a presentation on mechanics of claim construction and drafting by mrs. vinita radhakrishnan
DESCRIPTION
A Presentation on Mechanics of Claim Construction and Drafting by Mrs. Vinita RadhakrishnanTRANSCRIPT
![Page 1: A Presentation on Mechanics of Claim Construction and Drafting by Mrs. Vinita Radhakrishnan](https://reader036.vdocuments.site/reader036/viewer/2022062706/557c798ed8b42a37278b482b/html5/thumbnails/1.jpg)
Vinita Radhakrishnan
![Page 2: A Presentation on Mechanics of Claim Construction and Drafting by Mrs. Vinita Radhakrishnan](https://reader036.vdocuments.site/reader036/viewer/2022062706/557c798ed8b42a37278b482b/html5/thumbnails/2.jpg)
PATENT SYSTEM RIGHTS v. DUTY DUTY
◦ SPECIFICATION DESCRIPTION
SUFFICIENCY ENABLEMENT BEST MODE
CLAIMS CLEAR AND UNAMBIGUOUS
![Page 3: A Presentation on Mechanics of Claim Construction and Drafting by Mrs. Vinita Radhakrishnan](https://reader036.vdocuments.site/reader036/viewer/2022062706/557c798ed8b42a37278b482b/html5/thumbnails/3.jpg)
Claims define the metes and bounds of an invention
Claim Limits the extent of protection What is not claimed is disclaimed! Claims determine the value of your patent Each claim is a representation of your
invention. Single sentence ending with a period.
![Page 4: A Presentation on Mechanics of Claim Construction and Drafting by Mrs. Vinita Radhakrishnan](https://reader036.vdocuments.site/reader036/viewer/2022062706/557c798ed8b42a37278b482b/html5/thumbnails/4.jpg)
Implications of◦ Claiming too broadly ◦ Claiming too narrow
Claiming just right: ◦ This is an art and requires lots of imagination◦ Claim must be adequately supported by the
description Must avoid
◦ Not claiming what the client wants◦ Claiming what the client does not use or need
![Page 5: A Presentation on Mechanics of Claim Construction and Drafting by Mrs. Vinita Radhakrishnan](https://reader036.vdocuments.site/reader036/viewer/2022062706/557c798ed8b42a37278b482b/html5/thumbnails/5.jpg)
Cannot broaden the claims of a granted patent
Cannot broaden the disclosure and the claims beyond what has been included when drafting the application that was filed
You are responsible for getting the scope of protection the inventor deserves
You do not get a second chance
![Page 6: A Presentation on Mechanics of Claim Construction and Drafting by Mrs. Vinita Radhakrishnan](https://reader036.vdocuments.site/reader036/viewer/2022062706/557c798ed8b42a37278b482b/html5/thumbnails/6.jpg)
Three parts ◦Introductory Phrase
Introduces the subject matter of the invention
◦Body defines a particular embodiment of the
invention ◦Transition Phrase
joins the introductory phrase and the body of claim
Open ended v. close ended claims
![Page 7: A Presentation on Mechanics of Claim Construction and Drafting by Mrs. Vinita Radhakrishnan](https://reader036.vdocuments.site/reader036/viewer/2022062706/557c798ed8b42a37278b482b/html5/thumbnails/7.jpg)
![Page 8: A Presentation on Mechanics of Claim Construction and Drafting by Mrs. Vinita Radhakrishnan](https://reader036.vdocuments.site/reader036/viewer/2022062706/557c798ed8b42a37278b482b/html5/thumbnails/8.jpg)
“I claim a pencil having an eraser fastened to one end.”
Introductory phrase - “a pencil” Transition phrase – “having” Body – “an eraser fastened to one end”
![Page 9: A Presentation on Mechanics of Claim Construction and Drafting by Mrs. Vinita Radhakrishnan](https://reader036.vdocuments.site/reader036/viewer/2022062706/557c798ed8b42a37278b482b/html5/thumbnails/9.jpg)
Independent Claims◦ Do not depend on any other claim ◦ Generally defines the essential novel features of
the most preferred embodiments of a product or a process. A pencil having an eraser fastened to one end.
