a saprotrophic fungal isolate from northern sinaloa, méxico, with homology to members of the...

8/10/2019 A Saprotrophic Fungal Isolate From Northern Sinaloa, Mxico, With Homology to Members of the Chaetomiaceae Behaves as an Antagonist of Phytopathog

1/11

vista Mexicana de Fitopatologaciedad Mexicana de Fitopatologa, [email protected]

SN (Versin impresa): 0185-3309XICO

2005

Hugo Galindo Flores / Juan Carlos Martnez lvarez / Eusebio Nava Prez /Raymundo Sal Garca Estrada / Ignacio Eduardo Maldonado Mendoza

A SAPROTROPHIC FUNGAL ISOLATE FROM NORTHERN SINALOA, MEXICO,WITH HOMOLOGY TO MEMBERS OF THE CHAETOMIACEAE BEHAVES AS AN

ANTAGONIST OF PHYTOPATHOGENIC FUNGI IN VITRORevista Mexicana de Fitopatologa,julio - diciembre, ao/vol. 23, nmero 002

Sociedad Mexicana de Fitopatologa, A.C.Ciudad Obregn, Mxico

pp. 130-139

Red de Revistas Cientficas de Amrica Latina y el Caribe, Espaa y Portugal

Universidad Autnoma del Estado de Mxico

http://redalyc.uaemex.mx


2/11

A Saprotrophic Fungal Isolate From Northern Sinaloa, Mexico,with Homology to Members of the Chaetomiaceae Behaves as an

Antagonist of Phytopathogenic Fungi in vitro

Hugo Galindo-Flores1

, Juan Carlos Martnez-lvarez1

, Eusebio Nava-Prez1

,Raymundo Sal Garca-Estrada2, and Ignacio Eduardo Maldonado-Mendoza1,3,1Centro Interdisciplinario de Investigacin para el Desarrollo Integral Regional, InstitutoPolitcnico Nacional, Unidad Sinaloa (CIIDIR-IPN-Unidad Sinaloa), Apdo. Postal 280,km 1.0 Carr. Las Glorias, Guasave, Sinaloa, Mxico CP 81101; 2CIAD-Culiacn, Apdo.Postal 32-A, km 5.5 Carr. Culiacn-El Dorado, Sucursal Palacio de Gobierno, Culiacn,Sinaloa, Mxico CP 80129; 3Current Address: Boyce Thompson Institute for PlantResearch. Tower Rd. Ithaca, NY, USA 14853. Correspondence: [email protected].

Galindo-Flores, H., Martnez-lvarez, J.C., Nava-Prez, E.,Garca-Estrada, R.S., and Maldonado-Mendoza, I.E. 2005.A saprotrophic fungal isolate from northern Sinaloa, Mexico,with homology to members of the chaetomiaceae behaves asan antagonist of phytopathogenic fungi in vitro. RevistaMexicana de Fitopatologa 23:130-139.Abstract. An ascomycete was isolated from sporepreparations of arbuscular mycorrhizal fungi from soilsamples collected in northern Sinaloa, Mexico. This fungalisolate named CIIDIR-1, is ubiquitous in soils of thisagricultural region. Only the asexual phase of CIIDIR-1 can

be cultured in vitroin different culture media. DNA extractedfrom mycelium was used to amplify and sequence a 28S rDNAhypervariable region, which allowed its identification asrelated to members of the Chaetomiaceae family(Aporothielavia leptoderma and members of the genusChaetomium). CIIDIR-1 showed a saprophytic behavior inthe presence of plant roots grown in vitro. Bioassays showedthat the isolate acts as an antagonist against phytopathogenicfungi. When mycelium from the isolate was placed in contactwith Rhizoctonia solani and Fusarium oxysporum f. sp.lycopersici, it proliferated, surrounded them and inhibitedtheir growth. The presence of CIIDIR-1 in all soil samplesevaluated suggests an important role in the rhizosphere; also,

the understanding of its interactions with plants and otherrhizospheric organisms might be important for futureecological and agricultural studies.

Additional keywords:Aporothielavia leptoderma, 28S rDNAhypervariable region, Rhizoctonia solani , Fusariumoxysporum f. sp.lycopersici, antagonism.

