osteoblast/cemento-

blast differentiation and function

(34,35). BMP-2, GDF-5 and VEGF

are important growth factors for peri-

odontal tissue healing and regenera-

tion. BMP-2 is one of the most potent

growth factors inducing osteogenic/

cementogenic differentiation (36–38).GDF-5 has been demonstrated

A

B

C

Fig. 3. Acemannan promoted the expression of VEGF, type I collagen, and BMP-2. (A)

Acemannan significantly induced VEGF expression at 24 h, (B) type I collagen at 48 h

and (C) BMP-2 at 72 h. *Compared to the untreated group; p < 0.05, n = 3. BMP-2, bone

morphogenetic protein 2; VEGF, vascular endothelial growth factor.


to stimulate PDL development, new

cementum formation and bone regen-

eration (39,40). GDF-5 and its recep-

tor have been detected in PDLCs

(41). Intrabony defects treated with

BMP-2 or GDF-5 exhibited enhanced

periodontal healing/regeneration with

new alveolar bone, cementum and

PDL formation (37,39,42). VEGF has

been shown to induce angiogenesis by

increasing endothelial cell prolifera-

tion and migration (43). BMP-2 and

VEGF have been observed to stimu-

late dental follicle cells to differenti-

ate toward an osteoblast/cementoblast

phenotype (44,45). Therefore, aceman-

nan may accelerate periodontal tissue

healing/regeneration by stimulating

PDLC expression of BMP-2, GDF-5

and VEGF.

In addition to enhanced growth

factor synthesis, acemannan induced

the expression of type I collagen,

ALPase activity and mineral deposi-

tion by PDLCs. Type I collagen is the

predominant extracellular matrix pro-

tein in the PDL, cementum and alveo-

lar bone (46,47), providing physical

support and acting as a template

for mineral deposition in hard tissue.

A

C

B

Fig. 4. Acemannan increased ALPase activity and mineral deposition. Acemannan significantly enhanced periodontal ligament cell

ALPase activity after 72 h of incubation at concentrations of 2 and 4 mg/mL (A). *denotes statistical difference with the untreated group;

p < 0.05, n = 3. Acemannan increased periodontal ligament cell mineral deposition at 9 and 18 d (B, C). The 0.5, 1, 2 and 4 mg/mL

acemannan-treated groups had larger and more intensely stained areas than the untreated group. By quantitative alizarin red staining, the

0.5, 1, 2 and 4 mg/mL acemannan-treated groups significantly promoted mineralization. *,#Compared with the untreated group at the 9th

and 18th day of incubation, respectively, p < 0.05, n = 9. ALPase, alkaline phosphatase.


ALPase is an osteogenic/cementogenic

differentiation early phase marker

(48). Increased levels of ALPase activ-

ity in periodontal tissues correlated

with periodontal tissue regeneration

(49,50). Mineral deposition is a

unique characteristic of hard tissue

forming cells. Our data suggest that

acemannan can induce extracellular

matrix synthesis and the differenti-

ation of PDLCs into hard tissue

forming cells, osteoblasts and ce-

mentoblasts, which generate bone and

cementum, respectively.

Although our in vitro results indi-

cated acemannan induced PDLC

Table 2. Characteristic of the sponge pores

Parameters 5% Acemannan sponge 10% Acemannan sponge

Pore diameter (lm) 167.95 � 36.17 189.35 � 69.42

Circularity 0.72 � 0.16 0.58 � 0.2

Pore size/area (lm2) 1.843E4 � 7.105E3 2.7552E4 � 1.9867E4

A

C

Ba

a b c

d e f

b

c d

Fig. 5. Scanning electron microscopy analysis of the 5% (a, c) and 10% (b, d) acemannan sponges. Note the increased pore size in the

10% sponges (A). The acemannan sponge extracts significantly increased periodontal ligament cell proliferation (MTT assay) *Compared

with the untreated group; p < 0.05, n = 3. (B). Acemannan sponge biocompatibility with periodontal ligament cell. Direct contact test of

the 5% (a–c) and 10% (d–f) acemannan sponges was analyzed via the phase contrast microscope at 0 (a, d), 24 (b, e), and 72 h (c, f) after

seeding. #Sponge (C).