![Page 10: A Presentation on Mechanics of Claim Construction and Drafting by Mrs. Vinita Radhakrishnan](https://reader036.vdocuments.site/reader036/viewer/2022062706/557c798ed8b42a37278b482b/html5/thumbnails/10.jpg)
Dependent Claims◦Depend on either an independent claim or
another dependent claim◦Multiple-dependent claims
The pencil as in claim 1, where said eraser is fastened to said pencil on one end using an adhesive.
The pencil as claimed in claim 1 and 2 wherein the said adhesive is glue.
![Page 11: A Presentation on Mechanics of Claim Construction and Drafting by Mrs. Vinita Radhakrishnan](https://reader036.vdocuments.site/reader036/viewer/2022062706/557c798ed8b42a37278b482b/html5/thumbnails/11.jpg)
Process Claims◦ A Process Claim is used for process inventions
and has to clearly define the steps involved in the process.
Product Claims◦ A product claim may be claimed as an apparatus,
a system, a device, an article or any other product.
![Page 12: A Presentation on Mechanics of Claim Construction and Drafting by Mrs. Vinita Radhakrishnan](https://reader036.vdocuments.site/reader036/viewer/2022062706/557c798ed8b42a37278b482b/html5/thumbnails/12.jpg)
Markush Claims Product by process claims Fingerprint claims
Structure Claim Composition Claim Gene Sequence claim Diagnostic method claim
![Page 13: A Presentation on Mechanics of Claim Construction and Drafting by Mrs. Vinita Radhakrishnan](https://reader036.vdocuments.site/reader036/viewer/2022062706/557c798ed8b42a37278b482b/html5/thumbnails/13.jpg)
To Generalize is the Key
![Page 14: A Presentation on Mechanics of Claim Construction and Drafting by Mrs. Vinita Radhakrishnan](https://reader036.vdocuments.site/reader036/viewer/2022062706/557c798ed8b42a37278b482b/html5/thumbnails/14.jpg)
![Page 15: A Presentation on Mechanics of Claim Construction and Drafting by Mrs. Vinita Radhakrishnan](https://reader036.vdocuments.site/reader036/viewer/2022062706/557c798ed8b42a37278b482b/html5/thumbnails/15.jpg)
![Page 16: A Presentation on Mechanics of Claim Construction and Drafting by Mrs. Vinita Radhakrishnan](https://reader036.vdocuments.site/reader036/viewer/2022062706/557c798ed8b42a37278b482b/html5/thumbnails/16.jpg)
![Page 17: A Presentation on Mechanics of Claim Construction and Drafting by Mrs. Vinita Radhakrishnan](https://reader036.vdocuments.site/reader036/viewer/2022062706/557c798ed8b42a37278b482b/html5/thumbnails/17.jpg)
![Page 18: A Presentation on Mechanics of Claim Construction and Drafting by Mrs. Vinita Radhakrishnan](https://reader036.vdocuments.site/reader036/viewer/2022062706/557c798ed8b42a37278b482b/html5/thumbnails/18.jpg)
“The feline mammal occupying, a wholly if not entirely sedentary position, a horizontally-spread woven textile floor-covering, as is sometimes but not always the case".
![Page 19: A Presentation on Mechanics of Claim Construction and Drafting by Mrs. Vinita Radhakrishnan](https://reader036.vdocuments.site/reader036/viewer/2022062706/557c798ed8b42a37278b482b/html5/thumbnails/19.jpg)
![Page 20: A Presentation on Mechanics of Claim Construction and Drafting by Mrs. Vinita Radhakrishnan](https://reader036.vdocuments.site/reader036/viewer/2022062706/557c798ed8b42a37278b482b/html5/thumbnails/20.jpg)
Generalize to such an extent that your patent is close to prior art but can be clearly differentiated from the prior art
![Page 21: A Presentation on Mechanics of Claim Construction and Drafting by Mrs. Vinita Radhakrishnan](https://reader036.vdocuments.site/reader036/viewer/2022062706/557c798ed8b42a37278b482b/html5/thumbnails/21.jpg)
![Page 22: A Presentation on Mechanics of Claim Construction and Drafting by Mrs. Vinita Radhakrishnan](https://reader036.vdocuments.site/reader036/viewer/2022062706/557c798ed8b42a37278b482b/html5/thumbnails/22.jpg)
Product claims Process claims
![Page 23: A Presentation on Mechanics of Claim Construction and Drafting by Mrs. Vinita Radhakrishnan](https://reader036.vdocuments.site/reader036/viewer/2022062706/557c798ed8b42a37278b482b/html5/thumbnails/23.jpg)
New Chemical entity including a molecule or a compound
Combination Compositions
![Page 24: A Presentation on Mechanics of Claim Construction and Drafting by Mrs. Vinita Radhakrishnan](https://reader036.vdocuments.site/reader036/viewer/2022062706/557c798ed8b42a37278b482b/html5/thumbnails/24.jpg)
A chemical molecule developed in the early discovery stage which later translates into a drug product is generally referred to as a new chemical entity. ◦Actual molecular structure of the NCE in the
claim
![Page 25: A Presentation on Mechanics of Claim Construction and Drafting by Mrs. Vinita Radhakrishnan](https://reader036.vdocuments.site/reader036/viewer/2022062706/557c798ed8b42a37278b482b/html5/thumbnails/25.jpg)
A compound having the formula
Scope of protection rendered by the claim stated in the illustration is limited to the compound bearing the molecular structure.
