aac accepts, published online ahead of print on 4 may...
TRANSCRIPT
1
A non-canonical vancomycin resistance cluster from Desulfitobacterium hafniense Y51 1
Lindsay Kalan1, Sara Ebert
2, Tom Kelly
3and Gerard D. Wright
1* 2
3
Michael G. DeGroote Institute for Infectious Disease Research, Department of Biochemistry and 4
Biomedical Sciences, McMaster University, Hamilton, Ontario, Canada1, Department of 5
Biological Sciences, University of Alberta, Edmonton , Alberta, Canada2, and Department of 6
Microbiology, St. Josephs’ Health Care, Hamilton, Ontario, Canada3. 7
8
*Corresponding author: Michael G. DeGroote Institute for Infectious Disease Research, 9
McMaster University, 1200 Main St W., Hamilton, Canada L8N 3Z5. Email: 10
12
Running Title: New vancomycin resistance cluster in Desulfitobacterium 13
Copyright © 2009, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.Antimicrob. Agents Chemother. doi:10.1128/AAC.01408-08 AAC Accepts, published online ahead of print on 4 May 2009
on August 27, 2018 by guest
http://aac.asm.org/
Dow
nloaded from
2
ABSTRACT 14
The glycopeptide vancomycin is a drug of last resort for infection with Gram-positive organisms 15
and three genes are vital to resistance; vanH, vanA, and vanX. These genes are found in a 16
vanHAX cluster, which is conserved across pathogenic bacteria, glycopeptide antibiotic 17
producers, and other environmental bacteria. The genome sequence of anaerobic, Gram-18
positive, dehalogenating bacterium Desulfitobacterium hafniense Y51 revealed a predicted vanA 19
homolog however, it exists in a vanAWKmurFX cluster, unlike other vancomycin resistant 20
organisms. Using purified recombinant VanA from D. hafniense Y51 we determined its 21
substrate specificity and found it to have a 42-fold preference for D-Lactate over D-Alanine 22
confirming its activity as a D-Ala:D-Lac ligase and annotation as a VanA. Furthermore, we have 23
shown that D. hafniense Y51 is highly resistant to vancomycin where the minimum inhibitory 24
concentration for growth is 64 µg/mL. Finally, vanADh is expressed during growth in 25
vancomycin as demonstrated by RT-PCR. This finding represents a new glycopeptide antibiotic 26
resistance gene cluster and expands the genetic diversity of resistance to this important class of 27
antibiotic. 28
29
INTRODUCTION 30
The glycopeptide antibiotics such as vancomycin and teicoplanin continue to be frontline 31
therapies for the treatment of serious infections caused by Gram positive pathogens. These 32
antibiotics act on the outside of the cell by binding the terminal D-alanyl-D-alanine of nascent 33
peptidoglycan and precursors such as lipid II by a series of five hydrogen bonds (4, 17). 34
Clinical glycopeptide antibiotic resistance generally involves biosynthesis of 35
peptidoglycan terminating in D-Ala-D-X, where X is either Ser, whose side chain 36
on August 27, 2018 by guest
http://aac.asm.org/
Dow
nloaded from
3
hydroxymethyl group sterically interferes with the antibiotic-dipeptide interaction (20), or the α-37
hydroxy acid lactate (Lac) (4). High-level vancomycin resistance in vancomycin resistant 38
enterococci (VRE) and in glycopeptide producing bacteria is associated with the latter 39
substitution of D-Lac, resulting in a terminal depsipeptide (ester linkage) rather than a peptide 40
(amide linkage). Unlike D-Ala:D-Ser, D-Ala:D-Lac is isosteric with D-Ala:D-Ala, but the 41
substitution of the amide for an ester removes a critical hydrogen bond donor required for 42
optimal antibiotic interaction with peptidoglycan. This single change results in a 1000-fold 43
decrease in affinity of antibiotic for its target and clinical drug resistance (4). 44
Three genes are essential for D-Ala:D-Lac-mediated vancomycin resistance in 45
