a single nucleotide substitution in the internal ribosome entry site

JOURNAL OF VIROLOGY, July 1993, p. 3748-37550022-538X/93/073748-08$02.00/0Copyright © 1993, American Society for Microbiology

A Single Nucleotide Substitution in the Internal RibosomeEntry Site of Foot-and-Mouth Disease Virus Leads to

Enhanced Cap-Independent Translation In VivoENCARNACION MARTINEZ-SALAS,1 JUAN-CARLOS SAIZ,1 MERCEDES DAVILA,'

GRAHAM J. BELSHAM,2 AND ESTEBAN DOMINGO'*Centro de Biologia Molecular Severo Ochoa, Consejo Superior de Investigaciones Cientificas,

Universidad Aut6noma de Madrid, Cantoblanco, 28049 Madrid, Spain, 1 and AFRC Institute forAnimalHealth,

Pirbright, Woking GU24 ONF, United Kingdom2

Received 30 November 1992/Accepted 25 March 1993

Mutants of foot-and-mouth disease virus (FMDV) with altered biological properties can be selected duringthe course of persistent infection of BHK-21 cells with FMDV C-S8cl (J. C. de la Torre, E. Martinez-Salas, J.Diez, A. Villaverde, F. Gebauer, E. Rocha, M. Davila, and E. Domingo, J. Virol. 62:2050-2058, 1988). Twonucleotide substitutions, U to C at position -376 and A to G at position -15, (counting as +1 the A of the firstfunctional AUG), were fixed within the internal ribosome entry site (IRES) of R100, the virus rescued after 100passages of the carrier BHK-21 cells. IRES-directed cap-independent protein synthesis was quantitated byusing bicistronic constructs of the form chloramphenicol acetyltransferase gene-IRES-luciferase gene. TheIRES from R100 was 1.5- to 5-fold more active than that of C-S8cl in directing cap-independent luciferasesynthesis. This enhanced translational activity was observed when the RNAs were transcribed either in thenucleus or in the cytoplasm by a weak or a strong promoter, respectively. C-S8cl and R100 IRES elements werefunctional in both FMDV-sensitive and FMDV-resistant cells (including persistently infected R cells), indicatingthat factors mediating cap-independent protein synthesis are not limited in any of the analyzed cell lines.Constructs in which each of the two mutations in the R100 IRES were analyzed separately indicate that thetransition at position -376 is responsible for the enhanced activity of the R100 IRES. By estimating the effectthat an increase in the initial translation efficiency may have on subsequent RNA replication steps, we suggestthat the modifications in the IRES elements can account for the previously described hypervirulence ofFMDVR100 for BHK-21 cells. The results show that a single point mutation in an IRES element of a picornavirus cancause an increase in translation efficiency.

Picornavirus RNAs contain long 5' noncoding regionswith several unused AUG codons and a tight secondarystructure (reviewed in reference 25). Regions of about 450bases from the 5' noncoding regions of foot-and-mouthdisease virus (FMDV) (3, 29), poliovirus (PV) (38), andencephalomyocarditis virus (EMCV) (26, 27) direct internalinitiation of protein synthesis within artificial bicistronicmRNAs in vivo and in vitro. The presence of an internalribosome entry site (IRES) immediately upstream of an openreading frame also directs translation of the open readingframe when cap-dependent translation is inhibited (3). Al-though the sequence homology is only 50% between EMCVand FMDV and 35% between FMDV and hepatitis A virus,the secondary structures predicted for these IRES elementsshow conserved features (4, 41).Mutant analyses of the IRES region of different picorna-

viruses have defined important elements within this region.The boundaries of FMDV, EMCV, and PV IRES have beendefined by deletion analysis (27, 29, 37, 39). Site-directedmutagenesis and internal deletions revealed the requirementof secondary RNA structures to preserve IRES function(42). A pyrimidine-rich stretch, apparently crucial for effi-cient translation, is found in the EMCV, FMDV, and PVIRES elements. Complementarity between a polypyrimidinebox and the 18S rRNAs has been reported (29, 37). Thus,

* Corresponding author.

40S ribosomes could interact with this region via either 18SrRNA or trans-acting factors in a manner analogous to theShine-Dalgamo sequence interaction with the prokaryoticribosomes (42). Indeed, binding of cellular proteins to sev-

eral regions of the IRES appears to be a prerequisite forIRES function in EMCV, PV, and FMDV (27, 31, 35, 40).

Viral virulence can be affected by the IRES sequence.Reduction in the efficiency of PV translation initiation re-

sulted in lowered neurovirulence (20). A mutant of coxsack-ievirus Bi that lacks nucleotides 568 to 726 showed a

small-plaque morphology and decreased virulence for suck-ling mice compared with the wild-type virus (24). A hepatitisA virus variant adapted to grow on BSC-1 monkey kidneycells, which contained a U-to-G transversion at base 687within the IRES, manifested reduced hepatovirulence forsusceptible primates (5).

Persistent infections of FMDV in BHK-21 cells lead togross phenotypic alterations both in the host cells and in theresident virus (9-11). In particular, R100, the virus isolatedafter 100 passages of persistently infected BHK-21 cells,showed increased virulence for BHK-21 cells (11) but atten-uation for cattle and mice (15). The hypervirulence forBHK-21 cells is manifested in a shorter replication cycle andthe survival of a lower proportion of BHK-21 cells incytolytic infections in comparison with C-S8cl (15). R100differs from the parental C-S8cl virus by an average of 1% ofthe genomic residues (14, 19).We considered the possibility that mutations within the

3748

Vol. 67, No. 7

ENHANCED TRANSLATIONAL EFFICIENCY OF A MUTANT IRES 3749

IRES of the persistent virus R100 could contribute to itshypervirulence for BHK-21 cells (11). Here we report thatthe IRES of R100, which differs from that of C-S8cl in twopoint mutations, has evolved to show an increased activity indirecting cap-independent protein synthesis in a variety ofcells, including BHK-21 cells and persistently infected cellseither harboring FMDV or cured of infectious viral RNA. Byengineering the appropriate constructs, we show that thiseffect is mediated by a pyrimidine transition at position-376. Thus, this is the first report on a point mutationcausing an increase, rather than a decrease, in translationinitiation efficiency by a picornavirus.

