a ph-independent dna nanodevice for quantifying chloride ... · a ph independent dna nanodevice for...
TRANSCRIPT
![Page 1: A pH-independent DNA nanodevice for quantifying chloride ... · A pH independent DNA nanodevice for quantifying chloride transport in organelles of living cells Sonali Saha, Ved Prakash,](https://reader034.vdocuments.site/reader034/viewer/2022050200/5f5373b88b52e155ac17f38d/html5/thumbnails/1.jpg)
1
A pH independent DNA nanodevice for quantifying chloride
transport in organelles of living cells
Sonali Saha, Ved Prakash, Saheli Halder, Kasturi Chakraborty and Yamuna Krishnan*
Supplementary Information
Reagents: All unmodified oligonucleotides (Table S1 and Table S4) were purchased from Sigma (India).
All modified oligonucleotides (Table S1) were obtained from IBA GmbH (Germany). Fluorescently
labelled oligonucleotides were subjected to ethanol precipitation prior to use to remove any contaminants
from synthesis. The peptide nucleic acids (PNA) oligomer, P (Table S1) was synthesized using standard
solid phase Fmoc chemistry on Nova Syn® TGA resin (Novabiochem, Germany) using analytical grade
reagents (Applied Biosystems®, USA), purified by reverse phase HPLC (Shimadzu, Japan) and stored at
-20 °C until further use.
Nigericin, valinomycin, monensin, bafilomycin, CCCP (Carbonyl Cyanide m-Chlorophenylhydrazone),
tributyltin chloride (TBT-Cl), NPPB (5-nitro-2-(3-phenylpropylamino) benzoic acid) and human holo-
transferrin were obtained from Sigma (USA). FITC labelled 10 kDa dextran (FD10), Fluorescein-5-
Isothiocyanate and Alexa Fluor® 568 NHS ester were obtained from Molecular probes, Invitrogen
(USA). All other reagents were purchased from Sigma-Aldrich (USA) unless otherwise specified. Sources
for antibodies used in this study are mentioned in the western blot section. Plasmids for transient
transfection in S2R+ cells were obtained from Addgene, USA.
Fly stocks and cell culture: All the Drosophila stocks were obtained from Bloomington Stock Centre at
Indiana University, unless otherwise indicated (Table S6) and maintained as described 1.
Hemocytes were obtained from Drosophila 3rd instar larvae as described previously 1. Briefly, third instar
larvae were surface sterilized, and hemolymph was collected by puncturing the integument using
A pH-independent DNA nanodevice for quantifying chloride transport in organelles of
living cells
SUPPLEMENTARY INFORMATIONDOI: 10.1038/NNANO.2015.130
NATURE NANOTECHNOLOGY | www.nature.com/naturenanotechnology 1
© 2015 Macmillan Publishers Limited. All rights reserved
![Page 2: A pH-independent DNA nanodevice for quantifying chloride ... · A pH independent DNA nanodevice for quantifying chloride transport in organelles of living cells Sonali Saha, Ved Prakash,](https://reader034.vdocuments.site/reader034/viewer/2022050200/5f5373b88b52e155ac17f38d/html5/thumbnails/2.jpg)
2
dissection forceps into 150 μL Schneider’s complete media (SCM) containing 10% non-heat inactivated
fetal bovine serum (Gibco, Invitrogen, USA) and 1 μg/mL bovine pancreatic insulin (Sigma, USA) in 35-
mm coverslip-bottom dishes. Labelling incubations were performed on adherent hemocytes 2 h post-
dissection.
S2R+ cells were a generous gift from Prof. Satyajit Mayor’s lab 2, and maintained in Schneider’s medium
(Gibco, Invitrogen, USA) supplemented with 10% FBS (Gibco, Invitrogen, USA) and 1X Penicillin-
Streptomycin-Glutamine (Gibco, Life Technologies, USA) in T25 flask (Nunc, Denmark) and grown at
room temperature (25 °C). These cells stably express human transferrin receptor and were maintained
using 1 μg/mL puromycin (Sigma, USA).
Sample preparation: HPLC purified and lyophilized oligonucleotides and PNA oligomer were dissolved
in Milli-Q water (Milli-Q Integral Water Purification System, Millipore, Germany), aliquoted into small
fractions and stored at -20°C until further use. Stock solutions of Clensor were prepared at a final
concentration of 10 μM by mixing D1, D2 and P in equimolar ratio in 10 mM sodium phosphate buffer,
pH 7.4. The solution was briefly vortexed to mix all the components. Annealing was done by heating the
solution at 90°C for 5 min and cooling at the rate of 5°C / 15 min. For ClensorTf
samples, D1Tfapt, D2
and P were mixed in equimolar ratios at a final concentration of 10 μM in 10 mM sodium phosphate
buffer, pH 7.4 containing 1 mM EDTA, pH 8. Annealing was done as described above. All the samples
were incubated at 4°C for 48 h. Prior to use, stock solution of 100 mM sodium phosphate buffer, pH 7.4
and 500 mM EDTA, pH 8 were filtered using 0.22 μm disk filters (Millipore, Germany).
For modified I-switch (I4LY
A488/A647) sample preparation, 5 μM of I4 and I4′ were mixed in equimolar
ratios in 20 mM potassium phosphate buffer, pH 5.5 containing 100 mM KCl. The resulting solution was
heated to 90 °C for 5 minutes, cooled to the room temperature at 5 °C/15 min and equilibrated at 4 °C
overnight.
© 2015 Macmillan Publishers Limited. All rights reserved
![Page 3: A pH-independent DNA nanodevice for quantifying chloride ... · A pH independent DNA nanodevice for quantifying chloride transport in organelles of living cells Sonali Saha, Ved Prakash,](https://reader034.vdocuments.site/reader034/viewer/2022050200/5f5373b88b52e155ac17f38d/html5/thumbnails/3.jpg)
3
Gel electrophoresis: Native polyacrylamide gels containing 10% or 15% acrylamide [19:1 acrylamide/
bisacrylamide] were used for gel electrophoresis. Gels were run in 1X TBE buffer (100 mM Tris.HCl, 89
mM boric acid, and 2 mM EDTA, pH 8.3) at 4 °C. Post run, gels were stained with ethidium bromide
(1μg/ml) and observed under a UV- transilluminator (Alpha Imager, Alpha Innotech, USA).
Steady state fluorescence measurements: All fluorescence studies were carried out on a Fluoromax-4
(Horiba Scientific, Japan) spectrophotometer. 10 μM stock of Clensor was diluted to a final concentration
of 200 nM using 10 mM sodium phosphate buffer, pH 7.4 and incubated for 30 min at room temperature
prior to experiments. The emission spectra of BAC and Alexa 647 were acquired by exciting the samples
at 435 nm (Ex of BAC) and 650 nm (Ex of Alexa 647) respectively. Emission spectra of BAC and Alexa
647 were collected between 495-550 nm and 650-700 nm respectively. An emission value of 10 mM
sodium phosphate buffer, pH 7.4 served as blank and was subtracted from relevant acquired spectra. In
order to study the chloride sensitivity of Clensor, final chloride concentrations ranging between 5 mM to
200 mM were achieved by addition of microliter aliquots of 1 M stock of NaCl to 400 μL of sample.
Emission intensity of BAC at 505 nm (G) was normalized to emission intensity of Alexa 647 at 670 nm
(R). Fold change in R/G ratio was calculated from the ratio of R/G values at two specific values of [Clˉ].
To investigate chloride sensitivity of Clensor at pH 5, the stock solution of Clensor was diluted to a final
concentration of 200 nM using 1X modified pH clamping buffer (150 mM KNO3, 5 mM NaNO3, 1 mM
Ca(NO3)2, 1 mM Mg(NO3)2, 20 mM HEPES, pH adjusted to 5 using 1 N HNO3), pH 5 prior to
experiment and fluorescence spectra at different added chloride concentrations were recorded as
described above.
I4LY
A488/A647 samples were diluted to 50 nM in 1× pH clamping buffer of desired pH for all in vitro
fluorescence experiments. All samples were vortexed and equilibrated for 30 min at room temperature.