![Page 26: A Presentation on Mechanics of Claim Construction and Drafting by Mrs. Vinita Radhakrishnan](https://reader036.vdocuments.site/reader036/viewer/2022062706/557c798ed8b42a37278b482b/html5/thumbnails/26.jpg)
Include a chemical entity along with the various variants of the same
Close ended claims Claim by grouping
![Page 27: A Presentation on Mechanics of Claim Construction and Drafting by Mrs. Vinita Radhakrishnan](https://reader036.vdocuments.site/reader036/viewer/2022062706/557c798ed8b42a37278b482b/html5/thumbnails/27.jpg)
A compound having the formula
Wherein X is selected from a group consisting of Cl, Br, F and I.
![Page 28: A Presentation on Mechanics of Claim Construction and Drafting by Mrs. Vinita Radhakrishnan](https://reader036.vdocuments.site/reader036/viewer/2022062706/557c798ed8b42a37278b482b/html5/thumbnails/28.jpg)
When the exact structure is not known but the characteristics of the structure is sufficient to distinguish the compound from existing prior art.
e.g.:What is claimed is
A chemical entity characterized by molecular weight of 280, having a pH of 6.5, which has a melting point of 123 degree Celsius and a boiling point of 180 degree Celsius.
![Page 29: A Presentation on Mechanics of Claim Construction and Drafting by Mrs. Vinita Radhakrishnan](https://reader036.vdocuments.site/reader036/viewer/2022062706/557c798ed8b42a37278b482b/html5/thumbnails/29.jpg)
When the product cannot be clearly defined and is best defined by the process of preparing the same
![Page 30: A Presentation on Mechanics of Claim Construction and Drafting by Mrs. Vinita Radhakrishnan](https://reader036.vdocuments.site/reader036/viewer/2022062706/557c798ed8b42a37278b482b/html5/thumbnails/30.jpg)
![Page 31: A Presentation on Mechanics of Claim Construction and Drafting by Mrs. Vinita Radhakrishnan](https://reader036.vdocuments.site/reader036/viewer/2022062706/557c798ed8b42a37278b482b/html5/thumbnails/31.jpg)
Polyjuice potion: ◦A potion that transforms one person to
another person he desires to look and sound like
What is claimed is a potion prepared by: Mixing 12 lacewing flies that have been stewed
for 21 days; 1 ounce of crude Antimony; 4 leeches that have been “unsucculated”; 1 pinch of powdered horn of a Bicorn that has
been "lunar extracted“; and Extract of The-Transfigured-Being-To-Be followed by 21 days of brewing in a oak barrel.
![Page 32: A Presentation on Mechanics of Claim Construction and Drafting by Mrs. Vinita Radhakrishnan](https://reader036.vdocuments.site/reader036/viewer/2022062706/557c798ed8b42a37278b482b/html5/thumbnails/32.jpg)
Reference is made to the specification Usually not allowed in most jurisdiction It’s a play safe claiming strategy
![Page 33: A Presentation on Mechanics of Claim Construction and Drafting by Mrs. Vinita Radhakrishnan](https://reader036.vdocuments.site/reader036/viewer/2022062706/557c798ed8b42a37278b482b/html5/thumbnails/33.jpg)
A compound for treating Hemophilia, wherein the compound is substantially as discussed in the specification.
