AO

Ga

Pb

S

a

ARRAA

KRMRSI

1

cisadirtHmcs

tma

h0

Plant Science 227 (2014) 69–75

Contents lists available at ScienceDirect

Plant Science

j ourna l ho me pa ge: www.elsev ier .com/ locate /p lantsc i

redox-sensitive cysteine residue regulates the kinase activities ofsMPK3 and OsMPK6 in vitro

uosheng Xiea,∗, Kentaro Sasakib, Ryozo Imaib, Deying Xiea

National Key Laboratory of Crop Genetic Improvement, College of Plant Science and Technology, Huazhong Agricultural University, Wuhan 430070,R ChinaCrop Breeding Division, Hokkaido Agricultural Research Center, National Agricultural and Food Research Organization, Hitsujigaoka 1, Toyohira-ku,apporo 062-8555, Japan

r t i c l e i n f o

rticle history:eceived 6 March 2014eceived in revised form 1 July 2014ccepted 3 July 2014vailable online 11 July 2014

a b s t r a c t

Two subgroup A rice mitogen-activated protein kinases (MAPKs), OsMPK3 and OsMPK6, have been impli-cated in multiple stress responses. However, the redox-control of the kinase activity of these proteinsremains unknown. Here, immunoprecipitated OsMPK3 and OsMPK6 were initially activated in 15 min,and this activation transiently increased in rice seedlings under H2O2 stress. Among the six conservedcysteine residues, only the fourth cysteine residues in the kinase domain VII, Cys179 and Cys210, were

eywords:iceAPK

edox-controlite-directed mutagenesisn vitro kinase activity

required for the in vitro kinase activities of OsMPK3 and OsMPK6, respectively. Moreover, the substitu-tion of these specific cysteine residues with serine abrogated in vitro kinase responses to redox conditions.These results suggest a novel redox-control mechanism for the kinase activities of these MAPKs in vivo.

© 2014 Elsevier Ireland Ltd. All rights reserved.

. Introduction

As sessile organisms in an aerobic environment, plants areonstantly exposed to a variety of biotic (pathogen infection andnsect herbivory) and abiotic (chilling or heat, drought, and salinity)tresses [1,2]. Reactive oxygen species (ROS), such as superoxidenions and hydrogen peroxide (H2O2), are subsequently generatedue to the imbalance between ROS production and scaveng-

ng under these stresses. At higher concentrations, these highlyeactive substances induce significant oxidative stress and are dele-erious to biomolecules and metabolic processes in plant cells.owever, the rapid and transient increase of ROS in plant cellsight act as signals that mediate both the regulation of various

ellular activities and the adaptation of plants to abiotic and biotictresses [3,4].

Abbreviations: GSH, reduced glutathione; MAPKKK, mitogen-activated pro-ein kinase kinase kinase; MAPKK, mitogen-activated protein kinase kinase; MAPK,

itogen-activated protein kinase; ROS, reactive oxygen species; SOH, sulfeniccid; Cys, cysteine; SO2H, sulfinic acid; SO3H, sulfonic acid.∗ Corresponding author. Tel.: +86 27 87281765; fax: +86 27 87280016.

E-mail address: xiegsh@mail.hzau.edu.cn (G. Xie).

ttp://dx.doi.org/10.1016/j.plantsci.2014.07.002168-9452/© 2014 Elsevier Ireland Ltd. All rights reserved.

As a key reactive oxygen species, H2O2 has recently beencharacterized as a key signaling molecule in plants [5]. H2O2signaling is central to the control of stomatal closure, root growth,and programmed cell death, including hypersensitive responsesand the regulation of gene expression [6,7]. In plants, the inductionof the MAP (mitogen-activated protein) kinase cascade is an earlyand important signaling event that occurs in response to H2O2, andthis cascade includes three-tiered phosphorylating components,such as MAPKKK (mitogen-activated protein kinase kinase kinase),MAPKK (mitogen-activated protein kinase kinase) and MAPK(mitogen-activated protein kinase) components. In higher plants,four subgroups of MAPKs (subgroups A, B, C and D) have beenidentified according to the phosphorylation motifs present withinthe kinase domains of these MAPKs [8]. Moreover, the subgroup AMAPKs, MAPK3 and MAPK6, possess highly conserved character-istics in multiple oxidative stress responses in many plant species[9,10]. For example, H2O2 activates two subgroup A MAPKs in Ara-bidopsis, AtMPK6 and AtMPK3 [11–13]. H2O2 also activates SIPK(an ortholog of AtMPK6) in tobacco [14] and a 46-kDa homolog ofAtMPK6 in maize [15]. In the monocot model plant rice, relatively

little is known about the precise mechanisms for the regulation ofupstream H2O2 signal production and MAPK modules, particularlythe biochemical mechanisms underlying the activation of OsMPK3and OsMPK6 in the response to oxidative stress [16].

