Accumulation of trehalose within transgenic chloroplasts confers droughttolerance

Seung-Bum Lee1, Hawk-Bin Kwon2,3, Soo-Jin Kwon2, Soo-Chul Park2, Mi-Jeong Jeong2,Sang-Eun Han2, Myung-Ok Byun2 and Henry Daniell1,*1Molecular Biology and Microbiology Department, University of Central Florida, 336 Biomolecular Science(Bldg #20), Orlando, FL 32816-2360, USA; 2Molecular Genetics Division, National Institute of AgriculturalScience and Technology, Suwon, 441-707, Korea; 3Current address: Division of Applied Biological Sciences,Sunmoon University, Asan, 336-840, Korea; *Author for correspondence (e-mail: daniell@mail.ucf.edu;phone: 407-823-0952; fax: 407-823-0956)Received 18 July 2001; accepted in revised form 13 November 2001

Key words: Abiotic stress tolerance, Chloroplast genetic engineering, Clean-gene technology, Drought tolerance,Genetically Modified Crops

Abstract

Yeast trehalose phosphate synthase (TPS1) gene was introduced into the tobacco chloroplast or nuclear genomesto study resultant phenotypes. PCR and Southern blots confirmed stable integration of TPS1 into the chloroplastgenomes of T1, T2 and T3 transgenic plants. Northern blot analysis of transgenic plants showed that the chloro-plast transformant expressed 169-fold more TPS1 transcript than the best surviving nuclear transgenic plant. Al-though both the chloroplast and nuclear transgenic plants showed significant TPS1 enzyme activity, no significanttrehalose accumulation was observed in T0/T1 nuclear transgenic plants whereas chloroplast transgenic plantsshowed 1525 fold higher accumulation of trehalose than the best surviving nuclear transgenic plants. Nucleartransgenic plants (T0) that showed even small amounts of trehalose accumulation showed stunted phenotype,sterility and other pleiotropic effects whereas chloroplast transgenic plants (T1, T2, T3) showed normal growthand no pleiotropic effects. Transgenic chloroplast thylakoid membranes showed high integrity under osmoticstress as evidenced by retention of chlorophyll even when grown in 6% PEG whereas chloroplasts in untrans-formed plants were bleached. After 7 hr drying, chloroplast transgenic seedlings (T1, T3) successfully rehydratedwhile control plants died. There was no difference between control and transgenic plants in water loss duringdehydration but dehydrated leaves from transgenic plants (not watered for 24 days) recovered upon rehydrationturning green while control leaves dried out. These observations suggest that trehalose functions by protectingbiological membranes rather than regulating water potential. In order to prevent escape of drought tolerance traitto weeds and associated pleiotropic traits to related crops, it may be desirable to engineer crop plants for droughttolerance via the chloroplast genome instead of the nuclear genome.

Introduction

Water stress due to drought, salinity or freezing is amajor limiting factor in plant growth and develop-ment. Trehalose is a non-reducing disaccharide ofglucose and its synthesis is mediated by the trehalose-6-phosphate (T6P) synthase and trehalose-6-phos-phate phosphatase complex in Saccharomyces cerevi-siae. In S. cerevisiae, this complex consists of at least

three subunits performing either T6P synthase(TPS1), T6P phosphatase (TPS2) or regulatory activi-ties (TPS3 or TSL1, Thevelein and Hohmann (1995)and Singer and Lindquist (1998)). Trehalose is foundin diverse organisms including algae, bacteria, in-sects, yeast, fungi, animal and plants (Elbein 1974).Because of its accumulation under various stress con-ditions such as freezing, heat, salt or drought, there isgeneral consensus that trehalose protects against dam-

1Molecular Breeding 11: 113, 2003. 2003 Kluwer Academic Publishers. Printed in the Netherlands.

ages imposed by these stresses (Mackenzie et al.1988; De Vigilio et al. 1994; Sharma 1997). Treha-lose is also known to accumulate in anhydrobiotic or-ganisms that survive complete dehydration (Crowe etal. 1992), the resurrection plant (Bianchi et al. 1993)and some desiccation tolerant angiosperms (Drennanet al. 1993). Trehalose, even when present in lowconcentrations, stabilizes proteins and membranestructures under stress (Colaco et al. 1992; Iwahashiet al. 1995) because of the glass transition tempera-ture, greater flexibility and chemical stability (Colacoet al. 1995).

There have been several efforts to generate vari-ous stress resistant transgenic plants by introducinggene(s) responsible for trehalose biosynthesis, regu-lation or degradation (Holmstrom et al. 1996; God-dijn et al. 1997; Romero et al. 1997; Serrano et al.1999; Goddijn and van Dun 1999). When trehaloseaccumulation was increased in transgenic tobaccoplants by over-expression of the yeast TPS1, trehaloseaccumulation resulted in the loss of apical dominance,stunted growth, lancet shaped leaves and some steril-ity. Altered phenotype was always correlated withdrought tolerance; plants showing severe morpholog-ical alterations had the highest tolerance under stressconditions. In order to minimize the pleiotropic ef-fects observed in the nuclear transgenic plants accu-mulating trehalose, this study attempts to compart-mentalize trehalose accumulation within chloroplasts.Several toxic compounds expressed in transgenicplants have been compartmentalized in chloroplastseven through no targeting sequence was provided(During et al. 1990; Daniell and Guda 1997) indicat-ing that this organelle could be used as a repositorylike the vacuole. Also, osmoprotectants are known toaccumulate inside chloroplasts under stress condi-tions (Nuccio et al. 1999). Inhibition of trehalase ac-tivity is known to enhance trehalose accumulation inplants (Goddijn et al. 1997). Therefore, trehalose ac-cumulation in chloroplasts may be protected from tre-halase activity in the cytosol, if trehalase was absentin the chloroplast.

In addition, chloroplast transformation has severalother advantages over nuclear transformation (Bogo-rad 2000; Daniell 1999a,b,c, 2000; Daniell et al.2002). A common environmental concern about nu-clear transgenic plants is the escape of foreign genesthrough pollen or seed dispersal, thereby creating su-per weeds or causing genetic pollution among othercrops (Daniell 2002). These are serious environmen-tal concerns, especially when plants are genetically

engineered for drought tolerance, because of the pos-sibility of creating robust drought tolerant weeds andpassing on undesired pleiotropic traits to relatedcrops. Chloroplast transformation should also over-come some of the disadvantages of nuclear transfor-mation that result in lower levels of foreign gene ex-pression, such as gene suppression by positionaleffect or gene silencing (Finnegan and McElroy1994).