An in vitro pH calibration curve was obtained by plotting the ratio of donor intensity (D) at 520 nm and
© 2015 Macmillan Publishers Limited. All rights reserved
![Page 4: A pH-independent DNA nanodevice for quantifying chloride ... · A pH independent DNA nanodevice for quantifying chloride transport in organelles of living cells Sonali Saha, Ved Prakash,](https://reader034.vdocuments.site/reader034/viewer/2022050200/5f5373b88b52e155ac17f38d/html5/thumbnails/4.jpg)
4
acceptor intensity (A) at 669 nm (for A488/A647) as a function of pH when excited at 488 nm. Mean of
D/A from three independent experiments and their SEM were plotted for each pH value.
Labeling hemocytes: Cells were washed with 1X M1 buffer (150 mM NaCl, 5 mM KCl, 1 mM CaCl2, 1
mM MgCl2, 20 mM HEPES, pH 7.4 containing 1 mg/mL BSA and 2 mg/mL D-glucose) prior to
labelling. 10 μM Clensor stock was diluted to a final concentration of 2 μM with 1X M1 buffer and added
to the coverslip containing hemocytes. This step is referred to as a ‘pulse’. Hemocytes were incubated
with Clensor for 5-10 minutes (depending on the signal, *for measurements in early endosomes 5 min
pulse was given*). The cells were then washed 3 to 4 times with 1X M1 and incubated for an additional 5
to 120 minutes as specified. This step is referred to as a ‘chase’. For a chase longer than 5 minutes, 1X
M1 was replaced by SCM and transferred to a 20°C incubator. The cells were then washed 3 to 4 times
with 1X M1 and imaged.
For pHEE and pHRE measurements hemocytes were labelled with a mixture of 10 kDa FITC dextran
(FD10, 2 mg/mL) and ClensorA647 (1 μM), diluted in 1X M1 as described for Clensor.
For pHLY measurements hemocytes were labelled with I4LY
A488/A647 (1 μM), diluted in 1XM1 as described
for Clensor.
Labeling S2R+ cells: In order to facilitate the folding of the aptameric region of the D1Tfapt in ClensorTf
for efficient binding, the stock solution of the ClensorTf
was diluted to a final concentration of 2 μM with
1X M1 and incubated at room temperature for 30 min prior to pulse. To mark REs, we chose Drosophila
S2R+ lines stably expressing the well characterized human transferrin (Tf) receptor 2. The S2R+ cells
were washed with 1X M1 and then incubated with diluted ClensorTf
for 15 min on ice. The labeling
mixture was removed and cells were washed with 1X M1 for 3 to 4 times. The cells were then chased in
1X M1 for 15 min at room temperature and quickly transferred on ice. Surface bound probes were
removed using stripping buffer (160 mM sodium ascorbate, 40 mM ascorbic acid, 1 mM CaCl2, and 1
© 2015 Macmillan Publishers Limited. All rights reserved
![Page 5: A pH-independent DNA nanodevice for quantifying chloride ... · A pH independent DNA nanodevice for quantifying chloride transport in organelles of living cells Sonali Saha, Ved Prakash,](https://reader034.vdocuments.site/reader034/viewer/2022050200/5f5373b88b52e155ac17f38d/html5/thumbnails/5.jpg)
5
mM MgCl2, pH adjusted to 4.5 using 1N HCl) for 10 min on ice. The cells were further washed 3 to 4
times with 1X M1 and fixed using 2.5% PFA for 10 min at room temperature. The cells were then washed
3 to 4 times with 1X M1 and imaged. Similarly the S2R+ cells were labelled with 100 nM Tf-FITC or
TfA568 for pH measurement and colocalization assays respectively.
Competition assays: Three different dishes containing hemocytes were prepared. The first dish was
incubated with a mixture of 1 μM ClensorA647 and 10 fold excess of maleylated BSA (+ mBSA) for 5 min.
The second dish was incubated with ClensorA647 alone (- mBSA) for 5 min, and the third dish containing
unlabelled cells was imaged to measure the contribution of auto-fluorescence (AF). The cells were then
chased for 5 min to allow internalization by receptor mediated endocytosis, washed 3 times with 1X M1
and then imaged under a wide-field microscope. Whole cell intensities in the Alexa 647 channel was
quantified for ~ 20 cells per dish. The mean intensity from three different experiments were normalized
with respect to the autofluorescence and presented as the fraction of Clensor internalized.
Four independent dishes containing S2R+ cells were prepared. In the first dish, cells were labelled with a
mixture of 1 μM of Clensor Tf
A647 and 25 μM human holo transferrin (+ Tf). Cells in the second and third
dishes were labelled with 1 μM Clensor Tf
A647 without any exogenously added Tf (- Tf) and 1 μM of
ClensorA647 that lacks Tf aptamer (Clensor) respectively. The fourth dish containing unlabelled cells was
imaged to quantify the contribution of auto-fluorescence (AF). Whole cell intensities in the Alexa 647
channel was quantified for ~ 20 cells per dish. The mean intensity from three different experiments were
normalized with respect to autofluorescence and presented as the amount of ClensorTf
A647 internalized.
Chloride clamping of cells: As described earlier, hemocytes and S2R+ cells were pulsed and chased
with 2 μM of Clensor and ClensorTf
respectively. Hemocytes are then fixed with 200 μL 2.5% PFA for 2
min at room temperature, washed 3 times and retained in 1X M1. To obtain the intracellular chloride
calibration profile, perfusate and endosomal chloride concentrations were equalized by incubating the
previously fixed cells in the appropriate chloride clamping buffer containing a specific concentration of
© 2015 Macmillan Publishers Limited. All rights reserved
![Page 6: A pH-independent DNA nanodevice for quantifying chloride ... · A pH independent DNA nanodevice for quantifying chloride transport in organelles of living cells Sonali Saha, Ved Prakash,](https://reader034.vdocuments.site/reader034/viewer/2022050200/5f5373b88b52e155ac17f38d/html5/thumbnails/6.jpg)
6
chloride (see later), 10 μM nigericin, 10 μM valinomycin, and 10 μM tributyltin chloride (TBT-Cl) for 1 h
at room temperature.
S2R+ cells, pulsed with 2 μM of ClensorTf
are then fixed with 200 μL 2.5% PFA for 20 min at room
temperature, washed 3 times and retained in 1X M1. To obtain the intracellular chloride calibration
profile, perfusate and endosomal chloride concentrations were equalized by incubating the previously
fixed cells in the appropriate chloride clamping buffer containing a specific concentration of chloride (see
later), 10 μM nigericin, 10 μM valinomycin, 5 μM CCCP, 10 μM monensin and 200 nM bafilomycin for
3 h at room temperature.
Chloride calibration buffers containing different chloride concentrations were prepared by appropriately
mixing the 1X +ve chloride buffer (120 mM KCl, 20 mM NaCl, 1 mM CaCl2, 1 mM MgCl2, 20 mM
HEPES, pH, 7.4) and 1X -ve chloride buffer (120 mM KNO3, 20 mM NaNO3, 1 mM Ca(NO3)2, 1 mM
Mg(NO3)2, 20 mM HEPES, pH 7.4) in different ratios.