activity, which could lead to periodon-

tal tissue regeneration, acemannan in

solution may not be appropriate for

applying to periodontal pockets to

induce periodontal regeneration because

in solution acemannan would be

diluted by crevicular fluid. Because of

its physical properties as a polysac-

charide, acemannan can be prepared

as a sponge. SEM analysis revealed

acemannan sponges contained inter-

connected pores with diameters rang-

ing from 100 to 260 lm. This

diameter range is suitable for PDLC

attachment and growth (51). After

being inserted into a periodontal

defect, an acemannan sponge would

absorb and maintain serum or inter-

stitial fluid from the surrounding tis-

sue, which is enriched with growth

factors and nutrients that promote tis-

sue healing. We found that aceman-

nan sponges were biocompatible and

exhibited biological activity as shown

by their ability to stimulate PDLC

migration and proliferation. This sug-

gests that an acemannan sponge could

function in vivo by inducing PDLC

proliferation and activity and act as a

scaffold permitting PDLC infiltration

and growth.

Currently, the precise molecular

mechanisms governing the effects

of acemannan on cellular activity

remain unknown. Based on its struc-

ture, sugar composition and molecu-

lar weight, acemannan could bind to

a specific cell surface receptor and

then initiate downstream intracellular

signaling pathways to stimulate prolif-

eration and differentiation. Aceman-

nan induced the phosphorylation of

p38 mitogen-activated protein kinase

(MAPK) in dental pulp cells. Preincu-

bation with the specific p38 MAPK

inhibitor SB203580 resulted in a 50%

decrease in the phosphorylation level

of p38 MAPK as compared with the

acemannan-treated group (52). Peri-

odontal ligament cell proliferation,

gene expression, osteogenic differenti-

ation, and mineralization have all

been shown to be regulated by p38

MAPK (53). Therefore, acemannan

may activate periodontal ligament cell

proliferation and differentiation via

the MAPK pathway. Another possi-

ble pathway is via acemannan binding

to the mannose receptor. The man-

nose receptor family is composed of

Endo180 (CD280), the M-type phos-

pholipase A2 receptor, and the DEC-

205/gp200-MR6 subfamily. These

receptors contain C-type lectin-like

domains that recognize mannose,

fructose or N-acetylglucosamine at

the end of a polysaccharide chain

(54,55). After binding, the ligand–receptor complex is internalized and

subsequently releases the ligands

inside the cell. To better understand

the molecular mechanisms of aceman-

nan activity, future study is required.

In periodontal disease, the involve-

ment of a furcation defect is consid-

ered a complex and severe condition,

causing extensive and rapid attach-

ment loss and tooth loss. The success

of furcation defect treatment is often

limited (56,57). To demonstrate the

effect of acemannan on periodontal

regeneration, an in vivo class II furca-

tion defect model was chosen. An

advantage of a class II furcation

A B C

D E F

Fig. 6. Histology of periodontal regeneration in class II furcation defects at 30 d (A–C)

and 60 d (D–F) post-surgery of control group (A, D), 10-mg acemannan sponge group (B,

E) and 20-mg acemannan sponge group (C, F). At both time points the sponge-treated

groups showed more new bone and cementum formation than the control group. NB, new

bone; PB, pre-existing bone; black arrowhead, new cementum; white arrowhead, pre-exist-

ing cementum; white arrow, the apical limit of the defect. Scale bar = 500 lm.


defect model is that it limits the severe

gingival recession problems often

found in class III furcation defect

models. Severe gingival recession can

result in the loss of test material from

the defect and exposure of the defect

area leading to microbial contamina-

tion (58). However, class II furcation

defect models still have limitations in

their use in periodontal regeneration

studies. The lingual wall of a class II

defect is in contact with intact alveolar

bone, cementum and PDL, which is

not the case in a class III defect. Con-

sequently, the lingual defect area has a

greater healing rate than the buccal

area. Sectioning along the mesiodistal

plane of class II furcation defects may

lead to some difficulties in interpreting

the histological results. To account for

this, we employed criteria used in a

previous study to select the sections to

be examined (30). In a buccal direc-

tion beginning at the midsection, a

section every 120 lm of each defect

was selected and measured. The mean

of the histomorphometric results

obtained from each distance was used

in the statistical analysis.