7 cience

rgbompagtpbbnf(ttt(brumri

sOrtfat

2

2

igtdqdvs1t−

2p

iN(adCp

0 G. Xie et al. / Plant S

In general, the oxidative modification of reactive cysteineesidues within the catalytic domains of proteins has been sug-ested as a widespread posttranslational modification mechanismy which H2O2 signaling might affect the activity and functionf proteins, such as kinases, phosphatases, transcription factors,etabolic enzymes and structural proteins [17]. Many cellular

roteins are directly regulated based on the cellular redox state,nd the thiol group of cysteine (Cys) residues is a major tar-et for oxidation-induced chemical modification. Depending onhe micro-environment surrounding the cysteine residues in aarticular tertiary structure of a protein, selected cysteines cane preferentially deprotonated to form thiolate ions that cane readily oxidized to form sulfenic acid ( SOH) or undergo S-itrosylation. Sulfenic acid is generally unstable and can either be

urther oxidized to form sulfinic acid ( SO2H) and sulfonic acid SO3H) or converted to a disulfide with thiols from other pro-eins (i.e., intramolecular or intermolecular disulfides) or smallhiol-containing molecules, e.g., glutathione (GSH) [18–20]. In addi-ion, sulfenic acid could also be converted to cyclic sulfenamideCys-S-NH-R) through the nucleophilic attack of sulfur by a neigh-oring backbone amide nitrogen. These redox-sensitive cysteineesidues cause the conformational changes associated with the reg-lation of proteins in plant cells [21], and these posttranslationalodifications provide widespread regulation for proteins with

edox-sensitive cysteine residues in vitro and in planta, implicatedn signal transductions under development and stress conditions.

In the present study, we revealed the responsiveness of twoubgroup A multiple stress-associated MAPKs in rice, OsMPK3 andsMPK6, upon exposure to exogenous peroxide (H2O2), and the

edox-sensitive cysteine residues required for the activation ofhese proteins were identified through site-directed mutagenesis,ollowed by an in vitro kinase activity assay. These data will provide

new regulation strategy for the redox-control of the kinase activi-ies of OsMPK3 and OsMPK6 under oxidative stress in higher plants.

. Materials and methods

.1. Plant materials, growth conditions and stress treatments

Seeds of rice variety Yukihikari (Oryza sativa L. subsp. japon-ca) were surface-sterilized in 70% ethanol for 2 min, followed byentle shaking in the 2.5% NaClO for 30 min, and washing severalimes with sterilized water. The sterilized seeds were soaked inistilled water for 4 days and germinated in an incubator. Subse-uently, the seedlings were grown hydroponically at 25 ◦C for 7ays under continuous illumination in a growth chamber as pre-iously described [22,23]. The rice seedlings were subsequentlyubjected to 10 mmol/L H2O2, or H2O as a control for 0, 15, 30, 60,80, and 360 min. The root tissues were collected at the designatedime points, immediately frozen in liquid nitrogen, and stored at80 ◦C until further use.

.2. Multiple sequence analysis of plant MAPK3 and MPK6roteins

Eight subgroup A MAPKs from four popular model plant species,ncluding AtMPK3 (Q39023) and AtMPK6 (Q39026) in Arabidopsis,tWIPK (BAB79636) and NtSIPK (AAB58396) in tobacco, OsMPK3

Q10N20) and OsMPK6 (Q84UI5) in rice, and BdMPK3 (AFS18260)

nd BdMPK6 (AFS18261) in Brachypodium distachyon, wereownloaded from NCBI (http://www.ncbi.nlm.nih.gov/protein/).TALX1.81 and GeneDoc 2.6.02 programs were used for the multi-le sequence alignment analysis.

227 (2014) 69–75

2.3. MBP kinase assay of immunoprecipitated OsMPK3 andOsMPK6 in rice seedlings

Total soluble proteins (400 �g) were extracted from the roottissues of rice seedlings after 10 mmol/L H2O2 stress treatment orH2O as a control and incubated with 50 �l of anti-OsMPK3 or anti-OsMPK6 antibodies (provided from Dr. Shigemi Seo and Dr. YukoOhashi of the National Institute of Agrobiological Sciences, Tsukuba,Japan). Immunoprecipitated OsMPK3 (uniprotkb:Q10N20) andOsMPK6 (uniprotkb:Q84UI5) proteins were used to determined thein vitro MBP kinase activity as previously described [24]. In thepresent study, at least three independent assays were similarly per-formed for the immunoprecipitation of OsMPK3 and OsMPK6, andrepresentative results are shown in the corresponding figures.

