avocadod2g5na3xotdfpc.cloudfront.net/uploads/pdf/5927_fresh-mag-may-2012.pdfyour emails and letters...
TRANSCRIPT
ISSUE XX • XXXXXX 2012
9 300633 257477
ISSUE 75 • MAY 2012
MothEr’S dAY budget gift ideas hIgh tEA wIth A twISt
woolworths.com.au
weeknightdinners
freshmarketupdate
how to Choose and prepare P11
+ SpEEdY StIr-frIES+MIX ‘n’ MAtch SIdES+ prEp lIkE A chEf
avoCado
quick & easy
free
o ne- pot fami l ymea ls to addto your menu
FRE0512p001_coverR.indd 1 23/3/12 10:35:06 AM
freshGet great value when you visit yourlocal Woolworths supermarket.
Hass avocadosPacked with essentialnutrients and healthyfats, Woolworths stockdifferent varieties ofavocados year-round.
Cooked AussieTiger prawnshave distinctive dark-brown or rusty-orangestripes. They’re deliciouson their own or servedwith half an avocado anda drizzle of lemon.
RicottaThis is one ingredient thatshould always be a fridgestaple — it’s brilliant forboth savoury and sweetrecipes, plus it’s low in fat.
fruit &vegetables
Leg of lambCooking a roast for mum?You can’t go past theversatility of lamb — ourlamb legs are incrediblytender and are suitablefor a variety of cookingmethods (just rememberto rest the lamb properlyafter roasting.)
startgo!
Discover the freshest produce, new ideas and great
meatcabinet
Bulk-pack muffinsHost your own morningtea, without sweating atthe stove — these BulkPack Muffins (24pk) arethe perfect ready-to-serve morning tea snackat a great-value price.
the delicounter
thebakery
ILLU
STRATIO
NSCHRISTINA
BOLL
ENBACH
seafoodcounter
Kraft Live ActiveCheese Slices 10pkTrying to reduce yourcholesterol and missingyour favourite cheese?Kraft have the perfectsolution! Kraft Live Activecheese has been provento lower cholesterol. Bonus!
in thefridge
in store
A u s t r A l i A ’ s b i g g e s t m o r n i n g t e A
FRE0512p002-003mapR.indd 2 26/3/12 8:18:20 PM
Handy HintWhether you’re putting ona special lunch or looking
for an affordable gift, Woolworths haseverything you need to make Mumfeel special this Mother’s Day!Nicky HarperWoolworths Fresh MagazineLiaison Manager
Nestle PetersAlmond BrownieIce Cream Cake 1.2LPerfect for celebratingMother’s Day, thisindulgent cake has achocolate-brownie base,vanilla and choc-chipice-cream topping,sprinkled with sliveredalmonds. It’s a guaranteedwinner. Yum!
Jelly Baby monthYou can make lifebetter for people withtype 1 diabetes andfund research for thisdisease by purchasingthe Juvenile DiabetesResearch Foundation(JDFR) Jelly Babymerchandise fromWoolworths thismonth. You can alsomake a donationof any amount atthe checkout. Alldonations over $2are tax deductible.
at thecheckout
woolworthsliquor
South Island PinotNoir 750mlProduced in CentralOtago, one of NewZealand’s famous wineregions, the long sunnyseasons and cool nightshelp produce the finestwines. Exotic fruitflavours, both vibrantand dense on the palatecombine to produce asoft, lingering elegance.
savings at your local Woo lworths every day!
liquor
South Island PinotNoir 750mlProduced in CentralOtago, one of NewZealand’s famous wineregions, the long sunnyregions, the long sunnyseasons and cool nightsseasons and cool nightshelp produce the finesthelp produce the finestwines. Exotic fruitwines. Exotic fruitflavours, both vibrantflavours, both vibrantand dense on the palateand dense on the palatecombine to produce acombine to produce a
Woolworths SelectDeli-style ChipsThese incredibly tasty chipsare a delicious treat — cutfine and full flavoured,these deli-style chips arethe crunchiest crispsaround (and at a bargainprice to boot!)
groceries
macro wholefoodsmarket organicextra virgin olive oilThis high-quality organicextra virgin olive oil hasa distinct olive flavour andbeautiful, light fruity notes.
in thefreezer
macro wholefoodsmarket organicboxed chocolatesThe perfect gift forgourmet mums, theseorganic boxed chocolatesare a delicious temptationthat’s impossible to resist.
groceries
ILLU
STRATIO
NSCHRISTINA
BOLL
ENBACH groceriesgroceries
may supermarket update |
FRE0512p002-003mapR.indd 3 26/3/12 8:13:32 PM
LIMITED EDITION ON
CATCHES, COATS AND DE-CLUMPSEVERY LASH.
SATIN BLACKSATIN BLACK
A U S T R A L I A
CCCCACACACACACACACACACACACACACAACACAAACACAACAAAAAATCTCTCTCTCTCTCTCTCTCTCTCTCTTTTCCTTTCCTCTTCTCTTCCCCCHEHEHEHEHEHEHHEHEHEHHHHEHHHHEHEHHEHEHHEES,S,S,S,S,SS,SSS,S,SS,SS,SSS,S,S,S
BOLDER, BLACKER, GLOSSIER... BUT NEVER BULKY.
STRAIGHT FROM THE AUSTRALIAN CATWALK
MAY1593_Fresh_R.pdf Page 1 9/03/12, 2:58 PM
dearmumThank you for being our teacher,chef, taxi and nurse every day!
WOOLWORTHSFRESH MAGAZINE TEAM
Happy Mother’s Day to our mums !
Woolworths Brand ManagerJo Shapland – Mum Pat
Woolworths Fresh Magazine Liaison ManagerNicky Harper – Mum Thelma
Woolworths Sales Liaison ManagerLouise Taylor – Mum Jennifer
EditorClarissa Di Pietrantonio
Mum Frances and Nonna Antonietta
Food EditorChristine Sheppard – Mum Dawn
Group Senior Art DirectorMichelle Wiener – Mum Betty
Deputy Art DirectorLaila Ambour – Mum May
Woolworths Publishing Liaison ManagerAlana Watts – Mum Gwen
Production ManagerNeridah Burke – Mum Lois
Advertising Production CoordinatorLisa Kypreos – Mum Maria
To the special mums, grandmothers, aunts, sisters and friendsin our lives — thank you. We know you have lots to juggle betweenfamily, a busy household and work, so we’re committed to helping makelife that little bit easier for you. Check out our simple weeknight dinners(p17) with a kid-friendly twist, or our fresh ideas with in-season Avocadosthat Baby can enjoy too!For mums-to-be, from our colleagues at the Woolworths Baby & Toddler
Club, we learn what (and what not) to eat while you’re expecting (p40).Need some Mother’s Day inspiration? We’ve packed this issue with lots
of sweet ideas to say Happy Mother’s Day to the special lady in your life.And best of all, you can find everything you need at your local Woolworths.Until next time,
The fresh team
Join the conversation onfacebook.com/woolworths
Download the WoolworthsApp for iPhone or Android.
For more recipe ideas andWoolworths news, visit usonline at woolworths.com.au
PUBLiSHED By NEWS LiFE MEDiA PTy LTD (ACN 008 923 906), 170-180Bourke Rd, Alexandria, NSW 2015. NewsLifeMedia Pty Ltd is a wholly owned subsidiary ofNews Limited (ACN 007 871 178). Copyright 2012 by NewsLifeMedia Pty Ltd. All rights reserved. Reproduction in whole or part is strictly forbidden without the writtenpermission of the publisher. Woolworths Fresh and NewsLifeMedia Pty Ltd accept no responsibility in respect of any products, services or goods which may be presentedin this magazine, or any errors, omissions or mistakes in editorial references. Woolworths Fresh March 2012. Colour separations by Sinnotts Bros.Products featured in Woolworths Fresh magazine are available in all states in the majority of stores unless specified.ISSN 1839-7123Printed by Hannanprint, 55 Doody Street, Alexandria NSW 2015, iSO 14001 Environmental Management Certified. Paper fibre is sourced from certified forests and controlled sources.
Christine and Nickyenjoy a giggle onset at
our Cover shoot.
Clarissa and Michellecheck out the stylist’sprops for the next shot.
Remember toscan your issueat the checkoutEach month, we receive
your emails and letters
asking us where you
can find your free issue
of Woolworths Fresh.By scanning your copy
at the check out each
month, you can help us
decide if your local store
needs more copies. So
next time you shop at
Woolworths, remember
to present Fresh at the
check out for scanning.
FRE0512p005letterR.indd 5 26/3/12 4:42:50 PM
Happiness made simple
The beauty of cooking in one pan?All the flavours infuse in one pan.Introducing new MAGGI ONE PAN meals, a range of delicious recipes that allow you to cook everything in just one pan, including the pasta! With 6 tasty meals to choose from, try one today, because tasting is believing. maggi.com.au
NSC0305_OnePan_WF.pdf Page 1 28/03/12, 11:57 AM
May 2012
9 calendarWhat’s happening thismonth at Woolworths
11 fresh market updateAll you need to knowabout avocados
17 weeknight dinnersEasy one-pot mealsto feed your family
35 fresh food kidsGreat gift ideas for kidsto make for mum
29 high tea for the girlsMake a high tea withitems from the bakery
22 margaret fultonSlice and dice like a prowith these great tips
16 all aboutOrganic extra virginolive oil
contentswhat’shappeningthismonthMother’sDay13 may
Woolworths fresh 7
26 gifts for mumTreat mum to a rangeof clover hill flowers
38 select and saveGreat meal ideas thatcan be ready in minutes
46 10 ways with ...new ideas with macroorganic yoghurt
next month ...All about oranges and thebest of winter comfort food
40 health & wellbeingWhat to eat whenyou’re expecting
FRE0512p007contents.indd 7 27/3/12 12:01:14 PM
Meet the expertsWe’ve put together a team of expertsto help you in parenthood:Dr Mark Livingstone (below left)As deputy medical director of Genea,Mark is our resident fertility expert.Dr Ginni Mansberg (below right)Mum to a blended family of eight,Ginni is our GP and health expert.Emma Sutherland Our residentnutritionist is a first-time mum todaughter Sophia and brings withher a wealth of information on
eating the right foods. Follow herblog and articles.Kim McCosker 4 Ingredients authorand mum to three boys, Kim knowshow to feed a family on a budget.