Chloroplast genetic engineering has been success-fully employed to address aforementioned concerns.For example, chloroplast transgenic plants expressedvery high level of insect resistance (McBride et al.1995), due to expression of 10,000 copies of foreigngenes per cell, thereby overcoming the problem ofresistant insects observed in nuclear transgenic plants(Kota et al. 1999) or offering protection to non-targetinsects (De Cosa et al. 2001). Similarly, chloroplastderived herbicide resistance overcomes out-crossproblems of nuclear transgenic plants because of ma-ternal inheritance of plastid genomes (Daniell et al.1998; Scott and Wilkinson 1999). Recently, the chlo-roplast genome has been engineered with an antimi-crobial peptide to confer resistance against phyto-pathogenic bacteria and fungi (DeGray et al. 2001).Availability of tools to engineer the chloroplast ge-nome without the use of antibiotic selection (Daniellet al. 2001a,b) or excise antibiotic resistance genesafter the completion of selection process (Iamthamand Day 2000), provide additional incentives for ex-pression of foreign genes in this cellular compart-ment. Transgenic chloroplast technology has beenused to express pharmaceutical proteins or edible vac-cines in plants (Daniell et al. 2001c,d; Fernandez-SanMillan et al. 2003). This study has been undertakento extend the chloroplast genetic engineering technol-ogy to study abiotic stress and compare chloroplast/nuclear expression of TPS1 in transgenic plants. Thisshould shed light on the role of trehalose in stabiliz-ing membranes or conferring osmotolerance withinchloroplasts.

Materials and methods

Tobacco, A. tumefaciens and E. coli culture

For transformation experiments, Nicotiana tabacumvar. xanthi and Burley were grown in MS medium inthe Magenta culture box (Sigma, USA). For droughttolerance assays of transgenic tobacco plants, the

2

rooted young plants were transferred to pre-swollenJiffy-7 peat pellets (Jiffy Products, Norway) inside thegreenhouse. Plants used for enzyme assays weregrown and kept in Magenta culture boxes. Seven or 8leaf stage plants were used for enzyme assays. Twoto three-week old young transgenic tobacco plantswere used for stress analyses. Agrobacterium tumefa-ciens strain LBA4404 was grown in the YEP mediumat 29 C in a shaking incubator. Other E. coli strainswere cultured and maintained as described in Sam-brook et al. (1989).

Plasmid construction and antibody production

For hyper-expression of the TPS1 in E. coli for anti-body production, the yeast TPS1 gene was cloned intoplasmid pQE30 (Qiagen) as a BamHI fragment withN-terminal poly-histidine tag (as an EcoRI-BamHIfragment) and subsequently transformed into E. colistrain M15 [pREP4]. The resulting E. coli transfor-mant was grown at 37 C to an A600 of 0.50.8 andinduced by 2 mM isopropyl--D-thiogalactopyrano-side (IPTG) for 15 hrs. The induced cells wereharvested and homogenized by sonication. SDS-PAGE analysis showed the presence of TPS1 proteinin crude cell extracts, even with Coomassie Bluestain, indicating high levels of expression. Westernblot analysis using TPS1 antibody confirmed the trueidentity of the expressed protein (data not shown).The recombinant protein was purified using Ni2+resin, using the procedures provided by the manufac-turer. Affinity column purified recombinant proteinwas analyzed for purity by SDS-PAGE. Protein con-centrations were determined using the Bio-Rad(USA) protein assay kit with BSA as a standard. Poly-clonal antibody was generated using the purifiedTPS1 protein by the Takara Shuzo Co. (Japan).

Vector construction for plant transformation

The yeast 1.57 kbp TPS1 gene was inserted into theXbaI site of pCt vector generating pCt-TPS1 (Figure1B). For the nuclear transformation, the yeast TPS1gene was inserted into the pHGTPS1 vector in whichthe TPS1 gene is driven by the CaMV 35S promoter.The resulting vector confers hygromycin resistancebecause of the hygromycin phosphotransferase genedriven by the NOS promoter.

Chloroplast and nuclear transformation

For chloroplast transformation, particle bombardmentwas carried out using a helium driven particle gun,Biolistic PDS-1000He. Briefly, chloroplast vectors,pCt and pCt-TPS1 were delivered to tobacco leaves(Burley) using 0.6 m gold microcarriers (Bio-Rad)at 1,100 psi with a target distance of 9 cm (Daniell1997). For nuclear transformation, pHGTPS1 wasmobilized into the Agrobacterium tumefaciens strainLBA4404 by electroporation using Gene Pulsar (Bio-Rad, USA). The resulting Agrobacterium strain wasused in leaf disc transformation of wild type N.tabacum var. xanthi.

Chloroplast DNA isolation and PCR

Total DNA was extracted from leaves of wild typeand transformed plants using CTAB extraction bufferdescribed by Dellaporta et al. (1983). PCR was car-ried out to confirm spectinomycin resistant chloro-plast transformants using Peltier Thermal CyclerPTC-200 (MJ Research, USA). Three primer sets, 2P(5-GCGCCTGACCCTGAGATGTGGATCAT-3)-2M (5-TGACTG CCCAACCTGAGAGCG GACA-3), 3P(AAAACCCGTCCTCAGTTCGGATT GC)-3M (CCGCGTTGTTTCATCAAGCCTTACG) and5P(CTGTAGAAGTCACCATTGTTGTG C)-5M(GTCCAAGATAAGCCTGTCTAGCTTC) wereused for the PCR. PCR reactions were carried out asdescribed elsewhere (Daniell et al. 1998; Guda et al.2000).

RNA isolation and Northern Blot analysis

Total RNA was extracted from transgenic tobaccoplants using Tri Reagent (MRC, USA) followingmanufacturers instruction. For northern blots, RNAsamples (10 g of total RNA per lane) were electro-phoresed on a 1.5% agarose-MOPS gel containingformaldehyde. Uniform loading and integrity ofRNAs were confirmed by examining the intensity ofethidium bromide bound ribosomal RNA bands un-der UV light. RNAs on the gel were transferred ontoHybond-N membrane (Amersham, USA). The mem-brane was hybridized to radiolabeled TPS1 probe andwashed at 65 C in a solution of 0.2X SSC and 0.1%SDS for 20 min twice. The blot was exposed to anX-ray film at 70 C overnight. Transcripts werequantified using the BioID++ program with VilberLourmat Image Analyzer (Bioprofil, France).