Chloride measurements: For chloride measurements, hemocytes were pulsed with 2 μM Clensor and
then chased for (i) 5 min (EE), (ii) 60 min (LE) and (iii) 120 min (LY). Each set of cells are then washed
3 to 4 times with 1X M1 and imaged, acquiring images in BAC as well as Alexa 647 channels for each
field of view as described in the image analysis section. To measure chloride concentrations in REs,
S2R+ cell were labelled with ClensorTf
as described as earlier and imaged in two different channels (BAC
and Alexa 647) as described in the image analysis section. A period of 5-10 min was assigned with a
stopwatch, all the images for each time point was captured within this time frame.
pH clamping: For the intracellular pH calibration curve, hemocytes and were labelled with FD10 (2
mg/mL) and I4LY
A488/A647 (1 μM) and S2R+ cells were labelled with Tf-FITC (100 nM). The cells were
then briefly fixed with 200 μL 2.5% PFA for 2 min, washed 3 times and retained in 1X M1. 1X pH
clamping buffer of desired pH (150 mM KCl, 5 mM NaCl, 1 mM CaCl2, 1 mM MgCl2, 20 mM HEPES,
© 2015 Macmillan Publishers Limited. All rights reserved
![Page 7: A pH-independent DNA nanodevice for quantifying chloride ... · A pH independent DNA nanodevice for quantifying chloride transport in organelles of living cells Sonali Saha, Ved Prakash,](https://reader034.vdocuments.site/reader034/viewer/2022050200/5f5373b88b52e155ac17f38d/html5/thumbnails/7.jpg)
7
pH adjusted to 4.5 to 7 appropriately using 1N NaOH or 1N HCl) containing nigericin (10 μM) was
added to the previously fixed cells and incubated for 30 min followed by imaging in the same buffer.
pH measurements: Hemocytes were labelled with a mixture of 1 μM ClensorA647
and FD10 (2 mg/mL)
and chased for (i) 5 min (EE) and (ii) 60 min (LE). For pHLY measurements, hemocytes were labelled
with 1 μM I4LY
A488/A647 and chased for 120 min. Each set of cells were then washed with 1X M1 and then
imaged, acquiring two images for each field of view as described in the image analysis section.
Fluorescence microscope set up: All wide-field images for chloride measurements were acquired using
Olympus IX81 (Olympus, Japan) an inverted microscope illuminated with mercury halide lamp
(Olympus, Japan). Electronic shutters (Uniblitz, model VMM-D1, NY) in the illumination and detection
paths minimized sample illumination. All the images were acquired using a 512×512, iXonEM
CCD
camera (Andor,UK). Cells were viewed using a 100X, 1.3 NA, phase contrast oil immersion objective
(UPlanFLN, Olympus, Japan). Filter wheel, shutter and CCD camera were controlled using Micro-
Manager 1.4.7 software (developed at the University of California, San Francisco). BAC channel images
(referred to as ‘G’) were acquired using 480/20 band pass excitation filter, 535/40 band pass emission
filter and 86023bs-FITC/ Cy5 as dichroic filter. Alexa 647 channel images (referred to as ‘R’) were
obtained using 640/30 band pass excitation filter, 690/50 band pass emission filter and HQ665lp-665 long
pass dichroic filter. G and R images were acquired using 500 msec and 100 msec exposure times
respectively. GFP and YFP fluorescence were viewed using same filter set used for acquiring G images.
Co-localization experiments with TfA568 were performed on an inverted wide field microscope IX81R
(Olympus, Japan) equipped with iXon CCD camera (Andor technology, UK), X-CiteR metal halide lamp
(Olympus, Japan) and coupled to MetaMorph ver 7.7.1.0 (Molecular Devices, PA) for image acquisition.
Fluorescence images of cells labelled with TfA568 were acquired using 545/25 band pass excitation filter,
595/50 band pass emission filter and 89016bs-FITC/Cy3/Cy5 as dichroic filter. All the images were
© 2015 Macmillan Publishers Limited. All rights reserved
![Page 8: A pH-independent DNA nanodevice for quantifying chloride ... · A pH independent DNA nanodevice for quantifying chloride transport in organelles of living cells Sonali Saha, Ved Prakash,](https://reader034.vdocuments.site/reader034/viewer/2022050200/5f5373b88b52e155ac17f38d/html5/thumbnails/8.jpg)
8
obtained with a 100X oil immersion objective with 1.4 NA (UPlanSApo, Olympus, Japan). All excitation,
emission and dichroic filters used in this study were purchased from Chroma technology corp.,USA.
pH measurements were performed by dual excitation method of fluorescein 4 on an inverted wide field
microscope IX81R (Olympus, Japan) equipped with iXon CCD camera (Andor technology, UK), X-
CiteR metal halide lamp (Olympus, Japan) and coupled with MetaMorph ver 7.7.1.0 (Molecular Devices,
PA) for image acquisition. Two sets of images were acquired by exciting the cells using 430/30 (referred
as ‘Ex430’) and 480/30 (referred as ‘Ex480’) band pass excitation filters. In both the cases emissions
were collected using 535/40 band pass emission filter and 89006bs-CFP/YFP/RFP as dichroic filter. For
pH measurements in hemocytes, one extra set of images were acquired in the Alexa 647 channel using
655/20 band pass excitation filter, 710/75 band pass emission filter and 86020bs-FITC/Texas Red®/Cy5
as dichroic filter.
For pH measurements with I4LY
A488/A647, hemocytes were imaged in three channels to yield three images,
(i) donor channel by exciting at 488 nm and collecting at 520 nm (ii) FRET channel by exciting at 488 nm
and collecting at 669 nm and (iv) acceptor channel by exciting at 550 nm and collecting at 669 nm. All
the images for pH measurements were obtained with a 100X oil immersion objective with 1.4 NA
(UPlanSApo, Olympus, Japan). All excitation, emission and dichroic filters used in this study were
purchased from Chroma technology corp.,USA.
Image analysis: Images were analyzed with ImageJ ver 1.47 (NIH, USA). For chloride measurements,
regions of cells containing single well-demarcated endosomes/lysosomes in each Alexa 647 (R) image
were identified and marked manually using ‘elliptical’ selection tools and the coordinates saved in the
ROI plugin in ImageJ. Similarly for background computation, four nearby regions outside each of the
endosomes were marked and saved as ROI. The same regions were identified in the BAC (G) image
recalling the ROIs and appropriate correction factor for chromatic aberration if necessary. The average
background was computed for each selected endosome region from the mean intensity of the three lowest
© 2015 Macmillan Publishers Limited. All rights reserved
![Page 9: A pH-independent DNA nanodevice for quantifying chloride ... · A pH independent DNA nanodevice for quantifying chloride transport in organelles of living cells Sonali Saha, Ved Prakash,](https://reader034.vdocuments.site/reader034/viewer/2022050200/5f5373b88b52e155ac17f38d/html5/thumbnails/9.jpg)
9
of the four selected background regions. After background subtraction, integrated intensity and mean
intensity for each endosome (present in R and G images) were measured and recorded in an OriginPro 8.5
(OriginLab, USA) file. A ratio of R to G intensities (R/G) was obtained from these values by dividing the
integrated intensity of a given endosome in the R image with the corresponding intensity in the G image.
For a given experiment, mean [Clˉ] of an organelle population was determined by converting the mean
R/G value of the distribution to [Clˉ] values according to the intracellular calibration profile. The mean
[Clˉ] value of each organelle population across multiple trials on different days is determined and the final
data is presented as mean of this mean [Clˉ] value ± standard error of the mean. Data for chloride
clamping experiments was analyzed similarly.
Colocalization of GFP/YFP and Alexa 647 or Alexa 568 and Alexa 647 was determined by counting the
numbers of Alexa 647 positive puncta that colocalize with GFP/YFP or Alexa 568 positive puncta and
expressing them as a percentage of the total number of Alexa 647 positive puncta.
Auto-fluorescence was measured on unlabelled cells. For competition assays, first all the images were
subjected to background subtraction by taking mean intensity over a large cell-free area. The cell
boundary was determined from the phase contrast image and stored as ROI in ImageJ. These ROIs were
recalled after opening the fluorescence image and the total cell intensity in Alexa 647 channel was
measured in all dishes.
For pHEE and pHLE measurements in hemocytes Ex480 and Alexa 647 images were overlapped using
ImageJ and endosomes showing colocalization were selected for further analysis. After background
subtraction, endosomes were demarcated in each image and their mean intensity calculated for both
Ex430 and Ex480 images. Ex480 to Ex430 intensity ratio (Ex480/Ex430) was computed from the
integrated intensity of a given endosome in the Ex480 image with the corresponding intensity in the
Ex430 image. Similar analysis was performed to measure pH in S2R+ cells. For a given time point or a
given pH clamping experiment, the mean Ex480/Ex430 was determined for a collection of endosomes.
© 2015 Macmillan Publishers Limited. All rights reserved
![Page 10: A pH-independent DNA nanodevice for quantifying chloride ... · A pH independent DNA nanodevice for quantifying chloride transport in organelles of living cells Sonali Saha, Ved Prakash,](https://reader034.vdocuments.site/reader034/viewer/2022050200/5f5373b88b52e155ac17f38d/html5/thumbnails/10.jpg)
10
The mean Ex480/Ex430 for three experiments were collected and plotted along with s.e.m for a given
experimental condition such as chase time or pH clamp.