2.4. Gene cloning, in vitro site-mutagenesis and DNA sequencing

The pGEX-6P-3 vector system was used to express GST-fusion proteins. The GeneEditorTM in vitro site-directedmutagenesis system (Promega Corporation, Madison, USA)was used to generate six different point mutations usingthe following primers, substituting cysteine residues withserine residues in both OsMPK3 and OsMPK6, according tothe manufacturer’s instructions, and the following primerswere used in the mutagenesis reactions: GST-OsMPK3 (for-ward primer: GGATCCGGGATGGACG, BamHI restriction siteunderlined; reverse primer: GTCGACTCAATCTAGTACCGGATGTTTGG, SalI restriction site underlined), GST-OsMPK3-C51S(GGGATCGTCTCCTCCGTGATGA, mutated site underlined), GST-OsMPK3-C139S (CAGAAGAGCACTCCCAGTATTTCCTG, mutated siteunderlined), GST-OsMPK3-C174S (GAACGCCAACTCCGACCTCAAG,mutated site underlined), GST-OsMPK3-C179S(CTCAAGATCTCCGACTTCGGGC, mutated site underlined), GST-OsMPK3-C225S (GTCCGTCGGCTCCATCTTCATG, mutated siteunderlined) and GST-OsMPK3-C334S (TGAGCCCATCTCCCTGGAGC, mutated site underlined), and GST-OsMPK6 (forward primer:GGATCCATGG ACGCCGG, BamHI restriction site underlined;reverse primer, GTCGACCTGGTAATCAGGGTTG, SalI restrictionsite underlined), GST-OsMPK6-C82S (GGCATCGTCTCCTCGGCGCT,mutated site underlined), GST-OsMPK6-C170S (CAGAGGAG-CACTCCCAGTATTTCC, mutated site underlined), GST-OsMPK6-C205S (GAATGCAAATAGTGACCTCAAAA, mutated site underlined),GST-OsMPK6-C210S (TGACCTCAAAATTTCTGATTTTGGACTT,mutated site underlined), GST-OsMPK6-C256S (TGGTCTGTGGG-CTCTATTTT T ATGGA, mutated site underlined) and GST-OsMPK6-C364S (GATGAGCC AGTCTCCTCATCACCCT, mutatedsite underlined). DNA sequencing was performed using the BigDyeTerminator v3.1 Cycle Sequencing kit (Applied Biosystems, CA,USA) and an ABI PRISM 3130 Genetic Analyzer (Applied Biosys-tems, CA, USA). The DNA sequences were analyzed using GENETYXsoftware (Software Development, Tokyo, Japan).

2.5. Recombinant purified recombinant protein preparations

A total of 14 GST-fusion proteins, including wild-type GST-OsMPK3 and GST-OsMPK6, and 6 point mutations for eachrespective kinase with 12 mutants in total, e.g., GST-OsMPK3 (wt)and its associated mutant variants C51S, C139S, C174S, C179S,C225S and C334S, and GST-OsMPK6 (wt) and its associated mutantvariants C82S, C170S, C205S, C210S, C256S and C364S, wereinduced in Escherichia coli BL21 (DE3) cells, followed by sonicationand affinity purification using Glutathione-Sepharose 4B according

to the manufacturer’s instructions (GE Healthcare, Wisconsin, USA).Briefly, E. coli BL21 (DE3) containing pGEX-6P-OsMPK3, pGEX-6P-OsMPK6 and the respective point mutants were cultured overnightat 37 ◦C in LB broth containing 50 �g/ml ampicillin. Subsequently,

cience

1i3aiwtwwaUbcm(

2

bGpkM[3aAqMgo1

2

secIsbamw

FHkfi

G. Xie et al. / Plant S

ml culture was added into 50 ml of the fresh LB broth contain-ng 50 �g/ml ampicillin and cultured at 37 ◦C for approximately

h until the OD600 reached 0.6. IPTG was subsequently added to final concentration of 0.5 mmol/L, and the cultures were furthernduced at 37 ◦C for 3 h or occasionally at 30 ◦C for 5 h. The bacteria

ere collected after centrifugation at 8000 × g for 5 min, washedwice with 1× TBS, and resuspended in 5 ml of 1× TBS. The cellsere sonicated for 4 min at intervals of 15 s. The sonicated solutionsere centrifuged, and the total soluble fraction (supernatant) was

ffinity purified using Glutathione-Sepharose 4B (GE Healthcare,SA). The eluted affinity purified proteins was further subjected touffer exchange with 50 mM Tris (pH 7.5) using a Microcon Ultra-el YM-10 (Millipore, USA). The purified recombinant wild type andutant proteins were measured using the Bio-Rad Protein Assay kit

Bio-Rad, CA, USA) with BSA as a standard.

.6. In vitro kinase assays

In vitro kinase assays were performed using purified recom-inant proteins as previously described [25]. Briefly, 1 �g ofST-OsMPK3, GST-OsMPK6, or the six recombinant point mutantroteins for each respective kinase, were incubated in 20 �l ofinase reaction buffer (50 mM Tris pH 7.5, 10 mM MgCl2, 10 mMnCl2, 1 mM EGTA, and 1 mM DTT) containing 5 �g MBP and 1 �Ci

�-32P]-ATP with or without the addition of 4 mM reduced GSH for0 min at 30 ◦C. The reaction was terminated after the addition ofn equal volume (20 �l) of 2× SDS-PAGE sample loading buffer.pproximately 5 �l of the kinase reaction solutions were subse-uently separated on a 15% SDS-PAGE gel, and the phosphorylatedBP was visualized to examine the kinase activity via autoradio-

raphy. CBB staining was used to assess equal loading with 1.0 �gf each purified GST-tagged protein following electrophoresis on a5% gel.