3

Figure 1. A. Map of the nuclear expression vector pHGTPS1. B. Site of integration of foreign genes into the chloroplast genome and ex-pected fragment sizes in Southern blots. P1 is the 0.81 kbp BamHI-BglII fragment containing chloroplast DNA flanking sequences used forhomologous recombination. P2 is the 1.5 kbp XbaI Fragment containing the TPS1 coding sequence. The left flanking sequence is the chlo-roplast trnI gene (1.2 kbp) and the right flanking sequence is trnA gene (0.9 kbp). Please note that both tRNA genes contain introns. Allflanking and regulatory sequences present in the chloroplast vector were derived from the tobacco chloroplast genome. C. Southern blotanalysis of control, T1 and T3 chloroplast transgenic plants. Total plant DNA digested with BglII was hybridized with probes P1 or P2.Lanes: C, untransformed control; 1, T1 generation chloroplast transformant; 2, T3 generation chloroplast transformant.

4

Western blot analysis

Tobacco total protein extracts were prepared by mod-ified methods described by Ausubel et al. (1995). Thetotal extracts were fractionated on a 10% one-dimen-sional SDS-PAGE, transferred to Biotrace PDVF ni-trocellulose membrane (Gelman Sciences, USA), andimmunostained using Renaissance Western BlotChemiluminescence Reagent (NEN Life ScienceProducts, USA) according to manufacturers instruc-tions. Each lane was loaded with 100 g of total pro-tein. The primary antibody used was anti-TPS1 at a5000-fold dilution. The secondary antibody was anti-rabbit IgG HRP conjugate at a 2,000-fold dilution.

Drought tolerance and biochemical characterization

For analyses of drought tolerance, transgenic tobaccoplants or seedlings were used. Seeds of chloroplastand nuclear transformants were germinated on MSplates containing 3% or 6% PEG (MW 8,000, Sigma).TPS1 enzyme assay was performed using the methoddescribed by Londesbrough and Vuorio (1991). Forquantitative determination of T6P and trehalose, car-bohydrates were extracted from aerial parts of trans-genic or wild type tobacco plants by treatment in 85%ethanol at 60 C for 1 hr. The amount of T6P and tre-halose were measured by high-performance liquidchromatography (HPLC) on a Waters systemequipped with a Waters High Performance Carbohy-drate Column (4.6 250 mm) and a refractive indexdetector. The insoluble phase system was 75% aceto-nitrile-25% H2O with a flow rate of 1.0 ml/min.

Results

Expression of chloroplast vectors in E. coli

It is known that the yeast trehalose-6-phosphate syn-thase gene can be expressed well in nuclear trans-genic plants (Holmstrom et al. 1996; Romero et al.1997). Because chloroplasts are prokaryotic in nature,it would have been ideal to use bacterial genes insteadof genes from eukaryotic systems. However, the E.co-li otsA gene coding for trehalose phosphate synthasewas not available for this investigation. Therefore, theTPS1 gene from yeast was cloned into the E.coli ex-pression vector pQE30 and expressed in a suitableE.coli strain. Western blot analysis using TPS1 anti-body confirmed the true identity of the expressed pro-

tein (data not shown). These results also suggestedthat the codon preference of TPS1 is acceptable forexpression in a prokaryotic compartment. Also, be-cause of the high similarity in the transcription andtranslation systems between E. coli and chloroplasts(Brixey et al. 1997), expression vectors are routinelytested in E. coli before proceeding with chloroplasttransformation of higher plants (Kota et al. 1999;Daniell et al. 1998; Guda et al. 2000). However, thiswill not shed light on post-translational events, in-cluding proteolytic degradation that may be differentbetween E.coli and chloroplasts.

Chloroplast and nuclear expression vectors

Having confirmed suitability for prokaryotic expres-sion, the yeast TPS1 gene was inserted into the uni-versal chloroplast expression vector pCt-TPS1 (Fig-ure 1B). This vector can be used to transformchloroplast genomes of several plant species becausethe flanking sequences are highly conserved amonghigher plants (Daniell et al. 1998; Guda et al. 2000).This vector contains the 16SrRNA promoter (Prrn)from the tobacco chloroplast genome driving theaadA (aminoglycoside 3- adenylyl transferase) andTPS1 genes with the psbA 3 region (the terminatorfrom a gene coding for photosystem II reaction cen-ter component) from the tobacco chloroplast genome.It is known that the 16SrRNA promoter is one of thestrong chloroplast promoters and the psbA 3 regionstabilizes transcripts. In order to avoid hyper-expres-sion of TPS1 and associated pleiotropic effects, theoptimal chloroplast ribosome binding site (GGAGG)was not engineered upstream of the start codon. Thisconstruct integrates both genes into the spacer regionbetween the chloroplast transfer RNA genes codingfor alanine and isoleucine within the inverted repeat(IR) region of the tobacco chloroplast genome by ho-mologous recombination. For nuclear expression, theyeast TPS1 gene was inserted into the binary vectorpHGTPS1 (Figure 1A), in which the TPS1 gene isdriven by the CaMV 35S promoter and the hph geneis driven by the nopaline synthase promoter. The ex-pression cassette is flanked by both the left and rightT-DNA border sequences.

The binary vector pHGTPS1 was mobilized intothe Agrobacterium tumafaciens strain LBA 4404 byelectroporation. Transformed Agrobacterium strainwas introduced into Nicotiana tabacum var. xanthiusing the leaf disc transformation method. Ninety twoindependent TPS1 nuclear transgenic lines were ob-

5

tained on hygromycin selection. Seventeen confirmednuclear transformants were analyzed by northernblots. Among transformants showing various levels oftranscripts, five transformants with strong, moderate,weak, very weak and absence of transcripts were cho-sen for further characterization.