Resumen.Se aisl un ascomiceto en el norte del estado deSinaloa, Mxico, a partir de preparaciones de esporas de

hongos micorrzicos arbusculares. Este aislamiento fngicodesignado como CIIDIR-1, es ubicuo en suelos de estaimportante regin agrcola. CIIDIR-1 puede ser cultivado invitrosolamente en su etapa asexual en diversos medios decultivo. Se utiliz DNA extrado de micelio para amplificary secuenciar una regin hipervariable del rDNA 28S, lo cualpermiti identificarlo como un organismo relacionado a losmiembros de la familia Chaetomiaceae (Aporothielavialeptoderma y miembros del gnero Chaetomium). CIIDIR-1mostr un comportamiento saproftico en presencia de racesvegetales desarrolladas in vitro. En bioensayos se mostr que

el aislamiento acta como antagonista contra otros hongosfitopatgenos. Al poner en contacto el micelio de CIIDIR-1con Rhizoctonia solani o Fusarium oxysporum f. sp.lycopersici, ste prolifer alrededor de los fitopatgenos einhibi su crecimiento. Ya que CIIDIR-1 se encontr en todaslas muestras de suelo evaluadas, esto sugiere un papelimportante en la rizsfera; tambin, puede ser importante paraestudios futuros referentes al manejo agrcola y ecolgico,as como para el entendimiento sobre sus interacciones conplantas y otros organismos rizosfricos.

Palabras clave adicionales: Aporothielavia leptoderma ,regin hipervariable 28S rDNA, Rhizoctonia solani,

Fusarium oxysporum f. sp.lycopersici, antagonismo.

Guasave Valley in the state of Sinaloa, Mexico, is one of themost prominent agricultural regions of the country. Diversefactors such as water availability, crop management, andtechnology, and soil quality contribute to obtain high cropyields in this area. Nevertheless, several fungalphytopathogenic diseases have been described affecting theroot system of commercial crops, such as tomato(Lycopersicon esculentum Mill.) and pepper (Capsicum

(Received: November 19, 2004 Accepted: March 31, 2005)

130 /Volumen 23, Nmero 2, 2005


3/11

annuum L.), causing important economic losses due to theirdevastating effect on crop production. One of these is rootrot disease, caused by a consortium of soil microorganismsfrom which Fusarium oxysporum Schlechtend.:Fr. f. sp.lycopersici (Sacc.) Snyder and Hansen andRhizoctonia solaniKhn have been found consistently associated (Carrillo-Fasioet al., 2003; Gonzlez-Chavira et al., 2002). Besides chemicalcontrol, no biocontrol agents have been described that impactseveral of the fungal components of this consortium. Soilspossess the biological capacity to restrict disease progression.This phenomenon, termed general suppression, is conferredby the overall activity of the microbial community residentto the soil (Cook and Baker, 1983). The biotic and abioticfactors that contribute to specific soil suppressiveness havebeen elucidated for a number of plant pathogen systems (Amirand Alabouvette, 1993; Weller et al., 2002). Mycoparasiticfungi such as Trichoderma (Green et al., 1999) andGliocladium (Ortiz and Orduz, 2000) display antagonisticmechanisms against phytopathogenic fungi. Biocontrol of

phytopathogenic fungi has been carried out using saprotrophicfungi, bacteria (Whipps, 2001), or yeasts (El-Tarabily, 2004).The key is the knowledge of the ecological interactions takingplace in soil and root environment. This can then be used topr ed ic t the nece ss ary cond it io ns fo r bioc on tro l ofphytopathogenic fungi (Whipps, 2001). Information on thephysicochemical and biological components of the soils ofnorthern Sinaloa is still lacking. The microorganisms presentin the rhizosphere of these soils are basically unknown. Ourgroup has initiated the characterization and identification ofthe fungal entities present in the rhizosphere of soils ofnorthern Sinaloa; as a result of this work, we have isolated achetomiaceous fungus, with potential use as a biological

control agent against root pathogens. In this paper, we reportthe molecular identification, saprophytic behavior in thepresence of plant roots, and its antagonistic effect againstFusarium oxysporumandRhizoctonia solani.

MATERIALS AND METHODSPurification of microsclerotia from soil samples.Microsclerotia of the fungal isolate were obtained by wetsieving and decanting, a method commonly used to isolatearbuscular mycorrhizal fungi (AMF) from soil samples,involving the passage of the soil through specific-size meshesfollowed by differential centrifugation in sucrosediscontinuous gradients (Brundrett et al., 1996).