MATERIALS AND METHODS

Plasmid constructions. Nucleic acid manipulations wereperformed essentially according to Sambrook et al. (44).Plasmid pTT1 (5,314 bp) was derived from pTKluc (32) bytransfer of the 2.7-kb BamHI fragment, which includes theherpes simplex thymidine kinase gene (tk) promoter (33) andthe luciferase gene and polyadenylation signals (13), to theBamHI site of the pGEM-2 vector (Promega). To keep thePstI site in the tk promoter as a unique restriction site in theplasmid, the PstI, HindIII, and AccI restriction sites in thepolylinker were removed by digestion withAccI and HindIII,filling in of the ends with Klenow polymerase, and religation.SacI and EcoRI sites of the polylinker were eliminated byNaeI-plus-SmaI digestion and religation, so that the SacI sitein the tk-luciferase junction is unique in the plasmid. Lu-ciferase can be expressed from plasmid pTTl from the T7 ortk promoter (Fig. 1A).The IRES regions of C-S8cl and R100 virus RNA were

subjected to reverse transcription followed by polymerasechain reaction (PCR) amplification basically as described inRodriguez et al. (43), with oligonucleotides containing SacIrestriction sites at their ends. Briefly, 10 ng of purifiedC-S8cl or R100 RNA was copied into cDNA by 30 min ofincubation at 42°C with 10 U of reverse transcriptase (Seik-agaku) in PCR buffer (10 mM Tris-HCl [pH 8.3], 50 mM KCl,1.5 mM MgCl2, 0.01% gelatin, 100 ,uM each deoxynucle-otide). The cDNA was primed with the oligonucleotide5'CCGAGGCTCAGGGTCATTAATTG, complementary topositions -1 to -14 (relative to the adenosine of the firstfunctional AUG initiation codon in the C-S8cl nucleotidesequence [19], which is assigned position +1). The primerwith the same polarity as the virus RNA, 5'CACGAGCTCAGCAGG1TJTT7CC, spanning positions -470 to -450, wasadded as the partner in the PCR, performed by using 30cycles of 94°C for 1 min, 45°C for 1 min, and 72°C for 2 min,with 2.5 U of AmpliTaq (Cetus). The PCR products weretreated with SacI, purified by agarose gel electrophoresis,and ligated to the SacI-digested plasmid pTT1, upstream ofthe luciferase gene, to produce the monocistronic pIC (in-cluding the IRES of C-S8cl) and pIR (including the IRES ofR100) constructs. The nucleotide sequence of the T7, tk, andIRES regions were determined by primer extension anddideoxy-chain termination sequencing using T7 DNA poly-merase (28). All constructs expressing the luciferase geneinitiate protein synthesis at the AUG provided by the vectorpT117, 26 nucleotides downstream of the SacI site, since noother functional AUG is present (1, 2).The chloramphenicol acetyltransferase (CAT) gene from

pSV2CAT (22) was amplified by PCR with oligonucleotidescontaining PstI restriction sites generated by substitution ofthree nucleotides in the pSV2CAT sequence. The 5' end ofthe primer 5'CGT'lTAACTGCAGCAATAACTG, comple-

mentary to the coding strand, corresponds to position +692relative to the AUG initiation codon. The primer 5'GGAGCTGCAGAAGCTAAATG, of the same polarity as the codingstrand, spans positions -18 to +3. The 710-bp PCR productwas digested with PstI, purified by agarose gel electrophore-sis, and ligated to PstI-digested pIC or pIR upstream of theIRES region, to produce constructs pBIC and pBIR, respec-tively, which express bicistronic mRNAs (Fig. 1A).IRES elements including only one of the two substitutions

found in the IRES from R100 were constructed by exchang-ing the small and large NcoI-HindIII fragments (570 bp and5.9 kb, respectively) of pBIR with those of pBIC; they havebeen termed pR-15 and pR-376, in which the number indi-cates the position at which they differ from the IRES ofC-S8cl (Fig. 1). Plasmids pILC and pILR contain the IRESand extend past the L-coding region up to the XbaI site in theVP2-coding region (14) of C-S8cl and R100, respectively(Fig. 1A).

Cells and viruses. FMDV C-S8cl and R100 have beendescribed previously (14, 16). FMDV persistently infected(R) cells and ribavirin-cured (Rbv) cells have been describedby de la Torre et al. (7, 11). The R cells used in this studycorrespond to passages 87 to 117, and their culture mediumcontained 103 to 104 PFU/ml. BHK-21 cells were obtainedfrom the American Type Culture Collection, and BSC40cells were kindly provided by A. Portela. Immunoprecipita-tion of L protein from extracts of BHK cells infected withC-S8cl or of persistently infected R cells was carried outessentially as described by Strebel et al. (45), using a rabbitpolyclonal anti-L serum kindly provided by E. Beck.