We’re so excited with thelaunch of our new WoolworthsBaby and Toddler Club thatwe’re encouraging mums anddads all over Australia to getinvolved online!
MeMbership is free!Join our baby and Toddler Cluband get exclusive offers on productsfor babies and toddlers; as well aspregnancy and parentinginformation from our experts. Withgreat offers available to clubmembers, you can save money onspecial family events and productsin your local Woolworths store.
parenT foruM The Woolworthsbaby and Toddler Club forum is agreat place for you to chat, interact,share tips and connect with otherparents in an online community.
HOW TO JOINYou can join the new Woolworthsbaby and Toddler Club, simplylog in with your existing everydayrewards* account. Visit woolworthsbabyandtoddlerclub.com.au/joinand enter your everyday rewardsdetails. if you are not an everydayrewards card holder, simply fillout a form in store or apply online.Visit us at woolworths.com.aufor details.* excludes Tasmania.
baby food recipesAs you’d expect from The Fresh FoodPeople, fresh food and nutrition is atthe heart of our Baby and Toddler Club,with more than 100 recipes. Check outthe recipe tab on the website.
bump, baby, you and the familyAs you journey through parenthood,the Woolworths Baby and Toddler Clubis with you every step of the way withgreat advice on nutrition and diet(see our nutrition for pregnancystory on p40).
share your best recipesAs a member of the WoolworthsBaby and Toddler Club, you canupload photos and share your ownbaby food recipes! Plus — downloadour great meal plans!
Meet the latest addition to the Woolworths family— the new Woolworths Baby and Toddler Club!
Apple purée
Apple & apricot crumble
Dr Ginni MansbergDr Mark Livingstone
Woolworths fresh�
|woolworths news
FRE0512p008baby.indd 8 26/3/12 7:59:25 PM
what ’s happeningin store this month
Here’s the latest news and events happen i ng at your local Woo lworths supermarket.
May
LIKE USON FACEBOOKStay in touch with us
on Facebook for the latest news,
competitions and just to let us know
what you’re thinking. Find us at
facebook.com/woolworths
diary notes1 World Asthma Day
This year’s theme is “You Can
Control Your Asthma”.
nationalasthma.org.au
1-31 Kiss Goodbye to MS
Multiple sclerosis (MS) is a
chronic neurological condition.
kissgoodbyetoms.org.au
6-12 Heart Week The Heart
Foundation asks do you know
the signs of a heart attack?
heartfoundation.org.au
14-18 Food Allergy Awareness
Week Anaphylaxis Australia is
developing awareness of food
allergies. foodallergyaware.com.au
30 April – 6 MayOsteopathy Awareness Week
osteopathic.com.au
GUARANTEED
Fresh FoodEVERY TIME
With 25 years of expertise as
the Fresh Food People, we’re
so confident in the quality of our
fresh food, that in the unlikely
event you’re not satisfied with
anything you buy from us, we’ll
both refund your money AND
replace your purchase. Simply
present your receipt the next
time you shop, it’s that easy. You
can speak with your local Store
Manager if you have any questions,
or visit woolworths.com.au
Shop virtuallyanywhere!With the updated
Woolworths App
you can shop anywhere, anytime,
and have groceries delivered
straight to your door. Download
the updated App from the App
Store or Android Market and
start shopping today! For details,
visit woolworths.com.au/app
Woolworths fresh 9
TEAR OUT AND KEEP
HappyMother’s Day13
Celebrate the amazing women in
your life and say thank you with a
fresh bunch of gorgeous Clover Hill
flowers, available from your local
Woolworths. Select a bunch or
bouquet of flowers from a wide of
range of dazzling floral arrangements.
Whether your mum loves a bunch
of colourful tulips; roses; lilies; or
chrysanthemums — Clover Hill will
have an arrangement to suit her.
Turn to p26 for a sneak preview
of some of the bouquets.
NEXT ISSUE IN STORE TODAYScan your FREE copy of
Fresh at the checkout
every month!
30
calendar |
MonthMonth
Look for Jelly Baby products at the
checkout during May. Jelly Belly Month
is run by the Juvenile Diabetes Research
Foundation (JDRF). Money raised
through Jelly Baby products goes
towards diabetes research. Australia
has one of the highest rates of juvenile
diabetes in the world and, frighteningly,
the incidence is rising. Medical research
is the only hope for finding a way to
stop this condition and help find a cure
for those people living with the disease.
jelly babyMONTH
FRE0512p009calR.indd 9 26/3/12 2:23:47 PM
Hansfreshal12551643.pdf Page 1 2/24/2012, 4:37:15 PM
fresh market updateavocados
photo
graphy
craig
wall
styling
sarah
o’brien
recipedevelo
pmentchristinesh
eppa
rd
food
prepa
ratio
ndix
ieell
iot
Hass avocadoThis variety makes up formore than 75 per centof avocados in Australia.AppearanceWith adistinctive pebbly skin andoval shape, hass is sometimesreferred to as the ‘black sheepof the family’. the skin turns arich purple when ripe andthe flesh is ready to eat.Season almost all yearround in different regions.Size around 140-340g.a small seed means thereis more edible flesh per fruit.
what’s in season
pomegranate
passionfruit
mandarin
beetroot
fennel
zucchini
FabrizioFresh Foodspecialist
our delicious hassavocados are at the peakof their season and attheir best value.
in season: may |
FRE0512p011-015market.indd 11 23/3/12 1:34:52 PM
1 Lebanese cucumber1 carrot, peeled and grated¼ red cabbage, shredded1 spring onion, sliced¼ cup coriander leaves¼ cup mint leaves1 Hass avocado210g can Woolworths Select RedSalmon, drained, flaked
finely grated rind and juice of 1 lime1 tbs fish sauce2 tsp brown sugar1 red chilli, deseeded and chopped
1 Halve cucumber and slice. Coarselygrate carrot and combine in a bowlwith cucumber, cabbage, spring onion,coriander and mint. Halve avocado,remove stone and slice. Add to saladwith flaked salmon.2 Whisk lime rind and juice, fish sauce,brown sugar and chilli together untilsugar has dissolved. Pour over saladand toss to combine. Serve.FReSH Tip: If you’re preparing theavocado ahead, sprinkle it with lemonjuice to prevent it from discolouring.
Asian saladwith avocado& salmonPrep 10 mins | Serves 2
To ripen avocados quick ly ,place in a brown paper bag with a ripe banana. Toslow down the ripening, keep avocados in the fridge.
How toprepare an avocado
step 1 Cut around the avocadoseed lengthwise and rotate thehalves until they separate.
step 2 Hit the seed with a knife,twist. Remove seed; or slide a spoonunder seed and lift it out.
| in season: may
Woolworths fresh12
FRE0512p011-015market.indd 12 23/3/12 1:35:00 PM
GuacomolePrep 10 mins | Makes 2 cups
4 Hass avocados
1 tomato, deseeded and diced
½ small red onion, finely chopped
1 tbs jalapeño chillies, chopped
½ cup chopped coriander
¼ cup lime juice
salt, to taste
corn chips, to serve
1 Cut the avocados in half and remove
the seeds. Scoop out flesh using a
spoon and place in a bowl. Roughly
mash with a fork. Mix in tomato, onion,
chilli, coriander and lime juice. Season
with salt. Serve with corn chips.
Fresh tipWhen making
guacomole a few
hours ahead of serving,
place an avocado seed
into the centre of the
guacomole. This
will help prevent the
avocado from browning.
FRE0512p011-015market.indd 13 28/3/12 9:53:24 AM
From six months oldHalve an avocado and remove the seed.
Scoop flesh into a bowl and mash until
smooth. Leftover avocado can be frozen in
small containers or ice-cube trays. Mashed
banana or apple puree can also be mixed
with the avocado for a little natural sweetness.
Six to eight months oldRoughly mash avocado with steamed
pumpkin and cooked broccoli. Serve
just warm. Freeze any leftovers.
Eight months +Toast wholemeal bread and
spread with avocado. Cut into
fingers (also known as soldiers).
For babiesand toddlersAvocado makes a great first food
for babies, as the smooth, creamy
texture is easy to eat. They’re also
rich in vitamins and antioxidants.
Join our Baby & Toddler Club atwoo lworthsbabyandtodd lercl ub .com. au
for more food ideas, advice fromexperts and to share in the
conversatio n with other parents .
Woolworths fresh14
| in season: may
FRE0512p011-015market.indd 14 23/3/12 8:44:14 AM
How ripeis my
avocado?