Microsclerotia were co-isolated with AMF spores due to theirsimilarities on size and shape. This fungal isolate wasdenominated CIIDIR-1, and currently it is deposited in theceparium of CIAD-Culiacn and CIIDIR-IPN, UnidadSinaloa, Mexico.Surface sterilization of microsclerotia and AMF spores.Microsclerotia were treated with chloramine-T (2% w/v) andTween-20 (0.01% w/v) following several washes with steriledistilled water. Microsclerotia were then treated overnightwith an antibiotic solution (50 mg gentamycin and 100 mg

streptomycin in 10 ml water), and washed three times withabundant sterile distilled water. At this point, a mix of sporesof AMF and microsclerotia was obtained.Quantitation and morphological identification ofmicrosclerotia in soil samples. Samples containing a mix ofAMF spores and microsclerotia were separated manuallyunder a stereoscope using a fine paint brush, and spores (andmicrosclerotia) were subdivided according to colormorphotypes. One of the subsamples was denominated BMfor black morphotype, which was conformed by a mix ofblack AM spores and microsclerotia. BM subsamples werekept for two months at 4C in 1 mL of sterile water inmicrocentrifuge tubes. The abundance of microsclerotiacompared to black AMF spores in BM subsamples wasdetermined by visual inspection under the stereoscope.Calculated microsclerotia levels were expressed asmicrosclerotia per kilogram of soil analyzed. Sample numbersand names included in Table 1 are those of a current databasecontaining information on these soil samples (Martnez-

Alvarez, 2003; launching of website in preparation).Confirmation of the identity of the microsclerotia was doneby PCR amplification and sequencing as described below.In vitrogrowth of the fungal isolateCIIDIR-1. The purifiedmix of AMF spores/microsclerotia were transferred to multi-cell dishes using minimal M medium (Bcard and Fortin,1988) as substrate, and containing 10 g L-1of sucrose and 4 gL-1of gellan gum. They were germinated into an enrichedCO

2(2%) atmospheric chamber in darkness at 20-23C. The

fungal isolate grew profusely under these conditions and afterone week, this fungus formed microsclerotia in the multi-celldishes. A piece of agar medium (0.8 cm in radius) containingmycelium and microsclerotia were used as inoculum to

propagate the fungus in Petri dishes containing M medium.Molecular identification of the fungal isolate. DNA wasextracted from mycelium and microsclerotia obtained in vitro,or from soil samples, using plant DNAzol reagent (InvitrogenCat. No. 10978-021 Carlsbad, California, USA). Ahypervariable region from the 28S rDNA region was amplifiedby PCR using the primer set LSU 0061/LSU0599 (Kjllerand Rosendahl, 2000). PCR conditions were an initial stepof 95C for 3 min, denaturing at 95C for 30 sec, annealing at55C for 30 sec, and elongation at 72C for 30 sec, and atotal of 30 cycles. Final elongation was 72C for 5 min. Theamplification product was then cloned into the pGEM-T easyvector (Promega, Cat. No. 157348, Madison, WI, USA), and

sequenced from both strands using an ABI Prism 310sequencer. Sequences were compared using the BLAST-Nprogram (NCBI) with the GenBank database.Growth of the fungal isolate CIIDIR-1 on sterile tomatoplantlets and hairy root cultures.Tomato seeds were surfacesterilized and grown in Whatman 1 wet paper placed insidePetri plates under sterile conditions for ten days. Then, theywere transferred to Petri dishes containing M medium pH5.5. Plugs of M medium (0.8 cm in diameter) containingmycelium and microsclerotia of isolate CIIDIR-1 (3 weeks

Revista Mexicana de FITOPATOLOGIA/ 131


4/11

old) were placed surrounding the root system. Two-week oldhairy root cultures of carrot [Daucus carotasubsp.sativus(Hoffm.) Arcang.] and tomato growing on M solid mediumin Petri plates, were inoculated with plugs containingmycelium and microsclerotia of isolateCIIDIR-1 (two-weeksold), as described above. Fungal growth was monitored atone week post-inoculation for the tomato experiment, and atone and four weeks post-inoculation for the hairy rootexperiment.Fungal strains. Endemic strains ofRhizoctonia solani and