enterococci (VRE): vanH, vanA and vanX. vanH encodes a pyruvate dehydrogenase that 46
converts pyruvate to D-Lac. vanA encodes an ATP-dependent depsipeptide ligase that catalyzes 47
the synthesis of D-Ala:D-Lac. vanX encodes a dipeptidase that cleaves existing D-Ala:D-Ala in 48
the cell ensuring a cell wall enriched in D-Ala:D-Lac (1, 13). The phenotype is named after the 49
ligase VanA conferring high level resistance to both vancomycin and teicoplanin while 50
organisms displaying the VanB, D or F phenotype harbor D-Ala:D-Lac in their cell walls but 51
have varying levels of induction to different glycopeptide antibiotics. The vanHAX cluster (Fig. 52
1) is conserved in pathogens (VRE), in glycopeptide producing actinomycetes (17, 19), and can 53
also be found embedded in the genomes of environmental bacteria that do not produce 54
glycopeptides such as Streptomyces coelicolor (12), Paenibacillus sp. (8-10), and Frankia sp. 55
(Kalan and Wright unpublished). Furthermore, in a survey of ~500 soil bacteria 1% were shown 56
to be vancomycin resistant, and all resistant strains save 1 contained a vanHAX cluster as 57
determined by PCR (6). 58
on August 27, 2018 by guest
http://aac.asm.org/
Dow
nloaded from
4
Regardless of origin (VRE, environmental bacterium or glycopeptide producer) these 59
genes in high level vancomycin resitant organisms are always found in a vanHAX cluster (Fig. 60
1). Despite the ubiquity of this cluster, there are a number of different glycopeptide antibiotic 61
resistance phenotypes in VRE and other bacteria (15). Given the conservation of the vanHAX 62
cluster and of the associated biochemical mechanism, differences in glycopeptide resistance 63
phenotype are attributed to variable regulation of expression of these genes by a two-component 64
regulatory system comprised of VanS, a His kinase, and VanR, a response regulator (2) (Fig. 1). 65
A scan of recently sequenced genomes identified a vanA homolog in the genome of 66
Desulfitobacterium hafniense Y51, a strictly anaerobic, Gram positive rod with low G+C content 67
isolated from a site in Japan contaminated with halogenated organic compounds (18, 21). 68
Surprisingly, this homolog was not found in a vanHAX cluster but with a nearby vanX and a 69
vanW homolog, a protein of unknown function associated in VRE with the VanB phenotype (Fig 70
1). A similar arrangement was also found in the unpublished genome of D. hafniense DCB-2 71
(genome.jgi-psf.org/draft_microbes/desha/desha.home.html). 72
Here we report the biochemical characterization of this putative VanA as an active D-73
Ala:D-Lac ligase, part of a non-canonical vancomycin resistance gene cluster in the genome of 74
D. hafniense Y51. 75
76
MATERIALS AND METHODS 77
Cloning, expression and purification of D. hafniense Y51 VanA and Ddl homologs: 78
Desulfitobacterium hafniense Y51 strain and genomic DNA were generously provided by Dr. 79
Masatoshi Goto and Dr. Kensuke Furukawa (Kyushu University, Fukuoka, Japan). Cultures 80
were maintained in m-ISA medium consisting of 1% tryptone peptone, 0.35% sodium lactate, 81
on August 27, 2018 by guest
http://aac.asm.org/
Dow
nloaded from
5
0.05% Na2SO3, 0.2% MgSO4·7H2O, 0.05% iron (III) ammonium, and 0.001% resazurin, pH 7.2 82
and incubated at 30ºC. 83
Cloning of the putative D-Ala:D-Lac and D-Ala:D-Ala ligase gene from D. hafniense 84
Y51 was achieved by PCR amplification of the genes DSY3690 and DSY1579 respectively from 85
genomic DNA. Primers were designed to amplify 1.1 kB fragments from D. hafniese Y51 86
genomic DNA. Primers had attB sites engineered within to facilitate cloning using the 87
Gateway® technology (Invitrogen, Carlsbad, CA). The specific primers used for DSY3690 are : 88