OLIVE GREEN• 2-3 days to eating• Do not refrigerate, storein fruit bowl until skinturns Brown Green
BROWNGREEN• Firm, ripe and readyto eat
• Ideal for slicing• Store in fridge to keepfirm or continue to ripenin fruit bowl until DarkBrown
DARK BROWN• Soft, ripe and readyto eat
• Ideal for mashing, dipsor use as a spread
When are Hass avocados at their best?Australian Hass avocados are available fromApril through to February nationally, butour main packing season is from March toSeptember. We have the perfect sub-tropicalclimate for growing avocados, although,like anywhere else, we still have to contendwith Mother Nature throwing all sortsof weather at us.
How long have you been supplyingavocados to Woolworths?For more than 20 years! We’re a second-generation Aussie-family business and,with 200,000 avocado trees to look after,we work really closely with Woolworthsto ensure that customers get the highest-quality product. This year we will producearound 57.5 million pieces of fruit.
How do you ensure quality controlis maintained for customers?It starts with our integrated crop-management system in the field. Ourground crew hand-pick the avocados, andfrom there it goes to our processing facility.At key stages throughout the packing process,stringent quality checks are made to ensurewe only send out the highest-quality fruit.
How long does it take for theavocados to get from the farmto the supermarket shelf?We can have an avocado that’s readyto eat at Woolworths supermarketsin five days. Harvesting tends to kick-offthe ripening process in avocados, so westore them in ripening rooms after pickinguntil they’re ready to go to the supermarket.
growing regionsin
Austr A l i A
CelebratingFresh Food
Meet our growerAt Woolworths, we’recelebrating 25 years asthe Fresh Food People.Working with growers likeJohn Walsh from SimpsonFarms in Queensland,who has been supplyingavocados to Wooliesfor more than 20 years!
Apply gentle pressure with yourthumb to the top of the avocado.If it yields, it’s ripe and readyto eat. If the avocado doesn’tyield, it’s “firm” and will be ripein a couple of days.
how toChooseyouravoCado
John WalshSimpson Farms, Queensland
AVoCADos
FRE0512p011-015market.indd 15 23/3/12 1:35:18 PM
PH
OTO
GR
AP
HY
JE
RE
MY
SIM
ON
SS
TY
LIN
GD
AV
IDM
OR
GA
N
the good oilPrimarily produced in Mediterranean
regions, olive oil production in
Australia has been growing since
the 1800s. Olive oil is made by
‘pressing’ olives into a paste and
extracting the oil.
macro wholefoods market organicAustralian extra virgin olive oilis high-quality oil best suited
to dressings and marinades.
Organic Australian extra virgin olive oil
is cold pressed and unfiltered. Packed
in a new Tetra Pak to protect it from
light and air, this olive oil is full of
flavour and is budget friendly, too.
try this
golden liquidA good-quality, full-flavoured extra virgin olive oil is the
ultimate staple ingredient for any chef or cook.
| woolworths fresh promotion
fresh ideasDRESS steamed vegetables
with a little extra virgin olive
oil, garlic and salt flakes for
extra flavour.
ADD a few drops of balsamic
vinegar to a small dipping
bowl filled with extra
virgin olive oil and serve with
fresh crusty bread.
COAT spaghetti, cooked and
drained with a splash of extra
virgin olive oil, fresh chilli and
fresh basil leaves.
Woolworths fresh16
FRE0512p016aboutR.indd 16 27/3/12 12:13:28 PM
Photo
graPhy
Jeremy
SimonS
Styling
DaviD
morgan
reciPedevelo
Pment&Food
PrePa
ratio
nDix
ieell
iott
Lamb&olive casserole
Prep 10 mins | Cook 1½ hours | Serves 4
1 tbs Home Brand olive oil1 brown onion, thinly sliced3 rashers (250g) rindless bacon,cut into thin strips
1kg garlic & lemon-flavoured butterfliedlamb shoulder, diced
400g can Home Brand Diced tomatoes1½ cups Woolworths Select reduced-salt Chicken Stock
1 cup feta-filled green olives1 cup fresh basil leaves, torn, to garnish
1 heat oil in a large, deep heatproofcasserole over medium heat until hot.add onion and bacon. cook for 5minutes or until onion is soft. add lamband stir until well combined. cook for10 minutes or until meat is browned.2 add tomatoes and stock and stir untilcombined. Bring mixture to the boil.Partially cover and simmer for 1 hour15 minutes or until lamb is tender andmixture has thickened. add olivesto casserole. Stir until well combined.Simmer for 10 minutes. Season withsalt and pepper. garnish with basil.nutritional info Per serve: 64g protein,
44g fat (16g saturated fat), 7g carb, 3g dietary
fibre, 2835 kJ (675 Cals).
mondaycost per serve $7.24
Spend less time cooking and more time withyour family — these one-pot meals are lowon preparation time and high on flavour.
weeknightDinners
Save time by cooking thecasserole on the weekend,then on monday nightreheat (the flavours willdevelop further) andserve with mashedpotato (see p21).
make ahead
Woolworths fresh
weeknight dinners |
17
FRE0512p017-021weekR.indd 17 23/3/12 1:20:54 PM
Pumpkin & chickpea curry
Prep 10 mins | Cook 35 mins | Serves 4
1 tbs Home Brand Vegetable Oil
1 brown onion, finely chopped
1 bunch coriander
¼ cup korma curry paste
1.2 kg pumpkin, deseeded, peeled,
cut into 4cm pieces
400ml can coconut milk
½ cup water
400ml can Woolworths Select
Chickpeas, drained, rinsed
½ cup salted cashew nuts, roughly
chopped, to garnish
steamed rice, to serve
tuesday
cost per serve $4.29
Chicken & mushroom bake
Prep 10 mins | Cook 1½ hours | Serves 4
1 tbs Home Brand Olive Oil
12 chicken drumsticks
20g butter
600g mixed mushrooms,
thickly sliced
2 cups Woolworths Select
Chicken Stock
¼ cup white wine (optional)
1 tbs Home Brand Worcester Sauce
¼ cup finely chopped tarragon
mashed potato, to serve (see p21)
1 Preheat oven to 200°C. Heat oil
in a large heatproof baking dish
over medium heat until hot. Add
half the drumsticks and cook for
10 minutes, turning occasionally
until golden. Transfer to a plate.
Repeat with remaining drumsticks.
2 Melt butter in pan. Add mushrooms
and cook, stirring, for 10 minutes or
until golden. Add stock, wine, sauce
and half the tarragon into pan.
Bring to the boil. Return chicken
to pan and place into oven. Bake
for 40 minutes or until golden and
cooked through. Season with salt
and pepper. Garnish with remaining
tarragon. Serve with mashed potato.
NUTRITIONAL INFO Per serve: 43g
protein, 25g fat (8.5g saturated fat), 8g
carb, 3.5g dietary fibre, 1765 kJ (420 Cals).
wednesday
cost per serve $4.67
1 Heat oil in a large non-stick frying pan
over medium heat. Add onion and cook
for 3 minutes or until soft. Finely chop
coriander roots and add to onion. Cook
for 1 minute. Stir curry paste into onion
mixture and cook for 1 minute or until
aromatic. Add pumpkin, coconut milk
and water. Bring to the boil. Reduce
heat and simmer for 20 minutes. Add
chickpeas and cook for 10 minutes.
2 Roughly chop half the remaining
coriander, reserving sprigs to serve, and
stir through curry. Sprinkle over cashews
and coriander sprigs. Serve curry with
steamed rice.
NUTRITIONAL INFO Per serve: 18g protein,
44g fat (18g saturated fat), 39g carb, 9g dietary
fibre, 2620 kJ (625 Cals).
Cook double the batch
and freeze one batch for
another night. Prepare
batch to freeze to end
of step 1. Reheat curry
gently while you
cook the rice.
double up
Woolworths fresh18
| weeknight dinners
FRE0512p017-021weekR.indd 18 27/3/12 11:57:49 AM
Seafood taginewithtomato& harissa
Prep 15 mins | Cook 20 mins | Serves 4
8 long red chillies, deseeded,finely chopped
4 garlic cloves, crushed2 tsp ground cumin2 tsp ground coriander2 tsp sea salt flakes¼ cup Home Brand Olive Oil1 brown onion, finely diced2 sticks celery, finely diced1 carrot, peeled, finely diced400g can diced tomatoes4 x 150g boneless thick white fillets12 green prawns, peeled, deveined½ cup Continental parsley leaves,roughly chopped
1 lemon, cut into wedges, to serve
1 Put chillies, garlic, cumin, corianderand salt into a mortar and usinga pestle grind until a smooth pasteforms. Gradually add 2 tbs oil, ½ tspat a time, grinding into harissa mixtureuntil well combined. (Alternatively,
thursday
cost per serve $8.29make harissa in a small foodprocessor). Transfer to a bowl.2 Preheat oven to 200°C. Heatremaining oil in a heatproof tagine orcasserole dish over medium heat untilhot. Add onion, celery, carrot and cookfor 3 minutes or until soft. Addtomatoes, half of the harissa mixtureand ½ cup water. Stir until wellcombined and mixture comes to theboil. Add fish and prawns. Cover andplace in oven. Cook for 10 minutes oruntil fish and prawns are cookedthrough. Remove lid and sprinkle withparsley. Spoon remaining harissa intoa small serving bowl. Serve tagine withharissa and lemon wedges.NutritiONal iNfO Per serve: 53g protein,
18g fat (2.5g saturated fat), 17g carb, 6g
dietary fibre, 1800 kJ (430 Cals).