Transient expression assays. All cell lines were grown inDulbecco's modified Eagle's medium supplemented with 5%fetal calf serum. When transcription from the T7 promoterwas desired, BSC40, BHK-21, or R-cell monolayers wereinfected with the vaccinia virus (VV) recombinant vTF7-3(21) 1 h before transfection with the relevant plasmids.Lipofectin (Bethesda Research Laboratories)-mediatedtransfection was carried out according to the directions ofthe supplier. Usually, 1 ,ug of the appropriate plasmid(s)DNA was used to transfect monolayers of about 106 cells.Fetal calf serum (5%) was added to the monolayer 5 to 6 hlater. Cell extracts were prepared at the indicated times,either in 200 ,ul of 0.5% Nonidet P-40-120 mM NaCI-50 mMTris-HCl (pH 7.8) or by freeze-thawing in 50 RI of 0.1 Mphosphate buffer (pH 7.8)-i mM dithiothreitol. Experimentswere performed on duplicate or triplicate plates, and eachexperiment was repeated at least twice. The standard errorof the mean CAT and luciferase activities in experimentsdone in triplicate varied between 3 and 20% of the mean.

Luciferase assays were performed as described by Mar-tinez-Salas et al. (32), using a 2010 Luminometer (AnalyticalLuminescence). The accuracy of the assay was determinedby repeated measurements of the same extract; the standarderror of the mean was 2% of the mean. CAT activity wasdetermined by the liquid scintillation assay as described byNeumann et al. (36) except that the reaction mixture wasadjusted to 0.08 M sodium borate (pH 9)-4 M NaCl at theend of the incubation period to decrease the background.Appropriate dilutions of the extracts were chosen to be inthe linear range of the assay. The results are presented bothas absolute luciferase activities and as luciferase activitiesrelative to CAT activities measured in the same extract. Inthe assay of expression from the tk promoter transcripts, theenzyme activities were further normalized to the amount ofprotein measured in the cell extracts by the Lowry method.

VOL. 67, 1993

3750 MARTINEZ-SALAS ET AL.

A

pTT1 -T7-T Poly-A+splicing signals-

pBIC -T7Tk CAT T luciferase

pBIR -T77TkCAT luciferase

]-Poly-A+splicing signals-

-Poly-A+splicing signals-

pR-15 -T7'Tk4 CAT T

pR-376 -T7.Tk- CAT |C

G I luciferase

A I luciferase

+Poly-A+splicing signals-

IPoly-A+splicing signals-

pILC -T7-Tk C- -S8cl R C-S8cl L proteasek.........CVP4-VP2-

pILR -T7-Tkf ~ (It1FCjOOtpr6tease< VP4-VP2-

B3

4

1

53' binding

site

S' bindingsite

G

2

FIG. 1. (A) Diagram of the plasmids constructed in this work. Names and relevant features of the plasmids are indicated. Transcriptionstart sites (ri--), C-S8c1 sequences ( I ), and R100 sequences (z) are shown. The rectangle between CAT and luciferase depicts the IRESelement; bold letters in the IRES indicate nucleotide differences between the C-S8c1 and R100 IRES. The steps followed in the constructionof each plasmid are detailed in Materials and Methods. (B) Scheme of the secondary structure of the IRES of FMDV, showing the locationsof the two mutations which distinguish the C-S8cl IRES from that of R100. The secondary structure prediction and loop numbering are fromPilipenko et al. (41). Shaded areas correspond to p57 binding sites (31). The polypyrimidine motif is located on the striped area.

In no case did such a normalization alter the relative enzymeactivities reported here.

RESULTS

Differences in sequence between the C-S8cl and R100FMDV IRES elements. A region of 470 nucleotides preceding

the initiator AUG from the parental C-S8cl and the persis-tent R100 FMDVs was subjected to reverse transcription-PCR amplification and cloned into the expression vectorpTJl as described in Materials and Methods. Sequencecomparison of both cloned IRES elements revealed only twopoint mutations in R100 compared with C-S8c1 (Fig. 1A).One of the mutations (an A-to-G transition at position -15)

Il ic: =S;--;.

J. VIROL.


CA

O.-

0)

0b-

4)

-i

.105

-io4 G.

103 <

102

.10

125-

X 100

.o 75.

-* 50-.5

0lU

0

0a)Ico4)

10' 100no DNA pTT1 pBIC pBIR

FIG. 2. Expression of luciferase and CAT by FMDV constructsfrom the T7 or tk promoter in BHK-21 cells. Plasmids indicated atthe bottom (depicted in Fig. 1) were transfected into BHK-21 cells,which were infected with VTF7-3 when T7 promoter activity wasdesired; cell extracts were prepared in buffer containing NonidetP-40 24 h after serum addition. The luciferase (_) and CAT ( 1 )activities produced by 1 x 104 to 2 x 104 cells are represented. Todetermine activities from tk promoter transcription, cell extractswere prepared 42 h after serum addition by freeze-thawing of cellstransfected with the indicated plasmids. The luciferase (El) andCAT (rfl) activities produced by 0.5 x 106 to 1 x 106 cells arerepresented.

is close to the polypyrimidine box, a region which wasidentified as important for IRES function by Kuhn et al. (29)(Fig. 1B). A second mutation (a U-to-C transition at position-376) is located at the beginning of stem 3 defined byPilipenko et al. (41) (Fig. 1B). In addition to these twomutations, Escarmis et al. (19) reported a third substitutionin the IRES in the consensus RNA population from R100RNA. The sequence difference between the consensus RNAand a cDNA clone probably reflects the genetic heterogene-ity inherent to the quasispecies nature of FMDV (17).The IRES elements from cytolytic and persistent FMDVs

