abemaciclib is active in preclinical models of ewing ... · mal stem cells, which can lead to...

Translational Cancer Mechanisms and Therapy

Abemaciclib Is Active in Preclinical Models ofEwing Sarcoma via Multipronged Regulation ofCell Cycle, DNA Methylation, and InterferonPathway SignalingMichele Dowless1, Caitlin D. Lowery1, Terry Shackleford2, Matthew Renschler1,Jennifer Stephens1, Robert Flack1,Wayne Blosser1, Simone Gupta1, Julie Stewart1,Yue Webster1, Jack Dempsey1, Alle B. VanWye1, Philip Ebert1, Philip Iversen1,Jonathan B. Olsen1, Xueqian Gong1, Sean Buchanan1, Peter Houghton2,and Louis Stancato1

Abstract

Purpose: Ewing sarcoma (ES) is a rare and highly malig-nant cancer that occurs in the bone and surrounding tissueof children and adolescents. The EWS/ETS fusion transcrip-tion factor that drives ES pathobiology was previouslydemonstrated to modulate cyclin D1 expression. In thisstudy, we evaluated abemaciclib, a small-molecule CDK4and CDK6 (CDK4 and 6) inhibitor currently under clinicalinvestigation in pediatric solid tumors, in preclinical modelsof ES.

Experimental Design: Using Western blot, high-contentimaging, flow cytometry, ELISA, RNA sequencing, and CpGmethylation assays, we characterized the in vitro response of EScell lines to abemaciclib.We then evaluated abemaciclib in vivoin cell line–derived xenograft (CDX) and patient-derivedxenograft (PDX)mousemodels of ES as either amonotherapyor in combination with chemotherapy.

Results: Abemaciclib induced quiescence in ES cell linesvia a G1 cell-cycle block, characterized by decreased prolif-eration and reduction of Ki-67 and FOXM1 expression andretinoblastoma protein (RB) phosphorylation. In addition,abemaciclib reduced DNMT1 expression and promoted aninflammatory immune response as measured by cytokinesecretion, antigen presentation, and interferon pathwayupregulation. Single-agent abemaciclib reduced ES tumorvolume in preclinical mouse models and, when given incombination with doxorubicin or temozolomide plus irino-tecan, durable disease control was observed.

Conclusions: Collectively, our data demonstrate that theantitumor effects of abemaciclib in preclinical ES models aremultifaceted and include cell-cycle inhibition, DNA demethyl-ation, and immunogenic changes.ClinCancerRes;24(23);6028–39.�2018 AACR.

IntroductionEwing sarcoma (ES) is a rare and aggressive tumor occurring

in the bone and/or surrounding soft tissue of children andadolescents (1–3). Treatment regimens composed of surgery,radiation, and high-dose chemotherapy have improved out-comes for patients with localized disease, with a 5-year overallsurvival of 50% to 70% (4, 5). However, ES continues topresent a clinical challenge in the recurrent or metastatic diseasesetting, where the 5-year overall survival rate drops to <30%.

Furthermore, ES survivors often suffer from chronic conditionsattributed to intensive therapy (6, 7). Therefore, it is critical tofind new agents to improve patient outcomes and limit long-term side effects related to treatment.

The pathogenic biology of ES is not well understood andthus complicates the identification of potential therapeutictargets. ES is characterized by specific chromosomal trans-locations resulting in a chimeric EWS/ETS transcription factor,the most common of which is EWS/FLI1 generated by thet(11;22)(q24;q12) translocation (8, 9). Although the onco-genic EWS/FLI1 protein is thought to contribute to tumori-genesis through cell-cycle modulation (10, 11), its expressionalone is insufficient to promote tumor formation; furthermore,EWS/FLI1 is historically difficult to drug and therapeutic pur-suit of its downstream targets is the subject of much debate(12). Interestingly, ES is reported to have a high degree ofDNA methylation compared with normal human mesenchy-mal stem cells, which can lead to epigenetic silencing of keytumor suppressor genes (13, 14). There is some evidence thatEWS/FLI1 may play a role in this transcriptional epigeneticmodification (15) and, therefore, contribute to disease pro-gression through the resulting deregulation of methylation

1Eli Lilly and Company, Lilly Corporate Center, Indianapolis, Indiana. 2GreeheyChildren's Cancer Research Institute, University of Texas Health Science Centerat San Antonio, San Antonio, Texas.

Note: Supplementary data for this article are available at Clinical CancerResearch Online (http://clincancerres.aacrjournals.org/).

Corresponding Author: Louis F. Stancato, Eli Lilly and Company, Lilly CorporateCenter, Indianapolis, IN 46285. Phone: 317-655-6910; Fax: 317-276-1414; E-mail:[email protected]

doi: 10.1158/1078-0432.CCR-18-1256

�2018 American Association for Cancer Research.

ClinicalCancerResearch

Clin Cancer Res; 24(23) December 1, 20186028

on October 17, 2020. © 2018 American Association for Cancer Research. clincancerres.aacrjournals.org Downloaded from

Published OnlineFirst August 21, 2018; DOI: 10.1158/1078-0432.CCR-18-1256

http://crossmark.crossref.org/dialog/?doi=10.1158/1078-0432.CCR-18-1256&domain=pdf&date_stamp=2018-11-6

http://clincancerres.aacrjournals.org/

patterns (13). Furthermore, ES, like other pediatric tumortypes, has a low mutational burden compared with adultcancers (16); however, there are several genetic aberrationsfrequently reported in ES which contribute to cell-cycle dysre-gulation. For example, homozygous or hemizygous deletion ofCDKN2A (which encodes p16INK4a, a tumor suppressor pro-tein that binds to CDK4 and CDK6) is reported in 10% to 30%of primary ES patient tumors and up to 50% of ES cell linesand is a significant predictor of a poor prognosis for ES patients(8, 10, 17, 18). The combination of EWS/ETS fusion proteinactivities, genetic mutations, and epigenetic mechanisms likelyall contribute to the complexity of ES pathogenesis.

Abemaciclib (LY2835219; Verzenio�) is a small-moleculeinhibitor of cyclin-dependent kinase 4 (CDK4) and CDK6recently approved for the treatment of HRþ/HER2� advancedbreast cancer. In addition, abemaciclib is currently in clinicaldevelopment for non–small cell lung and other adult solidcancers (19–21) as well as newly diagnosed diffuse intrinsicpontine glioma and pediatric recurrent or refractory solidtumors (NCT02644460). Cell-based studies in preclinical can-cer models confirmed that the G1 cell-cycle arrest resultingfrom abemaciclib-mediated CDK4/6 inhibition requires afunctional RB protein (RBþ) and leads to sustained antitumoreffects through the induction of senescence, apoptosis, andaltered cellular metabolism (22–24). Interestingly, preclinicalmodels of human adult and pediatric cancers with D-typecyclin-activating features (DCAF, genomic aberrations knownto elevate D-cyclin levels) were recently shown to be highlysensitive to abemaciclib (25). Furthermore, previous studiesrevealed that cyclin D1 is a direct transcriptional target of EWS/FLI1 (26, 27), and ES cell lines require both CDK4 and cyclinD1 for survival (28). In this report, we demonstrate thatabemaciclib has single-agent activity in preclinical ES modelsthrough the expected G1 cell-cycle arrest and can be combinedwith chemotherapy to promote durable in vivo responses; inaddition, our data implicate abemaciclib in the reversal ofinhibitory epigenetic modifications and activation of interfer-on pathway signaling.