We recommendWhen buying prawns, bringa cooler bag with an ice
block to keep seafoodcool and fresh fromthe supermarketto home.
Save time by using a jar ofprepared curry paste and prawnsthat have been peeled and cleaned .
FRE0512p017-021weekR.indd 19 23/3/12 1:21:30 PM
Soy &honeybeefwithvegetables
Prep 25 mins | Cook 10 mins + 20 mins
standing | Serves 4
2 tbs Home Brand Soy Sauce½ tsp ground white pepper500g beef fillet or porterhouse steak1 tbs Home Brand Vegetable Oil3 spring onion, thinly sliced diagonally1 red capsicum, trimmed, cut into strips1 bunch broccolini, trimmed,halved lengthways
200g snow peas, trimmed,halved lengthways
½ cup Woolworths Select Soy,Garlic and Honey Marinade
steamed rice and spring onion, to serve
fridaycost per serve $6.06
1 Combine soy and white pepperin a bowl. Thinly slice beef diagonallyand add to soy mixture. Toss untilcombined. Cover. Stand for 20 minutes.2 Heat a wok over a high heat until hot.Add 1 tsp of oil and swirl around wokto coat. Add beef in batches and stir-fryfor 2 minutes or until browned. Transferto a bowl. Repeat with remaining beef,adding more oil as required.3 Reheat wok. Add 1 tsp oil and rollaround wok. Add spring onion,capsicum, broccolini and snow peas.Stir-fry for 2 minutes. Add 2 tbs water,cover and cook for 2 minutes or untilvegetables are just tender.
4 Return beef to wok with marinade.Stir-fry for 2 minutes or until beefand sauce is heated through. Servebeef and vegetables with steamed rice.Garnish with extra spring onion.NutritiONal iNfO Per serve: 17g protein,
6.5g fat (2g saturated fat), 12g carb, 2.5g
dietary fibre, 715 kJ (170 Cals).
While the beef is marinating, usethe time to prepare the vegetablesand put the rice on to cook .
WerecommendCreate a selectionof your favourite
meals every night of the weekwith Woolworths Select Soy,Garlic and Honey Marinade.Perfect for meat andvegetable dishes, thismarinade tastes delicious.
Woolworths fresh20
FRE0512p017-021weekR.indd 20 23/3/12 1:21:40 PM
Sweet potatomash
Prep 10 mins | Cook 20 mins | Serves 4
Peel 500g potatoes and 500g sweet
potato and cut into large pieces. Place
into a saucepan, cover with cold water
and bring to the boil. Simmer for 20
minutes until tender. Drain. Add 40g
Home Brand butter and ¾ cup warm
Home Brand Milk. Mash until smooth.
Season. Add ½ cup finely grated
Home Brand Parmesan and ⅓ cup
finely chopped fresh herbs. Stir
to combine. Serve.
French-style peas&mint
Prep 10 mins | Cook 10 mins | Serves 4
Trim and finely shred 1 baby cos lettuce.
Melt 20g Home Brand butter in a
saucepan over medium heat. Stir in
1 tbs plain flour until smooth. Cook for
1 minute. Slowly whisk in 1 cup chicken
stock, stirring until thick. Stir in 1½
cups Home Brand Frozen Peas and
lettuce. Stir. Cook for 2 minutes or
until lettuce just wilts. Add in 2 tbs
finely chopped fresh mint. Serve.
Warmcarrot salad
Prep 10 mins | Cook 15 mins | Serves 4
Halve 1 long red chilli, lengthways and
remove seeds if preferred. Finely chop
roots from 1 bunch coriander and
reserve leaves. Mix coriander roots with
chilli, 2 crushed garlic cloves and finely
grated 2 tsp grated ginger. Add ⅓
cup Home Brand Olive Oil, ¼ cup
lemon juice and 1 tsp Changs Sesame
Oil. Season. Peel and slice 4 carrots.
Place into a saucepan and cover with
cold water. Bring to the boil, simmer
for 15 minutes or until tender. Drain
well. Add carrots and ⅓ toasted flaked
almonds to dressing. Toss until well
combined. Serve with carrot salad.
Mix ‘n’matchsides
Cook potatoes in cold
water, as hot water cooks
the outside quicker and
waterlogs the potato. Add
warmmilk for smooth
mash, as cold milk cools
the mash down.
hot & co ld
cost per serve $3.18
cost per serve $1.24
cost per serve $2.99
Woolworths fresh
weeknight dinners |
21
FRE0512p017-021weekR.indd 21FRE0512p017-021weekR.indd 21 27/3/12 11:58:36 AM27/3/12 11:58:36 AM
Have you ever been confused by a recipe callingfor julienne or baton? Now you can master the artof these cutting techniques with my how-to guide.Fresh Food Chef
preparevegetables
how to
MaRgaRet’s little secRets Whether a recipe calls for julienne, shred,chop or dice, it’s important to cut each vegetable into same-size pieces— this ensures they cook at the same rate. place damp paper towel undera chopping board to prevent it from slipping while you cut ingredients.
Woolworths fresh22
FRE0512p022-025how to.indd 22 23/3/12 11:58:44 AM
PH
OTO
GR
AP
HY
JE
RE
MY
SIM
ON
SS
TY
LIN
GD
AV
IDM
OR
GA
NF
OO
DP
RE
PA
RA
TIO
ND
IXIE
ELLIO
T
MARGARET’S LITTLE SECRETS The French call it chiffonnade (which loosely
translates as “rag”). Shredding is great for cabbage, lettuce, English spinach
and herbs. Follow these steps for shredding your vegetables like a master chef.
STEP 2To shred spinach,
place leaves one on
top of the other to
create a stack and
roll up. Start with
pointed end down
and roll knife back
over the spinach roll
to finely shred leaves
crossways.
STEP 1To shred cabbage,
discard outer leaves.
Cut into quarters.
Place one cabbage
quarter, cut-side down,
on chopping board.
Finely slice cabbage
lengthways. Repeat
with remaining
cabbage quarters.
BATONPeel carrot and trim
one side. Turn onto
board so it’s stable
on the surface. Trim
remaining sides in the
same way. Cut 6-8mm
thick slices lengthways
to make batons.
JULIENNEPeel carrots and cut
into 8cm lengths. Trim
1 side and turn to lie flat.
Repeat to trim remaining
sides. Cut 1 trimmed
carrot piece lengthways
into 2-4mm thick slices.
Arrange the carrot
slices in a stack. Slice
the stack lengthways
into matchsticks.
MARGARET’S LITTLE SECRETS In French cuisine,
matchstick-style vegies are known as julienne.
A baton is a slightly thicker version of julienne.
Here, we show you how to prepare both.
shred
baton and julienne
Knife know-howPlace one hand firmly on the
vegetable, tuck your fingers
and thumb under to make
a claw. To protect fingertips,
place the flat side of the blade
against clawed fingers. Lean tip
of knife on the board. Keeping
blade against fingers, lift back
of the knife up and down.
Woolworths fresh 23
margaret fulton’s kitchen |
FRE0512p022-025how to.indd 23 27/3/12 12:04:11 PM
sliceMARGARET’s liTTlE sEcRETs Slicing theright way will help you get your vegetablesinto the desired uniform pieces. Here’s how.
STEP1Cut onion in halflengthways from tipto bulb end. Removepapery outer skin.Place onion, cut-sidedown, on board.
STEP2Cut off bulb tip.Using knife tip, cutonion crosswaysinto even slices.
dice
STEP1Cut onion in half lengthwaysfrom tip to bulb end. Removepapery outer layer of skin, makingsure to leave the bulb intact.
STEP2Holding the onion securely, usethe knife tip to cut onion lengthwaysinto even slices, leaving the slicesattached to the bulb end.
STEP3Hold onion firmly and cut horizontallyfrom tip to bulb end (but not all theway through). Cut onion crossways intothin slices to dice. Discard bulb end.
Onion know-howAvoid tears, by chilling onionin the freezer for 10-15minsbefore cutting. Slice the onionwith a sharp knife.
MARGARET’s liTTlE sEcRETs A sharp knife and a little know-howare foolproof cutting techniques for dicing your vegetables like amaster chef. Hold the knife, as shown, with tip first, slicing backward.
Woolworths fresh24
|margaret fulton’s kitchen
FRE0512p022-025how to.indd 24 23/3/12 11:59:33 AM
1 o’clock sharp.
7 o’clock sharp.
Wiltshire Stays Sharp.
6 o’clock sharp.
For more than 40 years Wiltshire Staysharp kniveshave stayed sharp for breakfast, lunch and dinner.At Wiltshire we have an appetite for success so we
haven’t stopped improving our self sharpeningscabbard, knife blades or our blocks.
Available at Woolworths stores nationally.For further information please contact McPherson’s
Consumer Products 1800 651146 or visitwww.wiltshirestaysharp.com.au
STEP1To remove the herb leaves from the stalks, run yourfingers down the stalks, against the growth, to removethe leaves. Repeat until you have enough for recipe.
chopMARGARET’s liTTlE sEcRETs Choppingherbs the right way cuts down on yourprep time. Follow these cooking tips forchopping your herbs and vegetables.
STEP2Place the leaves ina pile on a choppingboard and use a largesharp knife, tip downfirst, to chop coarselyor finely dependingon the recipe.
FRE0512p022-025how to.indd 25 23/3/12 11:59:47 AM
A beautiful bouquet of fresh flowers is a lovely gift for Mum.Check out the huge range of Clover Hill flowers in store.
motherFlowers For your
fresh flowersPrearrange your mum’sbouquet of freshClover Hill flowers andmake them last longer.Here’s how:
1When placing flowersin a vase, make sure to
cut the stems on a 45-degreeangle and ensure thereis no foliage sitting belowthe water line.