are functional in a heterologous system. To assess the activityof the IRES elements from C-S8c1 and R100 cDNAs, theseelements were inserted as the intergenic spacer between thetwo reporter genes, CAT and luciferase, to produce plasmidspBIC and pBIR, respectively (Fig. 1A). Bicistronic RNAstranscribed within cells, either by the cellular RNA poly-merase II from the tk promoter or by the T7 RNA poly-merase, using a recombinant VV from the T7 promoter,were translated, and the luciferase and CAT activities weremeasured in cell extracts (Fig. 2). Expression from the T7promoter was 103- to 104-fold higher for both luciferase andCAT activities than expression from the tk promoter. Asexpected, luciferase but not CAT activity was expressedfrom plasmid pTT1. The levels of expression of luciferaseactivity in the bicistronic constructs were similar to thecap-dependent translation activity observed with the vectorpTT1.To ensure that the luciferase activity induced by the pBIC

and pBIR constructs was the result of internal initiation andnot read-through from cap-dependent initiation, cap-depen-dent initiation of protein synthesis was inhibited by the Lprotease of FMDV (3, 12, 30). A plasmid (pLb) whichexpresses the Lb protease of C-S8cl from RNA transcribedfrom the T7 promoter (34) was cotransfected with eitherpBIC or pBIR in BHK-21 cells previously infected with theVV recombinant VTF7-3 to provide T7 RNA polymerase(21). The luciferase and CAT activities were compared with

pTT1 pTT1 pBIC pBIC pBIR pBIR+ + +pLb pLb pLb

FIG. 3. Luciferase and CAT expression modified by the Lbprotease. BHK-21 cells infected with VTF7-3 were transfected withthe plasmids indicated at the bottom (depicted in Fig. 1). Luciferase(_) and CAT ( ) activities were determined in cell extractsprepared 24 h after serum addition. Values are relative to theactivity expressed in the absence of pLb, which was taken as 100%in each case.

those produced by the bicistronic plasmid pBIC or pBIRalone. As shown in Fig. 3, translation of a cap-dependentRNA is sensitive to the inhibition mediated by Lb, asevidenced by the decrease in luciferase activity in thecontrol vector pTT1 or of CAT activity in the bicistronicconstructs including the IRES from either C-S8cl or R100.In contrast, translation of luciferase in the bicistronic con-struct pBIC or pBIR was not affected by the presence of Lb.R100 differs from C-S8cl in approximately 1% of the

genomic residues, including the region encoding the Lprotease (14a). To determine whether differences in L se-quence were influencing L activity, constructions containingthe original C-S8cl and R100 IRES-L protease combina-tions, pILC and pILR, were used to determine luciferasecap-independent translation. Results were similar to those

100

80-

60-

40)

1S

0-

pILC pILC pILC pILR pILR pILR+ + + + + +

pTT1 pBIC pBIR pTT1 pBIC pBIRFIG. 4. Relative translational activity of cap-dependent versus

cap-independent luciferase activity modified by the expression ofthe C-S8cl or R100 L protease directed by its homologous IRESsequence. Cells were transfected with the plasmids indicated at thebottom (depicted in Fig. 1). Luciferase activity was measured 24 hposttransfection in BHK-21 (_) or R cells ( ) infected withVTF7-3. For BHK-21 cells, values are relative to the activityexpressed by pBIC and pILC, which was taken as 100%. For Rcells, values are relative to the activity expressed by pBIR andpILR, which was taken as 100%.

VOL. 67, 1993

07


TABLE 1. Relative translational activities of the bicistronic mRNAs produced from the T7 promoter'Determination (mean + SEM)

Cell line pBIR/pBIC pR-376/pR-15

l.u. l.u./cpm l.u. l.u./cpm

BSC40 2.35 ± 0.63 (4) 5.20 ± 0.08 (4) 1.58 ± 0.28 (8) 1.79 ± 0.6 (4)BHK-21 2.61 ± 0.71 (6) 1.67 ± 0.53 (6) 1.84 ± 0.24 (13) 1.56 ± 0.4 (6)R 2.13 ± 0.38 (9) 1.15 ± 0.41 (4) 1.51 ± 0.23 (14) 2.09 ± 0.4 (6)Rbv 1.41 ± 0.25 (6) 2.29 ± 0.44 (6) ND ND

a The indicated cell lines, infected with VTF7-3, were transfected with plasmids carrying the R100 (pBIR) or C-S8cI (pBIC) IRES or the individual mutationspR-15 and pR-376 and harvested 24 h posttransfection. The number of determinations is indicated in parentheses. l.u., light units; cpm, counts per minute in theCAT assay (see Materials and Methods); ND, not done.

obtained for plasmid pLb (Fig. 4). However, when wecompared the relative luciferase activities in BHK-21 and Rcells, we observed that BHK-21 cells gave a larger differencebetween cap-dependent and cap-independent translation(Fig. 4), presumably because R cells are producing FMDVand therefore contain endogenous L protease. Indeed, the Lprotein could be immunoprecipitated from [35S]methionine-labeled R-cell extracts with a polyclonal anti-L serum,although the signal was weaker than that of BHK cellslytically infected either with C-S8cl or R100 (data notshown).The IRES from C-S8cl and R100 differ in the ability to

direct cap-independent protein synthesis in bicistronicmRNAs. The relative activities of the IRES from C-S8c1 andR100 in directing expression of luciferase relative to CATwere measured in several cell lines, some sensitive andothers resistant to infection by FMDV. In BSC40 cells, anefficient host for VV (23), pBIR induced an average 2.3-fold-higher luciferase activity than did pBIC (Table 1). Correctionof luciferase activity with that of CAT in the same extractcorroborates the conclusion, pBIR being 5.2-fold more ac-tive than pBIC in BSC40 cells. In BHK-21 or R cells, theratio of IRES activities (pBIR/pBIC) was 1.5 to 2.6 (Table 1)except when the activities in R cells were normalized forCAT activity. CAT activities in R cells are depressed,probably because of endogenous L expression in cells ac-tively producing viral particles, and this may cause inaccu-rate normalization.To explore whether the enhanced activity of pBIR over

pBIC was observed at different times after transfection, thetime course of luciferase and CAT expression was deter-mined by using BSC40 cells (Fig. 5). At all time pointsexamined, the R100 IRES-directed activity was larger thanthat directed by the C-S8cl IRES, as shown in the plot of theratio pBIR/pBIC versus time (Fig. SC). Similar analysis ofthe time course of luciferase expression from pBIR or pBICin BHK-21 and R cells also consistently indicated a higherefficiency of the R100 IRES over the C-S8c1 IRES (Fig. 6).