Materials and MethodsCell culture

Human ES cell lines A673, SK-ES-1, RD-ES, and SK-N-MCwere purchased from ATCC (cat#CRL-1598, HTB-86, HTB-166,and HTB-10) and maintained in suggested medium. Cado-ES-1and MHH-ES-1 were obtained from The German Collection ofMicroorganisms and Cell Culture (DSMZ, cat#255 and 167)and maintained in RPMI 1640 with 10% heat-inactivated FBS.ES-1, ES-2, ES-3, ES-4, ES-6, ES-7, ES-8, EW8, TC71, CHLA-258,RH18, RH30, RH36, RH41, RD, JR1, and SMS-CTR were kindlysupplied by Dr. Peter Houghton (Greehey Children's CancerResearch Institute; ref. 29) and maintained in RPMI 1640with 10% heat-inactivated FBS and 2 mmol/L glutamine. Allcells were maintained at 37�C and 5% CO2 in tissue culture-treated flasks.

Test compoundAbemaciclib (LY2835219, Eli Lilly and Company) was dis-

solved in DMSO at a stock concentration of 10 mmol/L forin vitro use and prepared in 1% HEC in 25 mmol/L phosphatebuffer, pH 2, for in vivo experiments.

Cell proliferationAssessment of cell proliferation following 96 hours of

abemaciclib treatment was conducted using CellTiter-GloLuminescent Cell Viability Assay (Promega, cat#G7571),alamarBlue assay (Thermo Fisher Scientific, cat#DAL1025) aspreviously described (30), or by quantification of viable cellson a Beckman Coulter ViCell XR. Absolute EC50 values werecalculated using GraphPad Prism 7 (GraphPad Software, Inc.)or by XLFit software (Microsoft) and presented as the average oftriplicate experiments � standard error of the mean (SEM).

Protein analysisGeneration of whole-cell lysates, SDS–PAGE, and immuno-

blot procedures were conducted as previously described (31).Tumor lysates were generated by homogenizing excised tumorsin 1% SDS, boiling for 5 minutes, and clarifying by centrifu-gation. Antibodies and conditions are listed in SupplementaryTable S1.

Conditioned media were collected from abemaciclib-treatedcells at indicated timepoints and frozen at�80�C for downstreamanalysis. Relative expression levels of secreted cytokines fromconditioned media were determined using the Human XL Cyto-kine Array Kit according to the manufacturer's protocol (R&DSystems, cat#ARY022). Quantitation of IP-10, MCP-1, and IL8from conditioned media was performed using Duoset ELISA Kitsfrom R&D Systems (cat#DY266, DY279, and DM3A00). Absor-bance was measured at 450 nm on a Spectromax250 (MolecularDevices). Presence of IFNa, b, g , and l was analyzed using theU-PLEX Interferon Combo (hu) kit (Meso Scale Diagnostics,cat#K15094K-1), Human IL29/IL28B Duoset ELISA (R&D Sys-tems, cat#DY1598B), Human IFNg High Sensitivity ELISA(eBioscience, cat#BMS228HS), andVeriKine-HSHuman IFNBetaserum ELISA Kit (PBL Assay Science, cat#41415) according to themanufacturer's protocol.

High-content imagingHigh-content imaging and cell immunofluorescence (IF)

analysis were performed as previously described (32, 33).

Translational Relevance

Abemaciclib is a highly selective small-molecule inhibitorof CDK4 and CDK6 recently approved for the treatment ofmetastatic breast cancer and currently under clinical evalua-tion for multiple indications including pediatric solid tumors(NCT02644460). Recently, it was reported that cancers withboth D-cyclin–activating mutations and functional RB aresensitive to abemaciclib. Ewing sarcoma (ES) is driven by achimeric oncogenic transcription factor implicated in activat-ing the CDK4-cyclin D-RB axis. In this study, we demonstratethat abemaciclib reduced tumor size in preclinical ES models;combination with cytotoxic chemotherapies enhanced thisantitumor activity resulting in durable responses. Further-more, in addition to the well-characterized and expectedabemaciclib-induced cell-cycle block, we report newly discov-ered abemaciclib-related effects, including regulation of DNAmethylation and interferon pathway signaling, which mayenhance abemaciclib activity.

Preclinical Activity of Abemaciclib in Ewing Sarcoma

www.aacrjournals.org Clin Cancer Res; 24(23) December 1, 2018 6029




Briefly, cells were treated with abemaciclib in flasks for long-term treatments then seeded in poly-D-lysine coated 96-wellblack/clear plates (Corning, cat#354640). For experiments with�4 days of abemaciclib treatment, cells were seeded directlyinto plates. Following treatment, cells were fixed in 3.7%formaldehyde (Sigma-Aldrich, cat#F-1268) in Dulbecco's PBS(D-PBS), permeabilized with 0.1% Triton X-100 in D-PBS, andblocked with 1% BSA in D-PBS. Cells were incubated withprimary antibodies overnight at 4�C, followed by 3 washes andincubation with secondary antibodies for 1 hour at roomtemperature. Antibody details are in Supplementary TableS1. DNA was stained with Hoechst 33342. Click-iTTM EdUAlexa FluorTM 488 HCS assay was performed per the manu-facturer's protocol following a 30-minute incubation with EdU(Molecular Probes, cat#C10350). Cells were imaged using aCellInsight NXT platform and analyzed by the TargetActivationV.4 Bioapplication (Thermo Fisher Scientific). Gates for percentresponders (percent positive for desired marker) were set basedon the DMSO-treated group for each cell line.

Evaluation of DNA methylationGenomic DNA was isolated according to the manufacturer's

protocol using Wizard Genomic DNA Purification Kit(Promega, cat#A1120) and evaluated using the MethylFlashMethylated DNA Quantification Kit per the manufacturer'sinstructions (EpiGentek, cat#p-1034). Individual promotermethylation analysis by pyrosequencing was conducted at theUniversity of Texas Health Science Center San Antonio Bio-analytics and Single-Cell Core. Genomic DNA (300 ng/sample)was subjected to bisulfite conversion using the EZ DNAMethylation Kit (Zymo Research, cat#D5001). PyroMark CpGMethylation Assays were used to detect methylation at pre-dicted CpG sites (Qiagen, cat#978746). Methylated CpG siteswere detected by the PyroMark Q96 MD System. Specific assaysused were Hs-CDK6_01_PM00029239, Hs-CDK6_02_PM00020246, Hs-RASSF1_01_PM00013293, Hs-RASSF1_02_PM00013300, and Hs-RASSF1_03_PM00013307. The LINE-1_a5M assay was custom designed with the following primers:Forward, AGATTATATTTTATATTTGGTTTAGAGG; reverse, AC-CCCCTTACAATTTAATCTCAAACTACTA; sequencing, ATTTGG-TTTAGAGGGTT. Methylated CpG sites were detected by thePyroMark Q96 MD System. Incomplete bisulfite conversioncheckpoint was set as 5%. The methylation percentage of eachinterrogated CpG site was calculated and visualized using theMultiExperiment Viewer v4.8 (Dana-Farber Cancer Institute,Boston, MA) and GraphPad Prism 7.

Flow cytometryC12FDG assays were performed as previously described (34),

and cells were analyzed on a Beckman Coulter F500 usingWinList6.0 software. For BrdU analysis, cells were pulsed with10 mmol/L BrdU for 1 hour prior to harvest, then fixed in ice-cold 70% ethanol. Cells were washed and incubated in 2 mol/LHCl for 20 minutes to denature DNA. After washing, HClwas neutralized with 0.1 mol/L sodium borate, pH 8.5. Cellswere stained with anti-BrdU FITC-conjugated antibody for30 minutes, washed, and stained with propidium iodide for30 minutes. Samples were run on a Beckman Coulter FC500.Data were analyzed using FlowJo v10 and ModFit LT (VerityHouse Software).