.7. Quantification of the phosphorylation and protein levels

After the SDS-PAGE, the relative autoradiograph signal inten-ities of each corresponding protein from the three independentxperiments in the in vitro kinase assay as described above, werealculated as the in vitro kinase activities for these proteins usingmage J software (http://rsbweb.nih.gov/ij/download.html). Sub-equently, t-tests were conducted to compare the significance

etween wild type and mutant purified recombinant OsMPK3nd OsMPK6 proteins and the differences between wild type andutant purified recombinant OsMPK6 proteins in kinase assaysith or without 4 mM GSH.

ig. 1. H2O2 regulates the activities of MPK3 and MPK6 in rice roots. (a) Total soluble pro2O2 stress or H2O as a control for the indicated time points and subsequently immunopinase activities of immunoprecipitated OsMPK3 and OsMPK6 were detected in the prollowed by 15% SDS-PAGE and autoradiography. Each experiment was repeated at least tmmunoprecipitated OsMPK3 and OsMPK6 under peroxidative stress compared with H2O

227 (2014) 69–75 71

3. Results and discussion

3.1. The in vivo kinase activity of OsMPK3 and OsMPK6 inresponse to peroxide stress in rice seedlings

The plant mitogen-activated protein kinase (MAPK) cascadeplays an important role in mediating biotic and abiotic stressresponses and is a major pathway through which extracellu-lar stimuli are transduced into intracellular signals. Interestingly,ozone transiently triggered the activation of AtMPK3 and AtMPK6within 30 and 120 min [26]. The constitutive activation of AtMPK6also confers ozone hypersensitivity in Arabidopsis [10]. In tobacco,the over-expression of constitutively active variant of the upstreamMAPKK, NtMEK2DD, triggers chloroplastic H2O2 production andprolongs the activation of orthologs of the downstream targetMAPK, NtSIPK and NtWIPK, leading to hypersensitive response-likecell death [27].

To determine whether the kinase activities of the MPK3 andMPK6 orthologs, OsMPK3 and OsMPK6, are similarly regulatedthrough H2O2 stress in rice, we performed immune-complex kinaseassays and detected the MBP kinase activities of immunopre-cipitated OsMPK3 and OsMPK6 proteins using anti-OsMPK3 andanti-OsMPK6 antibodies, respectively, in the roots of 7-day-old riceseedlings exposed to 10 mM H2O2 or H2O as control for differenttimes (0, 15, 30, 60, 180 and 360 min). As shown in Fig. 1, theMBP kinase activities of both immunoprecipitated OsMPK3 andOsMPK6 proteins in the roots of rice seedlings were initially andrapidly induced within 15 min under H2O2 stress, but with differentpatterns. OsMPK3 was activated within 30 min under H2O2 stresstreatment, and this activity decreased a lower level after 60 minuntil 6 h of H2O2 stress. However, OsMPK6 was initially activatedwithin 15 min of H2O2 stress treatment and slightly decreasedwithin 30 min of H2O2 stress with subsequent re-activation from60 min until the 3 h followed by a lower level compared with thecontrol treatment, indicating the transient and rapid inductionof in vivo kinase activities for both OsMPK3 and OsMPK6 underoxidative stress and the multiple regulation of these two MAPKs,including expression and phosphorylase levels, rhythm controland responsiveness to reducing agents (GSH, thioredoxin). Manylines of evidence have suggested that OsMPK3, OsMPK6, and theirrespective homologs in plant species, are co-activated through mul-tiple stress stimuli, and these proteins also share overlapping, but

differential, functions downstream of different MAPKKs in plantdevelopment and stress responses [26,28,29]. This phenomenon isubiquitous in the regulation of both subgroup A MAPK members,MPK3 and MPK6, in the response to multiple stresses in plants.

teins were extracted from the roots of 7-day-old rice seedlings exposed to 10 mMrecipitated using anti-OsMPK3 or anti-OsMPK6 antibodies, respectively. The MBPesence of 5 �g MBP and 4 �Ci [�-32P]-ATP in the kinase reaction buffer (10 �l),hree times, and representative results are shown. (b) The relative kinase activity of

control were calculated by Image J software as described above.

7 cience

3sO

p

FNBit

2 G. Xie et al. / Plant S

.2. Substitution of the fourth cysteines, Cys179 and Cys210, witherine residues specifically inhibits the in vitro kinase activities of

sMPK3 and OsMPK6

Phylogenetic analyses revealed that all MAPK family proteinsossess 11 kinase subdomains in eukaryotes. Three-dimensional

ig. 2. Multiple alignment analysis of eight plant subgroup A MAPK proteins from four ptWIPK (BAB79636) and NtSIPK (AAB58396) from tobacco, OsMPK3 (Q10N20) and OsMrachypodium distachyon were aligned, and gaps (dashes) have been introduced to maxim

ndicate the 11 conserved subdomains in Ser/Thr protein kinases. The # symbol overlyinghese MAPKs.

227 (2014) 69–75

structural models resolved the standard two-lobed structure ofMAPK proteins separated by a catalytic cleft, which contains con-

served amino acid residues in the different sets of � helices and� sheets [30]. The Sty1 MAPK in the fission yeast Schizosaccharo-myces pombe has been recently shown to contain two cysteineresidues, Cys153 and Cys158, which are important for hydrogen

opular plant species. AtMPK3 (Q39023) and AtMPK6 (Q39026) from Arabidopsis,PK6 (Q84UI5) from rice, and BdMPK3 (AFS18260) and BdMPK6 (AFS18261) fromize the alignment. The Roman numerals written in italics overlying the sequences

the sequences denotes the location of the six conserved cysteine (Cys) residues in

G. Xie et al. / Plant Science 227 (2014) 69–75 73

F OsMPu s the

O s black

p[c

stplA(itspaswmM

Okitptud

Fmi1rp

ig. 3. Schematic representation of the mutated cysteine residues in OsMPK3 and

sing an in vitro GeneEditorTM site-directed mutagenesis system were identified asMPK6 proteins. In addition, the kinase subdomains of both MAPKs are denoted a

eroxide-induced gene expression and oxidative stress resistance31]. However, there are no other reports concerning the redox-ontrol of cysteine residues in MAPK proteins in higher plants.