2 To keep your flowersfresh and healthy make
sure to change the waterand re-cut the stems everysecond day.
3 Keep your Clover Hillflower arrangement in
a cool area of the home,out of direct sunlight, forlong-lasting, fresh flowers.
Mum will love thesewhite, pink andsoft-pink roses.
Woolworths fresh26
FRE0512p026-027clover.indd 26 23/3/12 1:15:28 PM
oriental l i l ies The soft scent and striking appearanceof oriental lilies have open, reflex petals that are spotted,brushed, or edged with darker or contrasting colours.
roses Available in a wide range of colours, varieties andsizes to suit every taste, nothing beats the classic beautyof a rose. Choose from one-colour or assorted bouquets.
ch r ysa nth emums The traditional Mother’s Dayflower, Clover Hill have simple and elegant chrysanthemumsthat are easy to care for. Choose from a range of colours.
t u l i p s For the mum who loves striking colours, choosea bouquet of bold-coloured tulips to brighten her day.Placing different colours in a vase are a definite winner!
Woolworths fresh 27
woolworths fresh promotion |
FRE0512p026-027clover.indd 27 23/3/12 1:15:45 PM
Mum’s special
Mum’s breakfast menuGet cooking and present the specialwoman in your life with this feast!
Wattle Ridge The Environmental EggA great breakfast staple, cook eggsMum’s favourite way. Wattle ridge arefriendly to the environment and tasty!KR Castlemaine Bred Free RangeBacon Add this free range baconto the menu with grilled tomatoand toast for a delicious treat.Hash Browns from Woolworths deliAvailable from the deli in store,
hash browns add a tasty, crisp potatoflavour to your breakfast.Nutella Hazelnut Spread Completeyour breakfast with Nutella on acroissant — so easy for kids to prepare.
Nudie Nothing But 21 OrangesA big glass of fresh orange juiceis great to add to your breakfast.Try Nudie’s range of orange juice— available with or without pulp.
Mum’s special
Surprise your mum on Mother’sDay with a delicious breakfastin bed with these ingredients.
breakfast
Woolworths fresh
|woolworths fresh promotion
28
FRE0512p028brekkie.indd 28 26/3/12 10:01:33 PM
photo
graphy
Jeremy
SimonS
styling
DaviD
morgan
food
prepa
ratio
nDix
ieell
iot
Make Mother’s day special with this twist on traditionalhigh tea — follow these simple shortcuts from our bakery.
high tea
chocolate bitesPrep 5 mins | Makes 20
Cut a 500g WoolworthsChocolate Block Cake into3cm squares and top witha purchased Queen icingFlowers.
For the girlS
caramel & banana bitesPrep 5 mins | Makes 36
Beat 60g soft butter, ½ cup brownsugar, 2 tbs sour cream and 1½ cupssifted icing sugar together until smooth.spread icing over 4 Woolworths bananabread slices and sandwich with another4 banana bread slices. Cut into 3cmsquares and spread top with moreicing. top with a pecan half.
Woolworthsmini iced cupcakes&minimud cakes pk9these deliciously sweet bitesare available from the bakerysection at Woolworths stores.
The Woo lworths bakeryis fu l l of i nspi ratio nfo r mixi ng and match i ngyour own mi n i cakes .
Woolworths fresh 29
mother’s day |
FRE0512p029-031highteaR.indd 29 23/3/12 11:51:20 AM
minimeringuesBlend ¼ cup icing sugar with a littlewater to make a smooth paste. Coatthe tops of Woolworths Rainbow-flavoured Mini Meringues (100g pk)and sprinkle with mixed cachous.
salmon& cream cheeseMix Woolworths Select Cream Cheese,with lemon juice, chopped dill andbaby capers. Spread onto WoolworthsWholemeal Bread. Top with smokedsalmon and second bread slice. Trimcrusts and cut into fingers.
chicken& cucumberChop meat from a macro wholefoodsmarket family roast chicken and mixwith whole-egg mayonnaise andchopped parsley. Spread ontoWoolworths White Bread and topwith sliced cucumber and second breadslice. Trim crusts and cut into fingers.
chocolate cupsPick up a packet of 60g(12 pk) Woolworths MilkChocolate Cups and pleaseyour guests with ourdelicious fillings (p31).
egg&watercressPeel and mash 4 hard-boiled eggs.Stir in mayonnaise and season with saltand pepper. Spread onto WoolworthsWholemeal Bread, top with watercresssprigs and second bread slice.Trim crusts and cut into fingers.
beef & sour creamMix sour cream, horseradish andchives. Spread onto WoolworthsBread Slices, top with sliced rareroast beef and rocket. Top with andsecond buttered bread slice. Trimcrusts and cut into fingers.
|mother’s day
30 Woolworths fresh
FRE0512p029-031highteaR.indd 30 26/3/12 8:14:51 PM
1 Preheat oven to 180°C/160°C fan-forced.Grease a 9cm-deep, 20cm (base) roundcake pan. Line base with baking paper.
2 Process orange until puréed. Add butter,rind, sugar and eggs. Process untilcombined. Add flour and cinnamon.Pulse until just combined. Pour mixtureinto prepared pan. Bake for 1 hour oruntil a skewer inserted in the centre ofcake comes out clean (cover looselywith foil during cooking if over-browning). Cool in pan.
3 Make syrup Combine sugar and ½ cupcold water in a saucepan. Stir over lowheat until sugar has dissolved. Increaseheat to high. Bring to the boil. Reduceheat to low. Simmer, without stirring, for20 to 25 minutes or until light golden.Remove from heat. Add orange juice.Stir to combine. Return to heat. Addmarmalade. Stir until smooth. Transfer toa heatproof jug. Set aside to cool.
4 Turn cake out onto a plate. Prick cakeall over with a skewer. Pour over half thesyrup. Stand for 10 minutes. Slice cake.Drizzle with remaining syrup. Serve withcream.
1 orange, peeled, chopped,
seeds removed
200g butter, melted, cooled
1 teaspoon finely grated orange rind
1 ½ cups caster sugar
3 eggs, lightly beaten
2 cups self-raising flour, sifted
1 teaspoon ground cinnamon
Double cream, to serve
Syrup
1 cup caster sugar
½ cup orange juice
¼ cup Rose’s English Breakfast Marmalade
orange cakewith syrupServes 8chocolate cups
Pick up a packet of 60g (12pk)
Woolworths Milk Chocolate Cups
and please your guests with our
delicious fillings;
chocolate caramel
Fill cups with 1 tsp Woolworths
Select Toffee Dessert Sauce. Pipe
½ cup whipped thickened cream
on top. Decorate with crumbled
chocolate flake bar.
creamy mint
Flavour whipped thickened cream
with mint essence. Pipe into cups.
Top with grated chocolate.
orange & blueberry
Flavour whipped thickened cream
with orange essence. Pipe into
cups. Top with blueberry.
raspberry swirl
Flavour whipped thickened cream
with squashed raspberry. Pipe into
cups. Top with raspberry.
nut chocolate
Mix chopped nuts with whipped
thickened cream. Pipe mixture into
the chocolate cups. Top with
chocolate sprinkles.
Sho rtcuts
Woolworths Mini Meringues
Rainbow Flavours 100g
Woolworths Select Pure Ceylon Tea
Woolworths Milk Chocolate Cups 12pk
Woolworths Select Earl Grey Tea
Woolworths Banana Bread Slices Pk5
Serve sandwiches and
sweets with the new range
of Woo lworths Select Tea
(avai lab le i n s ix f lavours) .
Woolworths Mini Iced
Cupcakes or Mini Mud Cakes Pk9
FRE0512p029-031highteaR.indd 31 29/3/12 8:26:06 AM
Mother’s Day
Baileys with a hintof Mint Chocolate hasbeen created with ablend of Irish whiskey,fresh Irish cream and aspecial hint of deliciousmint chocolate. Pouredover ice, this adoredflavour is the perfectMother’s Day treat. Formore information aboutBaileys, visit facebook.com/BaileysAustralia
Find a special gift to give your mum on Mother’s Day at your local Woolworthssupermarket — there’s something to suit every budget and style.
Rejuvenate your skinwith NIVEA Vital TripleAction, a luxurious, anti-oxidant-rich face carerange that enhances thenatural process of skinto reduce all major signsof aging, while eveningout skin texture and tone,reducing wrinkles andpreventing age spots.
g ift gu ide
Say it with a special mug! Woolworths have a variety ofMother’s Day Mugs with a special message on each tosuit mums, wives and grandmothers. At just $2.99 each,you can send a special message at a great-value price.
Struggling to find the perfect gift for Mum?Give her the gift of choice with a gift cardfrom your local Woolworths supermarket.There’s a huge range of gift cards to choosefrom, including WISH Gift Cards, ExperienceCards, Restaurant Gift Cards and many more.You can find something to suit your mum’stastes and that matches your budget.
Get visibly younger-lookingskin in just two weeks.The NIVEA Q10plusAnti-Wrinkle rangecontains Q10 and creatinein a powerful formulathat works with yourskin’s natural processes toslow down the cell agingprocess to help giveyou the appearance ofyounger-looking skin.
Say it with a special mug! Woolworths have a variety of
FRE0512p032-033giftR.indd 32 27/3/12 2:03:20 PM
For mums who love the luxury of
scented bathroom products, this
Cherry Blossom & Vanilla gift pack
includes a shower gel and a bubble
bath so your mum can pamper herself.