In contrast to the transcripts from the T7 promoter that aresynthesized in the cytoplasm, which may resemble replicat-ing FMDV RNA, tk promoter transcripts are produced in thenucleus by RNA polymerase II, processed, and transportedto the cytoplasm as cellular mRNAs. The ratio of pBIR- topBIC-directed (pBIR/pBIC) luciferase activity of RNA tran-scribed from the tk promoter ranged between 1.6 and 4.4(Table 2). An analysis of the time course of luciferaseexpression in BHK-21 and R cells indicated that the in-creased activity of the R100 IRES over the C-S8cl IRES wasalso observed during 42 h after transfection (data notshown). We conclude that the IRES of FMDV R100, whichdiffers from that of FMDV C-S8cl in two point mutations,

shows a small but reproducibly higher translation activitythan does the IRES from FMDV C-S8cl, irrespective of thecellular localization of RNA synthesis.

Protein synthesis induced by the R100 IRES is not ther-mosensitive. The viruses shed by BHK-21 cells during per-sistence are thermosensitive (8). To determine whethertranslation from the R100 IRES was thermosensitive, wecarried out transfection experiments at 39°C on BSC40 cells,a cell line isolated specifically to detect thermosensitive VVmutants (6). The enhanced activity of R100 IRES overC-S8cl IRES is observed also at 39°C. An analysis of the

2.5

20-r 2.0-

, 1.5

a 1005co

'9 0.5

0

0coI-:'

2.5

2.0

1.5

1.0

5

0

.t 8O.2

i ) 6

4 15.2.2.

) 5 10 15 20 25

Time post-transfection (hours)

FIG. 5. Time course of translation of the bicistronic mRNAs inBSC40 cells. VTF7-3-infected cells were transfected with pBIR orpBIC and cell extracts were prepared at the times indicated asdescribed in Materials and Methods. (A) Luciferase activity, ex-pressed as light units, corresponding to 1 x 104 to 2 x 104 cells; (B)CAT activity, expressed as counts per minute, in the same extractsdiluted 100-fold; (C) pBIR/pBIC luciferase activity corrected by theCAT activity ratio.

A /

pBIR

/BABIC

5 1. .15 0. 25 10 15 20 25

-B

pBIR

0 5 10 15 20 25

C

00

S

J. VIROL.

C


3.5-w

3.0 -

- 2.5-C)

a 2.0-0

X 1.50

5 1.0-.1

0.5 -

Oil

25-0

2

,, 15-CD

- 10

5

0

0o 4-

t 2-

0 5 10 15 20 25 30

Time post-transfection (hours)

FIG. 6. Time course of bicistronic mRNAs translation inBHK-21 and R cells. VTF7-3-infected cells were transfected withpBIR or pBIC, and cell extracts were prepared at the timesindicated. Open symbols, R cells; closed symbols, BHK-21 cells.(A) Luciferase activity, expressed as light units, corresponding to 1X 104 to 2 x 104 cells; (B) CAT activity, expressed as counts perminute, in the same extracts diluted 10-fold; (C) pBIR/pBIC lu-ciferase activity corrected by the CAT activity ratio.

relative pBIR/pBIC efficiency at expressing luciferase activ-ity in the same experiment showed that at early times aftertransfection, the R100 IRES was 8 to 10 times more activethan the C-S8cl IRES. A pBIR/pBIC ratio of 1.1 to 4.4 wasobtained in transfections of BHK-21 and R cells at 39°C.

TABLE 2. Relative translational activities of bicistronic mRNAstranscribed from the tk promoterA

Mean pBIR/pBIC ratio + SEMCell line

l.u. l.u./cpm

BSC40 3.34 ± 0.58 (3) NDBHK-21 2.02 ± 0.25 (22) 4.49 ± 0.95 (4)R 1.93 ± 0.44 (9) 3.03 + 1.46 (4)Rbv 1.63 ± 0.20 (8) ND

a The indicated cell lines were transfected with plasmids carrying thepersistent (pBIR) or parental (pBIC) IRES and harvested 42 h posttransfec-tion. The number of determinations is indicated in parentheses. l.u., lightunits; cpm, counts per minute in the CAT assay (see Materials and Methods);ND, not done.

too 1.5

> 1.0.S

0a 0

II0.5

u 10.o

>; 8

t 600co 4-

, 2-J

in0

-

0

0

0

6

4.

2

_,I . .

0 5 10 15 20 25 30Time post-transfection (hours)

FIG. 7. Analysis of the effect of the individual point mutations ofthe R100 IRES in the time course of translation of bicistronicmRNAs in BSC40, BHK-21, and R cells. VTF7-3-infected cellstransfected with pR-15 or pR-376 (depicted in Fig. 1) were assayedat the indicated times as described in Materials and Methods.Luciferase activity is given as light units produced by 1 x 103 to 2 x103 cells. Broken lines represent the luciferase activity of pBIC andpBIR obtained in parallel experiments.

Therefore, induction of protein synthesis by R100 IRES isnot temperature sensitive.