5’- GGGGACAAGTTTGTACAAAAAAGCAGGCTTAATGGATCGGTTGAAAATCGCA-3’, 89
5’-GGGGACCACTTTGTACAAGAAAGCTGGGTCCCCATCCTATCGGCA-3’ 90
For DSY1579 the specific primer sequences are:: 5’-91
GGGGACAAGTTTGTACAAAAAAGCAGGCTYYCATATGATGACACGGCAAAAGATTA92
TTATTC-3’, 5’-93
GGGACCACTTTGTACAAGAAAGCTGGGTYAAGCTTCTAACGGGATATTTTCCGGG-3’ 94
The resulting PCR products were inserted into the pDEST17 (Invitrogen, Carlsbad, CA) 95
destination vector containing a 6xHis tag for ease of downstream purification. Gene integrity 96
was confirmed by DNA sequencing. Plasmids were propagated in Escherichia coli TOP10’ cells 97
and subsequently used to transform E. coli BL21 (DE3) Rosetta (Novagen, Darmstadt, Germany) 98
cells for high level protein expression under control of the T7 promoter. For VanAAo, VanADh, 99
and DdlDh overexpression, cells were propagated in 1 litre of Luria-Bertani broth until the optical 100
density at 600 nm reached 0.6. Protein expression was induced by addition of isopropyl β-D-1-101
thiogalactopyranoside to a final concentration of 1 mM and incubation of cultures at 16°C for 18 102
hours. Cells were harvested and washed in 0.85 % (w/v) NaCl before resuspension in 10 mL 103
on August 27, 2018 by guest
http://aac.asm.org/
Dow
nloaded from
6
lysis buffer (50 mM NaH2PO4; 300 mM NaCl; 10 mM imidazole; 1 mM phenylmethanesulfonyl 104
fluoride; 1 mM DNase; pH 8.0). Cells were lysed by four passes through a French pressure cell 105
at 1250 psi and cell debris removed by centrifugation at 27 000 x g for 30 min. The supernatant 106
was collected and purified enzyme was obtained using Nickel-NTA immobilized metal affinity 107
chromatography (Qiagen, Valencia, CA). Fractions containing the purified enzyme were pooled 108
and dialysed into 50 mM HEPES; 5 mM MgCl2; 1 mM EDTA; pH 8.0 at 4°C. 109
E. coli BL21(DE3) harboring pET28bvanAAo from the vancomycin producer 110
Amycolatopsis orientalis C329.2, was prepared as previously described (17) and purified as a 111
6xHis tagged protein as described above. E. coli W3110 harboring pTB2 for expression of the 112
D-Ala:D-Ala ligase DdlB was previously reported (24) . 113
Ddl assays: For qualitative determination of VanADh and DdlDh substrate specificity; initial 114
enzymatic characterization was carried out using the pyruvate kinase/lactate dehydrogenase 115
coupled assay to monitor ADP formation (22). Amino and hydroxy acid substrate specificity 116
was determined by thin-layer-chromatography and using radiolabelled substrates. Due to cost of 117
[U-14
C]-D-Alanine, [U-14
C]-L-Alanine was isomerized to a racemic mixture of [14
C]-L/D-118
Alanine with one unit of Bacillus stearothermophilus alanine racemase (SigmaAldrich). Ligase 119
reactions contained 50 mM HEPES pH 7.5; 10 mM MgCl2; 40 mM KCl; 6 mM ATP; 2 µM 120
enzyme; 0.1 µCi [U-14
C]-L/D-Ala; 1 mM D-Ala and 10 mM D-X substrate. Reactions were 121
quenched with 50% methanol and applied onto a PEI- cellulose TLC plate (SigmaAldrich). The 122
plates were developed in 12:3:5 butanol:acetic acid: water, dried overnight and exposed to a 123
phosphor-storage imaging screen. The screens were imaged using a Typhoon™ variable mode 124
imager and relative radioactive intensity was quantified using ImageQuant 5.2 software. 125
on August 27, 2018 by guest
http://aac.asm.org/
Dow
nloaded from
7
Michaelis-Menten kinetics were determined by using the software program GraFit 126
version 4.0.21 (Erithacus software) and initial rates were determined using the non-linear least 127
squares method and equation 1 (14). 128
v = (kcat/Et)[S]/(KM + [S]) [1] 129
RNA preparation: Cultures of D. hafniense Y51 were grown in m-ISA media (ref) for 24 hours 130
and diluted 1/100 into m-ISA containing 0 µg/mL or 125 µg/mL vancomycin and incubated at 131