For pHLY measurements with I4LY
A488/A647 integrated intensity in each endosome was measured in donor
(D) and FRET (A) channels and D/A ratio of each endosome was obtained. The mean D/A of each
distribution for lysosomes or pH clamped endosomes were converted to pH according to the intracellular
calibration curve. Data was represented as mean pH value ± standard error of the mean.
Immunofluorescence imaging were carried out on the Olympus Fluoview 1000 confocal microscope
(Olympus) using an Argon ion laser for 488 nm excitation and He-Ne laser for 633 excitation with a set
of dichroics, excitation, and emission filters suitable for each fluorophore.
Generation of dsRNA for DmClC-b and DmClC-c gene: Firstly, the cDNA of a region of DmClC-b
(~557 bp) and DmClC-c (~564 bp) gene was PCR-amplified using specific primers to add T7
polymerase-binding sites (Table S5). These ethanol precipitated PCR products were used as templates for
in vitro transcription (IVT). The dsRNA to both genes were synthesized using the Ambion MEGAscript
kit (AM1334, Life Technologies, USA). Each reaction mixture was then precipitated using 3M sodium
acetate and 100% ethanol at -20° C and the pellet was air-dried. The RNA pellet was resuspended in 20
μL of MilliQ water, heated at 65° C for 30 min and then cooled to room temperature to allow annealing of
the strands. The dsRNA was characterized by 1.5% agarose gel to verify the size and integrity, quantified
by UV spectrophotometry and stored at -20° C.
RNAi in S2R+ cells: S2R+ cells were plated in 12 well plates (Greiner Bio-One GmbH, Germany) in
Schneider’s complete media with a seeding density of 106 cells/well. The cells were then allowed to settle
down for 45 min to 1 h. After that, the complete media was removed and ~ 600 μL of Schneider’s
incomplete media containing 7.5 μg of dsRNA was added to the cells and incubated for 1 h. Control cells
were incubated in ~ 600 μL of Schneider’s incomplete media without dsRNA for same time. After 1 h,
© 2015 Macmillan Publishers Limited. All rights reserved
![Page 11: A pH-independent DNA nanodevice for quantifying chloride ... · A pH independent DNA nanodevice for quantifying chloride transport in organelles of living cells Sonali Saha, Ved Prakash,](https://reader034.vdocuments.site/reader034/viewer/2022050200/5f5373b88b52e155ac17f38d/html5/thumbnails/11.jpg)
11
Schneider’s incomplete media was replaced with ~ 600 μL of Schneider’s complete media and incubated
at 25 °C for 4 days. After 96 h the cells were plated for chloride concentration and pH measurements 2-3
h before the assays.
RT-PCR: To check the expression of DmClC-b and DmClC-c, total RNA was isolated from both S2R+
cells and Drosophila 3rd
instar larvae using the Trizol-chloroform method (Invitrogen, USA). Briefly, 1
μg of total RNA was reverse-transcribed using MuMLV reverse transcriptase (Invitrogen, USA) with
oligo dT18 primers. 2 μL of the cDNA was used for a standard PCR using Taq DNA Polymerase (New
England Biolabs, UK). The RT-PCR products were analyzed on a 1.5% agarose gel.
S2R+ cells were labelled with 200 nM Tf-FITC as described earlier. The cells were then washed with 1X
M1 and then imaged, acquiring two images for each field of view as described in the image analysis
section.
Western blot: To isolate total protein for western blot analysis, wild type or transgenic Drosophila 3rd
instar larvae were thoroughly cleaned in double distilled water to remove food. 5-10 larvae were
homogenized using a plastic pestle in 100 μL of homogenizing buffer (40 mM Tris pH 7.4, 1 mM EGTA,
1 mM EDTA, 0.05% Triton X-100) containing 1X protease inhibitor cocktail (Sigma, USA). Then the
sample was heated at 70°C for 10 min and briefly vortexed. Then the sample was spun at 100 g for 2 min
to settle debris. Protein was estimated using BCA assay in 96-well protocol (Thermo Scientific, USA).
An aliquot (~ 100 μg) of each lysate was subjected to 8% SDS-PAGE and transferred to nitrocellulose
using standard protocol. The nitrocellulose membrane was cut into two parts. One part was incubated
with a 1:100 dilution of a custom raised rabbit anti-DmClC-b antibody against the N-ter 14 aa sequence
of DmClC-b (Abmart, Chaina) and another part was incubated with 1:500 dilution of rabbit anti-CLCN3
antibody (Abcam) overnight at 4 °C. Then both the membranes were washed and probed with 1: 3000
dilution of HRP conjugated goat anti-rabbit antibody (Abcam) for 1 h at room temperature. Binding of
primary antibody was detected by the ECL method (Pierce) according to the manufacturer’s instructions.
© 2015 Macmillan Publishers Limited. All rights reserved
![Page 12: A pH-independent DNA nanodevice for quantifying chloride ... · A pH independent DNA nanodevice for quantifying chloride transport in organelles of living cells Sonali Saha, Ved Prakash,](https://reader034.vdocuments.site/reader034/viewer/2022050200/5f5373b88b52e155ac17f38d/html5/thumbnails/12.jpg)
12
Those membranes were further stripped using a mild stripping protocol and re-probed for tubulin using
1:5000 dilution of anti-tubulin antibody (Abcam).
Immunofluorescence staining: S2R+ cells were transfected with GFP-Rab5 / YFP-Rab7 / LAMP1-GFP/
YFP-Rab11 using Effectene (Qiagen). Immunofluorescence staining was carried out on S2R+ cells
transiently expressing GFP-Rab5 / YFP-Rab7 / LAMP1-GFP/ YFP-Rab11 after fixing the cells with 2.5%
paraformaldehyde for 20 min at room temperature. To detect intracellular antigens, the cells were
permeabilized with 0.37 % NP-40 (Sigma) in 1X M1 buffer. Non specific antibody binding was blocked
using 5% BSA (Sigma) in 1X M1 for 1.5 h at room temperature. The cells were then either stained with
rabbit anti-DmClC-b (Abmart, China) or rabbit anti-CLCN3 antibody (Abcam) for overnight at 4 °C
followed by incubation with Alexa 647 conjugated goat anti-rabbit (Invitrogen, USA) secondary antibody
for 1 h at room temperature. The cells were then imaged in a confocal microscope.
FRET and FLIM measurements: To quantitate the amount of dissociation of BAC-PNA if any from
Clensor, J774 cells were pulsed with 5 µM ClensorN-5ʹ
or ClensorN-3ʹ
in M1 buffer (pH 7.4) for 30 min at
37oC. Cells were then washed with PBS followed by a brief fixation using 2.5% PFA for 2 min at RT.
Cells were again washed with PBS and were clamped at pH 5 and 5 mM chloride for 1 hour.
Fluorescence images were acquired for BAC (λEx = 430/24 nm, λEm = 520/40 nm), Atto 565 (λEx = 545/25
nm, λEm = 595/50 nm) and FRET (λEx = 430/24 nm, λEm = 595/50 nm).
Mean autofluorescence in the FRET and acceptor channels were measured from unlabelled cells
subjected to identical conditions. These mean values were subtracted from whole cell intensity data
followed by calculation of FRET/A value for each cell. To compare these values to in vitro values, a drop
of 1μM ClensorN-5ʹ
or ClensorN-3ʹ
in pH 5 and 5 mM chloride clamping buffer was imaged under identical
imaging settings and corresponding FRET/A values were calculated.
In vitro temperature dependent fold change of FRET Clensor: 10 μM stock of ClensorN-5ʹ
or ClensorN-
3ʹwas diluted to a final concentration of 200 nM in pH 5 and 10 mM chloride clamping buffer and
© 2015 Macmillan Publishers Limited. All rights reserved
![Page 13: A pH-independent DNA nanodevice for quantifying chloride ... · A pH independent DNA nanodevice for quantifying chloride transport in organelles of living cells Sonali Saha, Ved Prakash,](https://reader034.vdocuments.site/reader034/viewer/2022050200/5f5373b88b52e155ac17f38d/html5/thumbnails/13.jpg)
13
incubated for 30 min at room temperature prior to experiments. Emission spectra was acquired by
exciting the samples at λEx = 435/5 nm and λEm = 450-700 nm at RT and 70 oC. An emission value of pH
5 and 10 mM chloride clamping buffer served as blank and was subtracted from relevant acquired spectra.