Independent analysis of the mutations implicated in theincreased activity of the R100 IRES compared with the C-S8clelement. The two nucleotide substitutions between theC-S8c1 and R100 elements could be conveniently separatedfrom each other by exchanging DNA fragments at either sideof the HindIII site at position -60 (see Materials andMethods). The nucleotide substitutions observed in the R100IRES were analyzed independently in transfections withplasmids pR-15 and pR-376, each harboring one of themutations present in the R100 IRES. The luciferase activitiesproduced by these plasmids were compared in BSC40,BHK-21, and R cells (Fig. 7). In all cases, pR-376 behavedvery similarly to pBIR, while pR-15 was comparable topBIC. The ratios of pR-376 to pR-15, both as luciferaseactivity alone and as luciferase activity corrected by CATactivity, have been included in Table 1 for comparison withthe values obtained with pBIC and pBIR. The result suggeststhat the mutation at position -376 is the main contributor to

BSC40

,/- R-376

pR-15.5.,

5 10 15 20 25 30

5 10 15 20 25 30

BHK

pR-370'

riFiI,~~~~~~10 5 10 15 20 25 30

0 5 10 15 20 25 30

C 0

0

0 0

R I,

,,?j~pR-376

,, R-1 5/'.

.1 -R -----

VOL. 67, 1993


the increased R100 IRES efficiency over C-S8cl IRESefficiency. The substitution at position -15 alone had noeffect that could be detected in this assay. We conclude thata single nucleotide transition is able to increase the IRESactivity of a FMDV rescued after prolonged persistence incell culture.

DISCUSSION

In this report, we have shown that a point mutation in theIRES element of FMDV R100 isolated from cells persis-tently infected with FMDV C-S8cl (7, 9-11, 14, 15, 19)induced an enhanced cap-independent expression of a re-porter gene (Fig. 3 and 4) in bicistronic mRNAs expressed inthe nucleus or the cytoplasm of mammalian cells (Tables 1and 2). We chose to analyze cap-independent translation ofRNA transcripts produced by a weak (tk) and a strong (T7)promoter to detect differences in IRES activity which mayhave been missed if saturating levels of transcripts had beenpresent. In both cases, an increase of 1.5- to 5-fold of theactivity of the modified IRES from FMDV R100 relative tothe IRES of C-S8cl was consistently found in assays carriedout at 37°C (Tables 1 and 2; Fig. 5 and 6), and a largerincrease (up to 10-fold) was detected at 39°C (data notshown). This finding suggest that the temperature-sensitivephenotype of R100 is unrelated to IRES activity at least inour bicistronic constructs in which the IRES has beenisolated from other genomic RNA sequences. Of the twomutations which distinguish the IRES of R100 from that ofC-S8cl, the enhanced IRES activity was associated with apyrimidine transition (U to C) at position -376, at the baseof loop 3 proposed by Pilipenko et al. (41) (Fig. 1B and 7). Itcould be thought that an increase of about twofold in IRESactivity at 37°C is not significant enough to account for thedifferences in the replication cycle previously noted betweenFMDV R100 and C-S8cl (11, 15), consisting of an advance ofabout 2 h both in the appearance of progeny RNA and in thetime at which the maximum level of progeny RNA isattained. However, an estimate of the effect of a twofolddifference in translation efficiency on the level of progenyFMDV RNA at early and middle times after infectionsuggests that the observed difference in IRES activity maybe highly significant. Under the simplest possible assump-tions that (i) at a given multiplicity of infection (m), viralRNA is translated with the efficiency E, (ii) one molecule ofprotein produces only one molecule of RNA, and (iii) RNAand protein molecules are used only once per translation orreplication round and then disappear from the active popu-lation, the extent of amplification of viral RNA (Y) is givenby the expression Y = [m x E]N, whereN is the number oftranslation-replication rounds per infectious cycle. Thus,after four rounds of translation at m = 1, a minimum of16-fold more RNA molecules would be produced when thetranslational efficiency differs by a factor of 2, and a 625-folddifference will be observed if the translational efficiencydiffers by a factor of 5. Under other less simple but perhapsmore realistic assumptions (i.e., one molecule of protein isinvolved in the synthesis of several RNA molecules, RNAand proteins molecules are used severalfold, etc.), the influ-ence of an increase in translation efficiency would be evenmore dramatic. According to studies of the coupling of RNAreplication and mRNA translation in the life cycle of RNAphages (18), substantial increases in the rate of either ge-nome replication or translation necessitate compensatorycontrol elements that avoid exhaustion of environmentalfactors (ribosomes, host cell proteins, etc.) needed for

successful replication. Thus, IRES elements endowed withbiological activity much higher than that of the wild typemay be selected against in vivo or in cell culture (18). Indeedin the analysis of IRES function by site-directed mutagene-sis, most modifications resulted in a decrease rather than anincrease of activity (27, 29, 37, 39, 42).The molecular basis of the increase in IRES activity

mediated by the transition U (-376) to C is not known, butthis residue is within the 5' binding site of protein p57identified by Luz and Beck (31), suggesting that this muta-tion might facilitate the interaction of the IRES with cellularproteins needed for initiation of translation (27, 31, 35, 40).Our results rule out the possibility that such proteins weremissing or inactive in R cells since they fully support IRESactivity, in agreement with previous results on cell fusionexperiments which suggested that the resistance of R cells toFMDV was due to trans-acting cellular inhibitors rather thanto the alteration or absence of cellular factors needed forviral replication (9). No effect of the substitution at position-15 could be detected in our assays (Fig. 7). However, theamounts of the two forms of L proteins synthesized by R100were altered relative to the amounts synthesized by C-S8clin BHK cells (data not shown) and in in vitro translationassays (14a). A possible effect of the substitution at -15 onaltering the use of the two functional AUGs is under study.

Finally, although the enhanced IRES activity of R100 canexplain the hypervirulence of this virus for BHK-21 cells, itis clear that other genetic alterations could also contribute tothis phenotypic trait (i.e., through a modification of othersteps in the viral replication cycle). Also, a number ofdifferent combinations of genetic lesions, not necessarilyinvolving the IRES element, may lead to the hypervirulencephenotype.