30ºC for 24 or 48 hours. Cultures were harvested by centrifugation for 15min at 3000 x g and 132
the pellets resuspended in 1mL of RNAprotect bacterial reagent (Qiagen, Valenica, CA). After 133
subsequent centrifugation, total RNA was extracted using the RNeasy Mini Kit (Qiagen, 134
Valencia, CA) following the enzymatic lysis and proteinase K digestion of bacteria (protocol 4) 135
before purification of total RNA (protocol 7). An on column DNAse I digestion was performed 136
in addition to a post elution DNAse I digestion and additional column purification. RNA was 137
quantified using a NanoDrop ND-1000 spectrophotometer and checked for genomic DNA 138
contamination by PCR analysis. 139
Expression analysis: Reverse transcription was carried out with 0.3 µg of DNAse I treated RNA 140
and 200 ng of random hexamers to generate cDNA using the Superscript III RT kit (Invitrogen, 141
Carlsbad, CA). The samples were incubated at 25ºC for 5 minutes prior to 50ºC for 45 minutes 142
followed by inactivation at 70ºC for 15 minutes. 1µL of the RT reaction was used for real-time 143
PCR with SYBR green in a SmartCycler system (Cepheid, Sunnyvale, CA). The following 144
primers were designed to amplify a 293 bp vanADh product and a 270 bp ddlDh product in a 25µL 145
reaction volume. vanA Dh primers are 5’-TTCTTCTTGGCGGCATACTT-3’ and 5’-146
ATCTGGTGTTTCCCGTTCTG-3’ while ddlDh primers are 5’-147
GTGAAGAACGGGGAAAATCA-3’ and 5’-CAATCCGGAGAACATGAGGT-3’. The results 148
on August 27, 2018 by guest
http://aac.asm.org/
Dow
nloaded from
8
were normalized by the 2-∆∆C
T method (16) to 16S rRNA expression using the primers 5’-149
AGGCCTTCGGGTTGTAAAGT- 3’ and 5’-ATACCCAGTTTCCGATGCAG-3’ to amplify a 150
237 bp product. Products were analyzed on a 1% agarose gel to confirm a single product was 151
amplified. 152
Antibiotic susceptibility testing : D. hafniense Y51 susceptibility tests for vancomycin and 153
teicoplanin using disc-diffusion assays were performed according to CLSI methods (5).. In 154
addition, the minimum inhibitory concentration (MIC) for vancomycin was determined using 155
Etest gradient strips (Dalvagen, Solna, Sweden). The organism was grown on purchased 156
Brucella agar with 5% sheep blood, vitamin K and hemin supplements (PML Microbiologicals, 157
Wilsonville, OR,) and the manufacturer’s protocol was followed for MIC determination. 158
159
RESULTS & DISCUSSION 160
Expression and characterization of VanA and Ddl homologues from D. hafniense 161
Y51. BLAST search of the D. hafniense Y51 genome revealed two predicted D-Ala-D-X ligase 162
genes. The first, DSY1579, is a predicted D-Ala:D-Ala ligase (DdlDh) while the second, 163
DSY3690, is homologous to VanA-like D-Ala:D-Lac ligases (VanADh) (Table 1). The ddlDh 164
gene is located proximal to other genes predicted to encode peptidoglycan assembly proteins 165
(e.g. DD-carboxypeptidase). Conversly, vanADh is clustered with murF, vanX, vanK, and vanW 166
homologues and a predicted vanSR two component regulatory system (Fig 1). We hypothesized 167
that this novel vanAWKmurFX cluster may encode an alternative glycopeptide resistance cluster 168
rather than the canonical vanHAX found in VRE, glycopeptide producers, and other 169
environmental bacteria. As noted above, VanX is a D-Ala:D-Ala hydrolase required to eliminate 170
constitutively produced D-Ala:D-Ala. VanK (11, 12) is a FemX protein that catalyzes the cross 171
on August 27, 2018 by guest
http://aac.asm.org/
Dow
nloaded from
9
linking reaction of peptidoglycan terminating in D-Ala:D-Lac (where native FemX enzymes will 172
not), while MurF adds the D-Ala:D-Lac depsipeptide to the growing chain (7). VanW on the 173
other hand is a protein of unknown function associated with VanB phenotype resistance clusters 174