Reverse transcription quantitative PCR and RNA sequencing(RNA-seq)

RNA was extracted from cells grown in continual presence ofabemaciclib using the RNeasy Mini Kit (Qiagen, cat#74104).cDNA prepared using High-Capacity cDNA Reverse Tran-scription Kit (Applied Biosystems, cat#43-688-14) was addedto TaqMan Fast Advanced Master Mix (Thermo Fisher Scientific,cat#4444557) along with the appropriate TaqMan assay andrun using the ViiA 7 Real-Time PCR System (Applied Biosys-tems). TaqMan assays (Thermo Fisher Scientific) used were asfollows: Hs0098418_m1 (IDO1), Hs00818803_g1 (HLA-B),Hs01013996_m1 (STAT1), Hs00292922_m1 (ERVH48-1),Hs01060665_g1 (ACTB), Hs00171042_m1 (CXCL10),Hs00971960_m1 (IRF1), and Hs02758991_g1 (GAPDH). Foldchanges were calculated using the DDCt method. RNA-seq wasperformed at the UCLA Technology Center for Genomics andBioinformatics on a Illumina HiSeq3000 using the TruSeqStranded mRNA Library Prep Kit with paired end sequencing,read length of 150 bp, and targeted read depth of 100Mreads/sample. Reads were quality trimmed by sickle v1.33with default parameters. Sequencing reads were mapped tohuman (GRCh37.p13) reference genome using GSNAP(v.2013-11-27). Read counts were generated against exonsannotated in NCBI gene models (genome builds downloadedin December 2013), then summed at the gene level to providea single number per gene per sample using a custom Perlscript. RNA-seq data were further subjected to a QC pipelinedeveloped at Eli Lilly and Company. Briefly, base quality/basecomposition, heterologous organism contamination, adaptercontent, mapping rate/mapped read counts, 30 bias, templatelength, sample identity, and rRNA/mito content were checked.

In vivo evaluationIn vivo studies were approved by the Eli Lilly and Company

Animal Care and Use Committee. To evaluate abemaciclib in cellline–derived xenografts (CDX), 5� 106 ES cells were resuspendedin Hank's Balanced Salt Solution and injected subcutaneouslyinto female nude mice. After randomization into treatmentgroups based on tumor volume and body weight, mice weregiven vehicle (1%HEC in 25mmol/L phosphate buffer, pH 2) or50 mg/kg abemaciclib orally once daily for 28 days (QD�28).Tolerability of combination treatments (abemaciclib þ chemo-therapy) was considered acceptable if mice did not lose >20%body weight during treatment. For combination studies, animalswere given abemaciclib (50 mg/kg, QD � 28, p.o.) plus doxoru-bicin [3 mg/kg, once weekly for 4 weeks (Q7D � 4), i.v.],cyclophosphamide (100 mg/kg, Q7D � 4, i.p.), temozolomide[TMZ, 66mg/kg, once daily for 5 days then rested for 16 days fortwo cycles (QD � 5, rest �16) � 2, p.o.], and/or irinotecan[2.5 mg/kg, (QD � 5, rest �16) � 2, i.p.]. For abemaciclib/TMZcombinations, administration was offset by 12 hours on thesame dosing day. For in vivo target inhibition experiments, micewere sacrificed after 10 days of treatment. Half of each excisedtumor was frozen at �80�C for future protein analysis byWestern blot and half was formalin-fixed and paraffin embeddedfor immunohistochemistry (IHC). Fluorescence-based IHC wasperformed and analyzed according to previously described meth-ods (35). Fourteen patient-derived ES xenograft (PDX) modelswere treated as described above and evaluated at ChampionsOncology. For analysis of combination effects, the BLISS inde-pendence method was used to define a statistically significant

Dowless et al.

Clin Cancer Res; 24(23) December 1, 2018 Clinical Cancer Research6030




effect. Combinations were defined as additive if the combinationarm was statistically different from both of the single-agent arms.

ResultsHigh cyclin D1 expression in ES cell lines correlates toabemaciclib sensitivity

Cancer cell lines most sensitive to abemaciclib were previ-ously shown to have DCAF (25); the EWS/FLI oncogenictranscription factor may also be considered a DCAF as itdirectly promotes expression of cyclin D1 (26, 27). In a largecell line panel consisting of both adult and pediatric tumorcells, 50% of ES cell lines (3/6) and 11/27 (40.7%) of othertumor cell lines with DCAF were highly sensitive to abemaci-clib at clinically achievable concentrations (EC50 � 1 mmol/L),whereas only 4.2% of cell lines with mutant RB1 (2/48) hadsubmicromolar EC50 values (Fig. 1A). SK-N-MC, which hascompromised RB function (RB�) due to the RB1-R698M/Shomozygous mutation, was determined to be the least sensi-

tive ES cell line to abemaciclib and was, therefore, used as anabemaciclib-resistant control cell line. Evaluation of abema-ciclib in a focused panel of 17 ES cell lines validated thisobservation as the majority of cell lines (16/17; 94.1%) weredetermined to have antiproliferative absolute EC50 valuesbelow 1 mmol/L (Fig. 1B). As DCAFs elevate D-cyclin expres-sion, cyclin D1 protein levels were evaluated across a panel ofpediatric cell lines (Fig. 1C). Strong cyclin D1 signal wasreadily apparent in ES cells but not in cancer cell lines lesssensitive to abemaciclib; however, the absolute expressionlevel of cyclin D1 did not correlate with the rank order ofabemaciclib sensitivity across the ES cell lines. Interestingly,most ES cell lines expressed low levels of CDK4 and lackedCDK6 expression when compared with non-ES cell lines.

Abemaciclib induces a G1 cell-cycle arrest in RBþ EScell lines

In RBþ cell lines (ie, those with functional RB), CDK4/6inhibition results in RB hypophosphorylation leading to a

Figure 1.

ES and other cell lines with DCAF are highly sensitive to abemaciclib. A, Box plot graphical representation of abemaciclib sensitivity in a 560-cell line panel.Data are divided into categories based on those cells with an EWS/FLI1 fusion (EWS.FLI), cells with DCAF, cells with RB mutation (RB), or all othercells (other). þ, geometric mean; black diamond, SK-N-MC ES cell line which has both the EWS/FLI fusion protein and an RB1 mutation; gray diamond,NCI-H1048 small cell lung cancer cell has both DCAF and an RB1 mutation. Ordinary one-way ANOVA of log EC50 values with Sidak multiple comparison test.� , P < 0.05; �� , P < 0.0001. For a complete list of cell lines tested, see Supplementary Table S1 of ref. 25. B, Cell lines were treated with abemaciclibfor 96 hours and proliferation determined using either cell counts or alamarBlue assay. Absolute EC50 values are the average of three biologicalreplicates. Black bars, ES cell lines; gray bars, rhabdomyosarcoma (RMS) cell lines; error bars, SEM; dotted line, clinically achievable sustained concentration.C, Whole-cell lysates from a panel of pediatric cell lines from multiple histologies: ES (black bars), neuroblastoma (CHP, KELLY, IMR-32), RMS (SJCRH30,RH41, RD), and osteosarcoma (MG-63, HuO9) were analyzed by Western blot for the indicated proteins. Quantitation below Western blot is cyclin D1normalized to GAPDH.






cell-cycle block at the G1–S transition and decreased E2F-driven transcription (23). Following abemaciclib treatment,RB phosphorylation at both serine 807 and the CDK4/6specific serine 780 (22) decreased, protein expression of boththe E2F target topoisomerase IIa and the cell-cycle transcrip-tion factor FOXM1 decreased, and cyclin E increased in RBþcell lines, all consistent with a G1–S cell-cycle block (Fig. 2A).Cyclin D1 slightly increased with abemaciclib treatment in theRBþ cell lines but was unchanged in SK-N-MC RB� cells.Evaluation of DNA content in abemaciclib-treated ES cellsconfirmed a G1 cell-cycle arrest in RBþ cells (Fig. 2B); further-more, a reduction in DNA synthesis, as evidenced by reducedBrdU staining, was observed in all RBþ cells (Fig. 2C).