A study by Jittapiromsak et al.,

reported that a dose of 300–600 lgacemannan was effective as a direct

pulp capping material for a pinpoint

pulpal exposure area of 1 mm2 (12,59).

The volume of the class II furcation

defects in the present study was

37 mm3. For use in a three-dimen-

sional defect, we calculated that the

appropriate amount of acemannan

sponge per defect should be 11–22 mg.

Therefore, 10 and 20 mg acemannan

sponges were prepared and placed in

the defects. To minimize the effect of

bone density variations between the

upper and lower jaw, and between

each animal, every group was repre-

sented in each jaw of each animal. In

this preliminary study, a convenient

sample of dogs and defects was used to

evaluate the effect of acemannan on

periodontal regeneration in canines.

Histomorphometric analysis revealed

that in all groups, more bone than

cementum was regenerated. This may be

because cementum has no direct blood

supply, lymphatic drainage or innerva-

tion. Thus, cementum lacks sources of

important factors for remodeling, repair

and regeneration as compared with

bone, which contains a blood supply

system. Consequently, cementum repair

and regeneration is lower and more

unpredictable than bone regeneration

(20,60,61). In our histological evalua-

tion, the new cementum, which covered

the denuded root dentin surface, exhib-

ited various patterns; amorphous eosin-

ophilic substance, cementoid-like tissue

and cellular cementum. This finding

corresponds to a previous report (62).

Ankylosis is the pathological fusion

between tooth root and alveolar bone.

Our study did not reveal any instances

of ankylosis in either the control or

experimental groups. Ankylosis has

been proposed to be caused by an

imbalance between new alveolar bone

and periodontal tissue formation,

A B C

D E F

Fig. 7. Histology of bone regeneration in class II furcation defects at 30 d (A–C) and 60 d

(D–F) post-surgery of control groups (A, D), 10-mg acemannan sponge groups (B, E) and

20-mg acemannan sponge groups (C, F). At 30 d of treatment, newly formed woven bone

was observed, while at 60 d, a more mature bone pattern containing osteons was found.

NB, new bone; PB, pre-existing bone.


which impairs or hinders periodontal

regeneration. In vivo, ankylosis is asso-

ciated with the application of recombi-

nant human BMP-2. The possible

explanation is that BMP-2 is strongly

osteoinductive with low periodontal

regeneration activity, while acemannan

can stimulate both soft and hard tissue

regeneration (10–14,63,64).In some of our samples, we found a

small space, known as slit formation,

located between newly formed cemen-

tum and denuded dentin. Although the

mechanism of slit formation is still

unclear, this phenomenon is com-

monly seen, indicating a weak cohesion

between cementum and dentin (58,

65–67). The formation of a smear layer

on the surgically denuded dentin sur-

face before new cementum synthesis

has been proposed as its cause (66,67).

Electron microscopy revealed the

smear layer as an electron-dense, gran-

ular and non-collagenous layer present

between these tissues (65,68). This

smear layer can inhibit the reattach-

ment between newly formed cementum

and dentin. Another possible cause of

slit formation is tissue shrinkage dur-

ing the paraffin sectioning process that

can break the weak attachment

between these two tissues (66). Recent

studies have shown that bone sialopro-

tein and osteopontin play a role in

adhesion between these two tissues

(69,70).

Currently, a number of bioactive

substances and techniques have been

introduced as clinical periodontal regen-

eration therapies such as GEM21,

EMDOGAIN and guided tissue

regeneration (65,66,71–74). GEM21 is

a mixture of recombinant human

platelet derived growth factor BB

and beta-tricalcium phosphate, while

EMDOGAIN is a purified extract of

porcine enamel matrix proteins, lar-

gely consisting of amelogenin. Guided

tissue regeneration is a technique that

uses membranes as a barrier to sup-

port the ingrowth of periodontal tis-

sue and inhibit the invasion of

gingival epithelium in to the periodon-

tal defect. There have been many mod-

ifications made to the membrane,

including gene, protein or cell therapy

approaches. All of these materials have

been reported as successful in animal

and clinical periodontal regeneration

studies (71,72).