For chloroplast transformation, green leaves of N.tabacum var. Burley were transformed with the chlo-roplast integration and expression vector by the bi-olistic process (Daniell 1997). Bombarded leaf seg-ments were selected on spectinomycin/streptomycinselection medium. Integration of foreign gene into thechloroplast genome was determined by PCR screen-ing of chloroplast transformants (data not shown).Primers were designed to eliminate mutants, nuclearintegration and to determine whether the integrationof foreign genes had occurred in the chloroplast ge-nome at the directed site by homologous recombina-tion. Primers 5P/5M land within the aadA gene andshould generate a 0.4 kbp fragment if the aadA genewas present in transgenic plants and eliminates thepossibility of mutation that could otherwise conferstreptomycin/spectinomycin resistance. The presenceof 0.4 kbp PCR product in plants transformed withthe universal vector alone (pCt) or the universal vec-tor containing the TPS1 gene (pCt-TPS1), but not incontrol untransformed plants (data not shown), con-firmed that these were transgenic plants and not mu-tants. The strategy to distinguish between nuclear andchloroplast transgenic plants was to land one primer(3P) on the native chloroplast genome adjacent to thepoint of integration and the second primer (3M) onthe aadA gene. This primer set generated 1.6 kbpPCR product in chloroplast transformants obtainedwith the universal vector (pCt) and the universal vec-tor containing the TPS1 gene (pCt-TPS1). Becausethis product can not be obtained in nuclear transgenicplants, the possibility of nuclear integration can beeliminated. Another primer set was designed to testintegration of the entire gene cassette. Primer 5Plands on the aadA gene and 2M lands on the trnAgene flanking the insert. This primer should generate3.1 kbp PCR product in the transgenic chloroplastgenome if the entire gene cassette was integrated. Thepresence of the expected size (3.1 kbp) PCR productusing 5P/2M primers from transgenic chloroplast ge-nomes confirmed that the entire gene cassette hasbeen integrated and that there were no deletions dur-ing integration via homologous recombination.

Determination of chloroplast integration,homoplasmy and copy number

Since there are no significant differences in the levelof foreign gene expression among different chloro-plast transgenic lines, one line was chosen to gener-ate subsequent generations (T1, T2, T3). Southern blotanalysis was performed using total DNA isolatedfrom transgenic and wild type tobacco leaves. TotalDNA was digested with a suitable restriction enzyme.Presence of a BglII at the 3 end of the flanking 16Sr-RNA gene and the trnA intron allowed excision ofpredicted size fragments in the chloroplast transfor-mants and untransformed plants. To confirm foreigngene integration and homoplasmy, individual blotswere probed with the chloroplast DNA flanking se-quence (probe P1, Figure 1B). In the case of the TPS1integrated plastid transformants (T1,T3), the bordersequence hybridized with 6.13 and 1.17 kbp frag-ments while it hybridized with a native 4.47 kbp frag-ment in the untransformed plants (Figure 1C). Thecopy number of the integrated TPS1 gene was alsodetermined by establishing homoplasmy in transgenicplants. Tobacco chloroplasts contain about 10,000copies of chloroplast genomes per cell. If only a frac-tion of the genomes was transformed, the copy num-ber should be less than 10,000. By confirming that theTPS1 integrated genome is the only one present intransgenic plants, one could establish that the TPS1gene copy number could be as many as 10,000 percell.

DNA gel blots were also probed with the TPS1gene coding sequence (probe P2) to confirm integra-tion into the chloroplast genomes. In chloroplasttransgenic plants (T1,T3), the TPS1 gene coding se-quence hybridized with 6.13 and 1.17 kbp fragmentswhich also hybridized with the border sequence inplastid transgenic lines (Figure 1C). This confirmsthat the tobacco transformants indeed integrated theintact gene expression cassette into the chloroplastgenome and that there has been no internal deletionsor loop out during integration via homologous recom-bination.

Analysis of transcript level in nuclear andchloroplast transformants

For comparison of introduced gene expression be-tween chloroplast and nuclear transformants, northernblot analysis of transgenic tobacco at similar devel-opmental stages was performed in T0, T1 and T2

6

plants. As shown in Figure 2, quantification of tran-scription level showed that the chloroplast transfor-mant (T2) expressed 169-fold (Figure 2E, lane 5)more TPS1 transcript than the best surviving nuclear(T1) transformant (Figure 2E, lanes 2, 3). Similar re-sults were obtained when T1 chloroplast (Figure 2B,lane 7) and T0 nuclear transgenic plants (Figure 2B,lanes 25) were compared. This large difference inTPS1 expression between nuclear and chloroplasttransgenic plants should be due to the presence ofthousands of TPS1 gene copies in each cell of trans-genic tobacco. Figure (2C, 2F) shows ethidium bro-mide stained RNA gels before blotting; this confirmsthat equal amount of RNA (10 g) was loaded in alllanes. It is remarkable that the 16SrRNA promoter isdriving both genes very efficiently, eliminating theneed for inserting additional promoters upstream ofthe gene of interest.

Figure 2E shows a full length autoradiogram inwhich monocistron, dicistron and polycistrons ofTPS1 are observed from transgenic chloroplast ge-nomes. Two 16SrRNA promoters drive transcriptionresulting in dicistrons and polycistrons (Figure 2B,2E, 2G). Nuclear TPS1 monocistron (1,750 nt) isslightly longer than chloroplast TPS1 monocistron(1,600 nt), because of the addition of poly A at 3 end.Presence of TPS1 monocistron in transgenic chloro-plast (Figure 2B, 2E, 2G) demonstrates RNA process-ing between aadA and TPS1, even though no specificintergenic sequences or 3 processing signals wereengineered downstream of the aadA gene. We rou-tinely observe monocistrons in transgenic chloro-plasts without such engineered sequences (Guda et al.2000; DeGray et al. 2001). This is in contrast to spe-cific DNA sequence or secondary srtucture require-ments for transcript processing reported in the litera-ture (Monde et al. 2000; Liere and Link 1997).However, the predominant transcripts are dicistronsand polycistrons which are efficiently translated with-out any need for processing in transgenic chloro-plasts. This is again in contrast to previous in vitrostudies in which processing was an absolute require-ment for translation of chloroplast genes (Barkan etal. 1994; Hirose and Sugiura 1996; Barkan and Gold-schmidt-Clermont 2000).