Fusarium oxysporum f. sp.lycopersici(Carrillo-Fasio et al.,2003) were provided by the ceparium of CIAD-Culiacn.These are two aggressive strains of phytopathogenic fungiand were used in antagonism experiments.Staining of CIIDIR-1 isolate. Young root tissues werecleared using 20% KOH, washed 4 times for 5 min at roomtemperature with abundant distilled water. Tissues were rinsedonce again at room temperature for 5 min using 1X PBS buffer(8 g of NaCl, 0.2 g of KCl, 1.44 g of Na

2HPO

4, and 0.24 g of

KH2PO

4) at pH 7.4. Staining of the fungus was performed

using 10 L of 0.1 g L -1wheat germ agglutinin conjugate(WGA-488; Molecular Probes, Cat. No. W11261; Eugene,

OR, USA) in 100 ml PBS pH 7.4. This is an antibody thatspecifically stains sialic acid residues from the fungal walls.Tissues were incubated overnight at 4C and the staining wasvisualized using fluorescence microscopy.Mycelium extract preparation. CIIDIR-1 was grown forone week on a 500 ml Erlenmeyer flask containing 100 mLof M liquid medium at 28C on an orbitary shaker (250 rpm).Mycelium was collected, frozen, and pulverized on a mortarin fresh M medium. Final concentration of mycelium was1% w/v. The extract was filter-sterilized by passing the

homogenate through a 0.2 M Millipore filtration unit.Antagonism bioassays. Two types of experiments were setup: 1) Co-inoculation of plates with phytopathogenic andantagonistic fungi. This first type of experiment involved twosubexperiments: A) one 8 mm agar disc containing thephytopathogen inoculum was placed in the center of the plate,while two 8 mm paper discs containing either 100 L of water,fungal extract (1% w/v), fungicide (3 g L -1), or 8 mm agardiscs containing CIIDIR-1. They were set up on opposite sidesof the plates at 0.5 cm from the edges. The commercialfungicide TIMSEN (United Promotions Inc. Atlanta, GA,USA, active ingredient n-alkyl dimethyl benzyl ammoniumchloride 3% w/w) was utilized as a control in antagonisticexperiments. Based on dose-response experiments ofTIMSEN onR.solaniandF.oxysporum(data not shown), aconcentration of 3 g L-1of the powder was used in subsequentexperiments. B) Another set of plates were done inoculatingthe phytopathogen on opposite sides of the plates from 0.5cm to the edges, and one disc containing the differenttreatments (water, fungal extract, fungicide, and CIIDIR-1)in the center of the plate (Fig. 1). Growth of thephytopathogens in the first set of plates was calculated by

measuring the diameter of their mycelium, and in the secondset of plates by measuring the length of the mycelial growthfrom the middle of the disc towards the center of the plate.Each of these experiments was performed twice with eachphytopathogen using three replicate plates obtaining similarresults in each experiment. Both experiments were done usingPDA plates and incubated at 23C. 2) Inoculation ofphytopathogens on a CIIDIR-1 mycelium net. To gain insighton the mechanisms of growth inhibition of the pathogens andto analyze the response of CIIDIR-1 to physical contact with

10. Callejones de Tamazula (surface) 756991 2816742 420 2814. Cruz Blanca (surface) 763689 2841517 468 4916. El Amole (surface) 757582 2810885 2852 3117. El Coyote (1 m) 733922 2853389 353 4721. El Varal (surface) 759045 2838085 1196 5223. Estacin Naranjo (surface) 753515 2856375 1020 6032. Las Lichis (1 m) 760119 2839808 714 3440. Portugus de Glvez (1 m) 761384 2848348 848 5341. Pozo Mezquitn (1 m) 742814 2828511 125 2546. Santa Fe (surface) 737331 2836391 595 35

Sample number and namew UTM UTM Coordinates Coordinates Microesc./ Morph. (West)x (North) kg soily (%)z

Table 1. Number of microsclerotia of CIIDIR-1 fungal isolate on soils from Guasave,Sinaloa, Mexico.

wSurface (0-30 cm) and 1 m (90 to 120 cm) indicates the depth at which the samples weretaken from the soil.xThe positioning of the sampling points is given on UTM coordinates.yMicrosclerotia per kilogram of soil.

zPercentage of microsclerotia from the total mix of AMF spores and microsclerotia fromthe black morphotype.