Abemaciclib promotes a quiescent phenotype and resistanceto chemotherapy in ES cell lines

Preclinical studies have previously demonstrated that cell-cycle arrest caused by CDK4/6 inhibition can lead to senescencein multiple tumor types (23, 24, 36, 37). Senescence is acomplex phenotype ultimately defined by an irreversible cell-cycle exit (38); therefore, we evaluated abemaciclib-treated EScell lines for senescence by measuring multiple endpoints. Anincrease in C12FDG, the substrate for b-galactosidase, wasobserved in A673 cells following 14-day treatment with abe-maciclib (Supplementary Fig. S1A). In general, abemaciclibalso reduced Ki-67 expression in RBþ cell lines indicatingdecreased proliferation and promoted a senescence-like

Figure 2.

Abemaciclib induces a cell-cycle block in ES cell lines with intact RB. A, After treatment with abemaciclib for 48 hours, cells were lysed and the indicatedtotal and phosphorylated proteins were assessed by Western blot analysis. B and C, After 96 hours of treatment with 500 nmol/L abemaciclib, cellswere pulsed with BrdU for 1 hour and then fixed. Cells were costained with anti-BrdU and PI and analyzed by flow cytometry. B, Cell cycle was basedon PI staining and modeled with ModFit software. Cell lines with RB proficiency are encompassed by the gray box. Percentage of cells in S-phase wasdetermined by BrdU analysis and is indicated by the boxed-in portion of the graph.

Dowless et al.





phenotype as evidenced by lower FOXM1 expression, increasedp21 expression (Supplementary Fig. S1B), and increased cellsize (Supplementary Fig. S1C). We also assessed the senes-cence-associated secretory phenotype (SASP; ref. 36) throughmeasurement of secreted cytokines from conditioned media(CM) of abemaciclib-treated ES cells. Although secretion ofsome SASP proteins (namely, CCL2/MCP-1 and IL8) wasnoted, most cytokine increases in the CM were associated withan acute immune response (Supplementary Fig. S1D).Although abemaciclib-treated RBþ cell lines exhibited multiplecharacteristics of cellular senescence, none of the cell lines werepositive for all senescence-related endpoints.

Abemaciclib-treated RBþ ES cells developed resistance to che-motherapy and targeted agents alike, which is characteristic ofsenescence; however, unlike true senescence, this acquired resis-

tance was reversible following removal of abemaciclib fromculture medium (Fig. 3A). Furthermore, A673 cells were able toproliferate following abemaciclib washout as measured by anincrease in cells undergoing DNA synthesis and phosphorylationof RB protein (Fig. 3B–D). Therefore, although abemaciclib-treated ES cells displayed various features of senescence, theywere ultimately able to reenter the cell cycle and regain sensitivityto other therapeutic agents, suggesting that abemaciclib promotesquiescence rather than senescence in ES.

Abemaciclib diminished DNMT1 protein and increasedinterferon signaling in ES cell lines

Selective CDK4/6 inhibitors including abemaciclib can pro-mote an immune response through suppression of the RB-E2F-DNMT1 axis, resulting in global upregulation of interferon

Figure 3.

Abemaciclib-treated ES cells are resistant to chemotherapy agents during simultaneous treatment but regain sensitivity upon abemaciclib washout. A, ES celllines were treated with 1 mmol/L abemaciclib or vehicle control continuously for 14 days. Cells were then cotreated with the indicated drug or abemaciclibwas washed out for 7 days prior to drug treatment. Cell proliferation was measured 72 hours postdrug treatment and EC50 values for chemotherapyagents calculated based on a 10-point serial dilution curve. B–D, A673 cells were treated continually for 14 days with abemaciclib or abemaciclib waswashed out prior to fixation (Day post-WO) and replaced with normal growth media. On day 14, cells were fixed, stained, and imaged for active DNA synthesisby EdU expression (B) and RB phosphorylation (C). Data are presented as the mean of four technical replicates � SEM measuring % positive cells. D,Representative images from each time point taken at 20X magnification. Blue, nuclei; green, EdU; red, pRB.






(IFN) signaling in breast cancer models (39). Similarly, weobserved a sustained decrease in DNMT1 protein and mRNAlevels in RBþ ES cells after treatment over a range of timepoints from 24 hours to 16 days (Fig. 4A and B). Abemaciclibreduced global DNA methylation levels in RBþ cell lines, butwithout concomitant decrease in DNA promoter methylationof CDK6, LINE-1, or RASSF1 (Supplementary Fig. S2B andS2C). In addition to the reduction of cell-cycle–related E2Ftranscriptional targets, such as CCNA2, CCNB1, E2F2, FOXM1,AURKA, and AURKB in all RBþ ES cell lines (Fig. 4B), abema-ciclib elicited a variable immune response as measured byelevation in secreted proinflammatory cytokines (Supplemen-tary Fig. S1D); marked upregulation of the canonical IFNsignaling pathway (Fig. 4A–C; Supplementary Fig. S2A andS2E); and increased expression of the antigen presentationprotein MHC-1 which was maintained at both the transcriptand protein level after abemaciclib washout (Fig. 4A and D;Supplementary Fig. S2E).

Based on the apparent increase in IFN/JAK/STAT1 pathwayactivity, we measured secreted IFNs from CM of abemaciclib-

treated cells. Surprisingly, IFNa, -b, -g , and -l were largely unde-tected in ES cell CM, with the exception of IFNb and -l in CMfrom RD-ES (Fig. 4C). In addition, MHC-1 upregulation onlyoccurred when ES cell lines were stimulated with IFN concentra-tions detectable by ELISA (Supplementary Table S2). These datasuggest that selective inhibition of CDK4/6 by abemaciclibmay elicit a ligand-independent IFN response in ES cells.

Combination of abemaciclib with chemotherapy promotesdurable in vivo responses in preclinical ES models

Abemaciclib was initially evaluated in the RD-ES CDXmousemodel where stable disease was achieved with single-agenttreatment (Fig. 5A); however, tumor growth resumed after theend of the dosing interval. Immunofluorescent analysis ofabemaciclib-treated tumors confirmed a G1–S cell-cycle blockby diminished Ki-67, decreased nuclear DNA content of cells,and reduced TUNEL staining when compared with controltumors (Fig. 5B). Areas of control tumors with high TUNELstaining corresponded to the necrotic core of rapidly growingtumors. Inhibition of tumor growth positively correlated with a

Figure 4.