DDIR/AFRET values (DDIR, λEx = 435/5 nm and λEm = 505/5 nm; AFRET, λEx = 435/5 nm andλEm = 590/5 nm)
were calculated and were used for comparison of ClensorN-5ʹ
or ClensorN-3ʹ
.
Statistical analysis of R/G values: Mann–Whitney U test were used to check the statistical significance
of the R/G distributions. Statistical significance level was set to P < 0.05 and marked as asterisks (*) in
the figures. All data were analyzed using online Mann-Whitney U-value Calculator
(http://www.socscistatistics.com/tests/mannwhitney/).
Name Sequence Comment
P BAC-NHε-Lys-ATC AAC ACT GCA-Lys-COOH PNA strand: Sensing module
D2 5′ TATATATA GGATCTTGCTGTCTGGTG TGC AGT GTT GAT 3′ DNA strand: Normalizing module; internal Alexa
647 modification on the T shown in bold
D1 5′CACCAGACAGCAAGATCC TATATATA 3′ DNA strand: Targeting module
D1Tfapt5ʹ
CACCAGACAGCAAGATCCTATATATAGGGGGAUCAAUCCAAGGGA
CCCGGAAACGCUCCCUUACACCCC 3ʹ
DNA RNA hybrid strand : Targeting module with
RNA aptamer against human transferrin
receptor.
I4 5ʹ
GACTCACTGTTTGTCTGTCGTTCTAGGATATATATTTTGTTATGTGTTA
TGTGTTAT 3ʹ
DNA strand: internal Alexa 647 modification on
the T shown in bold
I4ʹ 5ʹ
CCCCTAACCCCTAACCCCTAACCCCATATATATCCTAGAACGACAGAC
AAACAGTGAGTC 3ʹ
DNA strand: 5ʹ Alexa 488 modification
Clensor and ClensorTf sequences
Supplementary Table S1 | Sequences used for Clensor, ClensorTf and I4LYA488/A647 assemblies.
Oligo P, Oligo D1 and Oligo D2 combine to form Clensor. Oligo P, Oligo D1Tfapt and Oligo D2
combine to form ClensorTf. The sequences in matching colors are complementary. D1Tfapt a 69-
mer RNA-DNA hybrid sequence. The portion of the sequence in black correspond to the RNA
aptamer against human transferrin receptor, bold letters indicate 2ʹ fluoro modified bases.
Bases shown in green correspond to a DNA segment.
© 2015 Macmillan Publishers Limited. All rights reserved
![Page 14: A pH-independent DNA nanodevice for quantifying chloride ... · A pH independent DNA nanodevice for quantifying chloride transport in organelles of living cells Sonali Saha, Ved Prakash,](https://reader034.vdocuments.site/reader034/viewer/2022050200/5f5373b88b52e155ac17f38d/html5/thumbnails/14.jpg)
14
a b c
Supplementary Figure S1 | Gel mobility shift assay showing the formation of Clensor and
ClensorTf. a, 10% Native PAGE run in 1X TBE buffer (pH 8.3) at 4°C. Lane 1: D1Tfapt, 2: D2, 3:
D1+D2 (Clensor-P), 4: D1+D2+P (Clensor). b, 10% Native PAGE run in 1X TBE buffer (pH 8.3)
at 4°C. Lane 1: D1, 2: D2, 3: D1+D2 (Clensor-P), 4: D1+D2+P (Clensor), 5: D1Tfapt+D2. c, 15%
Native PAGE run in 1X TBE buffer (pH 8.3) at 4 °C. Lane 1: D1Tfapt+D2 (ClensorTf-P), 2:
D1Tfapt+D2+P.
Formation of Clensor and ClensorTf
: The formation of Clensor and ClensorTf
was confirmed by a gel
mobility shift assay using native polyacrylamide gel electrophoresis (PAGE) (Fig. S1). To see whether P,
D1 and D2 could associate to form Clensor, we annealed 10 μM of all three components in equimolar
ratios in 10 mM Sodium phosphate buffer, pH 7.4 and investigated the sample by PAGE. The formation
of Clensor (Fig. S1a, lane 4) was revealed by its lower electrophoretic mobility with respect to its
component single strands (Fig.S1a, lane 1 and 2) and all possible bimolecular complexes (Fig. S1a, lane
3). Similarly, we annealed 10 μM each of P, D1Tfapt and D2 in 10 mM Sodium phosphate buffer, pH 7.4
and analyzed the sample by PAGE. ClensorTf
showed a band with significantly reduced mobility (Fig.
S1c, lane 2) as compared to its component single strands and all possible bimolecular complexes (Fig.
S1b, lane 1, 2 and 5; Fig. S1c, lane 1) confirming the formation of ClensorTf
in excellent yield. Due to the
© 2015 Macmillan Publishers Limited. All rights reserved
![Page 15: A pH-independent DNA nanodevice for quantifying chloride ... · A pH independent DNA nanodevice for quantifying chloride transport in organelles of living cells Sonali Saha, Ved Prakash,](https://reader034.vdocuments.site/reader034/viewer/2022050200/5f5373b88b52e155ac17f38d/html5/thumbnails/15.jpg)
15
0 50 100 150 200
1
2
3
4
5 Clensor, pH 5
No
rma
lize
d R
/G
[Cl-](mM)
a b
0.0
0.5
1.0
1.5
2.0
2.5
3.0
pH 5.0
Fo
ld C
ha
ng
e
(Be
twe
en
0-1
20
mM
Cl- )
pH 7.4
U
W
small but significant mobility difference between the D2+D1Tfapt and ClensorTf
, we could not analyze
component single strands, bimolecular complex and ClensorTf
on 10% native PAGE. However, the
bimolecular complexes and ClensorTf
were resolved clearly in 15 % native PAGE with a 9 h run time.
Supplementary Figure S2 | In vitro characterization of Clensor (200 nM) as a function of
pH. a, Clˉ calibration profile of Clensor showing Alexa 647/BAC fluorescence intensity ratio
(R/G) versus [Clˉ] in 1X pH clamping buffer of pH 5. b, In vitro fold change in R/G ratios of
Clensor at 0 mM to 120 mM Clˉ measured at pH 7.4 and pH 5.0. Error bars indicate the mean of
three independent experiments ± s.e.m.
Effect of pH on chloride sensitivity of Clensor: To study the effect of pH on the chloride sensitivity of
Clensor, fluorescence spectra of Clensor (200 nM) were recorded in 1X modified pH clamping buffer
(buffer Clˉ replaced with NO3ˉ), pH 5 containing different added [Cl−] ranging from 5 mM to 200 mM.
The plot of normalized R/G as a function of [Cl−] indicates that Clensor, at pH 5, varies linearly with Clˉ
from 0 -200 mM with negligible change in its Clˉ sensitivity compared to pH 7.4 (Fig. S2a). The in vitro
fold change in R/G ratios of Clensor within 1 mM to 120 mM Clˉ concentration at pH 5 is similar to that
observed at pH 7.4 (Fig. S2b) indicating that the Clˉ sensitivity of Clensor is pH independent. The
denominator in the R/G is chloride sensitive whereas the numerator remains constant at different chloride
© 2015 Macmillan Publishers Limited. All rights reserved
![Page 16: A pH-independent DNA nanodevice for quantifying chloride ... · A pH independent DNA nanodevice for quantifying chloride transport in organelles of living cells Sonali Saha, Ved Prakash,](https://reader034.vdocuments.site/reader034/viewer/2022050200/5f5373b88b52e155ac17f38d/html5/thumbnails/16.jpg)
16
Clensor ClensorTf
a b
concentrations similar to the F0/F ratio in the Stern-Volmer equation. Therefore, R/G vs [Clˉ] plot is
equivalent to F0/F vs [Clˉ] plot or the Stern-Volmer plot.