5/11


6/11

throughout this study (different common nutrient media suchas M, PDA, MS (Murashige and Skoog, 1962), and V8 weretested, in addition to different pH and cold and heat treatments[data not shown]). No differences in length or sequence wereobserved between the PCR products obtained from fungalmaterial isolated from soil or in vitro. This confirmed thatthe microsclerotia obtained from soil samples and germinatedmicrosclerotia in water, are from the same fungus as the one

isolatedin vitro.CIIDIR-1 forms microsclerotia when cultured in vitro.CIIDIR-1 microsclerotia survived the surface sterilizationprotocol used to sterilize AMF spores and grew on minimalM medium. The fungus grew profusely in rich nutrient mediasuch as PDA (Fig. 2D) or MS, and less in minimal M medium(Fig. 2C). Microsclerotia remained clear while developing(Fig. 2A) and acquired a dark coloration when they reached

1 agcatatcaataagcggaggaaaagaaaccaacagggattgccctagtaacggcgagtga 60||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

5 agcatatcaataagcggaggaaaagaaaccaacagggattgccctagtaacggcgagtga 64

61 agcggcaacagctcaaatttgaaatctggcctcggcccgagttgtaatttgTagaggaag 120 ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||65 agcggcaacagctcaaatttgaaatctggcctcggcccgagttgtaatttgcagaggaag 124

121 ctttaggcgcggcaccTTctgagtcTccctggaacggggcgccatagagggtgagagccc 180 |||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||125 ctttaggcgcggcaccaactgagtc-ccctggaacggggcgccatagagggtgagagccc 183

181 cgtatagtCggaTgcctagcctgtgtaaagctccttcgacgagtcgagtagtttgggaat 240 |||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||184 cgtatagttggacgcctagcctgtgtaaagctccttcgacgagtcgagtagtttgggaat 243

241 gctgctcaaaatgggaggtaaatttcttctaaagctaaataccggccagagaccgatagc 300 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||244 gctgctcaaaatgggaggtaaatttcttctaaagctaaataccggccagagaccgatagc 303

301 gcacaagtagagtgatcgaaagatgaaaagcGctttgGaaagagggttaaatagcacgtg 360 ||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||304 gcacaagtagagtgatcgaaagatgaaaagcactttgaaaagagggttaaatagcacgtg 363

361 aaattgttgaaagggaagcgcttgtgaccagacttgcgccgggcTgatcatccggtgttc 420 |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||364 aaattgttgaaagggaagcgcttgtgaccagacttgcgccgggcggatcatccggtgttc 423

421 tcaccggtgcactcTgcccggctcaggccagcatcggttctcgcggggggaCaaaggCcc 480 |||||||||||||| |||||||||||||||||||||||||||||||||||| ||||| ||424 tcaccggtgcactccgcccggctcaggccagcatcggttctcgcggggggataaaggtcc 483

481 TgggaacgtagctcctccgggagtgttatagcccAgggcgCaatgccctcgcggggaccg 540 ||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||484 cgggaacgtagctcctccgggagtgttatagcccggggcgtaatgccctcgcggggaccg 543

541 aggttcgcgc-tctgcaaggatgctggcgtaatggtcatcagcgacccgtcttgaaacac599 |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||544 aggttcgcgcatctgcaaggatgctggcgtaatggtcatcagcgacccgtcttgaaacac603

600 ggacca605||||||

604 ggacca609

Fig. 3. Sequence comparison of the fungal isolate CIIDIR-1 andAporothielavia leptoderma.The top sequence corresponds to CIIDIR-1 fungal isolate and the bottom sequence from A.leptoderma. Primers used at the 5 and 3 ends of the fragment are shown in bold. Mismatchesbetween CIIDIR-1 and theA.leptodermasequence are shown in upper cases and bold on theCIIDIR-1 sequence. Sequence alignment was performed using the Blast 2 sequences program

from NCBI (Tatusova and Madden, 1999).