Western blot analysis of nuclear and chloroplasttransformants

Polyclonal antibodies raised against the TPS1 proteinoverexpressed and purified from E. coli (see experi-

mental protocol) was used for immunoblotting (Fig-ure 2A, 2D). A 56 kDa TPS1 polypeptide was de-tected in the T0 nuclear (Figure 2A, lanes 2, 3, 5), T1nuclear (Figure 2D lanes 2, 3) and T1 plastid (Figure2A, lane 7) and T2 plastid (Figure 2D, lane 5) trans-formants. However, no TPS1 was detected in the un-transformed control (Figure 2A, lanes 1, 6; 2D 1, 4))and transgenic plants which showed no TPS1 tran-script (Figure 2A, lane 4). As anticipated, westernblots showed only a five or ten fold increase in TPS1protein in chloroplast over the best surviving nucleartransgenic plants. This is because of the fact that thechloroplast vector pCt-TPS1 was designed to lowertranslation by not engineering an optimal chloroplastRBS (GGAGG) 5 nucleotides upstream of ATG, sothat transgenic plants are not affected by hyper-ex-pression of TPS1. AAG is a sub-optimal RBS (oneamong the three RBS predicted for the psbA gene,Eibl et al. (1999)). However, this is at position -13instead of the optimal distance of -5 from AUG. Asanticipated, this level of expression was adequate tocompare trehalose accumulation in cytosolic andchloroplast compartments and study resultant pheno-typic/physiological changes. It should be noted thatT1 nuclear and T2 chloroplast transgenic plants hadhigher levels of TPS1 protein; this may be due to ho-mozygous TPS1 alleles or homoplasmy.

Quantification of trehalose-6-phosphate andtrehalose in transformants

Trehalose formation is a two step process, involvingtrehalose-6-phosphate synthase and trehalose 6-phos-phate phosphatase. Trehalose-6-phosphate was notdetected in all tested chloroplast and nuclear transfor-mants even though the TPS2, trehalose-6-phosphatephosphatase that converts T6P to trehalose, was notintroduced (Table 1). Conversion of T6P to trehaloseshould have been accomplished by endogenous to-bacco trehalose phosphatase or by any non-specificendogenous phosphatase. Simultaneous expression ofboth enzymes in transgenic plants resulted only inmarginal increase of trehalose accumulation in previ-ous studies (Goddijn et al. 1997), confirming that it isadequate to express only TPS1. Leaf extracts fromboth nuclear and chloroplast transgenic plants cata-lyzed the synthesis of trehalose 6-phosphate from glu-cose-6-phosphate and UDP-glucose whereas untrans-formed tobacco had very low activity. T0 chloroplastand nuclear transgenic plants showed a 710 foldhigher TPS1 activity than untransformed control

7

Figure 2. Northern and western blot analyses of control, nuclear and chloroplast transgenic plants. A, D: Western blots detected throughchemiluminescence (100 g total protein per lane). B, E: Northern blots detected using 32P TPS1 probe. C, F: Ethidium bromide stainedRNA gel before blotting (10 g total RNA loaded per lane). Panel A, B, C: T0 nuclear and T1 chloroplast transgenic plants. Lanes: 1. N. t.xanthi control; 25: T0 nuclear transgenic plants. 2, X-113; 3. X-119; 4. X-121; 5. X-224; 6: N.t. Burley control; 7: chloroplast transgenicplant (T1). Panel D, E, F: T1 nuclear and T2 chloroplast transgenic plants. Lanes: 1. N. t xanthi control; 2, 3: T1 nuclear transgenic plants 2,X-113; 3.X-119; 4: N.t. Burley control; 5: chloroplast transgenic plant (T2). Panel G: expected transcript sizes of chloroplast transformants.

8

plants. The amount of trehalose present in untrans-formed control plants and T0 nuclear transgenicplants were similar whereas chloroplast transgenicplants accumulated a 1725 fold more trehalose thanthe best surviving nuclear transgenic plants (Table 1).T1 nuclear transgenic plants accumulated less treha-lose than control untransformed plants whereas T1chloroplast transgenic plants continued to accumulatehigh levels of trehalose (Table 1). Observation ofcomparable TPS1 activity in both nuclear and chlo-roplast transgenic plants but lack of trehalose accu-mulation in nuclear transgenic plants indicates thattrehalose may be degraded in the cytosol by trehalasebut not in the chloroplast compartment. Our observa-tion is consistent with a previous study on inhibitionof trehalase activity that resulted in trehalose accumu-lation in the cytosol (Goddijn et al. 1997). However,alternate explanations, including conditions favorablefor trehalose biosynthesis are under investigation.

Drought tolerance and pleiotropic effects

Chloroplast and nuclear transformants were examinedfor drought tolerance and pleiotropic effects. After sixweeks of growth in vitro, rooted shoots were trans-ferred to pots and grown in the greenhouse. TPS1nuclear transformants showed moderate to severegrowth retardation, lancet-shaped leaves and infertil-ity (Figure 3). The chloroplast transformants (T0)showed slightly decreased growth rate and delayedflowering (given the limitations of comparing in vitro

growth on antibiotics with potted control plants) butall subsequent generations (T1,T2,T 3) showed simi-lar growth rates and fertility as controls (Figure 3).The nuclear transgenic lines of stunted phenotypeshowed delayed flowering and produced fewer seeds(often non-viable) compared to wild type or did notflower. The nuclear transgenic line showing severegrowth retardation did not flower. This result is con-sistent with prior observations which demonstratedthat E. coli otsA (TPS1, Goddijn et al. (1997)) and S.cerevisiae TPS1 (Romero et al. 1997) transgenicplants exhibited stunted plant growth and other pleio-tropic effects. T1 nuclear transgenic plants that sur-vived showed no growth retardation and trehalose ac-cumulation. Therefore, these plants could not be usedfor appropriate comparison with chloroplast trans-genic plants for drought tolerance studies. When wildtype and transgenic seeds were germinated on MSmedium containing spectinomycin, all chloroplasttransgenic progeny (T1, T2, T3) were spectinomycinresistant while wild type seedlings were sensitive tospectinomycin (data not shown).

Because TPS1 chloroplast transgenic lines showedsignificant accumulation of trehalose, they weretested for drought tolerance characteristics and under-standing the role of trehalose within transgenic chlo-roplasts. Seeds of chloroplast transgenic plants weregerminated on the MS medium containing polyethyl-ene glycol. As shown in Figure 4A, chloroplast trans-genic seedlings grew in medium containing 3% and6% PEG, whereas control seedlings exhibited severedehydration, loss of chlorophyll and growth retarda-tion, ultimately resulting in death. Loss of chlorophyllin untransformed control plants confirms breakdownof thylakoid membranes within chloroplasts due toosmotic stress induced by PEG. Trehalose is knownto protect membranes under severe stress, even whenpresent in small quantities (Colaco et al. 1992; Iwa-hashi et al. 1995). Presence of chlorophyll in trans-genic chloroplasts confirms integrity of thylakoidmembranes, even in the presence of high concentra-tions of PEG (Figure 4A), strikingly demonstratingthe advantage of trehalose accumulation within trans-genic chloroplasts.