Comparison of BAC with other chloride sensitive small molecule: BAC is the best candidate for a
chloride sensitive small molecule for chloride measurements of subcellular compartments5. (1) It is
bioconjugatable and hence can be targeted to specific intracellular locations, ii) it can be excited in the
visible range and (iii) it can sense chloride over a wide range (0-200 mM) of chloride. Compared to BAC,
most other chloride-sensitive fluorophores are not bioconjugatable6. An attempt to make them
bioconjugatable often leads to loss of their chloride sensitivity. For example, lucigenin, the precursor
molecule of BAC has very high chloride sensitivity with Stern-Volmer constant for the collisional
quenching of 390 M-1
which decreases around 10 fold in case of BAC conjugated to dextran (36 M-1
)5,7
.
Most of them are excited at wavelengths in the UV range and not suitable for live cell imaging7. Their
limited range of chloride sensitivity has been an issue to measure high chloride concentrations8.
Supplementary Figure S3 | Clensor and ClensorTf integrity are maintained post-
endocytosis. a, Hemocytes were pulsed with Clensor (2 μM, 50 μL) for 5 min and chased for 2
h and imaged. Quantitative colocalization of BAC (green) and Alexa 647 (red) upto 2 h post
internalization in distinct punctate endosomes reflects Clensor integrity. Scale bar: 10 μm. b,
S2R+ cells were pulsed with ClensorTf (2 μM, 50 μL), chased for 15 min and then imaged under
© 2015 Macmillan Publishers Limited. All rights reserved
![Page 17: A pH-independent DNA nanodevice for quantifying chloride ... · A pH independent DNA nanodevice for quantifying chloride transport in organelles of living cells Sonali Saha, Ved Prakash,](https://reader034.vdocuments.site/reader034/viewer/2022050200/5f5373b88b52e155ac17f38d/html5/thumbnails/17.jpg)
17
a wide field microscope. Quantitative colocalization of BAC (green) and Alexa 647 (red) in
distinct punctate endosomes reflects ClensorTf integrity post-internalization. Scale bar: 10 μm.
0 50 100 150 200 2500.8
1.2
1.6
2.0
2.4
[Cl -] (m
M)
Time (min)
(E
x480/
Ex430)
Bafilomycin
20
40
60
80
100
120
60 min
Bafilomycin
20 mM
110 mM
[Cl-]
5 min 120 min
a b
Supplementary Figure S4| Integrity of Clensor during endo-lysosomal maturation. a, Plot
showing endo-lysosomal [Clˉ] (blue trace) and (Ex
480/Ex
430) ratios indicating endo-lysosomal
pH as a function of time (black trace). Red arrow head indicates time of was added external
addition of bafilomycin. Error bars indicate the mean of three independent experiments ± s.e.m.
(n >25 cells, ≥75 endosomes) b, Representative pseudocolour R/G map of hemocytes labelled
with Clensor and imaged at the indicated chase times before and after addition of bafilomycin
shown by red arrow head. Scale bar: 10 μm.
Integrity of Clensor during endo-lysosomal maturation: We confirmed the integrity of Clensor and the
photostability of BAC in the intracellular environment over 120 min of endosomal/lysosomal maturation,
using the following assay. Compartmental [Clˉ] and [H+] were depleted by the addition of bafilomycin at
45 min post endocytosis in macrophages 9. Therefore, bafilomycin was used to perturb endosomal [Clˉ]
and these perturbations were followed by changes in R/G ratios in Clensor labelled endosomes of
hemocytes. pH was simultaneously measured in this system by pulsing with 2 mg/mL 10 kDa FITC-
dextran (FD10) for 5 min at room temperature and chased for 120 min at 20 °C. The cells were then
© 2015 Macmillan Publishers Limited. All rights reserved
![Page 18: A pH-independent DNA nanodevice for quantifying chloride ... · A pH independent DNA nanodevice for quantifying chloride transport in organelles of living cells Sonali Saha, Ved Prakash,](https://reader034.vdocuments.site/reader034/viewer/2022050200/5f5373b88b52e155ac17f38d/html5/thumbnails/18.jpg)
18
incubated with 1X M1 buffer containing 200 nM bafilomycin followed by a 120 min chase at 20 °C in the
same buffer. Intracellular pH was measured by the dual excitation method. Ex480/Ex 430 emission
ratios show ~2.1 fold decrease as a function of time till 120 min post endocytosis, indicating the expected
decrease in pH (Fig. S4a, black) 9. Upon bafilomycin treatment, endosomal pH is reversed as given by
gradual increase (~2.2 fold) in Ex480/Ex 430 emission ratios (Fig. S4a, black).
Independently, changes in [Clˉ] were mapped by pulsing hemocytes with Clensor for 5 min at
room temperature and followed by 120 min chase at 20 °C. We observed a decrease in R/G ratios as a
function of time till 120 min post endocytosis, corresponding to a change in mean endosomal [Clˉ] from
~37.1 mM to ~108.5 mM that then remained quite constant till 180 min, when bafilomycin was added in
the external buffer (Fig. S4a, blue). After bafilomycin treatment, R/G ratios gradually decreased
indicating the reversal of endosomal [Clˉ] (Fig. S4a, blue). Here the decrease in R/G ratios or the recovery
of BAC fluorescence indicates that reduction in BAC fluorescence was not due to photobleaching but due
to collisional quenching by Clˉ present in the lumen of endosomal compartment. Fig. S4b shows the
representative pseudocolour R/G map of hemocytes during the time course of this experiment.
Additionally, colocalization of BAC and Alexa 647 in the endosomal compartments during the time
course of this experiment indicate the integrity of the Clensor scaffold. To overcome the issue of
photobleaching, same dishes were not imaged continuously. Instead, multiple dishes were chased for
different time period with or without bafilomycin treatment over the full duration of the assay.
Quantitative imaging to probe chemical integrity of Clensor: Using a set of quantitative imaging
experiments that utilizes the difference in photophysical properties of BAC-PNA alone, and BAC-PNA
when it hybridized to the Clensor scaffold, we show negligible Clensor dissociation in endosomes of
cells on the timescales of the study outlined in this manuscript. These include quantitative FRET and
FLIM experiments outlined below. Chemical integrity of dsDNA domain in Clensor (Fig. S5a, black
rectangle) has already been probed in a previous study from our lab 11
.
© 2015 Macmillan Publishers Limited. All rights reserved
![Page 19: A pH-independent DNA nanodevice for quantifying chloride ... · A pH independent DNA nanodevice for quantifying chloride transport in organelles of living cells Sonali Saha, Ved Prakash,](https://reader034.vdocuments.site/reader034/viewer/2022050200/5f5373b88b52e155ac17f38d/html5/thumbnails/19.jpg)
19
1. FRET reveals negligible Clensor disintegration within lysosomes: To measure the extent of
any dissociation of BAC-PNA from Clensor, we performed a quantitative FRET-based assay. A variant
of Clensor called ClensorN-3'
carrying a FRET pair was designed (Fig. S5b). Here, an acceptor dye
(Atto565) was attached to the 3ʹ terminus of D2 (with an inter-fluorophore distance of < 3 nm) such that it
undergoes efficient FRET with the BAC label on BAC-PNA. As a non-FRET control, we designed
ClensorN-5'
where the Atto 565 label was placed on the 5ʹ terminus, ~11 nm away from the BAC label,
well beyond the regimes conducive for FRET. ClensorN-5'
in endosomes serves as a mimic of a scenario
where BAC-PNA is dissociated from Clensor in the endosome and is somehow trapped in the endosome
along with the normalizing flourophore in a specific ratio, and thereby still able to give an accurate [Clˉ]
read-out, despite the DNA nanodevice having disintegrated.