7/11


8/11

experiment. Similar results were observed for the slowergrowing F.oxysporum f. sp. lycopersici after 8 days co-cultivation (Figs. 5A and B). The percentage of inhibitioncompared to the negative control was 59.78 and 50% forexperiments A and B, respectively, at the end of theexperiments. These results obtained at day 4 and day 8 ofgrowth for R.solaniiand F.oxysporum f. sp. lycopersici,respectively, are statistically different (ANOVA) with a degreeof significance of 0.05 to the negative and positive controltreatments (data not shown). The addition of CIIDIR-1

aqueous extract had no inhibitory effect on any of theexperiments made. In fact, in one of the experiments (Type1A,R.solani), a slight enhancement on growth at two andthree days post inoculation was observed compared to theintact fungus (Fig. 5C).Mycelium of the fungal isolate CIIDIR-1 responds tophysical contact with phytopathogenic fungi. The responseof CIIDIR-1 mycelium net to the presence of thephytopathogenic fungi was the production of halos of profusemycelium growth surrounding both R. solani and F.

oxysporumf. sp. lycopersici(Fig. 6A-D) and the restrictionof growth of these phytopathogens. Plugs of M medium ormycelium from the plant symbiotic fungus G.intraradiceswere used as negative controls and no effect on CIIDIR-1mycelium net overgrowth was observed 4 days postinoculation (Figs. 6E and F), or even two weeks after theiraddition (data not shown). Quantitative results showed agrowth inhibition effect at day 4 for F.oxysporum f. sp.lycopersici andR.solani. The percentage of growth inhibitioncompared to the water control was of 50-60% and 40-50%

forF. oxysporumf. sp. lycopersici andR.solani, respectively.These data support our hypothesis that CIIDIR-1 has anantagonistic effect on the phytopathogenic fungi growth.

DISCUSSIONCIIDIR-1 fungal isolate might belong to the genusAporothielaviaor Chaetomium. Molecular analysis of a 28SrDNA hypervariable region suggests that the fungus isolatedin this work from soils of Guasave, Sinaloa in Mexico, maybe long to the spec ie s Aporothi elav ia lept oderma .


4

3.5

3

2.5

1.5

2

1

0.5

00 2 4 6 8

days post inoculation

Myceli

umlength(cm)

A

C


Myceliumlength(cm)

4

3.5

3

2.5

2

1.5

1

0.5

00 1 2 3 4

B


Myceli

umlength(cm)

0 2 4 6 8

7

6

5

4

3

2

1

0

9

8

7

6

54

3

2

1

00 1 2 3 4


Myceliumlength(cm)

Fig. 5. Effect of CIIDIR-1 isolate on mycelium growth of Fusarium oxysporumf. sp. lycopersiciandRhizoctonia solani. A)Type 1A experiment withF. oxysporum; B) Type 1B experiment withF. oxysporum; C) Type 1A experiment withR.solani, D)Type 1B experiment withR.solani. Open circles refer to water control samples; open diamonds to fungicide (TIMSEN); closedsquares to intact CIIDIR-1 fungal isolate; and closed triangles to aqueous extracts of CIIDIR-1 mycelium.


9/11


10/11

propagation and dispersal mechanism for this fungal species.Microsclerotia of CIIDIR-1 were semi-purified from the totalAMF spore preparations as forming part of the black sporemorphotype, which constitutes the most abundant AMFmorphotype in this region. Detailed studies of AMFcomposition from these soils has shown that only two out of75 different soil samples from this region do not contain sporesof this morphotype (Martnez-Alvarez, 2003), which suggestsits possible ubiquitous presence throughout the Guasavevalley. CIIDIR-1 might be an important component of therhizosphere and its microbial interactions, and it maycontribute to the soil suppressiveness of disease in these soils.CIIDIR-1 behaves in vitroas a saprophyte in the presenceof roots. Observations made in vitrowith hairy roots (Fig.4A) and non-transformed roots of carrot and tomato (datanot shown), showed that CIIDIR-1 grows abundantly overthe roots without any sign of root penetration (Fig. 4D) whenthey are young and alive. When the plant tissue aged, profusemycelium growth and formation of microsclerotia was

observed on the decaying roots (Figs. 4B and C). CIIDIR-1most probably behaves saprotrophically in vivo. This wouldexplain its widespread distribution throughout the valley. C.