(Fig. 1). Bateman et al. hypothesized that VanW may be important in localizing other 175
vancomycin resistant proteins to unlinked peptidoglycan based on the presence of a G5 domain 176
in the C-terminus, which may bind to N-acetylglucosamine residues (3). 177
In order to experimentally verify the predicted biochemical activities of the D. hafniense 178
Y51 predicted D-Ala-D-X ligase genes, each was overexpressed as His6-tag fusions in E. coli, 179
and purified by immobilized metal affinity chromatography by standard methods yielding pure 180
proteins (Fig. 2). 181
Substrate specificity of recombinant D-Ala-D-X ligases: The amino acid specificity of 182
VanADh and DdlDh was qualitatively determined using [U-14
C]-D-Ala and unlabled D-amino and 183
D-hydroxy acid substrates followed by separation of the products by thin-layer chromatography 184
on a PEI-cellulose plate. DdlB, the D-Ala:D-Ala ligase from E. coli and VanAAo, the D-Ala:D-185
Lac ligase from the vancomycin producer A. orientalis C329.2, were used as positive controls. 186
DdlB is only able to produce D-Ala:D-Ala, while VanAAo catalyzes D-Ala:D-Lac synthesis. 187
Although the amino acid sequence identity is only 34%, DdlDh exhibits activity similar to that of 188
E. coli DdlB, producing only D-Ala:D-Ala even in the presence of excess (10-fold) D-Lac. In 189
contrast, the conserved amino acid identy between VanADh and VanAAo is 67% and VanADh 190
shows substrate specificity similar to VanAAo, producing only D-Ala:D-Lac (Table 1, Fig.3). 191
The functions of the two D-D ligases in D. hafniense Y51 clearly show different substrate 192
specificities indicating that VanADh is able to produce D-Ala:D-Lac, an observation consistent 193
with our hypothesis that vanAWmurFKX may encode an alternate glycopeptide resistance cluster. 194
on August 27, 2018 by guest
http://aac.asm.org/
Dow
nloaded from
10
Steady state kinetics of D-Ala:D-Ala/Lac Ligases: We performed steady state kinetic analyses 195
to quantify the enzyme activity of VanADh. Purified ligases were kinetically characterized for 196
utilization of D-Ala, D-Lac, and ATP by monitoring the change in absorbance at 340 nm with 197
the coupled pyruvate kinase-lactate dehydrogenase continuous ADP release assay. The results 198
indicate (Table 2) that D-Lac is the preferred substrate for VanADh where the KM is 0.53 mM 199
compared to 22 mM for D-Ala. Furthermore, the catalytic efficiency (kcat/KM) is 42-fold higher 200
for D-Lac under the same conditions. DdlDh was unable to use D-Lac as a substrate (10 mM) and 201
the kcat/KM for D-Ala is comparable to the kcat/KM for D-Lac utilization by VanADh (3.1x103 and 202
1.1x103 M
-1s
-1 respectively). 203
The enzymes bind two molecules of D-amino/hydroxy acids in two distinct binding sites 204
(24). The first is always D-Ala thus we are measuring the kinetic parameters for the second 205
binding site using the coupled assay. Although the active site discriminates which hydroxy 206
amino acid it prefers, in the case of VanADh some D-Ala:D-Ala is concurrently being formed in 207
addition to D-Ala:D-Lac. Unfortunately, it is difficult to resolve the rate and the effect on D-208
Ala:D-Lac formation using the spectrophotometric coupled assay. The markedly large increase 209
in kcat/KM is a good indicator of the discrimination for D-Lac in the active site of the enzyme; 210
however, this assay is unable to quantify directly the formation of D-Ala:D-Lac. Therefore, a 211
direct TLC assay involving radiolabelled substrates was employed. Using this approach, the KM 212
for D-Lactate is 0.8 mM while the kcat is 7.6 x 10-2
s -1
and the kcat/KM is 1.7 x 102
M-1
s-1
(Table 2). 213
D. hafniense Y51 is vancomycin resistant: D. hafniense Y51 was found to be resistant to 214