0.0
0.5
1.0
1.5
No
rma
lize
dA
FR
ET
/AD
IR
Atto 565 AFRET/ADIR
0 1 20
5
10
15
20
Fre
qu
en
cy
AFRET/ADIR
ClensorN-5'
0 1 20
5
10
15
20
Fre
qu
en
cy ClensorN-3'
da
ClensorN-3' ClensorN-5'
c
e
P
D1D2
P
D1D2
D1 D2
P
Clensor
b
Cle
nso
rN-3
' C
len
so
rN-5
'
Supplemenatry Figure S5 | In cellulo integrity of Clensor. a, Dotted rectangle indicates
dsDNA domain of Clensor. b, Design of FRET Clensor. P: sensing module (pink line) containing
BAC (green filled star); D2: normalizing module containing acceptor, Atto 565 (red filled circle)
at 3ʹ (ClensorN-3ʹ) or 5ʹ end (ClensorN-3ʹ) of D2. c, in vitro fold change in AFRET/ADIR for two
constructs. d, Atto 565 channel and corresponding pseudocolour AFRET/ADIR map of J774 cells
© 2015 Macmillan Publishers Limited. All rights reserved
![Page 20: A pH-independent DNA nanodevice for quantifying chloride ... · A pH independent DNA nanodevice for quantifying chloride transport in organelles of living cells Sonali Saha, Ved Prakash,](https://reader034.vdocuments.site/reader034/viewer/2022050200/5f5373b88b52e155ac17f38d/html5/thumbnails/20.jpg)
20
pulsed with ClensorN-3ʹ or ClensorN-5ʹ, clamped at 5 mM Clˉ and pH 5. e, Histograms showing
typical spread of AFRET/ADIR values of whole cells clamped at 5 mM Clˉ and pH 5. (n> 30 cells).
Fluorescence images were acquired for BAC (λEx = 430/24 nm, λEm = 520/40 nm), Atto 565 (λEx
= 545/25 nm, λem = 595/50 nm) and FRET (λEx = 430/24 nm, λEm = 595/50 nm). Scale bar 10
μm.
ClensorN-3'
shows higher AFRET/ADIR value while ClensorN-5'
shows a lower AFRET/ADIR value (AFRET =
intensity in the acceptor channel when exciting BAC; ADIR = intensity in the acceptor channel upon direct
excitation of Atto565) (Fig. S5d). A quantitative measure of a fully associated nanodevice, with
quantitative retention of structural integrity, is given by the ratio of AFRET/ADIRvalues between ClensorN-
3'to Clensor
N-5'. In vitro, this corresponds to an AFRET/ADIR value of 1.4 (Fig. S5c). All the FRET
measurements in vitro and in cellulo were done in clamping buffer, pH 5 (to mimic lysosomal pH) and 5
mM Clˉ, to enhance BAC fluorescence in order to have efficient FRET. Next, J774 cells were labelled
with either 5 µM ClensorN-5ʹ
or ClensorN-3ʹ
and clamped as described in methods section. Fluorescence
images were acquired in the Atto channel (λem = 595/50 nm) by direct excitation (ADIR, λex = 545/25 nm)
and by FRET (AFRET, λex = 430/24 nm). Whole cell intensities in the ADIR and AFRET channels were each
background subtracted from autofluorescence levels (values obtained from unlabelled cells under the
excitation and emission conditions). A ratio of background corrected AFRET/ADIR values for n >30 cells of
ClensorN-3'
to ClensorN-5'
was ~1.4, indicating no detectable dissociation of BAC-PNA from ClensorN-3ʹ
within endosomes of cells on the timescales employed in this entire study (Fig. S5e).
We provide the thermal melting profile of the sensing module of Clensor that indicates a very high Tm
(~78 oC) (Fig. S6a). This was a critical, primary consideration in the choice of duplex sequence that went
into the design of Clensor12
. In fact, DDIR/AFRET values (DDIR, λEx = 435/5 nm and λEm = 505/5 nm; AFRET,
λEx = 435/5 nm and λEm = 590/5 nm) of ClensorN-3'
to ClensorN-5'
showed an in vitro value close to 2.2 at
© 2015 Macmillan Publishers Limited. All rights reserved
![Page 21: A pH-independent DNA nanodevice for quantifying chloride ... · A pH independent DNA nanodevice for quantifying chloride transport in organelles of living cells Sonali Saha, Ved Prakash,](https://reader034.vdocuments.site/reader034/viewer/2022050200/5f5373b88b52e155ac17f38d/html5/thumbnails/21.jpg)
21
RT and ~2.3 even at 70 oC, indicating negligible thermal denaturation at this high temperature (Fig. S6b).
This is consistent with the observed integrity of the device at room temperature in cells.
Supplemenatry Figure S6 | In vitro integrity of Clensor. a, in vitro UV melt of D2+P duplex.
b, comparison of fold change in DDIR/AFRET at RT and 70oC (DDIR, λEx = 435/5 nm and λEm = 505/5
nm; AFRET, λEx = 435/5 nm and λEm = 590/5 nm).
2. FLIM reveals that free BAC-PNA cannot be retained in endosomes: To mimic conditions
where Clensor is dissociated and to illustrate the fundamentally different behavior of BAC-PNA post-
disintegration from the Clensor scaffold, 100 µM BAC-PNA in M1 buffer (pH 7.4) was pulsed for 30 min
at 37oC in J774 cells, washed with PBS, briefly fixed (2.5% PFA for 2 min) at RT and clamped at pH 5
and 5 mM Clˉ as described. Confocal FLIM (Fluorescence Lifetime Imaging Microscopy) images of cells
were acquired on Nikon ISS Alba (λEx= 448 nm, λEm = 530/43 nm, frequency modulation of 20-140 MHz
with peak counts of ~1000). Identical images were obtained from unlabelled J774 cells. A comparison of
BAC-PNA labelled J774 cells with autofluorescence of unlabelled cells shows a marked difference in
intensity and labelling pattern (Fig. S7a, b). BAC-PNA “paints” the entire cytoplasm, along with
significant enrichment in the nucleolus (Fig. S7a, c). This is in dramatic contrast to the punctate pattern
seen in the autofluorescence image (Fig. S7b, d). In all our studies deploying Clensor in J774 cells and
0
1
2
No
rmalized
DD
IR/A
FR
ET
a
RT 70oC
b
40 50 60 70 80 900.435
0.440
0.445
0.450
0.455 1 M D2+P
A2
60
Temperature (C)
© 2015 Macmillan Publishers Limited. All rights reserved
![Page 22: A pH-independent DNA nanodevice for quantifying chloride ... · A pH independent DNA nanodevice for quantifying chloride transport in organelles of living cells Sonali Saha, Ved Prakash,](https://reader034.vdocuments.site/reader034/viewer/2022050200/5f5373b88b52e155ac17f38d/html5/thumbnails/22.jpg)
22
hemocytes, we have never observed BAC intensity in the nucleolus, which one anticipates as a clear
indicator of Clensor dissociation.
The molecular identity of the fluorophore in BAC-PNA labelled cells was obtained from the lifetimes
(Fig. S7e-h). The long lifetime component of BAC-PNA stained cells was found to be 6.7 ± 1.1 ns and is
notably different from the long lifetime component of autofluorescence (4.5 ± 0.7 ns) (Table S2). Further,
the in vitro FLIM of a solution of 1µM BAC-PNA in 5 mM chloride clamping buffer, pH 5 obtained
under identical instrument settings yielded a long lifetime component of 7.3 ± 0.5 ns. This was consistent
with the in cellulo data within experimental error. The short lifetime component in vitro for BAC-PNA is
due to Photoinduced Electron Transfer (PET) from PNA nucleobases 13–15
. Taken together this data
confirms(i) negligible Clensor dissociation in endosomes of cells, and (ii) that if BAC intensity is
observed in an endosome, it arises from BAC-PNA which is hybridized to its complementary DNA strand
on Clensor.
c d
g h
a b
e f
Supplemenatry Figure S7 | Subcellular localization of BAC-PNA. Comparison of J774 cells
labelled with BAC-PNA (100 μM) and unlabelled cells clamped at 5 mM Chloride and pH 5. a,
Raw fluorescence intensity for BAC-PNA labelled cells. b, Raw fluorescence intensity for
unlabelled cells. c, Zoom in of a. d, Zoom in of b. e, long fluorescence lifetime component for
© 2015 Macmillan Publishers Limited. All rights reserved
![Page 23: A pH-independent DNA nanodevice for quantifying chloride ... · A pH independent DNA nanodevice for quantifying chloride transport in organelles of living cells Sonali Saha, Ved Prakash,](https://reader034.vdocuments.site/reader034/viewer/2022050200/5f5373b88b52e155ac17f38d/html5/thumbnails/23.jpg)
23
0
20
40
60
80
100
120 min60 min5 min
% o
f c
olo
ca
liza
tio
n
YFPRab5
YFPRab7
GFPLAMP
BAC-PNA labelled cells. Scale bar 10 μm. f, long fluorescence lifetime component for unlabelled
cells. g, Zoom in of c. scale bar 5 μm. h, Zoom in of d.