As described above, OsMPK3 and OsMPK6 are members of theubgroup A MAPKs in higher plants. In the present study, to iden-ify the conserved cysteine residues in this subgroup in the higherlants, we obtained eight MPK3 and MPK6 proteins from four popu-

ar dicot and monocot plant species, such as AtMPK3 (Q39023) andtMPK6 (Q39026) in Arabidopsis, NtWIPK (BAB79636) and NtSIPK

AAB58396) in tobacco, OsMPK3 (Q10N20) and OsMPK6 (Q84UI5)n rice, and BdMPK3 (AFS18260) and BdMPK6 (AFS18261) in B. dis-achyon, and conducted multiple protein sequence alignments. Ashown in Fig. 2, all eight MPK3 and MPK6 proteins in these modellant species shared high similarity in the amino acid sequencesnd contained eleven conserved kinase domains. In addition, theseubgroup A kinases also possessed six conserved cysteine residuesithin the kinase subdomains (Fig. 2), suggesting the involve-ent of these cysteine residues in the redox-control of subgroup AAPKs in these plant species.As the six conserved cysteine residues identified in both

sMPK3 and OsMPK6 proteins were located in or near proteininase subdomains I, V, VI, VII, IX and XI (Fig. 3), it would bentriguing to determine whether these residues are important forhe kinase activity induced through H2O2 stress. Therefore, we

erformed single site mutations, substituting each of the six cys-eine (Cys) residues with serine (Ser) residues in both MAPKssing different sets of primers and the GeneEditorTM in vitro site-irected mutagenesis system. Following IPTG induction in E. coli

ig. 4. The effects of cysteine mutation on the in vitro kinase activities of OsMPK3 and

utants C51S, C139S, C174S, C179S, C225S and C334S and GST-OsMPK6 (wt) and its asncubated with 5 �g MBP and 1 �Ci [�-32P]-ATP in kinase reaction buffer (20 �l) for 30 min5% SDS-PAGE. Approximately 1.0 �g of purified GST-tagged protein was equally loadedepeated at least three times, and representative results are shown. (b) The kinase activroteins in vitro were calculated by Image J software. **Denotes significant differences at

K6. The relative sites of the six conserved cysteine residues subjected to mutationactual sites, indicated in the upper side using hollow rectangles for OsMPK3 and

boxes with the capital roman letters I, II, III, IV, V, VI, VII, VIII, IX, X and XI below.

BL21 and resin affinity purification using a Glutathione-Sepharose4B, we purified GST-tagged OsMPK3 (M.W. 68 kDa) and GST-taggedOsMPK6 (M.W. 71 kDa) as described in Supplementary Figs. S1 andS2. The purified recombinant proteins were used to determine andcompare the in vitro kinase activities of the wild type (wt) andmutant recombinant proteins. As shown in Supplementary TableS1, under native conditions, the autoradiograph intensity and cor-responding CBB staining levels in the each lane of the gels showeda correlation coefficient of r = 0.756, and this value was statisticallysignificant (p < 0.05), suggesting the feasibility of determining thekinase activity of OsMPK3 and OsMPK6 by calculating the relativeintensity using Image J software. As demonstrated in Fig. 4a, onlymutations in the fourth Cys residues of subdomain VII, Cys179 andCys210, greatly inhibited the in vitro kinase activities of OsMPK3 andOsMPK6, respectively, and these values were extremely significant(p < 0.01) (Fig. 4b). In contrast, no significant inhibitory effects onthe in vitro kinase activities of both OsMPK3 and OsMPK6 throughCys mutations in the other five sites were observed (Fig. 4a and b).This result strongly suggested that the fourth Cys residues, Cys179

and Cys210, of OsMPK3 and OsMPK6, respectively, are requiredto maintain the in vitro MBP kinase activity of both MAPKs. Sim-ilarly, in humans, the conserved fourth cysteine residue of theATP-binding site within ERK2 (MAPK) protein kinase subdomain VIIand upstream MAPKKs, such as MEK1 and MKK7, has been impli-

cated in the covalent binding to a novel and selective inhibitor,FR148083, in vitro [32]. In eukaryotes, this cysteine residue is com-monly observed in most MAPKs, except for a few MAPKs, such asp38, JNK1 and IKK�. Thus, the fourth cysteine residue most likely

OsMPK6. (a) 1.0 �g of purified recombinant GST-OsMPK3 (wt) and its associatedsociated mutants C82S, C170S, C205S, C210S, C256S and C364S were individually

at 30 ◦C, and phosphorylated MBP was detected through autoradiography following for electrophoresis on a 15% gel, followed by CBB staining. Each experiment wasities of purified recombinant MPK3 (wt), MPK6 (wt) and their respective mutant

p < 0.01.