vancomycin as indicated by no inhibition of growth around a 5 µg vancomycin paper disc while 215
only intermediately resistant to teicoplanin indicated by a 40 mm zone of inhibition around a 30 216
on August 27, 2018 by guest
http://aac.asm.org/
Dow
nloaded from
11
µg disc. The minimum inhibitory concentration for vancomycin was determined using Etest 217
gradient strips and found to be 64 µg/mL. 218
vanADh expression levels during growth in vancomycin: The induction of vancomycin 219
resistance by vanADh was examined by real-time PCR. Relative RNA levels were normalized to 220
16S rRNA expression and it was determined that vanADh expression is increased 181 and 256 221
fold after 24 and 48 hours incubation in vancomycin respectively. Furthermore, ddlDh RNA 222
levels remained constant regardless of growth in the presence or absence of vancomycin. The 223
fold change of ddlDh upon addition of vancomycin was only 1.19 and 1.23 after 24 and 48 hours 224
growth respectively (Fig. 4). 225
Summary and conclusions. We have identified a glycopeptide antibiotic resistance cluster with 226
novel gene organization in the dehalorespiring organism D. hafniense Y51. This cluster includes 227
predicted vanA and vanX genes as well as additional auxiliary genes predicted to be required for 228
inducible glycopeptide resistance. Biochemical analysis of recombinant VanADh confirms that it 229
is a functional D-Ala:D-Lac ligase. Although, a D-lactate dehydrogenase (vanH) was not part of 230
this new cluster, four annotated D-isomer specific 2-hydroxyacid dehydrogenase genes 231
(DSY0996, DSY1673, DSY3442, and DSY4020) are present in the genome of D. hafniense Y51. 232
The organism exhibits high level resistance to vancomycin even though these dehydrogenases 233
have less than 30% identity to VanH, and therefore at least one of these gene products can 234
provide the requisite D-Lac substrate for VanADh. 235
This new vancomycin resistance cluster expands our understanding of the genetic 236
diversity that encompasses the vancomycin resistome, which includes all the genes in pathogenic 237
and environmental bacteria that can give rise to glycopeptide resistance (23). The presence of 238
this new vancomycin resistance cluster gives rise to a number of unanswered questions 239
on August 27, 2018 by guest
http://aac.asm.org/
Dow
nloaded from
12
including: why do D. hafniense harbor these genes (is it antibiotic resistance or some 240
physiological advantage for D-Ala:D-Lac terminating cell walls?); is this gene cluster more wide 241
spread in other organisms?; and can this new cluster be mobilized into pathogenic bacteria like 242
vanHAX? While the answers to these questions require further study, what is clear is that 243
continued microbial genome sequencing is revealing the remarkable depth of the antibiotic 244
resistome within microbial populations across the globe. 245
246
ACKNOWLEDGEMENTS 247
We are grateful for the assistance of Dr Julia Foght, University of Alberta. This work was 248
supported by Grant MT-13536 and a graduate student award from the Canadian Institutes of 249
Health Research and a Canada Research Chair to GDW. 250
on August 27, 2018 by guest
http://aac.asm.org/
Dow
nloaded from
13
REFENCES 251
1. Arthur, M., and P. Courvalin. 1993. Genetics and mechanisms of glycopeptide 252
resistance in enterococci. Antimicrob Agents Chemother 37:1563-71. 253
2. Arthur, M., C. Molinas, and P. Courvalin. 1992. The VanS-VanR two-component 254
regulatory system controls synthesis of depsipeptide peptidoglycan precursors in 255
Enterococcus faecium BM4147. J Bacteriol 174:2582-91. 256
3. Bateman, A., M. T. Holden, and C. Yeats. 2005. The G5 domain: a potential N-257