globosum, one of the fungi with close homology to the 28SrDNA region of CIIDIR-1, has been described as asaprotrophic growing fungus. C.globosum, when grown onaeroponics, does not invade the root tissue and interacts onlywith the epidermis and never invades the exodermis. In MSagar (Murashige and Skoog, 1962), C.globosumis able togrow not only in the epidermis, but also in the exodermis andcortical cells. The main difference between root tissuesgrowing under these two conditions is the formation of anexodermis with Casparian bands and complete suberin

lamellae under aeroponics conditions. This suggests aninhibitory role of the exodermis for the establishment of aplant-pathogen association (Reissinger et al., 2003). It is stillnot known if there is a similar mechanism for root protectionagainst invasion by CIIDIR-1, and will need to be addressedin the future.CIIDIR-1 behaves as an antagonist of root rot fungi.CIIDIR-1 fungal isolate showed an antagonistic effect onF.oxysporumf. sp. lycopersiciandR.solaniin in vitrobioassays.The immediate response of CIIDIR-1 mycelium to thepresence of the phytopathogens was exacerbated growthsurrounding and limiting growth of the pathogenic fungi (Fig.6). Competition for carbon, nitrogen, and iron has been shown

to be a mechanism associated with biocontrol or suppressionofFusarium wilt in several systems by non-pathogenic

Fusarium and Trichoderma species (Couteaudier, 1992;Mandeel and Baker, 1991; Sivan and Chet, 1989) andcompetition for thiamine factors into the control ofGaeummanomyces graminis(Sacc.) Arx and D. Olivier var.tritici J. Walker by a sterile red fungus in the rhizosphere ofwheat (Triticum aestivumL.) (Shankar et al., 1994). It ispossible that CIIDIR-1 might use a similar antagonisticmechanism. Chaetomium globosum shows antagonism to

other fungi involved in root diseases, including Fusariumculmorum (W.G. Sm.) Sacc. (Knudsen et al., 1995) and

Pythium ult imum Trow (Di Pietro et al., 1992). Themechanism that this Chaetomiumspecies uses, involves theproduction of antibiotic substances (Di Pietro et al., 1992;Hubbard et al., 1982). This does not seem to be the mechanismthat CIIDIR-1 isolate uses, since aqueous extracts of themycelium did not seem to inhibit growth of thephytopathogens (Fig. 5). Nevertheless, the antagonisticmechanism used by this fungus remains to be elucidated.Further experiments in vitro, in pots, and in the field arecurrently underway to discover if the effect observed in vitrohas any relevance in vivo. CIIDIR-1 has the potential to beused as a biocontrol agent to prevent root rot disease. This isespecially relevant for horticultural crops that involvegermination in the greenhouse and further transfer of plantletsto soil, since the fungus could be established on the rootsystem in the greenhouse. This would create a mycelial netthat would help prevent the infection of roots with

phytopathogens.Acknowledgements. The authors thank Dr. Melina Lopez-Meyer and Megan Ackerman for the critical review of thismanuscript; and the support received by IPN (CGPI2002-0546), CECyT-Sinaloa (2002, and 2003) and UNESCO(MEX200606).

LITERATURE CITEDAmir, H., and Alabouvette, C. 1993. Involvement of soil

abiotic factors in the mechanisms of soil suppressivenesstoFusariumwilts. Soil Biology and Biochemistry 25:157-164.

Andrews, J., Berbee, F., and Nordheim, E.F. 1983. Microbialantagonism to the imperfect stage of the apple scabpathogen,Venturia inaequalis. Phytopathology 73:228-234.

Bcard, G., and Fortin, J.A. 1988. Early events of vesicular-arbuscular mycorrhiza formation on Ri T-DNAtransformed roots. New Phytologist 108:211-218.

Brundrett, M., Bougher, N., Dell, B., Tim, G., and Nick, M.1996. Working with mycorrhizas in forestry andagriculture. Australian Centre for International AgriculturalResearch. Canberra, Australia. 374 p.

Carrillo-Fasio, J., Montoya-Rodrguez, T., Garca-Estrada,R., Cruz-Ortega, J., Mrquez-Zequera, I., and Saudo-

Barajas, A. 2003. Races of Fusarium oxysporum f. sp.lycopersici Snyder and Hansen, in tomato (Lycopersiconesculentum Mill.) in the valley of Culiacan, Sinaloa,Mexico. Revista Mexicana de Fitopatologa 21:123-127.

Cook, R., and Baker, K. 1983. The Nature and Practice ofBiological Control of Plant Pathogens. AmericanPhytopathology Society, St. Paul, Minnesota, USA. 539p.

Couteaudier, Y. 1992. Competition for carbon in soil andrhizosphere, a mechanism involved in biological control



11/11

a saprotrophic fungal isolate from northern sinaloa, méxico, with homology to members of the...

Documents