74 G. Xie et al. / Plant Science 227 (2014) 69–75

Fig. 5. Effects of cysteine mutation on the in vitro kinase activities of OsMPK6 under reduced GSH conditions. (a) 1.0 �g of purified recombinant GST-OsMPK6 or associatedmutant proteins C82S, C170S, C205S, C210S, C256S and C364S was incubated in MBP with or without the addition of 4 mM reduced GSH at 30 ◦C for 30 min, and phosphorylatedM �g of the purified proteins was equally loaded for electrophoresis on a 15% gel, followedb ntative results are shown. (b) The in vitro kinase activities of purified recombinant MPK6( ed GSH, were calculated by Image J software. **Denotes significant differences at p < 0.01.

pk

3rO

pioaOav(tkwieaGtst0vtsatTttopObIihsdTa

Fig. 6. A proposed model for reversible MAPK protein thiol modification throughredox-control. Both OsMPK3 and OsMPK6 present three different types of redoxstates depending on the fourth cysteine residue, Cys179 and Cys210, respectively,which is critical for the catalytic sites of the 11 kinase subdomains. Under normal

conditions, these proteins maintain an inactivated thiolate in MAPKs ( ). Underoxidative stress, MAPKs are oxidized through H2O2, resulting in the formation of

an activated sulfenic acid intermediate ( ) with enhanced kinase activity, which

BP was detected through autoradiography after 15% SDS-PAGE. Approximately 1.0y CBB staining. Each experiment was repeated at least three times, and the represewt) and its respective mutant proteins, with or without the addition of 4 mM reduc

lays an essential role in the regulation of the tertiary structure andinase activities of MAPKs in vitro and in vivo.

.3. The fourth cysteines, Cys179 and Cys210, are most likely aedox-sensitive residue involved in the regulation of OsMPK3 andsMPK6 kinase activity in vitro

In a previous report, we showed that 5 mM reduced GSH com-letely abrogates the kinase activities of OsMPK3 and OsMPK6

n vitro [33]. To further explore the effects of Cys mutationsn the redox-control of the in vitro kinase activities of OsMPK3nd OsMPK6, we compared the kinase activities of OsMPK3 andsMPK6 mutants under redox conditions. As shown in Fig. 5, nopparent changes in the in vitro kinase activities of OsMPK6 mutantariants harboring substitutions of the fourth Cys with Ser residuei.e., C210S) were observed in the absence or presence of pre-reatment with 4 mM reduced GSH (Fig. 5a and b). However, theinase activities of wild type (wt) and OsMPK6 mutant variantsith Cys site mutations in the other five sites were markedly

nhibited after pretreatment with 4 mM reduced GSH, and theseffects were statistically extremely significant (p < 0.01) (Figs. 5and 5b). Furthermore, OsMPK3 also showed similar results underSH pretreatment (data not shown). These data strongly suggest

he specific redox-control of the in vitro kinase activities for theubgroup A MAPKs, OsMPK3 and OsMPK6, through the fourth cys-eine residues Cys179 and Cys210, respectively. In rice seedlings,.2 mM GSH pretreatment inhibited the cadmium-induced acti-ation of the 40-kDa MBP kinase in rice roots, corresponding tohe MW of OsMPK3 (approximately 42 kDa) [34,35]. In Arabidop-is seedlings, 0.2 mM GSH pretreatment also effectively inhibits thectivation of AtMPK3 and AtMPK6 in the roots [29]. In plant cells,he concentration of GSH is typically within the mM range [36,37].aken together, these results suggest that GSH directly inhibitshe in vitro and in vivo kinase activities of OsMPK3 and OsMPK6hrough interactions with the fourth Cys in the ATP-binding sitesf kinase subdomain VII in OsMPK3 and OsMPK6. Here, we pro-ose a redox-control model for the in vivo kinase activities of bothsMPK3 and OsMPK6 (Fig. 6), although whether oxidized MAPKinds to GSH or reduced thioredoxin in rice cells remains unknown.n these cases, OsMPK3 and OsMPK6 maintain basal kinase activ-ties under relatively reduced states when rice plants are growingealthily under normal and favorable conditions. Under oxidative

tress, OsMPK3 and OsMPK6 can be rapidly and transiently oxi-ized and activated to transduce a specific stress signal [23,33].he reducing agents in the rice cells, such as reduced thioredoxinnd GSH, are subsequently accumulated in large quantities under

is subsequently restored to the reduced state ( ) through the action of reducedglutathione (GSH).

stress. These biochemically reactive substances suppress MAPKactivation through specific cysteine modifications involved in thestress signaling to subsequent cellular metabolism and stress tol-erance responses. Thus, a feedback regulatory mechanism is likelyinvolved in the ROS signaling through the MAPK pathway in plants.