Abemaciclib treatment induces a loss of DNMT-1, active interferon pathway signaling, and durable antigen presentation response in vitro. ES cell lineswere treated continually with 500 nmol/L abemaciclib for up to 16 days. A, Whole-cell lysates were analyzed by Western blot for expression of theindicated proteins. B, Day 14 biological triplicate samples were split for RNA and protein analysis, RNA-seq results are presented as a heat map. ANOVAmodels were used to eliminate machine, flow-cell, and lane effects. Gene count data were quantile normalized and log2 transformed. For each gene, thedifference in expression between the control and abemaciclib-treated in each cell line was estimated using linear regression model. The Bonferronicorrection P value of 2.43E�06 was used to determine differential expression. Genes presented are split into four groups depicted by colored bar, Blue,E2F target genes showing cell-cycle changes; orange, DNMT group; purple, interferon-stimulated genes; green, HLA genes. C, Interferon a, b, g , and llevels were assessed in the conditioned media of ES cells treated for 14 days with 500 nmol/L or 1 mmol/L abemaciclib. Changes in IFNl (left) andIFNb (29) levels are shown. IFNa and IFNg were not detected in any samples. Dotted line represents lowest IFN concentration of standard curve. n ¼ 3,two-way ANOVA analysis, �� , P < 0.001; �� , P < 0.0001. D, A673 cells were treated continually for 14 days with abemaciclib or abemaciclib waswashed out 4, 3, 2, and 1 day prior to fixation. Top left, %POSITIVE MHC-1 is mean of 4 technical replicates � SEM. Top right, Images show representativefields taken at 20� magnification for the indicated timepoint. Post, days postwashout. Blue, nuclei; yellow, MHC-1. Bottom, ES cell lines were treatedcontinually for 14 days with abemaciclib or abemaciclib was washed out 96, 72 48, or 24 hours prior to harvest and replaced with growth media. On day14, cells were lysed and indicated proteins were analyzed by immunoblot.

Dowless et al.





statistically significant reduction of RB phosphorylation andtopoisomerase IIa protein expression, as expected followingprolonged CDK4 inhibition (Fig. 5C).

As stable disease in mice bearing RD-ES tumors duringabemaciclib monotherapy was not maintained beyond theend of treatment, studies combining abemaciclib with

Figure 5.

Abemaciclib has single-agent activityin the xenograft model RD-ES giving astable disease response for duration oftreatment. Mice bearing RD-ESxenografts were treated orally with50 mg/kg abemaciclib (&) or vehicle(*) daily. A, Tumor growth over time.Dotted lines indicate dosing interval.Mean� SEM is displayed, n¼ 3/group.B and C, Xenografts were harvestedafter 10 days of treatment. B, IHCanalysis for cell death (TUNEL), cellproliferation (Ki-67), and cell number(DNA content). Bar graphs undereach set of representative imagesquantify staining for each endpoint,n ¼ 8 fields/group. One-way ANOVAwith Dunnett comparison. C,Analysis of protein expression byimmunoblotting. Protein levels werequantitated using the Chemidoc XRSsoftware (Bio-Rad). Reported valuesare normalized to GPDH (n ¼ 8/group). Error bars, SEM. PairedStudent t test; � , P < 0.05; �� , P < 0.01;�� , P < 0.001; �� , P < 0.0001.






chemotherapeutic agents were conducted in 14 PDX models ofES using an "n of 1" study design. Abemaciclib plus doxoru-bicin increased response durability as measured by tumordoubling time, with combination treatment demonstratingsuperiority to either single agent in eight of 14 PDX models,while no added benefit was observed with abemaciclib/cyclo-phosphamide combinations (Supplementary Figs. S3 and S4).Further analysis in three of these PDX models using moreanimals (n ¼ 3/arm) confirmed that abemaciclib plus doxo-rubicin promoted durable antitumor responses (stable diseaseor partial tumor regression; Fig. 6A and B; Supplementary TableS3; Supplementary Figs. S3 and S4). Abemaciclib-inducedinhibition of tumor growth positively correlated with a reduc-tion in RB phosphorylation, topoisomerase IIa, and DNMT1expression (Fig. 6A; Supplementary Figs. S3C, S3E, and S4).

Patients with relapsed or recurrent ES who receive treatmentregimens including irinotecan and temozolomide (TMZ) haveresponse rates of up to 68%, with a 1-year overall survival rate of65% (40, 41); therefore, we also tested this combination plusabemaciclib in A673 and RD-ES CDXmodels and 9 "n of 1" PDXmodels (Fig. 6C and D; Supplementary Table S3; Supplementary

Figs. S3 and S4). In the A673 model, the triple combinationresulted in five animals with stable disease and 1 animal with apartial regression which was maintained beyond the end of thedosing interval (Fig. 6C and D; Supplementary Table S3 andSupplementary Fig. S4A). In the RD-ES model, the triple combi-nation resulted in partial regression (Supplementary Table S3).In one PDX model, the triple combination resulted in acomplete regression, while in the remaining majority of PDXmodels evaluated (8/9), the response to abemaciclib/irinotecan/TMZ was either stable disease or progressive disease (Supple-mentary Table S3). Combinations were well tolerated in micebased on body weight measurements (Supplementary Figure S4).

DiscussionES is a devastating malignancy predominantly occurring in

adolescents and young adults. Despite aggressive treatment regi-mens, patient prognosis is often poor and marked by tumorrecurrence and/or metastasis. Furthermore, systemic therapy mayresult in chronic illness or development of secondary cancers;therefore, it is imperative to identify and evaluate new therapeutic

Figure 6.

Abemaciclib plus chemotherapy demonstrates additive effects of stable disease and tumor regression in preclinical models of ES. A, Animals bearingCTG-0142 PDX were given vehicle, abemaciclib (daily), doxorubicin (once weekly), or the combination for 28 days (n ¼ 3/group). Dotted line marksend of dosing schedule. Additional mice (3/arm) were added to each cohort and xenografts were harvested after 10 days of treatment (x) andinterrogated for expression of DNMT1 and topoisomerase IIa and phosphorylation of RB. B, Waterfall plot of CTG-0142 PDX study at day 28. C, Micewith A673 tumors were treated with vehicle, abemaciclib (daily), temozolomide (TMZ) and irinotecan (once daily for 5 days, rest for 16 days), or thecombination (n ¼ 5/group). Dotted line represents end of dosing schedule. D, Waterfall plot of A673 CDX study at day 31. Error bars, SEM. Blue bars,progressive disease (PD, �10%); red bars, stable disease (SD, �50% to 10%); green bars, partial response (PR, ��50% and >14 mm3).

Dowless et al.





options. Abemaciclib is a CDK4/6 inhibitor approved for thetreatment of HRþ/HER2� advanced breast cancer currently underclinical evaluation for both adult and pediatric solid malignan-cies. In this report, we evaluated abemaciclib in preclinicalmodelsof pediatric cancers and determined that ES, with functional RBtumor suppressor protein, was sensitive at clinically achievableconcentrations. Abemaciclib displayed a three-pronged mecha-nism of action in vitro: inhibition of the cell cycle, deregulation ofDNA methylation, and activation of the interferon pathway.Furthermore, tumor growth was inhibited by abemaciclib, eitheralone or in combination with chemotherapy, in multiple ESxenograft models.

Recently, our group reported that cancer cell-line sensitivityto abemaciclib was associated with genetic aberrations, whichresult in activated cyclin D and a dependence on D-cyclin genesfor proliferation (25). As the EWS/FLI1 fusion oncoprotein canpromote the expression of cyclin D1 (26, 27), it is reasonable toconsider this chimeric transcription factor as an additionalDCAF. Indeed, ES cell lines have higher relative cyclin D1protein expression levels than non-DCAF, abemaciclib-resis-tant rhabdomyosarcoma (RMS) cell lines, and a super-enhancerscreen identified both cyclin D1 and CDK4 as necessary for EScell survival and anchorage-independent growth (28).