Based on the source and composi-

tion of acemannan, the sponges may

be an alternative biomaterial for

patients who wish to avoid the use of

recombinant protein or have restric-

tions on the source of a material.

Moreover, in sponge form, aceman-

nan is easy to insert into periodontal

defects. An acemannan sponge can be

conveniently combined with various

types of periodontal surgery tech-

niques. Unlike a solution or gel, an

A

B

a b c

a b c

d e f

d e f

Fig. 8. Histology of cementum and PDL regeneration in class II furcation defects at 30 d

(a–c) and 60 d (d–f) post-surgery of control groups (a, d), 10-mg acemannan sponge

groups (b, e), and 20-mg acemannan sponge groups (c, f). The width and length of the

cementum in the acemannan-treated groups was greater than that of the untreated group

(A). At 60 d post-surgery, the PDL fibers were denser and more organized at 30 d post-

surgery (B). NB, new bone; PB, pre-existing bone; NC, new cementum; PC, pre-existing

cementum; PDL, PDL space; D, dentin; black arrow, Sharpey’s fibers; white arrow, the

apical limit of the defect. Scale bar = 50 lm.


acemannan sponge remains in the

defect for several weeks and gradually

releases its bioactive molecules to pro-

mote regeneration of the surrounding

tissue. We found in our in vivo study

that the sponge itself is able to stop

excessive bleeding. The blood and tis-

sue fluid held in the sponge can be a

source of growth factors and nutrients

for tissue regeneration. The ability to

physically remain in the surgical

defect might help to decrease epithe-

lial downgrowth and provide space

for periodontal tissue regeneration.

With some modification, acemannan

can be prepared as a scaffold and be

used as a cell carrier in tissue engi-

neering techniques. However, more

animal and clinical studies regarding

the efficiency of acemannan on peri-

odontal regeneration and a compari-

son with these other materials and

techniques are required.

We note that the class II furcation

defects in our study were iatrogenically

created in healthy periodontal tissue.

Therefore, there was neither microor-

ganism invasion nor the chronic

inflammation and tissue destruction as

occurs in periodontal defects. To con-

firm our data and verify its clinical

applicability, further in vivo studies of

acemannan in bacteria-induced peri-

odontal defects should be performed.

Conclusion

In conclusion, acemannan increased

PDLC proliferation, growth factor and

extracellular matrix synthesis, differen-

tiation and mineralization in vitro,

and enhanced periodontal regeneration

in class II furcation defects. Taken

together, our data suggest that ace-

mannan could be a candidate herbal

biomolecule for periodontal tissue

regeneration.

Acknowledgements

We thank Professor Dr. Visaka Lim-

wong, Associate Professor Dr. Dolly

Methatharathip, and Dr. Kevin A.

Tompkins for their valuable sugges-

tions. This work was supported by the

Higher Education Research Promotion

and National Research University Pro-

ject of Thailand (AS549A), Thailand

Government Research Fund, Develop-

ing Research Unit in Herbal Medicine

for Oral Tissue Regeneration Fund,

and the 90th Anniversary of Chul-

alongkorn University Fund (Ratcha-

daphiseksomphot Endowment Fund).

No conflicts of interest exist.

References

1. Drisko CH. Nonsurgical periodontal

therapy. Periodontol 2000;2001:77–88.

2. Benatti BB, Silverio KG, Casati MZ,

Sallum EA, Nociti FH Jr. Physiological

features of periodontal regeneration and

approaches for periodontal tissue engi-

neering utilizing periodontal ligament

cells. J Biosci Bioeng 2007;103:1–6.

3. Grzesik WJ, Narayanan AS. Cementum

and periodontal wound healing and

regeneration. Crit Rev Oral Biol Med

2002;13:474–484.

4. Bansal J, Kedige SD, Anand S. Hyal-

uronic acid: a promising mediator for

periodontal regeneration. Indian J Dent

Res 2010;21:575–578.

5. Francesko A, Tzanov T. Chitin, chitosan

and derivatives for wound healing and

tissue engineering. Adv Biochem Eng Bio-

technol 2011;125:1–27.