![Page 34: A Presentation on Mechanics of Claim Construction and Drafting by Mrs. Vinita Radhakrishnan](https://reader036.vdocuments.site/reader036/viewer/2022062706/557c798ed8b42a37278b482b/html5/thumbnails/34.jpg)
Novel Combination product patents including two or more already known chemical compounds.
These compounds may be available in the public domain. But so long as the combination is novel, they can be patented.
A composition claim usually shall include several components both essential and non essential for the invention.
![Page 35: A Presentation on Mechanics of Claim Construction and Drafting by Mrs. Vinita Radhakrishnan](https://reader036.vdocuments.site/reader036/viewer/2022062706/557c798ed8b42a37278b482b/html5/thumbnails/35.jpg)
What is claimed isA shampoo composition comprising a. 25 % of Alkyl ether sulphate; b. 10% of Dimethicone; c. 2% of imidazole and d. 63% water.
![Page 36: A Presentation on Mechanics of Claim Construction and Drafting by Mrs. Vinita Radhakrishnan](https://reader036.vdocuments.site/reader036/viewer/2022062706/557c798ed8b42a37278b482b/html5/thumbnails/36.jpg)
What is claimed is1. A shampoo composition comprising
20- 30% of at least one Surfactant; 5-15% of at least one conditioning agent; 1-3% of at least one anti fungal agent and water.
2. The shampoo composition as claimed in claim 1, wherein the antifungal agent is selected from a group consisting of pyrazole, imidazole, triazole, tetrazole and pentazole.
3. The shampoo composition in claim 1 wherein said anti fungal agent is imidazole.
![Page 37: A Presentation on Mechanics of Claim Construction and Drafting by Mrs. Vinita Radhakrishnan](https://reader036.vdocuments.site/reader036/viewer/2022062706/557c798ed8b42a37278b482b/html5/thumbnails/37.jpg)
A shampoo composition comprising 20- 30% of at least one Surfactant; 5-15% of at least one conditioning agent; 1-3% of at least one anti fungal agent and Water
wherein the antifungal agent is selected from a group consisting of pyrazole, imidazole, triazole, tetrazole and pentazole.
![Page 38: A Presentation on Mechanics of Claim Construction and Drafting by Mrs. Vinita Radhakrishnan](https://reader036.vdocuments.site/reader036/viewer/2022062706/557c798ed8b42a37278b482b/html5/thumbnails/38.jpg)
A process claim enumerates the step wise process for manufacturing the compound or formulation
Steps to be enumerated in the logical order.
![Page 39: A Presentation on Mechanics of Claim Construction and Drafting by Mrs. Vinita Radhakrishnan](https://reader036.vdocuments.site/reader036/viewer/2022062706/557c798ed8b42a37278b482b/html5/thumbnails/39.jpg)
A process for preparing a modified phosphocalcic compound comprising:
a) adding a gem-biphosphonic acid or an alkali metal or alkaline-earth metal salt thereof to a suspension of a precursor phosphocalcic compound in ultrapure water;
b) stirring the reaction medium at room temperature and
c) recovering the formed compound there from by centrifugation.
![Page 40: A Presentation on Mechanics of Claim Construction and Drafting by Mrs. Vinita Radhakrishnan](https://reader036.vdocuments.site/reader036/viewer/2022062706/557c798ed8b42a37278b482b/html5/thumbnails/40.jpg)
Biphenyl Propionic acid
![Page 41: A Presentation on Mechanics of Claim Construction and Drafting by Mrs. Vinita Radhakrishnan](https://reader036.vdocuments.site/reader036/viewer/2022062706/557c798ed8b42a37278b482b/html5/thumbnails/41.jpg)
![Page 42: A Presentation on Mechanics of Claim Construction and Drafting by Mrs. Vinita Radhakrishnan](https://reader036.vdocuments.site/reader036/viewer/2022062706/557c798ed8b42a37278b482b/html5/thumbnails/42.jpg)
A compound wherein the compound is
What is claimed is a compound wherein ring P is an aromatic ring optionally having substituent(s), ring Q is an aromatic ring optionally further having substituent(s) besides —Y—COOH, and X and Y are each independently a spacer, or a salt thereof or a prodrug thereof.