Senescence and apoptosis following inhibition of CDK4/6have been well documented in preclinical models of breastcancer and neuroblastoma (23, 24). Although abemaciclibpromoted various features of cellular senescence in ES cells,the absence of apoptosis and the observation that cells ulti-mately resumed growth upon abemaciclib withdrawal indicateinduction of quiescence rather than senescence. Another unex-pected function of abemaciclib in ES is its ability to negativelyregulate DNA methylation, an aspect of the compound that hasnot been reported in pediatric cancer. High levels of DNAmethylation reported in ES tumors and cell lines putativelycontribute to a gene-silencing mechanism that inhibits tumorsuppressor expression (13, 14). Consistent with this idea,reports have linked aberrant DNA methylation with the path-ogenesis of many other pediatric tumor types (42). Abemaciclibrapidly decreased expression of DNMT1, the enzyme respon-sible for maintenance DNA methylation, in ES cells, thusreducing global DNA methylation; however, this did not leadto appreciable changes in DNA promoter methylation of 3 keygenes. These findings are supported by prior observations thatDNMT1 knockdown leads to limited genomic demethylation(43). Consistent with previous data generated in breast cancermodels (39), abemaciclib did not affect DNMT3A expression.Both DNMT3A and 3B, which are responsible for de novomethylation, can functionally overlap with DNMT1 (43), andit is, therefore, possible that DNMT3A could compensate forthe absence of DNMT1 and assume maintenance methylationactivity. However, questions remain whether the abemaciclib-mediated loss of DNMT1 in ES leads to reexpression of otherepigenetically silenced genes (e.g., tumor suppressors) or ifDNMT3A plays a role in maintenance methylation.

Mechanistically, loss of DNA methylation may lead to ele-vated expression of endogenous retrovirus (ERV) genes, therebyactivating cytosolic double-stranded RNA (dsRNA)-sensingpathways and inducing an IFN response (44). Following abe-maciclib treatment, RBþ ES cell lines exhibited a prototypicalIFN response, as evidenced by increased gene transcripts forSTAT-1, IRF-1, CXCL-10, IDO-1, and HLA-B. STAT1 pathway

activation was confirmed at the protein level by increasedpSTATY701, IRF9, and MHC-1. However, this response seemsto be ligand-independent as we were unable to detect expres-sion of any interferon ligands in the CM of all but one ES cellline. In RD-ES CM, low levels of IFNb and IFNl (also known astype I and type III IFN, respectively) were detected after abe-maciclib treatment. Types I and III IFN both induce strongantiviral responses but differ in the activating ligands (type I,IFNa/b; type III, IFNl) and receptor distribution (type I,global; type III, restricted to mucosal epithelial cells; refs. 45,46). The epithelial-restricted expression of type III IFN wasrecently illustrated by the sole induction of IFNl and itsassociated downstream immune response observed in breastcancer cell lines following abemaciclib treatment (39). As ES isby definition a mesenchymal tumor, the abemaciclib-inducedIFNl increase detected in RD-ES cells is an interesting exceptionto the current understanding of type III IFN receptor distribu-tion, as is the apparent ligand-independent IFN pathway acti-vation in other ES cell lines. Although it is possible that traceamounts of IFN may have been secreted at levels below detec-tion limits, it is unlikely given that MHC-1 was not expressed inES cells following stimulation with IFN concentrations wellwithin ELISA detection limits. This observation suggests thatthe abemaciclib-induced MHC-1 response could be a ligand-independent intrinsic cellular response with a yet undefinedmechanism.

The innate immune response to virus includes IFN secretion,which stimulates release of inflammatory chemokines such asCXCL10/IP-10 and IL8. These chemokines act as chemoattrac-tants for activated T cells, neutrophils, and basophils, and resultin upregulation of MHC class I cell-surface antigen proteins andmounting of an adaptive immune response. Recently, abema-ciclib was shown to induce a T-cell inflammatory signature andupregulation of antigen presentation in tumors of syngeneicmurine carcinoma models (47) and CDK4/CDK6 inhibition inconjunction with immune-checkpoint blockade is currentlybeing tested in the clinic in breast and other adult solid tumors(NCT02791334, NCT03294694). Similarly, abemaciclib trig-gered a heightened immune phenotype analogous to an innate/adaptive response in ES cells; therefore, the potential clinicalimplications of this observation in pediatric oncology shouldbe the subject of future studies and merits the development ofimmune-competent ES models. Combination of abemaciclibwith chemotherapy improved the durability of disease controlin preclinical ES models, though benefit was dependent onboth the specific chemotherapy and the model. The additiveeffect of abemaciclib plus chemotherapy is a surprising obser-vation given the in vitro resistance data; however, such an effectis reported with other chemotherapies in other contexts includ-ing temozolomide in glioblastoma (48) and antimitotics inbreast cancer (49), suggesting that our current assumptionsconcerning the combinability of CDK4/6 inhibitors with che-motherapy may be overly simplistic. Abemaciclib plus doxo-rubicin resulted in additive, durable responses ranging fromstable disease to partial regression in multiple ES mouse mod-els. Although the exact mechanism of action for this combi-nation is currently undefined, ES cells treated with abemaciclibin vitro retained partial sensitivity to doxorubicin despiteacquiring resistance to other chemotherapeutics, indicatingthat doxorubicin may act in a cell-cycle–independent manner.In addition, DNA intercalators, such as doxorubicin, can inhibit






DNMT1 (50) and could potentially enhance the demethylatingeffects of abemaciclib. The combination of abemaciclib/TMZresulted in an enhanced response significantly different fromTMZ alone in mice bearing A673 xenografts. Interestingly,while TMZ/irinotecan controlled A673 tumor growth, theaddition of abemaciclib prevented tumor regrowth duringdosing holidays. In contrast to the superior responses observedwith abemaciclib/doxorubicin or abemaciclib/TMZ/irinotecancombinations, the combination of abemaciclib plus cyclophos-phamide was not superior to either single agent. It is possiblethat the sequencing of chemotherapy with abemaciclib mayprovide greater benefit than simultaneous administration andfurther studies are required to fully explore various regimens toidentify an optimal treatment strategy.

Overall, abemaciclib exhibits a unique mechanism of actionencompassing cell-cycle blockade, DNA demethylation, and acti-vation of the adaptive immune response in ES models. Althoughour data strongly support evaluation of abemaciclib in immune-competent ES models, development of such models has provedelusive. Therefore, further studies of the multifaceted CDK4/6inhibitor abemaciclib should be pursued in additional preclinicalmodels of adult and pediatric malignancies.

Disclosure of Potential Conflicts of InterestR. Flack holds ownership interest (including patents) in Eli Lilly. P. J. Ebert

holds ownership interest (including patents) in Eli Lilly. No potential conflictsof interest were disclosed by the other authors.

Authors' ContributionsConception and design: M.S. Dowless, J.R. Stephens, S.G. Buchanan,P.J. Houghton, L.F. Stancato

Development of methodology: M.S. Dowless, J.R. Stephens, J.B. Olsen,P.J. HoughtonAcquisition of data (provided animals, acquired and managed patients,provided facilities, etc.): M.S. Dowless, T.J. Shackleford, M. Renschler,J.R. Stephens, R. Flack,W. Blosser, J. Stewart, J. Dempsey, A.B. VanWye, P.J. Ebert,J.B. Olsen, P.J. HoughtonAnalysis and interpretation of data (e.g., statistical analysis, biostatistics,computational analysis): M.S. Dowless, M. Renschler, W. Blosser, S. Gupta,J. Stewart, Y.Webster, J. Dempsey, A.B. VanWye, P.J. Ebert, P. Iversen, J.B. Olsen,X. Gong, S.G. BuchananWriting, review, and/or revision of the manuscript: M.S. Dowless,C.D. Lowery, T.J. Shackleford, R. Flack, A.B. VanWye, P.J. Ebert, P. Iversen,J.B. Olsen, S.G. Buchanan, P.J. Houghton, L.F. StancatoAdministrative, technical, or material support (i.e., reporting or organiz-ing data, constructing databases): M.S. Dowless, C.D. Lowery,M. Renschler, R. Flack, W. Blosser, A.B. VanWye, P. IversenStudy supervision: M.S. Dowless

AcknowledgmentsThe authors would like to acknowledge the Cancer Prevention Research

Institute of Texas for its support of the Bioanalytics and Single-Cell Core atthe University of Texas Health Science Center San Antonio by grantRP150600. T. Shackleford received funding from grant CA165995. Thisstudy was funded by Eli Lilly and Company, Lilly Corporate Center, India-napolis, Indiana.