A

B

C

Fig. 9. Acemannan sponge induced periodontal regeneration. Acemannan significantly

increased the percentage of new bone formation at 30 and 60 d post-surgery (A). Aceman-

nan significantly increased the percentage of new cementum formation at 60 d (B). Peri-

odontal ligament length in acemannan-treated groups was shorter than those of untreated

control (C). Columns bars labeled by different letters are statistically different. p < 0.05,

n = 4.


6. Munarin F, Guerreiro SG, Grellier MA

et al. Pectin-based injectable biomaterials

for bone tissue engineering. Biomacro-

molecules 2011;12:568–577.

7. Wong M. Alginates in tissue engineering.

Methods Mol Biol 2004;238:77–86.

8. Barbosa MA, Granja PL, Barrias CC,

Amaral IF. Polysaccharides as scaffolds

for bone regeneration. ITBM-RBM

2005;26:212–217.

9. Santo VE, Gomes ME, Mano JF, Reis

RL. Chitosan-chondroitin sulphate nano-

particles for controlled delivery of plate-

let lysates in bone regenerative medicine.

J Tissue Eng Regen Med 2012;6(suppl 3):

s47–s59.

10. Boonyakul S, Banlunara W, Sangvanich

P, Thunyakitpisal P. Effect of aceman-

nan, an extracted polysaccharide from

aloe vera, on BMSCs proliferation, dif-

ferentiation, extracellular matrix synthe-

sis, mineralization, and bone formation

in a tooth extraction model. Odontology

2013 (in press) doi:10.1007/s10266-012-

0101-2.

11. Jettanacheawchankit S, Sasithanasate S,

Sangvanich P, Banlunara W,

Thunyakitpisal P. Acemannan stimulates

gingival fibroblast proliferation; expres-

sions of keratinocyte growth factor-1,

vascular endothelial growth factor, and

type I collagen; and wound healing. J

Pharmacol Sci 2009;109:525–531.

12. Jittapiromsak N, Sahawat D, Banlunara

W, Sangvanich P, Thunyakitpisal P.

Acemannan, an extracted product from

Aloe vera, stimulates dental pulp cell

proliferation, differentiation, mineraliza-

tion, and dentin formation. Tissue Eng

Part A 2010;16:1997–2006.

13. Sahawat D, Kanthasuwan S, Sangvanich

P, Takata T, Kitagawa M, Thunyakitpi-

sal P. Acemannan induces cementoblast

proliferation, differentiation, extracellular

matrix secretion, and mineral deposition.

J Med Plant Res 2012;6:4069–4076.

14. Bhalang K, Thunyakitpisal P, Rungsir-

isatean N. Acemannan, a polysaccharide

extracted from Aloe vera, is effective in

the treatment of oral aphthous ulcera-

tion. J Altern Complement Med 2012 (in

press) doi:10.1089/acm.2012.0164.

15. Ni Y, Turner D, Yates KM, Tizard I.

Isolation and characterization of struc-

tural components of Aloe vera L. leaf

pulp. Int Immunopharmacol 2004;4:

1745–1755.

16. Jittapiromsak N, Jettanacheawchankit S,

Lardungdee P, Sangvanich P, Thun-

yakitpisal P. Effect of acemannan on

BMP-2 expression in primary pulpal

fibroblasts and periodontal fibroblasts, in

vitro study. J Oral Tissue Eng 2007;4:

149–154.

17. Tai-Nin CJ, Williamson DA, Yates KM,

Goux WJ. Chemical characterization of

the immunomodulating polysaccharide of

Aloe vera L. Carbohydr Res

2005;340:1131–1142.

18. Kadar K, Kiraly M, Porcsalmy B et al.

Differentiation potential of stem cells

from human dental origin - promise for

tissue engineering. J Physiol Pharmacol

2009;60(suppl 7):167–175.

19. Marmary Y, Brunette DM, Heersche JN.

Differences in vitro between cells derived

from periodontal ligament and skin of

Macaca irus. Arch Oral Biol 1976;21:

709–716.

20. Yoshizumi M, Kagami S, Suzaki Y et al.

Effect of endothelin-1 (1–31) on human

mesangial cell proliferation. Jpn J Phar-

macol 2000;84:146–155.

21. Chou AM, Sea-Lim V, Lim TM et al.

Culturing and characterization of human

periodontal ligament fibroblasts - a preli-

minary study. Mater Sci Eng, C

2002;20:77–83.