Acknowledgements

This research was supported through grants from the NationalNatural Science Foundation of China (Grant Nos. 30871463,31371550), the Fundamental Research Funds for the CentralUniversities of China (Grant no. 2012MBDX008), Huazhong Agri-cultural University Scientific & Technological Self-innovationFoundation (No. 2012SC14), the Japan Society for the Promotionof Science (No. 05F05689) and a JSPS Invitation Fellowship (L-

10560). The authors would like to thank Dr. Shigemi Seo and Dr.Yuko Ohashi of the National Institute of Agrobiological Sciences,Tsukuba, Japan, for kindly providing the antibodies against OsMPK3and OsMPK6.

cience

A

i2

R

[

[

[

[

[

[

[

[

[[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

G. Xie et al. / Plant S

ppendix A. Supplementary data

Supplementary material related to this article can be found,n the online version, at http://dx.doi.org/10.1016/j.plantsci.014.07.002.

eferences

[1] L. Xiong, Y. Yang, Disease resistance and abiotic stress tolerance in rice areinversely modulated by an abscisic acid-inducible mitogen-activated proteinkinase, Plant Cell 15 (2003) 745–759.

[2] V. Chinnusamy, K. Schumaker, J. Zhu, Molecular genetic perspectives oncross-talk and specificity in abiotic stress signalling in plants, J. Exp. Bot. 55(2004) 225–236.

[3] Y. Xing, W. Jia, J. Zhang, AtMEK1 mediates stress-induced gene expression ofCAT1 catalase by triggering H2O2 production in Arabidopsis, J. Exp. Bot. 58(2007) 2969–2981.

[4] X. Wan, J. Liu, Comparative proteomics analysis reveals an intimate proteinnetwork provoked by hydrogen peroxide stress in rice seedling leaves, Mol.Cell Proteomics 7 (2008) 1469–1488.

[5] A. Pitzschke, H. Hirt, Mitogen-activated protein kinases and reactive oxygenspecies signaling in plants, Plant Physiol. 141 (2006) 351–356.

[6] J. Foreman, V. Demidchik, J.H. Bothwell, P. Mylona, H. Miedema, M.A. Torres, P.Linstead, S. Costa, C. Brownlee, J.D. Jones, J.M. Davies, L. Dolan, Reactive oxygenspecies produced by NADPH oxidase regulate plant cell growth, Nature 422(2003) 442–446.

[7] C. Laloi, D. Mestres-Ortega, Y. Marco, Y. Meyer, J.P. Reichheld, The Arabidopsiscytosolic thioredoxin h5 gene induction by oxidative stress and its W-box -mediated response to pathogen elicitor, Plant Physiol. 134 (2004) 1006–1016.

[8] L.P. Hamel, M.C. Nicole, S. Sritubtim, M.J. Morency, M. Ellis, J. Ehlting, N. Beau-doin, B. Barbazuk, D. Klessig, J. Lee, G. Martin, J. Mundy, Y. Ohashi, D. Scheel,J. Sheen, T. Xing, S. Zhang, A. Seguin, B.E. Ellis, Ancient signals: comparativegenomics of plant MAPK and MAPKK gene families, Trends Plant Sci. 11 (2006)192–198.

[9] G.P. Miles, M.A. Samuel, Y. Zhang, B.E. Ellis, RNA interference-based (RNAi) sup-pression of AtMPK6, an Arabidopsis mitogen-activated protein kinase, resultsin hypersensitivity to ozone and misregulation of AtMPK3, Environ. Pollut. 138(2005) 230–237.

10] J.S. Lee, B.E. Ellis, Arabidopsis MAPK phosphatase 2 (MKP2) positively regulatesoxidative stress tolerance and inactivates the MPK3 and MPK6 MAPKs, J. Biol.Chem. 282 (2007) 25020–25029.

11] R. Desikan, A. Clarke, P. Atherfold, J.T. Hancock, S.J. Neill, Harpin inducesmitogen-activated protein kinase activity during defence responses in Ara-bidopsis thaliana suspension cultures, Planta 210 (1999) 97–103.

12] Y. Kovtun, W.L. Chiu, G. Tena, J. Sheen, Functional analysis of oxidative stress-activated mitogen-activated protein kinase cascade in plants, Proc. Natl. Acad.Sci. U.S.A. 97 (2000) 2940–2945.

13] H. Moon, B. Lee, G. Choi, D. Shin, D.T. Prasad, O. Lee, S.S. Kwak, D.H. Kim, J. Nam,J. Bahk, J.C. Hong, S.Y. Lee, M.J. Cho, C.O. Lim, D.J. Yun, NDP kinase 2 interactswith two oxidative stress-activated MAPKs to regulate cellular redox state andenhances multiple stress tolerance in transgenic plants, Proc. Natl. Acad. Sci.U.S.A. 100 (2003) 358–363.

14] M.A. Samuel, G.P. Miles, B.E. Ellis, Ozone treatment rapidly activates MAP kinasesignalling in plants, Plant J. 22 (2000) 367–376.

15] A. Zhang, M. Jiang, J. Zhang, M. Tan, X. Hu, Mitogen-activated protein kinaseis involved in abscisic acid-induced antioxidant defense and acts downstream

of reactive oxygen species production in leaves of maize plants, Plant Physiol.141 (2006) 475–487.

16] K. Cho, G.K. Agrawal, N.S. Jwa, A. Kubo, R. Rakwal, Rice OsSIPK and its orthologs:a “central master switch” for stress responses, Biochem. Biophys. Res. Commun.379 (2009) 649–653.