The combination of cherry and vanilla
offers a soothing, aroma to help your
mum relax after a hard day’s work.
This bathroom set is also paraben free.
mother’s day gift guide |
Thank your mum this Mother’s
Day with Olay Regenerist
Wrinkle Revolution Complex.
This top-selling moisturiser, in
Australia*, has micro-fillers and
light-reflecting technology that
dramatically reduces wrinkles
in just a single application. It’s
a gift that mum won’t forget.
* Aztec Data, AU Grocery + Pharmacy
dollar sales 1/8/11 — 31/12/11
Enjoy soft, scented skin with Sweet Lavender &
Passionflower gift packs. This four-piece luxury bath
set includes shower gel, hand cream, body scrub and
body lotion. A three-piece bath set is also available.
Sweet Lavender & Passionflower are paraben free.
Give your mum the smooth melting
Lindor moment she deserves
on Mother’s Day. The irresistibly
smooth melting Lindor ball is made
of a fine chocolate shell with a
smooth filling centre… A premium
chocolate experience like no other.
LINDOR, created by Lindt’s Master
Chocolatiers. Passion and love for
chocolate since 1845.
For MumFind something specialfor your mum at your localWoolworths supermarketthis Mother’s Day.
FRE0512p032-033giftR.indd 33 26/3/12 2:19:07 PM
Afternoon teaWITH MUM
• Haywood & Padgett Scones have 25 years’ experience in baking the fi nest scones. These traditional Yorkshire plain and sultana scones are moist, soft and crumbly. Fantastic for afternoon /morning tea, school lunch box fi ller and even as a sneaky dessert!
• The secret of Bonne Maman Preserves is simple – our ingredients. Made from the same time-honored traditional French recipes used to create the brand, our preserves feature only the fi nest quality fruit and 100% all-natural ingredients.
• Pura Thickened Cream cansubstituted for pure cream in most recipes. As the name suggests, Pura Thickened Cream is thicker in texture and holds its shape well after beating. The perfect cream to use on scones, in desserts such as trifl es, as topping on a cake or pavlova; or just whipped and dolloped on pies or a hot fruit crumble.
• Western Star Spreadable Supersoft is super soft and super spreadable. It’s the easiest way to spread that great 5-star taste on sandwiches, toast and all your spreading occasions.
ee
en n
Create a delicious afternoon tea for Mum. Simply butter the scones and dollop with jam and cream.
MAG051209.pdf Page 1 27/03/12, 5:21 PM
Every mum loves a homemade gift,especially one that’s made with love.Surprise her with these sweet ideas.
photo
graphy
Jeremy
simons
styling
david
morgan
recipedevelo
pmentchristinesh
eppa
rd
food
prepa
ratio
ndix
ieell
iotmodelJia
for mum
Choc-chip biscuitsPrep 5 mins | Cook 15 mins | Makes 18
1 preheat oven to 180°c. line 2 oventrays with baking paper. Beat ¼ cuppolyunsaturated margarine, 2 tbsbrown sugar, 1 eggwhite and 1 tspvanilla essence together with aspatula until combined.2 stir ¾ cup wholemeal plain flour,2 tbs cocoa and 1 tsp baking powderinto mixture. stir in ¼ cup choppeddark chocolate and 1 tbs skim milk.3 roll 2 teaspoons of mixtureinto balls and place on trays, leavingspace for spreading. flatten withyour fingers or a fork. Bake for 10-12minutes. cool on a wire rack.nutritional info per serve: 1.5g
protein, 3.5g fat (1g saturated fat), 6.5g
carb, 0.5g dietary fibre, 265 kJ (65 cals).
fresh tip: nutritionists recommenddiabetes sufferers have one biscuit.
Once you ’ve wrapped Mum’sb iscu its , tu rn over the pagea nd make her a g if t tag .
Diabetic-friendly biscuits for mum!
special treatsfresh food kids |
Woolworths fresh 35
FRE0512p035-037kidsR.indd 35 23/3/12 11:47:22 AM
for
acl
assic
mum
fora
lov ing
mum
fo r a supersta r mum
for a hugs & kissesmum
HOW TOMAKE YOUR OWN GIFT TAG
STEP 1Cut out your favourite
stencil from one of the
shapes above. Cut hole.
STEP 2Place stencil on a piece
of cardboard. Draw
around stencil. Cut out.
Help make life better for people
with type 1 diabetes and fund
research for this disease by
purchasing Jelly Belly products from
Woolworths this month. Jelly Belly
Month is run by the Juvenile Diabetes
Research Foundation (JDRF).
type 1 diabetesAustralia has one of the highest
rates of juvenile diabetes in the
world and, frighteningly, the
incidence is rising for unknown
reasons. Medical research is the
only hope for finding a way to stop
the onset of this condition and help
find a cure for those people who are
living with the disease.
Juvenile DiabetesResearch Foundation
Gather up all your
essential craft
equipment from
around your home
or at Woolworths:
• scissors
• buttons
• needle
• thread
• tissue paper
• pencils
• gift wrap
Woolworths fresh36
| fresh food kids
FRE0512p035-037kidsR.indd 36 23/3/12 8:17:16 AM
CONVENIENCE & SAFETY
• Portable and easy to install
• Light sensor: Illuminates
in low level/no light
• Motion sensor:
Illuminates 5m2 for 30 seconds
• Light Heads: Rotate 90º for
precision lighting
MOTION
SENSOR LIGHT
HYGIENE TRAINING
LED TIMER FOR KIDS
MagicTouch®
Making everydaylife easier.
• Fun and effectiveway to improveand maintainpersonal hygiene
• Operation: Light flashes greento ‘start’ and red to ‘stop’
• Two timing modes: washing handsand cleaning teeth
• Simple operation encourages use
• Portable and easy to install
Available in the electrical department
at selected Woolworths Supermarkets
Follow the steps (see left page) to make mum’s gift tag, then
decorate it as you like. Here are some tips to get you started.
for more great ideas visit woolworths.com.au
BroccoliLooks like My fellow broccoli heads and I are
coloured from dark green to purplish green.
Tastes like Similar to asparagus, cabbage
and cauliflower.
Feels like Closely related to the cabbage,
broccoli is a small, dense tree with greeny-
white branches ending in green flower buds.
Good for Vitamin C, dietary fibre, potassium,
vitamin E, folate and beta carotene.
HOW TODECORATE YOUR GIFT TAG
superstar mum tagA star-shaped tag for a superstar mum
deserves a bit of bling. Cover your card-
board in white or coloured paper with
glue. Write “Mum” on the tag. Cut out
stars from tinfoil and stick onto tag.
mum-shaped tagThis tag is in the shape of a person.
Glue white paper on both sides. Draw
your Mum’s face onto the paper with
crayons or colouring pens.
loving mum tagA heart-shaped tag can be decorated
in red. We drew a red line on white
paper and stuck it on the tag and
wrote Mum’s name in the middle.
classic mum tagNothing beats a good old-style tag. Try
decorating this one in butcher’s paper
or brown paper and don’t forget to
write on Mum’s name.
hugs & kisses mum tagCover your circle tag in white paper
and draw on all your favourite shapes
in a range of different colours around
your Mum’s name.
FRE0512p035-037kidsR.indd 37 23/3/12 8:17:44 AM
Looking for a delicious meal you can make in a hurry? Simply
grab either a Woolworths Select Vegetable and Beef or Lamb
Stir-fry, available from the freezer aisle, then heat and serve.
Fast & tasty
Woo lworths Select Vegetablea nd Beef or Lamb Sti r- fryis the co nven ient way tocreate i ncredib le Asia n -i nspi red meals i n mi nutes .
Woolworths Select
Vegetable and Beef Stir-fry
served with steamed rice
Woolworths Select
Vegetable and Lamb
Stir-fry served
with noodles
PH
OTO
GR
AP
HY
JER
EM
YSI
MO
NS
STY
LIN
GD
AV
IDM
OR
GA
NF
OO
DP
RE
PAR
AT
ION
DIX
IEE
LLIO
TT
Woolworths fresh38
| select and save
FRE0512p038-039privateR.indd 38 23/3/12 8:30:09 AM
‘Tasty nutritious meals that I can trust, for
those days when I’m just over cooking.
Made for You? Made for us all!
Available now in the freezer section of your nearest Woolworths Supermarket.
www.madeforyoufoods.com.au
• Low GI tested
• Fibre and vegies
• Low fat
• Portion controlled
– Peter Howard, chef, author and Made for You Foods co-founder.
Watchingyour blood sugar?
1800 4U FOOD(1800 48 3663)
IMC
2623
WF
R
We asked our expert panel to taste
the new Select Vegetable and Beef;
and Select Vegetable and Lamb
Stir-Fry. Here are their verdicts.
“A great stand-by
for the freezer.
No chopping needed,
simply heat from frozen
and it’s ready in 10 mins.
Choose from lamb or
beef and serve with
noodles or rice.”Christine Sheppard
Woolworth Fresh
Food Editor
“ I love the idea
of convenience
food but I want it to be
nutritious as well as tasty.
These stir-fries were
seriously as satisfying as
takeout, plus I know
exactly what’s in them.”Janette, Lindfield
Woolworth Fresh
magazine reader
“Our customer
panellists loved
the fresh flavour of these
nutritious stir-fries — lots
of positive comments
about the crunchy
vegies and the incredibly
tender meat strips.”Sally Stagles
Woolworths
Sensory Kitchen
FRE0512p038-039privateR.indd 39 23/3/12 8:30:49 AM
equal to 65-100gm of cooked meat or
chicken (eg. ½ cup mince, 2 small
chops) or 80-120g cooked fish fillet.