The costs of publication of this article were defrayed in part by thepayment of page charges. This article must therefore be hereby markedadvertisement in accordance with 18 U.S.C. Section 1734 solely to indicatethis fact.

Received April 25, 2018; revised June 19, 2018; accepted August 16, 2018;published first August 21, 2018.

References1. Cesari M, Righi A, Cevolani L, Palmerini E, Vanel D, Donati DM, et al.

Ewing sarcoma in patients over 40 years of age: a prospective analysis of 31patients treated at a single institution. Tumori 2016;102:481–7.

2. Leavey PJ, Mascarenhas L, Marina N, Chen Z, Krailo M, Miser J, et al.Prognostic factors for patientswith Ewing sarcoma (EWS) atfirst recurrencefollowing multi-modality therapy: a report from the Children's OncologyGroup. Pediatr Blood Cancer 2008;51:334–8.

3. Esiashvili N, GoodmanM,Marcus RB Jr.Changes in incidence and survivalof Ewing sarcoma patients over the past 3 decades: surveillance epidemi-ology and end results data. J Pediatr Hematol Oncol 2008;30:425–30.

4. McTiernanAM,Cassoni AM,DriverD,MichelagnoliMP,KilbyAM,WhelanJS. Improving outcomes after relapse in Ewing's sarcoma: analysis of 114patients from a single institution. Sarcoma 2006;2006:83548.

5. Rainusso N, Wang LL, Yustein JT. The adolescent and young adult withcancer: state of the art—bone tumors. Curr Oncol Rep 2013;15:296–307.

6. Bacci G, Longhi A, Barbieri E, Ferrari S, Mercuri M, Briccoli A, et al. Secondmalignancy in 597 patients with Ewing sarcoma of bone treated at a singleinstitution with adjuvant and neoadjuvant chemotherapy between 1972and 1999. J Pediatr Hematol Oncol 2005;27:517–20.

7. Hamilton SN, Carlson R, Hasan H, Rassekh SR, Goddard K. Long-termoutcomes and complications in pediatric Ewing sarcoma. Am J Clin Oncol2017;40:423–8.

8. Ladanyi M. EWS-FLI1 and Ewing's sarcoma: recent molecular data andnew insights. Cancer Biol Ther 2002;1:330–6.

9. Arvand A, Denny CT. Biology of EWS/ETS fusions in Ewing's familytumors. Oncogene 2001;20:5747–54.

10. Kowalewski AA, Randall RL, Lessnick SL. Cell cycle deregulation in Ewing'ssarcoma pathogenesis. Sarcoma 2011;2011:598704.

11. Le DeleyMC, Delattre O, Schaefer KL, Burchill SA, Koehler G, HogendoornPC, et al. Impact of EWS-ETS fusion type on disease progression in Ewing'ssarcoma/peripheral primitive neuroectodermal tumor: prospective results

from the cooperative Euro-E.W.I.N.G. 99 trial. J Clin Oncol 2010;28:1982–8.

12. Kovar H. Blocking the road, stopping the engine or killing the driver?Advances in targeting EWS/FLI-1 fusion in Ewing sarcoma as novel therapy.Expert Opin Ther Targets 2014;18:1315–28.

13. Patel N, Black J, Chen X, Marcondes AM, GradyWM, Lawlor ER, et al. DNAmethylation and gene expression profiling of ewing sarcoma primarytumors reveal genes that are potential targets of epigenetic inactivation.Sarcoma 2012;2012:498472.

14. Avigad S, Shukla S, Naumov I, Cohen IJ, Ash S, Meller I, et al. Aberrantmethylation and reduced expression of RASSF1A in Ewing sarcoma.Pediatr Blood Cancer 2009;53:1023–8.

15. Huertas-Martinez J, Court F, Rello-Varona S,Herrero-MartinD, Almacellas-Rabaiget O, Sainz-Jaspeado M, et al. DNA methylation profiling identifiesPTRF/Cavin-1 as a novel tumor suppressor in Ewing sarcoma when co-expressed with caveolin-1. Cancer Lett 2017;386:196–207.

16. Chalmers ZR, Connelly CF, Fabrizio D, Gay L, Ali SM, Ennis R, et al.Analysis of 100,000 human cancer genomes reveals the landscape of tumormutational burden. Genome Med 2017;9:34.

17. Brohl AS, Solomon DA, Chang W, Wang J, Song Y, Sindiri S, et al. Thegenomic landscape of the Ewing Sarcoma family of tumors reveals recur-rent STAG2 mutation. PLoS Genet 2014;10:e1004475.

18. Honoki K, Stojanovski E, McEvoy M, Fujii H, Tsujiuchi T, Kido A, et al.Prognostic significance of p16 INK4a alteration for Ewing sarcoma: ameta-analysis. Cancer 2007;110:1351–60.

19. Tate SC, Sykes AK, Kulanthaivel P, Chan EM, Turner PK, Cronier DM. Apopulation pharmacokinetic and pharmacodynamic analysis of abema-ciclib in a phase I clinical trial in cancer patients. Clin Pharmacokinet2018;57:335–44.

20. Fujiwara Y, Tamura K, Kondo S, Tanabe Y, Iwasa S, Shimomura A, et al.Phase 1 study of abemaciclib, an inhibitor of CDK 4 and 6, as a single agent

Dowless et al.





for Japanese patients with advanced cancer. Cancer Chemother Pharmacol2016;78:281–8.

21. Patnaik A, Rosen LS, Tolaney SM, Tolcher AW, Goldman JW, Gandhi L,et al. Efficacy and safety of abemaciclib, an inhibitor of CDK4 and CDK6,for patients with breast cancer, non-small cell lung cancer, and othersolid tumors. Cancer Discov 2016;6:740–53.

22. Gelbert LM, Cai S, Lin X, Sanchez-Martinez C, Del Prado M, LallenaMJ, et al. Preclinical characterization of the CDK4/6 inhibitorLY2835219: in-vivo cell cycle-dependent/independent anti-tumoractivities alone/in combination with gemcitabine. Invest New Drugs2014;32:825–37.

23. Torres-Guzman R, Calsina B, Hermoso A, Baquero C, Alvarez B, Amat J,et al. Preclinical characterization of abemaciclib in hormone receptorpositive breast cancer. Oncotarget 2017;8:69493–507.

24. Rader J, Russell MR, Hart LS, NakazawaMS, Belcastro LT, Martinez D, et al.Dual CDK4/CDK6 inhibition induces cell-cycle arrest and senescence inneuroblastoma. Clin Cancer Res 2013;19:6173–82.

25. Gong X, Litchfield LM, Webster Y, Chio LC, Wong SS, Stewart TR, et al.Genomic aberrations that activate d-type cyclins are associated withenhanced sensitivity to the CDK4 andCDK6 inhibitor abemaciclib. CancerCell 2017;32:761–76 e6.