[

227 (2014) 69–75 75

17] A. Higdon, A.R. Diers, J.Y. Oh, A. Landar, V.M. Darley-Usmar, Cell signalling byreactive lipid species: new concepts and molecular mechanisms, Biochem. J.442 (2012) 453–464.

18] T. Finkel, Redox-dependent signal transduction, FEBS Lett. 476 (2000) 52–54.19] S.G. Rhee, Y.S. Bae, S.R. Lee, J. Kwon, Hydrogen peroxide: a key messenger that

modulates protein phosphorylation through cysteine oxidation, Sci. STKE 2000(2000) pe1.

20] D. Barford, The role of cysteine residues as redox-sensitive regulatory switches,Curr. Opin. Struct. Biol. 14 (2004) 679–686.

21] N.V. Bykova, B. Hoehn, C. Rampitsch, J. Hu, J.A. Stebbing, R. Knox, Thiol redox-sensitive seed proteome in dormant and non-dormant hybrid genotypes ofwheat, Phytochemistry 72 (2011) 1162–1172.

22] J.Q. Wen, K. Oono, R. Imai, Two novel mitogen-activated protein signaling com-ponents, OsMEK1 and OsMAP1, are involved in a moderate low-temperaturesignaling pathway in rice, Plant Physiol. 129 (2002) 1880–1891.

23] G. Xie, H. Kato, R. Imai, Biochemical identification of the OsMKK6-OsMPK3signalling pathway for chilling stress tolerance in rice, Biochem. J. 443 (2012)95–102.

24] S. Katou, E. Karita, H. Yamakawa, S. Seo, I. Mitsuhara, K. Kuchitsu, Y. Ohashi,Catalytic activation of the plant MAPK phosphatase NtMKP1 by its physiologicalsubstrate salicylic acid-induced protein kinase but not by calmodulins, J. Biol.Chem. 280 (2005) 39569–39581.

25] Y. Huang, H. Li, R. Gupta, P.C. Morris, S. Luan, J.J. Kieber, ATMPK4, an Ara-bidopsis homolog of mitogen-activated protein kinase, is activated in vitroby AtMEK1 through threonine phosphorylation, Plant Physiol. 122 (2000)1301–1310.

26] R. Ahlfors, V. Macioszek, J. Rudd, M. Brosche, R. Schlichting, D. Scheel, J. Kan-gasjarvi, Stress hormone-independent activation and nuclear translocation ofmitogen-activated protein kinases in Arabidopsis thaliana during ozone expo-sure, Plant J. 40 (2004) 512–522.

27] S. Zhang, D.F. Klessig, The tobacco wounding-activated mitogen-activatedprotein kinase is encoded by SIPK, Proc. Natl. Acad. Sci. U.S.A. 95 (1998)7225–7230.

28] J.J. Rudd, J. Keon, K.E. Hammond-Kosack, The wheat mitogen-activated pro-tein kinases TaMPK3 and TaMPK6 are differentially regulated at multiple levelsduring compatible disease interactions with Mycosphaerella graminicola, PlantPhysiol. 147 (2008) 802–815.

29] X. Liu, K.E. Kim, K.C. Kim, X.C. Nguyen, H.J. Han, M.S. Jung, H.S. Kim, S.H. Kim,H.C. Park, D.J. Yun, W.S. Chung, Cadmium activates Arabidopsis MPK3 andMPK6 via accumulation of reactive oxygen species, Phytochemistry 71 (2010)614–618.

30] D. Kultz, Phylogenetic and functional classification of mitogen- and stress-activated protein kinases, J. Mol. Evol. 46 (1998) 571–588.

31] A.M. Day, E.A. Veal, Hydrogen peroxide-sensitive cysteines in the Sty1 MAPKregulate the transcriptional response to oxidative stress, J. Biol. Chem. 285(2010) 7505–7516.

32] M. Ohori, T. Kinoshita, S. Yoshimura, M. Warizaya, H. Nakajima, H. Miyake, Roleof a cysteine residue in the active site of ERK and the MAPKK family, Biochem.Biophys. Res. Commun. 353 (2007) 633–637.

33] G. Xie, H. Kato, K. Sasaki, R. Imai, A cold-induced thioredoxin h of rice OsTrx23,negatively regulates kinase activities of OsMPK3 and OsMPK6 in vitro, FEBSLett. 583 (2009) 2734–2738.

34] C.M. Yeh, L.J. Hsiao, H.J. Huang, Cadmium activates a mitogen-activated proteinkinase gene and MBP kinases in rice, Plant Cell Physiol. 45 (2004) 1306–1312.

35] C.M. Yeh, P.S. Chien, H.J. Huang, Distinct signalling pathways for induction ofMAP kinase activities by cadmium and copper in rice roots, J. Exp. Bot. 58 (2007)659–671.

36] W.G. Kirlin, J. Cai, S.A. Thompson, D. Diaz, T.J. Kavanagh, D.P. Jones, Glutathione

redox potential in response to differentiation and enzyme inducers, Free Radic.Biol. Med. 27 (1999) 1208–1218.

37] S.G. Kim, S.T. Kim, S.Y. Kang, Y. Wang, W. Kim, K.Y. Kang, Proteomic analysis ofreactive oxygen species (ROS)-related proteins in rice roots, Plant Cell Rep. 27(2008) 363–375.