![Page 43: A Presentation on Mechanics of Claim Construction and Drafting by Mrs. Vinita Radhakrishnan](https://reader036.vdocuments.site/reader036/viewer/2022062706/557c798ed8b42a37278b482b/html5/thumbnails/43.jpg)
Nothing is unfair when you define the scope of your invention.
Examiners are always stingy
![Page 44: A Presentation on Mechanics of Claim Construction and Drafting by Mrs. Vinita Radhakrishnan](https://reader036.vdocuments.site/reader036/viewer/2022062706/557c798ed8b42a37278b482b/html5/thumbnails/44.jpg)
![Page 45: A Presentation on Mechanics of Claim Construction and Drafting by Mrs. Vinita Radhakrishnan](https://reader036.vdocuments.site/reader036/viewer/2022062706/557c798ed8b42a37278b482b/html5/thumbnails/45.jpg)
Product related claims Process related claims
![Page 46: A Presentation on Mechanics of Claim Construction and Drafting by Mrs. Vinita Radhakrishnan](https://reader036.vdocuments.site/reader036/viewer/2022062706/557c798ed8b42a37278b482b/html5/thumbnails/46.jpg)
Gene sequence Amino Acid sequence Vector and host used for expression of the
gene An antibody against the protein / sequence
and a kit made from the antibody / sequence
![Page 47: A Presentation on Mechanics of Claim Construction and Drafting by Mrs. Vinita Radhakrishnan](https://reader036.vdocuments.site/reader036/viewer/2022062706/557c798ed8b42a37278b482b/html5/thumbnails/47.jpg)
What is claimed is ◦ An isolated nucleic acid comprising a nucleic acid
sequenceATGGGCCTAACGTGAGGGAATTCGAAATT
Or What is claimed is
◦ An isolated nucleic acid molecule comprising a nucleic acid Sequence of SEQ ID no. 1.
![Page 48: A Presentation on Mechanics of Claim Construction and Drafting by Mrs. Vinita Radhakrishnan](https://reader036.vdocuments.site/reader036/viewer/2022062706/557c798ed8b42a37278b482b/html5/thumbnails/48.jpg)
A nucleic acid molecule comprising a nucleic acid sequence that hybridizes to SEQ ID no.1 under stringent conditions.
![Page 49: A Presentation on Mechanics of Claim Construction and Drafting by Mrs. Vinita Radhakrishnan](https://reader036.vdocuments.site/reader036/viewer/2022062706/557c798ed8b42a37278b482b/html5/thumbnails/49.jpg)
A nucleic acid molecule comprising1) SEQ ID no.1 OR2) a nucleic acid sequence that hybridizes
to SEQ ID no.1 under stringent conditions
![Page 50: A Presentation on Mechanics of Claim Construction and Drafting by Mrs. Vinita Radhakrishnan](https://reader036.vdocuments.site/reader036/viewer/2022062706/557c798ed8b42a37278b482b/html5/thumbnails/50.jpg)
What is claimed is An isolated nucleic acid molecule which
encodes a polypeptide comprising the amino acid sequence Met Ala Asp Asp Cys Glu Phe Val Gly Ser Ala Val
Or
An isolated nucleic acid molecule which encodes a polypeptide comprising the amino acid sequence of SEQ ID NO 2.
![Page 51: A Presentation on Mechanics of Claim Construction and Drafting by Mrs. Vinita Radhakrishnan](https://reader036.vdocuments.site/reader036/viewer/2022062706/557c798ed8b42a37278b482b/html5/thumbnails/51.jpg)
Vector:◦ A vector comprising a nucleic acid molecule as
claimed in Claim 1.
Host Cell:◦ A transgenic host cell that contains the vector
comprising a nucleic acid molecule comprising the nucleic acid sequence of SEQ ID no.1.
![Page 52: A Presentation on Mechanics of Claim Construction and Drafting by Mrs. Vinita Radhakrishnan](https://reader036.vdocuments.site/reader036/viewer/2022062706/557c798ed8b42a37278b482b/html5/thumbnails/52.jpg)
Isolated Antibody:◦An isolated antibody or fragment thereof
comprising the amino acid sequence of of SEQ ID no. 2.
Antibody Kit:◦A kit comprising the antibody or
fragment thereof of claim 1.