ACKNOWLEDGMENTS

We thank Ewald Beck for the anti-L serum and Miguel Medina forplasmid pLb and for critical reading of the manuscript.Work at CBM was supported by CICYT PB91-0051-C02-01, The

European Community (Bridge Program), and Fundaci6n Ram6nAreces.

REFERENCES

1. Beck, E., S. Forss, K. Strebel, R. Cattaneo, and G. Feil. 1983.Structure of the FMDV translation initiation site and of thestructural proteins. Nucleic Acids Res. 11:7873-7885.

2. Belsham, G. J. 1992. Dual initiation sites of protein synthesis onfoot-and-mouth disease virus RNA are selected following inter-nal entry and scanning of ribosomes in vivo. EMBO J. 11:1105-1110.

3. Belsham, G. J., and J. K. Brangwyn. 1990. A region of the 5'noncoding region of foot-and-mouth disease virus RNA directsefficient internal initiation of protein synthesis within cells:involvement with the role of L protease in translational control.J. Virol. 64:5389-5395.

4. Brown, E. A., S. P. Day, R. W. Jansen, and S. M. Lemon. 1991.The 5' nontranslated region of hepatitis A virus RNA: second-ary structure and elements required for translation in vitro. J.Virol. 65:5828-5838.

5. Cohen, J. I., B. Rosenblum, S. M. Feinstone, J. Ticehurst, andR. H. Purcell. 1989. Attenuation and cell culture adaptation ofhepatitis A virus (HAV): a genetic analysis with HAV cDNA. J.Virol. 63:5364-5370.

6. Condit, R. C., and A. Moticzka. 1981. Isolation and preliminarycharacterization of temperature-sensitive mutants of vacciniavirus. Virology 113:224-241.

7. de la Torre, J. C., B. Alarc6n, E. Martinez-Salas, L. Carrasco,and E. Domingo. 1987. Ribavirin cures cells of a persistent

J. VIROL.


infection with foot-and-mouth disease virus in vitro. J. Virol.61:233-235.

8. de la Torre, J. C., M. Davila, F. Sobrino, J. Ortin, and E.Domingo. 1985. Establishment of cell lines persistently infectedwith foot-and-mouth disease virus. Virology 145:24-35.

9. de la Torre, J. C., S. de la Luna, J. Dfez, and E. Domingo. 1989.Resistance to foot-and-mouth disease virus mediated by trans-acting cellular products. J. Virol. 63:2385-2387.

10. de la Torre, J. C., E. Martinez-Salas, J. Diez, and E. Domingo.1989. Extensive cell heterogeneity during persistent infectionwith foot-and-mouth disease virus. J. Virol. 63:59-63.

11. de la Torre, J. C., E. Martinez-Salas, J. Diez, A. Villaverde, F.Gebauer, E. Rocha, M. Davila, and E. Domingo. 1988. Coevo-lution of cells and viruses in a persistent infection of foot-and-mouth disease virus in cell culture. J. Virol. 62:2050-2058.

12. Devaney, M. A., V. N. Vakharia, R. E. Lloyd, E. Ehrenfeld, andM. J. Grubman. 1988. Leader protein of foot-and-mouth diseasevirus is required for cleavage of the p220 component of thecap-binding protein complex. J. Virol. 62:4407-4409.

13. de Wet, J. R., K. V. Wood, M. DeLuca, D. R. Helinski, and S.Subramani. 1987. Firefly luciferase gene: structure and expres-sion in mammalian cells. Mol. Cell. Biol. 7:725-737.

14. Diez, J., M. Dfvila, C. Escarmis, M. G. Mateu, J. Dominguez,J. J. Perez, E. Giralt, J. A. Melero, and E. Domingo. 1990.Unique amino acid substitutions in the capsid proteins offoot-and-mouth disease virus from a persistent infection in cellculture. J. Virol. 64:5519-5528.

14a.Diez, J., C. Escarmis, et al. Unpublished data.15. Diez, J., M. Hofner, E. Domingo, and A. I. Donaldson. 1991.

Foot-and-mouth disease virus strains isolated from persistentlyinfected cell cultures are attenuated for mice and cattle. VirusRes. 18:3-8.

16. Domingo, E., M. Dvila, and J. Ortin. 1980. Nucleotide se-quence heterogeneity of the RNA from a natural population offoot-and-mouth disease virus. Gene 11:333-346.

17. Domingo, E., C. Escarmis, M. A. Martinez, E. Martinez-Salas,and M. G. Mateu. 1992. Foot-and-mouth disease virus popula-tions are quasispecies. Curr. Top. Microbiol. Immunol. 176:33-47.

18. Eigen, M., C. F. Biebricher, and M. Gebinoga. 1991. Thehypercycle. Coupling of RNA and proteins by synthesis in theinfection cycle of an RNA bacteriophage. Biochemistry 30:11005-11018.

19. Escarmis, C., M. Toja, M. Medina, and E. Domingo. 1992.Modifications of the 5' untranslated region of foot-and-mouthdisease virus after prolonged persistence in cell culture. VirusRes. 26:113-125.

20. Evans, M. A., G. Dunn, P. D. Minor, G. C. Schild, G. Cann, G.Stanway, J. W. Almond, K. Currey, and J. V. Maizel. 1985.Increased neurovirulence associated with a single nucleotidechange in a noncoding region of the Sabin type 3 poliovaccinegenome. Nature (London) 314:548-550.

21. Fuerst, T. R., E. G. Niles, F. W. Studier, and B. Moss. 1986.Eukaryotic transient expression system based on recombinantvaccinia virus that synthesizes bacteriophage T7 RNA poly-merase. Proc. Natl. Acad. Sci. USA 83:8122-8126.