Dehydration and subsequent rehydration of three-week-old seedlings were done exactly as described byHolmstrom et al. (1996). When seedlings were driedfor 7 hours at room temperature in 50% relative hu-midity, they were all affected by dehydration. How-ever, when dehydrated seedlings were rehydrated for48 hours in MS medium, all chloroplast transgenic

Table 1. Analysis of T6P and trehalose, and TPS1 activity in con-trol, nuclear and chloroplast transgenic tobacco plants.

Transformant T6P (g/gfreshweight)

Trehalose(g/g freshweight)

TPS1 activ-ity (U*/mgprotein)

T0 GenerationCt-TPS1(B) 0.00 361.7 5.0Nu-TPS1(x-119) 0.00 23.3 4.4Nu-TPS1(x-113) 0.00 15.0 3.5Control 0.00 17.1 0.5T1 GenerationCt-TPS1 (B) 0.00 444.2 ndNu-TPS1(x-119) 0.00 17.6 ndNu-TPS1(x-113) 0.00 16.3 ndControl 0.00 21.6 nd

*Unit: The amount of enzyme producing 1 mole product per minin the respective standard assay is 1 U. nd, not determined

9

lines recovered while all control seedlings werebleached (Figure 4B). Even the couple of controlseedlings that partly survived (because of uneven dry-ing of seedlings on filter papers) eventually died.These results suggest that trehalose accumulationwithin transgenic chloroplasts protects them from ly-sis during dehydration and enables their subsequentrecovery. This is consistent with existing understand-ing that trehalose functions by protecting biologicalmembranes rather than regulating water potential(Iwahashi et al. 1995).

Mature leaves from fully-grown plants were testedfor their ability to regulate water loss under drought

conditions. When detached leaves were air dried, con-trol and chloroplast transgenic plants lost water to thesame extent (data not shown). Control and chloroplasttransgenic potted plants were not watered for 24 days.Again, both showed dehydration to the same extent(Figure 5A, 5B). However, upon rehydration, fullydehydrated leaves (indicated by arrows, Figure 5C,5D) recovered in chloroplast transgenic plants but notin controls. Again, these experiments confirm theability of trehalose to protect transgenic chloroplasts.Unfortunately, these experiments could not be donein fully grown plants because trehalose accumulationvaried based on leaf age, development and senes-

Figure 3. Nuclear and chloroplast transgenic plants to illustrate pleiotropic effects. 1. N. t xanthi control; 25: T0 nuclear transgenic plants2, X-113; 3.X-121; 4. X-119; 5. X-224; 6, T1 chloroplast transgenic plant; 7, N. t. Burley control.

Figure 4. Assays for drought tolerance. Four week old seedlings on MS medium containing 3% (A, B) or 6% (C, D) polyethylene glycol(MW 8,000). A, C: Control untransformed N.t. Burley. B, D: T1 Chloroplast transgenic plants. E, F. Dehydration/rehydration assay. Three-week old seedlings germinated on agarose in the absence (control) or presence of spectinomycin (transgenic, 500 g/ml) were air-dried atroom temperature in 50% relative humidity. After 7 hrs drying, seedlings were rehydrated for 48 hrs by placing roots in MS medium. C,untransformed; T1 and T2 chloroplast transgenic lines.

10

cence, due to significant difference in chloroplast ge-nome copy number. Such variation in levels of for-eign proteins within transgenic chloroplasts (100-fold) has been reported previously (Daniell et al.2001a; De Cosa et al. 2001; Daniell et al. 2001d; Si-dorov et al. 1999). Other physiological variationswithin transgenic plants complicated the experimen-tal outcome and interpretation. While it is evident thateach of the methodologies (used in prior studies toasses drought tolerance), has positive aspects anddrawbacks, collectively they establish the ability oftrehalose to protect transgenic chloroplasts fromdrought stress without causing any harm to the plant.

Discussion

This study attempted to investigate the effect of tre-halose accumulation within chloroplasts and cytosol,conferred by the yeast TPS1 engineered via the chlo-roplast or nuclear genomes. An alternate approachwould have been to target the trehalose phosphatesynthase enzyme from the cytosol into chloroplasts,as a nuclear gene product. This approach was notpursued because it was not known whether trehalosephosphate synthase was catalytically active when thetransit peptide was present, as several other enzymestargeted to chloroplasts (e.g. the EPSP synthase,Daniell et al. (1998)). This would have made the in-terpretation of observed results more difficult, in ad-dition to complications of the position effect and genesilencing frequently observed in the nuclear trans-genic plants and the presence of trehalase in the cy-tosol.

This study shows that accumulation of smallerquantities of trehalose may be adequate to protectchloroplasts from drought stress. Larger quantities oftrehalose accumulation may be needed for commer-

cial applications of trehalose. For example, trehaloseis added during dehydration of fruits and herbs topreserve color and aroma (Roser and Colaco 1993).However, such commercial application of trehalose isseverely limited because of its cost (about $300/kg).Therefore, trehalose is primarily used now in thepharmaceutical industry. Currently, trehalose is pro-duced in yeast where accumulation is severely lim-ited by trehalase (Goddijn et al. 1997). Investigationsshould be done to enhance trehalose accumulationwithin transgenic chloroplasts, because of its non-tox-icity in this compartment. For such studies, it may benecessary to engineer the bacterial two gene operon,including the trehalose 6-phosphate phosphatase withUTRs for optimal expression and maximal accumu-lation of trehalose within chloroplasts. Expression ofbacterial operons within transgenic chloroplasts isnow possible (De Cosa et al. 2001; Daniell and Dh-ingra 2002). Characterization of such transgenicplants should shed light on the mechanism of stresstolerance.