22. Wang W, Kirsch T. Retinoic acid stimu-

lates annexin-mediated growth plate

chondrocyte mineralization. J Cell Biol

2002;157:1061–1069.

23. Peniche C, Fernandez M, Rodriguez G

et al. Cell supports of chitosan/hyal-

uronic acid and chondroitin sulphate sys-

tems. Morphology and biological

behaviour. J Mater Sci Mater Med

2007;18:1719–1726.

24. Parenteau-Bareil R, Gauvin R, Cliche S,

Gariepy C, Germain L, Berthod F. Com-

parative study of bovine, porcine and

avian collagens for the production of a

tissue engineered dermis. Acta Biomater

2011;7:3757–3765.

25. Yan-Zhi X, Jing-Jing W, Chen YP, Liu

J, Li N, Yang FY. The use of zein and

Shuanghuangbu for periodontal tissue

engineering. Int J Oral Sci 2010;2:

142–148.

26. Martins AM, Santos MI, Azevedo HS,

Malafaya PB, Reis RL. Natural origin

scaffolds with in situ pore forming capa-

bility for bone tissue engineering applica-

tions. Acta Biomater 2008;4:1637–1645.

27. Mosmann T. Rapid colorimetric assay for

cellular growth and survival: application

to proliferation and cytotoxicity assays. J

Immunol Methods 1983;65:55–63.

28. Carlo RE, Borges AP, Del Carlo RJ

et al. Guided tissue regeneration using

rigid absorbable membranes in the dog

model of chronic furcation defect. Acta

Odontol Scand 2012 (in press) doi:10.

3109/00016357.2012.680909.

29. Deliberador TM, Nagata MJ, Furlaneto

FA et al. Autogenous bone graft with or

without a calcium sulfate barrier in the

treatment of Class II furcation defects: a

histologic and histometric study in dogs.

J Periodontol 2006;77:780–789.

30. Kosen Y, Miyaji H, Kato A, Sugaya T,

Kawanami M. Application of collagen

hydrogel/sponge scaffold facilitates peri-

odontal wound healing in class II furca-

tion defects in beagle dogs. J Periodontal

Res 2012;47:626–634.

31. Marchesan JT, Scanlon CS, Soehren S,

Matsuo M, Kapila YL. Implications of

cultured periodontal ligament cells for

the clinical and experimental setting: a

review. Arch Oral Biol 2011;56:933–943.

32. Gay IC, Chen S, MacDougall M. Isola-

tion and characterization of multipotent

human periodontal ligament stem cells.

Orthod Craniofac Res 2007;10:149–160.

33. Seo BM, Miura M, Gronthos S et al.

Investigation of multipotent postnatal

stem cells from human periodontal liga-

ment. Lancet 2004;364:149–155.

34. Bronckers AL, Engelse MA, Cavender

A, Gaikwad J, D’Souza RN. Cell-specific

patterns of Cbfa1 mRNA and protein

expression in postnatal murine dental tis-

sues. Mech Dev 2001;101:255–258.

35. Ducy P, Zhang R, Geoffroy V, Ridall

AL, Karsenty G. Osf2/Cbfa1: a tran-

scriptional activator of osteoblast differ-

entiation. Cell 1997;89:747–754.

36. Kobayashi M, Takiguchi T, Suzuki R

et al. Recombinant human bone mor-

phogenetic protein-2 stimulates osteo-

blastic differentiation in cells isolated

from human periodontal ligament. J

Dent Res 1999;78:1624–1633.

37. Miyaji H, Sugaya T, Ibe K, Ishizuka R,

Tokunaga K, Kawanami M. Root sur-

face conditioning with bone morphoge-

netic protein-2 facilitates cementum-like

tissue deposition in beagle dogs. J Peri-

odontal Res 2010;45:658–663.

38. Zhao M, Xiao G, Berry JE, Franceschi

RT, Reddi A, Somerman MJ. Bone

morphogenetic protein 2 induces dental

follicle cells to differentiate toward a ce-

mentoblast/osteoblast phenotype. J Bone

Miner Res 2002;17:1441–1451.