Limit saturated fats and ‘junk’
carbohydrates including biscuits,
doughnuts, lollies, chips, chocolate
and cakes.
Discover the best foods and ones to avoid duringyour pregnancy, with this health and nutrition guide.
health & nutrition:
pregnancy
Eat healthy complex
carbohydrates for sustained
energy. This includes fruit,
wholegrain cereals, breads and
pasta, potatoes, beans and
lentils. Aim for 4-6 serves a
day. One serve is equal to 2
slices of bread or 1 cup of
cooked pasta or rice.
Eat protein-rich foods, such as
chicken, fish, lean red meat,
dairy, seeds and pulses. All of
these will help your baby’s
growth and development. Aim
for 1½ serves a day. One serve is
What to eat during pregnancy
When you’re pregnant, everything
you eat and drink can directly benefit,
or potentially harm, your growing
baby. Do you need a better reason
to fuel your body with healthy,
nutrient-dense foods?
Smart, fresh foods will also give your
body the extra energy boost it needs
to get through the next few months
of pregnancy. And remember, now is
not a time to ‘eat for two’ or, conversely,
to try and lose weight. To get the most
nutritional bang for your buck, follow
our smart, simple guide to eating
during your pregnancy…
Replenish your iron levels with lots
of meat, chicken, pulses, green vegies
and wholegrain cereals. Pregnancy
increases your need for iron, not to
mention the fact that your baby draws
enough iron from you to last the first
five or six months after birth.
Fill up on vitamin C-rich foods, such as
raw fresh fruits and vegetables to help
your body fight infection. Vitamin C acts
as an antioxidant, which protects cells
from damage and is essential for wound
healing and tissue repair, bone and
growth repair and healthy skin. It also
helps your body absorb iron so try
eating vitamin C-rich foods each meal.
WO
RD
SK
AY
TEN
UN
NA
SS
EE
NO
NW
WW
.WO
OLW
OR
TH
SB
AB
YA
ND
TO
DD
LE
RC
LU
B.C
OM
.AU
Woolworths fresh40
FRE0512p040-041healthR.indd 40 26/3/12 2:21:34 PM
Authority has a clear guideline on
how to eat fish safely.
Iodine is essential for everyone,
especially pregnant and breast-feeding
women. Mild to moderate iodine
deficiency during pregnancy can result
in the baby having learning difficulties
and affect the development of motor
skills and hearing. Think about stocking
up on the right type of fish, seaweed
and iodised salt to get your fix.
Eat plenty of folate-rich foods
like green leafy vegetables such as
broccoli and spinach, plus oranges,
bananas, chickpeas, nuts, orange juice
and folate-enriched breakfast cereals.
Folate, also known as folic acid or
Vitamin B9, is one of eight B vitamins
and one of the few nutrients known to
prevent neural tube birth defects such
as spina bifida. The National Health
and Medical Research Council
(NHMRC) recommends women get an
extra 400mcg of folic acid every day
for at least one month before, and
three months after, conception.
Want to know more about how
your pregnancy diet can affect your
baby? Or looking for nutritious
meal ideas? The Woolworths Baby
and Toddler Club is on hand, all
day, every day to help make your
pregnancy a little easier.
FOODS TO AVOID•Listeria is a type of bacteria found
in some foods, which can cause a
rare but dangerous condition linked
to miscarriage and stillbirth. To
reduce the risk, avoid eating the
following foods:
•Pâte
•Oysters
•Raw and smoked fish
•Raw eggs
•Raw meat
•Sprouts
•Processed meats
•Sushi
•Ready made salads
•Soft cheeses
•Soft-serve ice-cream
ALSO AVOIDAlcohol The National Health and
Medical Research Council (NHMRC)
advises the safest option is not to
drink alcohol at all if you’re pregnant
or breastfeeding, or planning to
get pregnant.
Smoking It increases the risk of
premature birth, low birth weight,
respiratory problems and SIDS.
Coffee Small amounts of caffeine
are safe during pregnancy, but too
much may increase the risk of
miscarriage and premature birth.
NSW Health recommends pregnant
women limit caffeine to 200mg
daily (3 cups of instant coffee).
Aim for 5 to 6 serves of vegiesand legumes a day and talk to
your doctor about whether you need
to take a supplement. One serve is
equal to ½ cup of broccoli or spinach
or 1 piece of medium sized fruit
such as apples, bananas or oranges.
Omega-3s are very good for you
and found in fish. Although there are
certain types of seafood to avoid
(raw oysters, cooked chilled prawns
and some deep-sea fish due to
potentially high levels of mercury),
it’s recommended for pregnant women
to eat 2 to 3 serves of fish a week. Be
careful about what type of fish you eat
during pregnancy. The NSW Food
Get at least 2 servings of
dairy a day. When you’re pregnant,
your calcium requirements increase
and during the third trimester, your
baby needs a large amount of calcium
as they start to develop and
strengthen their bones. Enjoy foods
such as milk, hard cheese, yoghurt and
calcium-fortified soy milk.
ABOUT THE WRITERKayte Nunn, mum of three, is a
regular contributor to the Woolworths
Baby and Toddler Club.
baby & toddler club |
Woolworths fresh 41
FRE0512p040-041healthR.indd 41 26/3/12 2:22:14 PM
You’ll always be prepared for anything with these medicine cabinetmust-haves, available from the medicinal aisle at your local Woolworths.
Everyday ESSENTIALS
PROPOVIRDon’t let an unsightly cold sore ruin your
day. Clinically proven to heal cold sores up
to four days faster, Propovir is a naturally
derived and proven treatment to heal
those unsightly cold sores when they strike.
Propovir works to reduce the pain and
effectively target all stages of the cold
sore cycle, from the initial tingle or blister
right through until the lesion has healed.
Always read the label. Use only as
directed. If symptoms persist see
your doctor/healthcare professional.
BOSISTO’SStressed? Tired? Bosisto’s Lavender
Spray contains 100 per cent pure
lavandula angustifolia lavender oil,
a premium quality pharmaceutical-
grade oil. Enjoy the fragrant,
soothing properties of lavender
at the touch of a button. Help
relieve headaches, or use to create
a calming aroma in the bedroom
or children’s nursery so they can
drift naturally to sleep. Bosisto’s
Lavender Spray is also a natural
antibacterial. For more details,
visit fgb.com.au
ELASTOPLASTElastoplast’s Antibacterial Fabric
Strips kill harmful germs and helps
prevent the development of an
infection to your skin wounds. With
unique silver healing technology,
Elastoplast Antibacterial Fabric
Strips provide you with a natural
antiseptic covering for scratches
and abrasions. Flexible and durable,
they’re suitable for all types of skin
and wound sizes.
Always read the label. Use only as
directed. If symptoms persist, consult
your healthcare practitioner.
NICORETTEIf you’re having trouble giving
up smoking cigarettes, Nicorette
presents a new way to control
the cravings for a cigarette.
New Nicorette Freshdrop Lozenge
Mint is a discreet fast-release
lozenge that contains nicotine,
to actively control how much
nicotine you use and when you
use it while you’re trying to quit.
NICORETTE® products contain
Nicotine. Stop smoking aid.
Always read the label. Use only
as directed.
LIFESTYLES®LifeStyles Two in One
Massage & Intimate Gel has
a delicate aroma and subtle
warming sensation that’s
designed to create a more
sensual experience for you
and your partner. Made with
ginger extract, LifeStyles
Two in One can be applied
to all parts of the body, even
your most intimate areas.
Woolworths fresh42
FRE0512p042-045coldR.indd 42 28/3/12 2:37:54 PM
PRODUCTS SHOWN MAY NOT BE AVAILABLE IN ALL STORES
CLEARWIPEClearwipe Lens Cleaner are
pre-moistened wipes that allow
you to safely clean your glasses,
sunglasses, lenses and electronic-
device screens (such as mobile
phones and tablet computers)
anywhere, anytime. Clearwipe
Lens Cleaner are available in
convenient, individually wrapped
packs of 24 pieces.
MACK’S EAR PLUGSEar hygiene and protection is a
crucial part of your family’s health
and wellness. Mack’s Earplugs have
provided high-quality innovative
ear protection for families for more
than 50 years. Used for sleeping,
swimming, showering, snoring,
studying, travelling, industrial-work
noise and flying comfort, Mack’s
Earplugs are non-toxic and non-
allergenic. They are recommended
for sealing your ear drum from water
to help prevent swimmer’s ear, as
well as providing protection after
ear surgeries, and protecting against
flying discomfort and loud noises.
COMPEED® BLISTER PATCHThe Hydrocolloid particles in
COMPEED® blister patches absorb
wound fluid, creating a gel that
protects the wound by sealing
in moisture and preventing scab
formation. This creates the optimal
healing environment, speeding up
the healing process for your blisters.
A COMPEED® Blister Patch acts like
a second skin to instantly relieve
blister pain, allow faster healing^
and protect from further rubbing.
^Compared to no treatment.
Always read the label. Use only as directed.
If symptoms persist see your healthcare
professional.
COMPEED® TOTAL CARE®COLD SORE PATCHA COMPEED Total Care® Invisible
Cold Sore Patch lessens scabs on
your cold sore for faster healing.