It is quite evident from this study that trehaloseaccumulation within chloroplasts did not confer os-motic stress tolerance. Several lines of evidence pointout that trehalose confers membrane protection, espe-cially for thylakoid membranes. Control and trans-genic plants lost water to the same extent, demon-strating that trehalose is unable to regulate waterpotential (loss) and therefore does not act as an os-moprotectant. Instead, trehalose enables dehydratedleaves to recover by protecting membranes. Protec-tion of membranes offered by trehalose need not belimited to thylakoids within chloroplasts. Protectionof plasma membrane or other cellular components toprevent cell collapse may be entirely possible by ly-sis of transgenic chloroplasts during dehydration torelease trehalose into the cytosol. Indeed, such releaseof high concentrations of an antimicrobial peptide

Figure 5. Dehydration and rehydration of potted plants. Potted plants were not watered for 24 days and rehydrated for 24 hours. Arrowsindicate fully dried leaves that either recovered or did not recover from dehydration. A, C: Control untransformed; B, D: chloroplast trans-genic plants.

11

from transgenic chloroplasts into the cytosol resultedin preventing subsequent spread of bacterial or fun-gal pathogens (DeGray et al. 2001).

Previous studies have also shown that the mecha-nism of improved performance of trehalose synthe-sizing plants in drought tolerance may not be due toregulation of water potential (Goddijn and van Dun1999). Dramatic effect on growth, even with very lowlevels of trehalose accumulation suggests a greaterrole in cellular metabolism and regulation. It is pos-sible to alleviate most of the pleiotropic effects (suchas sterility, stunted growth etc.) by engineering via thechloroplast genome. This study opens the door to en-gineer drought tolerant plants via the chloroplast ge-nome, using other genes, especially those that codefor osmoprotectants. Additionally, biological contain-ment of introduced genes may be vital to prevent thegeneration of drought resistant weeds and transfer ofassociated undesirable pleiotropic traits to relatedcrops (Daniell 2002).

References

Ausubel F., Brent R., Kingston R.E., Moore D.D., Sediman J.G.,Smith J.A. et al. 1995. Short Protocols in Molecular Biology.Wiley and Sons, Inc., USA.

Barkan A. and Goldschmidt-Clermont M. 2000. Nuclear participa-tion in chloroplast expression. Biochimie. 82: 559572.

Barkan A., Walker M., Nolasco M. and Johnson D. 1994. A nuclearmutation in maize blocks the processing and translation of sev-eral chloroplast mRNAs and provides evidence for differentialtranslation of alternative mRNA forms. EMBO J. 13: 31703181.

Bianchi G., Gamba A. and Limiroli R. 1993. The unusual sugarcomposition in leaves of the resurrection plant Myrothamnusflabellifolia. Physiol Plantarum 87: 223226.

Bogorad L. 2000. Engineering chloroplasts: an alternative site forforeign genes, proteins, reactions and products. Trends in Bio-technology 18: 257263.

Brixey P.J., Guda C. and Daniell H. 1997. The chloroplast psbApromoter is more efficient in E.coli than the T7 promoter forhyper-expression of a foreign protein. Biotechnology letters 19:395399.

Colaco C., Sen S., Thangavelu M., Pinder S. and Roser B. 1992.Extraordinary stability of enzymes dried in trehalose: simpli-fied molecular biology. Bio/technology 10: 10071011.

Colaco K., Kampinga J. and Roser B. 1995. Amorphous stabilityand trehalose. Science 268: 788789.

Crowe J.H., Hoekstra F.A. and Crowe L.M. 1992. Anhydrobiosys.Annu. Rev. Physiol. 54: 579599.

Daniell H. 1997. Transformation and foreign gene expression inplants mediated by microprojectile bombardment. Meth. Mol.Biol. 62: 453488.

Daniell H. 1999a. New tools for chloroplast genetic engineering.Nature Biotechnol. 17: 855856.

Daniell H. 1999b. GM crops: Public perception and scientific so-lutions. Trends in Plant Science 4: 467469.

Daniell H. 1999c. Environmentally friendly approaches to geneticengineering. In vitro Cellular and Developmental Biology-Plant35: 361368.

Daniell H. 2000. Genetically modified food crops: current concernsand solutions for the next generation crops. Biotechnology andGenetic Engineering Reviews 17: 327352.

Daniell H. 2002. Molecular strategies for gene containment intransgenic crops. Nature Biotechnol. 20: 581586.

Daniell H. and Dhingra A. 2002. Multiple gene engineering: dawnof an exciting new era in biotechnology. Current Opinion inBiotechnology 13: 136141.

Daniell H. and Guda C. 1997. Biopolymer production in microor-ganisms and plants. Chemistry and Industry 14: 555560.

Daniell H., Data R., Varma S., Gray S. and Lee S.B. 1998. Con-tainment of herbicide resistance through genetic engineering ofthe chloroplast genome. Nature Biotechnol. 16: 345348.

Daniell H., Muthukumar B. and Lee S.B. 2001a. Marker free trans-genic plants: engineering the chloroplast genome without theuse of antibiotic selection. Current Genetics 39: 109116.

Daniell H., Wiebe P.O. and Fernandez-San Millan A. 2001b. Anti-biotic free chloroplast genetic engineering an environmen-tally friendly approach. Trends in Plant Science 6: 237239.

Daniell H., Streafield S.J. and Wycoff K. 2001c. Medical molecu-lar farming: production of antibodies, biopharmaceuticals andedible vaccines in plants. Trends Plant Science 6: 219226.

Daniell H., Lee S.B., Panchal T. and Wiebe P.O. 2001d. Expres-sion of cholera toxin B subunit oligomers in transgenic tobaccochloroplasts. Journal of Molecular Biology 311: 10011009.

Daniell H., Khan M.S. and Allison L. 2002. Milestones in chloro-plast genetic engineering: an environmentally friendly era inbiotechnology. Trends in Plant Science 7: 8491.

De Cosa B., Moar W., Lee S.B., Miller M. and Daniell H. 2001.Hyper-expression of Bt Cry2Aa2 operon in chloroplast leads toformation of insecticidal crystals. Nature Biotechnol. 19: 7174.

De Vigilio C., Hottinger T., Dominguez J., Boller T. and WiekmanA. 1994. The role of trehalose synthesis for the acquisition ofthermotolerance in yeast I. Genetic evidence that trehalose is athermoprotectant. Eur. J. Biochem. 219: 179186.

DeGray G., Smith F., Sanford J., Rajasekaran K. and Daniell H.2001. Expression of an antimicrobial peptide via the chloroplastgenome to control phytopathogenic bacteria. Plant Physiol.127: 852862.