26. Matsumoto Y, Tanaka K, Nakatani F,Matsunobu T,Matsuda S, Iwamoto Y.Downregulation and forced expression of EWS-Fli1 fusion gene results inchanges in the expression of G(1)regulatory genes. Br J Cancer2001;84:768–75.

27. Zhang J, Hu S, Schofield DE, Sorensen PH, Triche TJ. Selective usage ofD-Type cyclins by Ewing's tumors and rhabdomyosarcomas. Cancer Res2004;64:6026–34.

28. Kennedy AL, Vallurupalli M, Chen L, Crompton B, Cowley G, Vazquez F,et al. Functional, chemical genomic, and super-enhancer screening identifysensitivity to cyclin D1/CDK4 pathway inhibition in Ewing sarcoma.Oncotarget 2015;6:30178–93.

29. Houghton PJ, Morton CL, Tucker C, Payne D, Favours E, Cole C, et al. Thepediatric preclinical testing program: description of models and earlytesting results. Pediatr Blood Cancer 2007;49:928–40.

30. Bid HK, Phelps DA, Xaio L, Guttridge DC, Lin J, London C, et al. TheBromodomain BET Inhibitor JQ1 suppresses tumor angiogenesis in mod-els of childhood sarcoma. Mol Cancer Ther 2016;15:1018–28.

31. Lowery CD, VanWye AB, Dowless M, Blosser W, Falcon BL, Stewart J,et al. The checkpoint kinase 1 inhibitor prexasertib induces regression ofpreclinical models of human neuroblastoma. Clin Cancer Res 2017;23:4354–63.

32. Low J, Huang S, Blosser W, Dowless M, Burch J, Neubauer B, et al. High-content imaging characterization of cell cycle therapeutics through in vitroand in vivo subpopulation analysis. Mol Cancer Ther 2008;7:2455–63.

33. Low J, Shuguang H, Dowless M, Blosser W, Vincent T, Davis S, et al. High-content imaging analysis of the knockdown effects of validated siRNAs andantisense oligonucleotides. J Biomol Screen 2007;12:775–88.

34. Cahu J, Sola B. A sensitive method to quantify senescent cancer cells.J Vis Exp 2013;78:50494.

35. Falcon BL, Stewart J, Ezell S, Hanson J, Wijsman J, Ye X, et al. High-contentmultiplexed tissue imaging and quantification for cancer drug discovery.Drug Discov Today 2013;18:510–22.

36. Freund A, Orjalo AV, Desprez PY, Campisi J. Inflammatory networksduring cellular senescence: causes and consequences. Trends Mol Med2010;16:238–46.

37. Anders L, Ke N, Hydbring P, Choi YJ, Widlund HR, Chick JM, et al. Asystematic screen for CDK4/6 substrates links FOXM1 phosphorylationto senescence suppression in cancer cells. Cancer Cell 2011;20:620–34.

38. BurtonDG, Krizhanovsky V. Physiological and pathological consequencesof cellular senescence. Cell Mol Life Sci 2014;71:4373–86.

39. Goel S, DeCristo MJ, Watt AC, BrinJones H, Sceneay J, Li BB, et al. CDK4/6inhibition triggers anti-tumour immunity. Nature 2017;548:471–5.

40. Raciborska A, Bilska K, Drabko K, Chaber R, PogorzalaM,Wyrobek E, et al.Vincristine, irinotecan, and temozolomide in patients with relapsedand refractory Ewing sarcoma. Pediatr Blood Cancer 2013;60:1621–5.

41. Casey DA, Wexler LH, Merchant MS, Chou AJ, Merola PR, Price AP, et al.Irinotecan and temozolomide for Ewing sarcoma: the Memorial Sloan-Kettering experience. Pediatr Blood Cancer 2009;53:1029–34.

42. Harada K, Toyooka S, Maitra A, Maruyama R, Toyooka KO, Timmons CF,et al. Aberrant promotermethylation and silencing of the RASSF1A gene inpediatric tumors and cell lines. Oncogene 2002;21:4345–9.

43. Jin B, Robertson KD. DNA methyltransferases, DNA damage repair, andcancer. Adv Exp Med Biol 2013;754:3–29.

44. Chiappinelli KB, Strissel PL, Desrichard A, Li H, Henke C, Akman B, et al.Inhibiting DNA methylation causes an interferon response in cancer viadsRNA including endogenous retroviruses. Cell 2015;162:974–86.

45. Wack A, Terczynska-Dyla E, Hartmann R. Guarding the frontiers: thebiology of type III interferons. Nat Immunol 2015;16:802–9.

46. Levy DE, Marie IJ, Durbin JE. Induction and function of type I and IIIinterferon in response to viral infection. Curr Opin Virol 2011;1:476–86.

47. Schaer DA, Beckmann RP, Dempsey JA, Huber L, Forest A, Amaladas N,et al. The CDK4/6 inhibitor abemaciclib induces a T cell inflamed tumormicroenvironment and enhances the efficacy of PD-L1 checkpoint block-ade. Cell Rep 2018;22:2978–94.

48. Raub TJ, Wishart GN, Kulanthaivel P, Staton BA, Ajamie RT, Sawada GA,et al. Brain exposure of two selective dual CDK4 and CDK6 inhibitors andthe antitumor activity of CDK4 and CDK6 inhibition in combination withtemozolomide in an intracranial glioblastoma xenograft. Drug MetabDispos 2015;43:1360–71.

49. O'Brien N, Conklin D, Beckmann R, Luo T, Chau K, Thomas J, et al.Preclinical activity of abemaciclib alone or in combination with antimi-totic and targeted therapies in breast cancer. Mol Cancer Ther 2018;17:897–907.

50. Yokochi T, Robertson KD. Doxorubicin inhibits DNMT1, resulting inconditional apoptosis. Mol Pharmacol 2004;66:1415–20.






2018;24:6028-6039. Published OnlineFirst August 21, 2018.Clin Cancer Res Michele Dowless, Caitlin D. Lowery, Terry Shackleford, et al. Interferon Pathway SignalingMultipronged Regulation of Cell Cycle, DNA Methylation, and Abemaciclib Is Active in Preclinical Models of Ewing Sarcoma via

Updated version

10.1158/1078-0432.CCR-18-1256doi:

Access the most recent version of this article at:

Material

Supplementary

http://clincancerres.aacrjournals.org/content/suppl/2018/09/07/1078-0432.CCR-18-1256.DC2

Access the most recent supplemental material at:

Cited articles

http://clincancerres.aacrjournals.org/content/24/23/6028.full#ref-list-1

This article cites 50 articles, 10 of which you can access for free at:

Citing articles

http://clincancerres.aacrjournals.org/content/24/23/6028.full#related-urls

This article has been cited by 2 HighWire-hosted articles. Access the articles at:

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected]

To order reprints of this article or to subscribe to the journal, contact the AACR Publications Department at

Permissions

Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://clincancerres.aacrjournals.org/content/24/23/6028To request permission to re-use all or part of this article, use this link



http://clincancerres.aacrjournals.org/lookup/doi/10.1158/1078-0432.CCR-18-1256

http://clincancerres.aacrjournals.org/content/suppl/2018/09/07/1078-0432.CCR-18-1256.DC2

http://clincancerres.aacrjournals.org/content/24/23/6028.full#ref-list-1

http://clincancerres.aacrjournals.org/content/24/23/6028.full#related-urls

http://clincancerres.aacrjournals.org/cgi/alerts

mailto:[email protected]

http://clincancerres.aacrjournals.org/content/24/23/6028


abemaciclib is active in preclinical models of ewing ... · mal stem cells, which can lead to...

Documents