acetylglucosamine recognition domain involved in biofilm formation. Bioinformatics 258
21:1301-3. 259
4. Bugg, T. D., G. D. Wright, S. Dutka-Malen, M. Arthur, P. Courvalin, and C. T. 260
Walsh. 1991. Molecular basis for vancomycin resistance in Enterococcus faecium 261
BM4147: biosynthesis of a depsipeptide peptidoglycan precursor by vancomycin 262
resistance proteins VanH and VanA. Biochemistry 30:10408-15. 263
5. CLSI. 2007. Methods for Antimicrobial Susceptibility Testing of Anaerobic Bacteria, 7 264
ed. Approved standard M11-A7 ed, vol. 27, Wayne, PA. 265
6. D'Costa, V. M., K. M. McGrann, D. W. Hughes, and G. D. Wright. 2006. Sampling 266
the antibiotic resistome. Science 311:374-7. 267
7. El Zoeiby, A., F. Sanschagrin, and R. C. Levesque. 2003. Structure and function of the 268
Mur enzymes: development of novel inhibitors. Mol Microbiol 47:1-12. 269
8. Guardabassi, L., and Y. Agerso. 2006. Genes homologous to glycopeptide resistance 270
vanA are widespread in soil microbial communities. FEMS Microbiol Lett 259:221-5. 271
9. Guardabassi, L., H. Christensen, H. Hasman, and A. Dalsgaard. 2004. Members of 272
the genera Paenibacillus and Rhodococcus harbor genes homologous to enterococcal 273
glycopeptide resistance genes vanA and vanB. Antimicrob Agents Chemother 48:4915-8. 274
10. Guardabassi, L., B. Perichon, J. van Heijenoort, D. Blanot, and P. Courvalin. 2005. 275
Glycopeptide resistance vanA operons in Paenibacillus strains isolated from soil. 276
Antimicrob Agents Chemother 49:4227-33. 277
11. Hong, H. J., M. I. Hutchings, L. M. Hill, and M. J. Buttner. 2005. The role of the 278
novel Fem protein VanK in vancomycin resistance in Streptomyces coelicolor. J Biol 279
Chem 280:13055-61. 280
12. Hong, H. J., M. I. Hutchings, J. M. Neu, G. D. Wright, M. S. Paget, and M. J. 281
Buttner. 2004. Characterization of an inducible vancomycin resistance system in 282
Streptomyces coelicolor reveals a novel gene (vanK) required for drug resistance. Mol 283
Microbiol 52:1107-21. 284
13. Kahne, D., C. Leimkuhler, W. Lu, and C. Walsh. 2005. Glycopeptide and 285
lipoglycopeptide antibiotics. Chem Rev 105:425-48. 286
14. Leatherbarrow, R. J. 1992. GraFit, 4.0.21 ed. Erithacus Software Ltd. 287
15. Levine, D. P. 2006. Vancomycin: a history. Clin Infect Dis 42 Suppl 1:S5-12. 288
16. Livak, K. J., and T. D. Schmittgen. 2001. Analysis of relative gene expression data 289
using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25:402-290
8. 291
17. Marshall, C. G., I. A. Lessard, I. Park, and G. D. Wright. 1998. Glycopeptide 292
antibiotic resistance genes in glycopeptide-producing organisms. Antimicrob Agents 293
Chemother 42:2215-20. 294
on August 27, 2018 by guest
http://aac.asm.org/
Dow
nloaded from
14
18. Nonaka, H., G. Keresztes, Y. Shinoda, Y. Ikenaga, M. Abe, K. Naito, K. Inatomi, K. 295
Furukawa, M. Inui, and H. Yukawa. 2006. Complete genome sequence of the 296
dehalorespiring bacterium Desulfitobacterium hafniense Y51 and comparison with 297
Dehalococcoides ethenogenes 195. J Bacteriol 188:2262-74. 298
19. Pootoolal, J., M. G. Thomas, C. G. Marshall, J. M. Neu, B. K. Hubbard, C. T. 299
Walsh, and G. D. Wright. 2002. Assembling the glycopeptide antibiotic scaffold: The 300
biosynthesis of A47934 from Streptomyces toyocaensis NRRL15009. Proc Natl Acad Sci 301
U S A 99:8962-7. 302
20. Reynolds, P. E., H. A. Snaith, A. J. Maguire, S. Dutka-Malen, and P. Courvalin. 303
1994. Analysis of peptidoglycan precursors in vancomycin-resistant Enterococcus 304
gallinarum BM4174. Biochem J 301 ( Pt 1):5-8. 305
21. Villemur, R., M. Lanthier, R. Beaudet, and F. Lepine. 2006. The Desulfitobacterium 306
genus. FEMS Microbiol Rev 30:706-33. 307
22. Wampler, D. E., and E. W. Westhead. 1968. Two aspartokinases from Escherichia 308