Dellaporta S.L., Wood J. and Hicks J.B. 1983. A plant DNA mini-preparation: Version II. Plant Mol. Biol. Rep. 1: 19.

Drennan P.M., Smith M.T., Goldsworthy D. and Van Staden J.1993. The occurrence of trehalose in the leaves of the desicca-tion-tolerant angiosperm Myrothamnus flabellifolius Welw. J.Plant Physiol. 142: 493496.

During K., Hippe S., Kreuzaler F. and Schell J. 1990. Synthesisand self-assembly of a functional monoclonal antibody in trans-genic Nicotiana tabacum. Plant Molecular Biology 15: 281293.

Eibl C., Zou Z., Beck A., Kim M., Mullet J. and Koop U.H. 1999.In vivo analysis of psbA rbcL and rpl32 UTR elements by

12

chloroplast transformation: tobacco plastid gene expression iscontrolled by modulation of transcript levels and translation ef-ficiency. Plant J. 19: 333345.

Elbein A.D. 1974. The metabolism of, -trehalose. Adv. Carbohyd.Chem. Biochem. 30: 227256.

Finnegan J. and McElroy D. 1994. Transgene Inactivation: Plantsfight back. Biotechnology 12: 883888.

Fernandez-San Millan A., Mingeo-Castel A., Miller M. and DaniellH. 2003. A chloroplast transgenic approach to hyper-expressand purify Human Serum Albumin, a protein highly susceptibleto proteolytic degradation. Plant Biotechnology Journal (inpress).

Goddijn O.J.M. and van Dun K. 1999. Trehalose metabolism inplants. Trends in Plant Science 4: 315319.

Goddijn O.J.M., Verwoerd T.C., Voogd E., Krutwagen W.H.H., deGraff P.T.H.M., Poels J. et al. 1997. Inhibition of trehalase ac-tivity enhances trehalose accumulation in transgenic plants.Plant Physiol 113: 181190.

Guda G., Lee S.B. and Daniell H. 2000. Stable expression of abiodegradable protein-based polymer in tobacco chloroplasts.Plant Cell Reports 18: 257262.

Hirose T. and Sugiura M. 1996. Cis acting elements and trans act-ing factors for accurate translation of chloroplast psbA mRNAs:development of an in vitro translation system from tobaccochloroplasts. EMBO J. 15: 16871695.

Holmstrom K.O., Mantyla M., Wekin B., Mandal A., Palva E.T.,Tunnela O.E. et al. 1996. Drought tolerance in tobacco. Nature379: 683684.

Iamtham S. and Day A. 2000. Removal of antibiotic resistancegenes from transgenic tobacco plastids. Nature Biotechnol. 18:11721176.

Iwahashi H., Obuchi K., Fujii S. and Komatsu Y. 1995. The cor-relative evidence suggesting that trehalose stabilizes mem-brane-structure in the yeast Saccharomyces cerevisiae. CellMol. Biol. 41: 763769.

Kota M., Daniell H., Varma S., Garcynski F., Gould F. and MoarW.J. 1999. Overexpression of Bacillus thuringiensis Cry2Aprotein in chloroplasts confers resistance to plants against sus-ceptible and Bt resistant insects. Proc. Natl. Acad. Sci. USA 96:18401845.

Liere K. and Link G. 1997. Chloroplast endoribonuclease p54 in-volved in RNA 3 end processing is regulated by phosphoryla-tion and redox state. Nucleic Acid Research 12: 24032408.

Londesbrough J. and Vuorio O. 1991. Trehalose-6-phosphate syn-thase/phosphatase complex from bakers yeast: purification ofa protelytically activated form. J. Gen. Microbiology 137: 323330.

Mackenzie K.F., Singh K.K. and Brown A.D. 1988. Water stressplating hypersensitivity of yeast: protective role of trehalose inSaccharomyces cerevisiae. J. Gen. Microbiology 134: 16611666.

McBride K.E., Svab Z., Schaaf D.J., Hogen P.S., Stalker D.M. andMaliga P. 1995. Amplication of a chimeric Bacillus gene inchloroplasts leads to extraodinary level of an insecticidal pro-tein in tobacco. Bio/technology 13: 362365.

Monde R.A., Schuster G. and Stern D.B. 2000. Processing anddegradation of chloroplast mRNA. Biochimie. 82: 573582.

Nuccio M.L., Rhodes D., McNeil S.D. and Hanson A.D. 1999.Metabolic engineering of plants for osmotic stress resistance.Current Opinion in Plant Biology 2: 128134.

Romero C., Belles J.M., Vaya J.L., Serrano R. and Culianez-MaciaF.A. 1997. Expression of the yeast trehalose-6-phosphate syn-thase gene in transgenic tobacco plants: pleiotropic phenotypesinclude drought tolerance. Planta. 201: 293297.

Roser B. and Colaco C. 1993. A sweeter way to fresher food. NewScientist 138: 2428.

Sambrook J., Maniatis T. and Fritsch E.J. 1989. Molecular Clon-ing: A Laboratory Manual. Cold Spring Harbor Laboratory,Cold Spring Harbor, NY, USA.

Scott S.E. and Wilkinson M.J. 1999. Low probability of chloroplastmovement from oilseed rape (Brassica napus) into wild Bras-sica rapa. Nature Biotechnol. 17: 390392.

Serrano R., Culianez-Macia F.A. and Moreno V. 1999. Genetic en-gineering of salt and drought tolerance with yeast regulatorygenes. Scientia Horticulture 78: 261269.

Sharma S.C. 1997. A possible role of trehalose in osmotoleranceand ethanol tolerance in Saccharomyces cerevisiae. FEMS Mi-crobiology Letters 152: 1115.

Sidorov V.A., Kasten D., Pang S.Z., Hajdukiewicz P.T., Staub J.M.and Nehra N.S. 1999. Potato plastid transformation: high ex-pression of green fluorescent protein in chloroplasts. Plant J.19: 209216.

Singer M.A. and Lindquist S. 1998. Thermotolerance in Saccharo-myces cerevisiae: the Yin and Yang of trehalose. Trends in Bio-tech. 16: 460468.

Thevelein J.M. and Hohmann S. 1995. Trehalose synthase: guardto the gate of glycolysis in yeast? Trends in Bioscience 20:310.

13