39. Kwon HR, Wikesjo UM, Park JC et al.

Growth/differentiation factor-5 signifi-

cantly enhances periodontal wound

healing/regeneration compared with plate-

let-derived growth factor-BB in dogs.

J Clin Periodontol 2010;37:739–746.

40. Moore YR, Dickinson DP, Wikesjo

UM. Growth/differentiation factor-5: a

candidate therapeutic agent for peri-

odontal regeneration? A review of pre-

clinical data. J Clin Periodontol 2010;37:

288–298.

41. Nakamura T, Yamamoto M, Tamura M,

Izumi Y. Effects of growth/differentiation

factor-5 on human periodontal ligament

cells. J Periodontal Res 2003;38:597–605.

42. King GN, King N, Cruchley AT, Wozney

JM, Hughes FJ. Recombinant human

bone morphogenetic protein-2 promotes

wound healing in rat periodontal fenestra-

tion defects. J Dent Res 1997;76:

1460–1470.


43. Bao P, Kodra A, Tomic-CanicM, Golinko

MS, Ehrlich HP, Brem H. The role of vas-

cular endothelial growth factor in wound

healing. J Surg Res 2009;153:347–358.

44. Chen XP, Qian H, Wu JJ et al. Expres-

sion of vascular endothelial growth fac-

tor in cultured human dental follicle cells

and its biological roles. Acta Pharmacol

Sin 2007;28:985–993.

45. Xu LL, Liu HC, Wang DS et al. Effects

of BMP-2 and dexamethasone on osteo-

genic differentiation of rat dental follicle

progenitor cells seeded on three-

dimensional beta-TCP. Biomed Mater

2009;4:065010.

46. Kook SH, Hwang JM, Park JS et al.

Mechanical force induces type I collagen

expression in human periodontal liga-

ment fibroblasts through activation of

ERK/JNK and AP-1. J Cell Biochem

2009;106:1060–1067.

47. Lukinmaa PL, Waltimo J. Immunohisto-

chemical localization of types I, V, and

VI collagen in human permanent teeth

and periodontal ligament. J Dent Res

1992;71:391–397.

48. Marom R, Shur I, Solomon R,

Benayahu D. Characterization of adhe-

sion and differentiation markers of osteo-

genic marrow stromal cells. J Cell

Physiol 2005;202:41–48.

49. Kawasaki N, Hamamoto Y, Nakajima

T, Irie K, Ozawa H. Periodontal regener-

ation of transplanted rat molars after

cryopreservation. Arch Oral Biol 2004;

49:59–69.

50. Goncalves PF, Lima LL, Sallum EA,

Casati MZ, Nociti FH Jr. Root cementum

may modulate gene expression during

periodontal regeneration: a preliminary

study in humans. J Periodontol 2008;79:

323–331.

51. Schander K, Arvidson K, Mustafa K

et al. Response of bone and periodontal

ligament cells to biodegradable polymer

scaffolds in vitro. J Bioact Compat Pol

2010;25:584–602.

52. Boonpaisanseree W, Jaru-Ampornpan K,

Koontongkaew S, Thunyakitpisal P.

Acemannan stimulated dentine sialophos-

phoprotein expression in human dental

pulp cell via p38 mitogen activated pro-

tein kinase. In: Fan S, Le T, Le Q, Yue

Y, eds. Proceeding of International Con-

ference: Innovative Research in a Chang-

ing and Challenging World. Thailand:

Australian Multicultural Interaction

Institute, 2012:356–365.

53. Kook SH, Lee JC. Tensile force inhibits

the proliferation of human periodontal

ligament fibroblasts through Ras-p38

MAPK up-regulation. J Cell Physiol

2012;227:1098–1106.

54. Boskovic J, Arnold JN, Stilion R et al.

Structural model for the mannose receptor

family uncovered by electron microscopy

of Endo180 and the mannose receptor.

J Biol Chem 2006;281:8780–8787.

55. Martinez-Pomares L. The mannose

receptor. J Leukoc Biol 2012;92:1177–

1186.

56. Payot P, Bickel M, Cimasoni G. Longi-

tudinal quantitative radiodensitometric

study of treated and untreated lower

molar furcation involvements. J Clin

Periodontol 1987;14:8–18.