22. Gorman, C. M., L. F. Moffat, and B. H. Howard. 1982.Recombinant genomes which express chloramphenicol acetyl-transferase in mammalian cells. Mol. Cell. Biol. 2:1044-1051.

23. Hruby, D. E., D. L. Lynn, R. C. Condit, and J. R. Kates. 1980.Cellular differences in the molecular mechanisms of vacciniavirus host range restriction. J. Gen. Virol. 47:485-488.

24. Iizuka, N., H. Yonekawa, and A. Nomoto. 1991. Nucleotidesequences important for translation initiation of enterovirusRNA. J. Virol. 65:4867-4873.

25. Jackson, R., M. T. Howell, and A. Kaminski. 1990. The novelmechanism of initiation of picornavirus RNA translation.Trends Biochem. Sci. 15:477-483.

26. Jang, S. K., A. Davies, R. J. Kaufman, and E. Wimmer. 1989.Initiation of protein synthesis by internal entry of ribosomesinto the 5' nontranslated region of encephalomyocarditis virus

RNA in vivo. J. Virol. 63:1651-1660.27. Jang, S. K., and E. Wimmer. 1990. Cap-independent translation

of encephalomyocarditis virus RNA: structural elements of theinternal ribosomal entry site and involvement of a cellular 57-kDRNA-binding protein. Genes Dev. 4:1560-1572.

28. Jones, D. S. C., and J. P. Schofield. 1990. A rapid method forisolating high quality plasmid DNA suitable for DNA sequenc-ing. Nucleic Acids Res. 18:7463-7464.

29. Kuhn, R., N. Luz, and E. Beck. 1990. Functional analysis of theinternal translation initiation site of foot-and-mouth diseasevirus. J. Virol. 64:4625-4631.

30. Lloyd, R. E., M. J. Grubman, and E. Ehrenfeld. 1988. Relation-ship of p220 cleavage during picornavirus infection to 2Aproteinase sequence. J. Virol. 62:4216-4223.

31. Luz, N., and E. Beck. 1991. Interaction of a cellular 57-kilodalton protein with the internal translation initiation site offoot-and-mouth disease virus. J. Virol. 65:6486-6494.

32. Martinez-Salas, E., E. Linney, J. Hassell, and M. L. DePamphi-lis. 1989. The need for enhancers in gene expression firstappears during mouse development with formation of the zy-gotic nucleus. Genes Dev. 3:1493-1506.

33. McKnight, S. L., and R. Kingsbury. 1982. Transcriptionalcontrol signals of a eukaryotic protein-coding gene. Science217:316-324.

34. Medina, M., E. Domingo, J. K. Brangwyn, and G. J. Belsham.The two species of the foot-and-mouth disease virus leaderprotein, expressed individually, exhibit the same activities.Virology, in press.

35. Meerovitch, K., J. Pelletier, and N. Sonenberg. 1989. A cellularprotein that binds to the 5'-noncoding region of poliovirus RNA:implications for internal translation initiation. Genes Dev.3:1026-1034.

36. Neumann, J. R., C. A. Morency, and K. 0. Russian. 1987. Anovel rapid assay for chloramphenicol acetyl transferase geneexpression. BioTechniques 5:444-447.

37. Nicholson, R., J. Pelletier, S. Le, and N. Sonenberg. 1991.Structural and functional analysis of the ribosome landing pad ofpoliovirus type 2: in vivo translation studies. J. Virol. 65:5886-5894.

38. Pelletier, J., and N. Sonenberg. 1988. Internal initiation oftranslation of eukaryotic mRNA directed by a sequence derivedfrom Poliovirus RNA. Nature (London) 334:320-325.

39. Percy, N., G. J. Belsham, J. K. Brangwyn, M. Sullivan, D. M.Stone, and J. W. Almond. 1992. Intracellular modificationsinduced by poliovirus reduce the requirement for structuralmotifs in the 5' noncoding region of the genome involved ininternal initiation of protein synthesis. J. Virol. 66:1695-1701.

40. Pestova, T. V., C. U. T. Hellen, and E. Wimmer. 1991. Trans-lation of poliovirus RNA: role of an essential cis-acting oligopy-rimidine element within the 5' nontranslated region and involve-ment of a cellular 57-kilodalton protein. J. Virol. 65:6194-6204.

41. Pilipenko, E. V., V. M. Blinov, B. K. Chernov, T. M. Dimitrieva,and V. I. Agol. 1989. Conservation of the secondary structureelements of the 5'-untranslated region of cardio and aphtovirusRNAs. Nucleic Acids Res. 17:5701-5711.

42. Pilipenko, E. V., A. P. Gmyl, S. V. Maslova, Y. V. Svitkin, A. N.Sinyakov, and V. I. Agol. 1992. Prokaryotic-like cis elements inthe cap-independent internal initiation of translation on picor-navirus RNA. Cell 68:119-131.

43. Rodriguez, A., E. Martinez-Salas, J. Dopazo, M. Davila, J. C.Saiz, and F. Sobrino. 1992. Primer design for specific diagnosisby PCR of highly variable RNA viruses: typing of foot-and-mouth disease virus. Virology 189:363-367.

44. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecularcloning: a laboratory manual, 2nd. ed. Cold Spring HarborLaboratory, Cold Spring Harbor, N.Y.

45. Strebel, K., E. Beck, K. Strohmaier, and H. Schaller. 1986.Characterization of foot-and-mouth disease virus gene productswith antisera against bacterially synthesized fusion products. J.Virol. 57:983-991.

VOL. 67, 1993

a single nucleotide substitution in the internal ribosome entry site

Documents