![Page 53: A Presentation on Mechanics of Claim Construction and Drafting by Mrs. Vinita Radhakrishnan](https://reader036.vdocuments.site/reader036/viewer/2022062706/557c798ed8b42a37278b482b/html5/thumbnails/53.jpg)
Method of expression claims Biotechnological process claims
![Page 54: A Presentation on Mechanics of Claim Construction and Drafting by Mrs. Vinita Radhakrishnan](https://reader036.vdocuments.site/reader036/viewer/2022062706/557c798ed8b42a37278b482b/html5/thumbnails/54.jpg)
A method of expressing a target protein or polypeptide comprising the steps of:
◦ A) transfecting a host cell with the expression vector of claim 2;
◦ B) culturing the host cell transfected with the expression vector under conditions that permit expression of the target protein or polypeptide; and
◦ C) isolating the target protein or polypeptide.
![Page 55: A Presentation on Mechanics of Claim Construction and Drafting by Mrs. Vinita Radhakrishnan](https://reader036.vdocuments.site/reader036/viewer/2022062706/557c798ed8b42a37278b482b/html5/thumbnails/55.jpg)
A process for making an insulin precursor or an insulin analog precursor, said method comprising
(i) culturing a host cell comprising a polynucleotide sequence encoding an insulin precursor or an insulin analog precursor according to claim 1 under suitable culture conditions for expression of said precursor; and
(ii) isolating the expressed precursor.
![Page 56: A Presentation on Mechanics of Claim Construction and Drafting by Mrs. Vinita Radhakrishnan](https://reader036.vdocuments.site/reader036/viewer/2022062706/557c798ed8b42a37278b482b/html5/thumbnails/56.jpg)
Product Process
![Page 57: A Presentation on Mechanics of Claim Construction and Drafting by Mrs. Vinita Radhakrishnan](https://reader036.vdocuments.site/reader036/viewer/2022062706/557c798ed8b42a37278b482b/html5/thumbnails/57.jpg)
A diagnostic kit used for detecting malaria antibodies in a biological sample comprising of the protein encoded by SEQ ID NO.1 where the said protein is brought in contact with the biological sample under appropriate conditions which allow the formation of an immune complex, wherein said peptide is labeled with a detectable label.
![Page 58: A Presentation on Mechanics of Claim Construction and Drafting by Mrs. Vinita Radhakrishnan](https://reader036.vdocuments.site/reader036/viewer/2022062706/557c798ed8b42a37278b482b/html5/thumbnails/58.jpg)
A method for in vitro diagnosis of malaria antibodies in a biological sample, comprising
(i) contacting said biological sample with a composition comprising a protein encoded by SEQ ID no1 under appropriate conditions which allow the formation of an immune complex, wherein said peptide is labeled with a detectable label, and
(ii) detecting the presence of said immune complexes visually or mechanically.
![Page 59: A Presentation on Mechanics of Claim Construction and Drafting by Mrs. Vinita Radhakrishnan](https://reader036.vdocuments.site/reader036/viewer/2022062706/557c798ed8b42a37278b482b/html5/thumbnails/59.jpg)
An isolated nucleic acid encoding a flavonoid methyltransferase molecule bearing the SEQ ID no 1 and its amino acid sequence bearing SEQ ID no 2
![Page 60: A Presentation on Mechanics of Claim Construction and Drafting by Mrs. Vinita Radhakrishnan](https://reader036.vdocuments.site/reader036/viewer/2022062706/557c798ed8b42a37278b482b/html5/thumbnails/60.jpg)
An isolated nucleic acid molecule according to any one of claims 1 to 3 having the nucleotide sequence comprising:
(i) a nucleotide sequence set forth in SEQ ID NO:1;
(ii) a nucleotide sequence capable of hybridizing under low stringency conditions to SEQ ID NO: 1 or its complementary form;
(iv) a nucleotide sequence capable of encoding the amino acid sequence set forth in SEQ ID NO:2;
wherein said nucleotide sequence encodes a FMT molecule or a mutant, part, fragment or portion thereof or a functional and/or structural equivalent or homolog thereof.