coli. Nature of the inhibition and molecular changes accompanying reversible 309
inactivation. Biochemistry 7:1661-71. 310
23. Wright, G. D. 2007. The antibiotic resistome: the nexus of chemical and genetic 311
diversity. Nat Rev Microbiol 5:175-86. 312
24. Zawadzke, L. E., T. D. Bugg, and C. T. Walsh. 1991. Existence of two D-alanine:D-313
alanine ligases in Escherichia coli: cloning and sequencing of the ddlA gene and 314
purification and characterization of the DdlA and DdlB enzymes. Biochemistry 30:1673-315
82. 316
317
on August 27, 2018 by guest
http://aac.asm.org/
Dow
nloaded from
15
Figure Legends 318
Fig 1: Organization of vancomycin resistance cassettes in glycopeptide producing (Actinoplanes 319
teichomyceticus,and Streptomyces toyocaensis), pathogenic (Vancomycin Resistant Enterococci 320
Van A and B) and environmental bacteria (Paenibacillus apiarius PA-B2B, Streptomyces 321
coelicolor, Desulfitobacterium hafniense Y51 and DCB-2). 322
Fig 2. Purification of recombinant D. halfniense D-Ala-D-X-ligases. Ni-NTA purified fractions 323
of A) VanADh and B) DdlD were separated on a 4-12 % SDS-polyacrylamide gel and stained 324
with Coomassie Blue. 325
Fig 3. Substrate specificity of D-Ala:D-X ligases. Substrate specificity was examined using [U-326
14C]-D-Ala and either D-Ala or D-Lac. The products of each reaction were separated by TLC 327
and exposed to a phospor-storage screen. All reaction contain 0.1 µCi [U-14
C]-D-Ala and a) 10 328
mM D-Ala; b) 1 mM D-Ala, 10 mM D-Lac or c) 10 mM D-Lac. VanADh exhibits activity 329
similar to the D-Ala:D-Lac ligase VanAAo from Amycolatopsis orientalis while DdlDh shows 330
activity similar to the E. coli D-Ala:D-Ala ligase DdlB. The negative control (-) has no enzyme. 331
Fig 4. Change in expression levels of vanADh (striped bars) and ddlDh (shaded bars) after growth 332
in 125 µg/mL vancomycin. Relative RNA levels are normalized to 16S rRNA levels after 24 333
and 48 hours of growth. 334
on August 27, 2018 by guest
http://aac.asm.org/
Dow
nloaded from
16
Table 1: Comparison of the percent identity between DdlDh and VanADh with various Ddls: 335
DdlB (E. coli); DdlBc (B. cereus); DdlCb (C. botulinum A str. ATCC 3502); DdlStm ( S. 336
typhimurium); VanASt (S. toyocaensis); VanAAt (A. teichomyceticus); VanAAo (A. orientalis 337
C329.2); VRE VanA (E. faecium); VanASt ( S. toyocaensis) and VanA,B,D,F ( Enterococcal 338
clinical phenotypes). 339
340
Enzyme DdlDh VanADh VanXDh VanWDh
DdlB 34 31
DdlBc 31 33
DdlCb 31 34
DdlStm 35 31
VanA 35 64
VanB 37 66
VanD 35 61
VanF 36 64
VanASt 35 74
VanAAt 36 70
VanAAo 36 67
VanX 66
VanXB 65
VanXD 66
VanXF 69
VanXAt 74
VanXSt 74
VanXAo 71
VanWG 54
VanWB 51
341
342
Table 2. Kinetic characterization of D. hafniense Y51 D-Ala-D- Lac and D-Ala:D-Ala
ligase using the pyruvate kinase/lactate dehydrogenase assay or [14
C]-D-Ala radioactive
assay
Enzyme Product KM (mM) kcat (s-1
) kcat/KM (M-1
s-1)
VanADh D-Ala:D-Ala 22 ± 2.6 0.58 ± 0.03 2.6 x 101
D-Ala:D-Lac 0.53 ± 0.06 0.61 ± 0.02 1.1 x 103
ATP 0.013 ±0.001 0.65 ± 0.01 4.7 x 104
[14
C]-D-Ala:D-Lac 0.80 ± 0.08 0.0076 ± 0.003 1.7 x 102
DdlDh D-Ala:D-Ala 0.26 ± 0.05 0.80 ± 0.05 3.1 x 103
ATP 0.018 ± 0.002 0.68 ± 0.02 3.8 x 104
on August 27, 2018 by guest
http://aac.asm.org/
Dow
nloaded from
17
Figure 1 343
344
345
346
on August 27, 2018 by guest
http://aac.asm.org/
Dow
nloaded from
18
70
55
40
kDa A B
Figure 2 347
348
349
350
351
352
353
354
355
on August 27, 2018 by guest
http://aac.asm.org/
Dow
nloaded from
19
Figure 3 356
357
358
359
360
361
362
363
364
365
366
367
368
369
370
371
372
373
on August 27, 2018 by guest
http://aac.asm.org/
Dow
nloaded from
20
1
10
100
1000
24 48
Time (hrs)
Rela
tive R
NA
levels
Figure 4 374
376
on August 27, 2018 by guest
http://aac.asm.org/
Dow
nloaded from