57. Carranza FA Jr, Jolkovsky DL. Current

status of periodontal therapy for furca-

tion involvements. Dent Clin North Am

1991;35:555–570.

58. Pontoriero R, Nyman S, Ericsson I,

Lindhe J. Guided tissue regeneration in

surgically-produced furcation defects. An

experimental study in the beagle dog. J

Clin Periodontol 1992;19:159–163.

59. Horsted P, Sandergaard B, Thylstrup A,

El Attar K, Fejerskov O. A retrospective

study of direct pulp capping with calcium

hydroxide compounds. Endod Dent Trau-

matol 1985;1:29–34.

60. Wikesjo UM, Selvig KA. Periodontal

wound healing and regeneration. Period-

ontol 2000;1999:21–39.

61. Goncalves PF, Sallum EA, Sallum WS,

Casati MZ, Toledo S, Nociti FH Jr.

Dental cementum reviewed: development,

structure, composition, regeneration and

potential functions. Braz J Oral Sci

2005;4:651–658.

62. Ripamonti U, Petit JC, Teare J.

Cementogenesis and the induction of

periodontal tissue regeneration by the

osteogenic proteins of the transforming

growth factor-beta superfamily. J Peri-

odontal Res 2009;44:141–152.

63. Takahashi D, Odajima T, Morita M,

Kawanami M, Kato H. Formation and

resolution of ankylosis under application

of recombinant human bone morphoge-

netic protein-2 (rhBMP-2) to class III

furcation defects in cats. J Periodontal

Res 2005;40:299–305.

64. Wikesjo UM, Sorensen RG, Kinoshita

A, Jian Li X, Wozney JM. Periodontal

repair in dogs: effect of recombinant

human bone morphogenetic protein-12

(rhBMP-12) on regeneration of alveolar

bone and periodontal attachment. J Clin

Periodontol 2004;31:662–670.

65. Al-Hezaimi K, Al-Askar M, Al-Rasheed

A. Characteristics of newly-formed

cementum following Emdogain applica-

tion. Int J Oral Sci 2011;3:21–26.

66. Bosshardt DD, Sculean A, Windisch P,

Pjetursson BE, Lang NP. Effects of

enamel matrix proteins on tissue forma-

tion along the roots of human teeth. J

Periodontal Res 2005;40:158–167.

67. Park JC, Um YJ, Jung UW, Kim CS,

Choi SH, Kim CK. Histological charac-

teristics of newly formed cementum in

surgically created one-wall intrabony

defects in a canine model. J Periodontal

Implant Sci 2010;40:3–10.

68. Listgarten MA. Electron microscopic

study of the junction between surgically

denuded root surfaces and regenerated

periodontal tissues. J Periodontal Res

1972;7:68–90.

69. Bosshardt DD, Degen T, Lang NP.

Sequence of protein expression of bone

sialoprotein and osteopontin at the devel-

oping interface between repair cementum

and dentin in human deciduous teeth.

Cell Tissue Res 2005;320:399–407.

70. Harahashi H, Odajima T, Yamamoto T,

Kawanami M. Immunohistochemical

analysis of periodontal reattachment on

denuded root dentin after periodontal

surgery. Biomed Res 2010;31:319–328.

71. Kaigler D, Cirelli JA, Giannobile WV.

Growth factor delivery for oral and peri-

odontal tissue engineering. Expert Opin

Drug Deliv 2006;3:647–662.

72. Needleman IG, Worthington HV, Gied-

rys-Leeper E, Tucker RJ. Guided tissue

regeneration for periodontal infra-bony

defects. Cochrane Database Syst Rev

2006;19:CD001724.

73. Ridgway HK, Mellonig JT, Cochran DL.

Human histologic and clinical evaluation

of recombinant human platelet-derived

growth factor and beta-tricalcium phos-

phate for the treatment of periodontal

intraosseous defects. Int J Periodontics

Restorative Dent 2008;28:171–179.

74. Nevins M, Giannobile WV, McGuire

MK et al. Platelet-derived growth factor

stimulates bone fill and rate of attach-

ment level gain: results of a large multi-

center randomized controlled trial. J

Periodontol 2005;76:2205–2215.


acemannan sponges stimulate alveolar bone, cementum and ... · periodontal ligament, cementum and...

Documents