![Page 61: A Presentation on Mechanics of Claim Construction and Drafting by Mrs. Vinita Radhakrishnan](https://reader036.vdocuments.site/reader036/viewer/2022062706/557c798ed8b42a37278b482b/html5/thumbnails/61.jpg)
Claim Dependency First Medical Use Second Medical Indication/Swiss
Claim/New Use claim Process Claims Product by process Gene Sequence: Isolated and
Purified/Synthetic Method of treatment, Diagnosis Combination Claim
![Page 62: A Presentation on Mechanics of Claim Construction and Drafting by Mrs. Vinita Radhakrishnan](https://reader036.vdocuments.site/reader036/viewer/2022062706/557c798ed8b42a37278b482b/html5/thumbnails/62.jpg)
Pre drafting Understand the invention Identify the crux of the invention Consider all possible embodiments Plan the structure Play the role of a devils advocate
![Page 63: A Presentation on Mechanics of Claim Construction and Drafting by Mrs. Vinita Radhakrishnan](https://reader036.vdocuments.site/reader036/viewer/2022062706/557c798ed8b42a37278b482b/html5/thumbnails/63.jpg)
While Drafting Keep the inventor informed. Draft Claim outline before starting to draft
the description. Finalize the claim after specification is drafted
Avoid Unnecessary information Keep in mind the level of PHOSITA while
drafting the claim.
![Page 64: A Presentation on Mechanics of Claim Construction and Drafting by Mrs. Vinita Radhakrishnan](https://reader036.vdocuments.site/reader036/viewer/2022062706/557c798ed8b42a37278b482b/html5/thumbnails/64.jpg)
Be frugal with words Clarity Every word Anchored Be greedy, But do not lose focus of what
your invention is
![Page 65: A Presentation on Mechanics of Claim Construction and Drafting by Mrs. Vinita Radhakrishnan](https://reader036.vdocuments.site/reader036/viewer/2022062706/557c798ed8b42a37278b482b/html5/thumbnails/65.jpg)
PRECISION!
CLARITY!
IMAGINATION!
FORESIGHT!
![Page 66: A Presentation on Mechanics of Claim Construction and Drafting by Mrs. Vinita Radhakrishnan](https://reader036.vdocuments.site/reader036/viewer/2022062706/557c798ed8b42a37278b482b/html5/thumbnails/66.jpg)
Herbal formulation with melon extract:
![Page 67: A Presentation on Mechanics of Claim Construction and Drafting by Mrs. Vinita Radhakrishnan](https://reader036.vdocuments.site/reader036/viewer/2022062706/557c798ed8b42a37278b482b/html5/thumbnails/67.jpg)
Herbal Preparation The medicinal preparation comprises of:
◦ 1. Melon Extract (40%)◦ 2. Aloe Vera Extract (10%)◦ 3. Saffron (5%)◦ 4. Papaya extract (20%)◦ 5. Water
![Page 68: A Presentation on Mechanics of Claim Construction and Drafting by Mrs. Vinita Radhakrishnan](https://reader036.vdocuments.site/reader036/viewer/2022062706/557c798ed8b42a37278b482b/html5/thumbnails/68.jpg)
1. A personal care composition comprising ofa) 20-60% of melon extract;b) 0-10% of moisturizing agent;c) 3-7% of anti oxidative agent;d)10-30% of cleansing agent; ande) a suitable solvent.
2. The personal care composition claimed in claim 1 where in the said cleansing agent is selected from a group consisting of papaya extract, cucumber extract and strawberry extract.
3. The personal care composition claimed in claim 1 and 2 where in the cleansing agent is papaya extract.
![Page 69: A Presentation on Mechanics of Claim Construction and Drafting by Mrs. Vinita Radhakrishnan](https://reader036.vdocuments.site/reader036/viewer/2022062706/557c798ed8b42a37278b482b/html5/thumbnails/69.jpg)
4. The personal care composition claimed in claim 1, where in the composition is administered as a serum.
5. The personal care composition claimed in claim 1, where in the composition is used for treatment of vitiligo.
![Page 70: A Presentation on Mechanics of Claim Construction and Drafting by Mrs. Vinita Radhakrishnan](https://reader036.vdocuments.site/reader036/viewer/2022062706/557c798ed8b42a37278b482b/html5/thumbnails/70.jpg)
For More Details VisitWeb: www.bananaip.com
Blog:www.bananaip.com/sinapse-blog