The unique Hydrocolloid technology
acts like a second skin to support the
natural moisture balance to deliver
effective, fast, invisible wound healing
and significantly reducing the lesion
from scabbing* and causing it to look
unsightly on your lip. Hide and protect
your cold sore with COMPEED®.
*Compared to no treatment.
Always read the label. Use only as directed.
If symptoms persist see your healthcare
professional.
P
RO D U C
TS
ALL
NEW
Available
instore from
2ndM
ay
Woolworths fresh
woolworths fresh promotion |
43
FRE0512p042-045coldR.indd 43 28/3/12 2:38:59 PM
PANADOLAustralia’s trusted pain reliever has a new
weapon in the fight against pain. Panadol
tablets with Optizorb® technology, means
Panadol’s fast-dissolving action can start
fighting pain in as little as 15 minutes*.PANADOL COLD & FLUPanadol Cold & Flu + Decongestant
Caplets have the trusted pain relief
of the Panadol brand with the added
benefit of another ingredient, to
provide respite from the symptoms
of a cold or flu. Panadol helps relieve
body aches and pains, fever and sore
throat, while the decongestant helps
ease a blocked nose without
making you feel drowsy.
NYAL COUGH, COLD & FLUWhen you or your family see the first
signs of a cold or flu, grab Nyal Cough,
Cold & Flu Day and Night tablets. They
contain six premium herbal ingredients,
plus zinc and vitamin C to help relieve
symptoms of a cold or flu. Nyal Cough,
Cold & Flu Day and Night tablets also help
promote temporary relief from coughs.
*GSK data on file when taken at 1000mg dose.
Always read the label. For the temporary
relief of pain. Use only as directed. If symptomspersist consult your healthcare professional.ASMI 20076-0312
Always read the label, use only as directed.
If symptoms persist consult your healthcareprofessional. CHC52358-03/12
Always read the label. Use only as
directed. If symptoms persist consult
your healthcare professional.
ASMI 20076-0312
When a cold or flu hits during winter, strike back and fight off any baddieswith these products that are available from the medicinal aisle at Woolworths.
Winter cold AND FLU
EASEACOLD KIDSSpecially formulated to help reduce
the severity of your child’s cold and
flu symptoms, such as a runny and
blocked nose, dry cough, sneezes
and sniffles, headache and fever.
Kids also love the great tasting
orange-flavoured chewable burslets
and when taken daily it can also
help to support their immunity.
Use only as directed. Always readthe label. If symptoms persist consultyour healthcare professional.
EASEACOLD DAY & NIGHTContaining ingredients to help reduce the
severity of your cold, EaseaCold Cough, Cold
& Flu is formulated to help reduce symptoms,
including cough, sore throat, congestion and
headache. The day formulation helps to
relieve symptoms without causing drowsiness,
and the night formulation helps provide a
good night’s sleep.
Use only asdirected. Alwaysread the label.If symptomspersist consultyour healthcareprofessional.
Woolworths fresh44
FRE0512p042-045coldR.indd 44 28/3/12 2:39:58 PM
PRODUCTS SHOWN MAY NOT BE AVAILABLE IN ALL STORES
CARMEXDry, chapped lips are often a sign that
winter is reaping havoc on your skin!
Find relief for your lips with the Carmex®
lip balm range — the soothing ingredients
of Carmex lip balm will coat your winter-
ravaged lips, giving them much-needed
moisturise. The Carmex lip range fits
easily in your handbag or pocket and
includes the classic 7.5g jar,
10g squeeze-tube
applicator, and the
new slimline Carmex
Moisture Plus lip balm
in clear satin gloss.
LEMSIP FLEXIThe new Lemsip Flexi is the first and
only flexible dual usage cold & flu remedy.
You can either swallow the caplets when
you’re busy and on the go, or dissolve the
caplets into a soothing hot drink when
you crave that extra comfort. Lemsip Cold
& Flu with Decongestant is for cold and
flu that comes with a blocked or runny
nose. Trust Lemsip Decongestant when
you need to ease troublesome cold and
flu symptoms.
Always read the label. Use only as directed.Incorrect use could be harmful. See yourhealthcare professional if symptoms persist.
LEMSIP MULTI-RELIEFWhen cold and flu strikes, it can leave
you with multiple symptoms that make
you feel down. Trust Lemsip Multi-Relief
to help you feel better, it has clinically
proven active ingredients for effective
relief from headache, fever, aches,
blocked or runny noes, sore throat
and chesty coughs. Available in a lemon
hot drink (10 per pack) and convenient
capsules (16 per pack) that will help
to give you relief from the multiple
symptoms that come with the common
cold and flu.
Always read the label. Use only as directed.Incorrect use could be harmful. See yourhealthcare professional if symptoms persist.
STREPSILS WARMWant a comforting, warming sensation
to soothe your throat when a cold or
flu strikes? Try the new Strepsils Warm
lozenges when you’re on the go and
you need fast, soothing relief. Strepsils
Warm give you the gentle, soothing,
warm sensation to help comfort a sore
throat. Strepsils Warm are available in
a pack of 16 or a pack of 36 lozenges.
Always read the label. Use only as directed.
Incorrect use could be harmful. See your
healthcare professional if symptoms persist.
Be preparedKeep your medicine
cabinet stocked with
these essentials to battle
a cold when it strikes.
• Pain relief
• Cold & flu tablets
for day and night
• Throat lozenges
• Decongestants
• Hot drink remedies
Woolworths fresh
woolworths fresh promotion |
45
FRE0512p042-045coldR.indd 45 28/3/12 2:40:58 PM
1 Yoghurt PancakesMake a batch of macro wholefoods
market organic pancakes followingpacket directions. Ladle batter into pan,leaving space between. Add blueberries.Cook for 3–4 minutes, flip over and cookuntil golden. Stack and serve with organicyoghurt, berries and maple syrup.
2 sMoothieWhizz up frozen mixed berries with
skim milk, organic yoghurt and macrowholefoods market chia seeds.
3 suPer salad dressingCombine ¾ cup organic yoghurt,
1 crushed garlic clove, 2 tbs choppedparsley, 1 tbs honey, 1 tbs grain mustardand 1 tbs white wine vinegar.
4 soothing sideHalve a Lebanese cucumber and
scoop out seeds. Grate coarsely andsqueeze out liquid. Add 1 cup organicyoghurt, 1 tsp ground cumin and2 tbs chopped mint. Serve withsizzling curries.
5 snazzY souPStir a dollop of organic yoghurt
into a bowl of pumpkin soup andsprinkle chopped coriander on top.
6 chicken MarinadeMix 1 cup organic yoghurt,
2 crushed garlic cloves, 2 tsp groundcoriander, 2 tsp ground cumin, 1 tspturmeric and 2 tsp freshly grated gingertogether. Use as a marinade for chicken.
7 easY dessertCombine seasonal fruits like apple,
banana, kiwifruit and mandarins, addsome toasted almonds, a drizzle of honeyand a good dollop of organic yoghurt.
8 Bircher MuesliStir 1½ cups unsweetened apple
juice into 3 cups Woolworths SelectSwiss Bircher Muesli. Cover andrefrigerate for 2 hours. Stir in gratedapple, toasted almond and organicyoghurt. Serve with berries.
9 creaMY diPRoast chunks of pumpkin until
golden and tender. Process with ⅓ cupcashews, ½ tsp caraway seeds. Seasonwith salt. Finish with organic yoghurt.
10 lighter dessertUse organic yoghurt when
making desserts, such as mousse,cakes and muffins. It adds a slightlytart, creamy flavour.
Not just for snacking or smoothies, yoghurtis a versatile staple ingredient that all masterhome cooks should have in their fridge.
10ways with...
macrowholefoodsmarketorganic yoghurt
Enjoy the delicious taste of macrowholefoods market organic yoghurtThis ingredient is so versatile youcan use it in a variety of sweet andsavoury dishes. Add to dips, soupsand salad dressings, or enjoy itwith fresh fruit and in cake mixes.
The texture was socreamy and the flavourwas fantastic.
Mel, Woolworth Fresh reader
reader testedWe asked a Freshreader to tastethe organicyoghurt and giveus their thoughts:
Woolworths fresh46
PHoTo
GRAPHy
JereMY
siMons
STyLInG
david
Morgan
ReCIPedeveLo
PMenTchristinesh
ePPa
rd
Food
PRePA
RATIo
ndix
ieell
iott
| fresh ideas
FRE0512p04610waysR.indd 46 23/3/12 1:01:22 PM
Enjoy just two slices a day as part of a healthy balanced diet. Learn more at www.kraft.com.au/liveactive
* By up to 10% for elevated cholesterol levels, two slices daily over three weeks. Individual results are influenced by many factors including age, current blood cholesterol levels and metabolism. LIVEACTIVE IS A TRADE MARK OF KRAFT FOODS.
Kraft Italian 4 Cheese Blend. Parmesan + Cheddar + Romano + Asiago blended together to make your Italian more ‘authentico.’
o
FROM HO-HUM TO YUM IS A TRADE MARK OF KRAFT FOODS.
KraftCheese12671731.pdf Page 1 7/03/12, 5:49:54 PM
Australian Grown Imperial Mandarins are the fi rst Mandarins of the season, available between April and July. When choosing Mandarins look for a bright and glossy skin and enjoy in salads, sweet and savory cooking or on their own. For more hints and tips, visit woolworths.com.au/freshmarketupdateFabrizio, Fresh Foodie.
woolworths.com.au
WC9024-1.pdf Page 1 2/03/12, 5:20 PM