Supplementary Table S2| Comparison fluorescence lifetimes of BAC-PNA and
autofluorescence clamped at 5 mM Clˉ and pH 5.8 Frame average and 8 pixel binning was done
to improve S/N ratio and individual pixels were fitted to multiexponential functions. The
goodness of fit was determined by using the reduced χ2 values. Data acquisition and processing
were utilized Vista Vision version 4.1.031.08 software. Uncertainties in the phase and
modulation values were 0.2 and 0.004, respectively. Instrument was calibrated against
fluorescein in 0.1 M NaOH.
Supplementary Figure S8 | Trafficking of Clensor (ClensorA647
) in Drosophila hemocytes
isolated from flies expressing YFP-Rab5, YFP-Rab7 and GFP-LAMP at the indicated chase
times. Percentage colocalization of ClensorA647
with fluorescent protein-tagged endosomal
SampleIndividual lifetime components and
populationsAverage lifetime (ns)
In vitro BAC-PNA 2.1 1.6 (0.47 0.21), 7.3 0.5 (0.53 0.21) 7.0 0.3
In cellulo BAC-PNA 1.4 0.7 (0.76 0.06), 6.7 1.1 (0.24 0.06) 4.9 0.8
Autofluorescence 1.3 0.4 (0.27 0.09), 4.5 0.7 (0.73 0.09) 3.2 0.4
© 2015 Macmillan Publishers Limited. All rights reserved
![Page 24: A pH-independent DNA nanodevice for quantifying chloride ... · A pH independent DNA nanodevice for quantifying chloride transport in organelles of living cells Sonali Saha, Ved Prakash,](https://reader034.vdocuments.site/reader034/viewer/2022050200/5f5373b88b52e155ac17f38d/html5/thumbnails/24.jpg)
24
markers (Rab5, EE, black bars; Rab7, LE/LY, white bars; LAMP, LY, gray bars) at indicated
times (n >10 cells, ~75 endosomes). Error bars indicate the mean of three independent
experiments ± s.e.m.
Trafficking of Clensor in Drosophila hemocytes: To follow endosomal maturation along the ALBR
pathway, we determined the residence times of internalized Clensor in compartments along the endo-
lysosomal pathway namely early endosomes (EEs), late endosomes (LEs) and lysosomes (LYs).
Therefore, time-course experiments were performed with a Clensor scaffold carrying only Alexa 647
called ClensorA647, in Drosophila hemocytes expressing fluorescent fusions of well-known endocytic
compartment markers such as YFP-Rab5 for EEs, YFP-Rab7 for LEs/LYs and GFP-LAMP for LYs 16
.
Initially, ClensorA647 shows negligible colocalization (~12%) with LAMP that gradually increases and
reaches a maximum at 120 min (~84%) (Fig. S8). At 5 min, ClensorA647 shows highest colocalization with
Rab5 (~78%) that decays with increasing time (Fig. S8). However, colocalization with Rab7 is negligible
at 5 min and saturates at 60 min (~78%) (Fig. S8). This reveals that in Drosophila hemocytes, Clensor is
resident predominantly in the EEs, LEs and LYs at 5 min, 60 min and 120 min respectively. Fig. 2b
shows representative co-localization images in hemocytes between the indicated fluorescent endosomal
marker and ClensorA647 at the indicated chase times, consistent with previous studies 10
.
© 2015 Macmillan Publishers Limited. All rights reserved
![Page 25: A pH-independent DNA nanodevice for quantifying chloride ... · A pH independent DNA nanodevice for quantifying chloride transport in organelles of living cells Sonali Saha, Ved Prakash,](https://reader034.vdocuments.site/reader034/viewer/2022050200/5f5373b88b52e155ac17f38d/html5/thumbnails/25.jpg)
25
0
12
A647 R/G
5mM
80mM
- fixation + fixation- fixation + fixation
0.0
0.5
1.0
1.5
2.0
J774 - Fix
J774 + Fix
Hemocytes - Fix
Hemocytes + Fix
Fo
ld C
ha
ng
e (
5 m
M -
80 m
M)
In vitro
a b
c d
Supplementary Figure S9 | Chloride clamping with or without fixation. a, Representative
bright field images of Drosophila hemocytes after incubation in chloride clamping buffer
containing 10 µM nigericin, 10 µM valinomycin and 10 µM TBT-Cl for 1 h, without (-fixation) and
with mild fixation (+fixation). Scale bar: 10 µm; b, Representative bright field images of J774
macrophages after incubation in chloride clamping buffer containing 10 µM nigericin, 10 µM
valinomycin and 10 µM TBT-Cl for 1 h, without (-fixation) and with mild fixation(+fixation). Scale
bar: 10 µm; c,Alexa 647 channel and respective pseudocolour R/G map of J774 macrophages
pulsed with Clensor and clamped at 5 mM and 80 mMClˉ. Scale bar: 5 μm. Macrophages were
pulsed with Clensor (2 μM, 50 μL) for 45 min, fixed and clamped at [Clˉ] values 5 mM and 80
mM through the external addition of 10 μMnigericin, 10 μMvalinomycin and 10 µM TBT-Clˉ.
© 2015 Macmillan Publishers Limited. All rights reserved
![Page 26: A pH-independent DNA nanodevice for quantifying chloride ... · A pH independent DNA nanodevice for quantifying chloride transport in organelles of living cells Sonali Saha, Ved Prakash,](https://reader034.vdocuments.site/reader034/viewer/2022050200/5f5373b88b52e155ac17f38d/html5/thumbnails/26.jpg)
26
Cells were incubated for 1 h and then imaged on a wide field microscope. Scale bar: 5 μm. d,
Comparison of fold change in R/G ratios of Clensor at 5 mM and 80 mMClˉ in vitro, in
hemocytes fixed (+Fix) and unfixed (-Fix)and in J774 macrophages fixed (+Fix) and unfixed (-
Fix).
Justification of fixation prior to chloride clamping: Live cells maintain specific cytosolic and intra-
organellar ionic concentrations for their proper function. Therefore enforcing an equilibration (i.e.,
clamping) of ionic concentrations of the extracellular and intracellular milieu in order to calibrate a probe
is, by definition, a non-physiological condition – whether it is in a “live”, unfixed state or a fixed state. It
is well documented that cell health deteriorates rapidly post-exposure to the ionophores such as nigericin
and tributyltin chloride (TBT-Cl) 17,18
. Infact, PC12 cells treated with 5 µM TBT-Cl for 1 h shows nearly
100% cytotoxicity 19
. Therefore after 1 h of incubation with 10 µM nigericin, 10 µM valinomycin and 10
µM TBT-Cl for chloride clamping, anyway the relevant Drosophila cells would not be expected to be
‘alive’.
We have performed our clamping experiments in Drosophila hemocytes. Hemocytes are primary cells
that are loosely adherent in nature. When incubated with ionophores for 1 -3 h without a priori fixation,
hemocyte morphology and adherence to the supporting surface was remarkably poor compared to the
hemocytes that were mildly fixed before the same procedure (Fig. S9a). Typically dying hemocytes round
up and detach from the surface and these observations support that chloride clamping is indeed toxic to
these cells. However, we found that mildly fixing hemocytes using 2.5% paraformaldehyde for 2 min at
room temperature helped preserve cell morphology and as well as retain cell adherence resulting in large
numbers of labelled cells to obtain meaningful statistics. In fact, in the literature, pH clamping studies to
evaluate different kinds of pH probes in Drosophila hemocytes and S2R+ cells incorporates a mild
fixation protocol for precisely the above reasons 10,20
.
© 2015 Macmillan Publishers Limited. All rights reserved
![Page 27: A pH-independent DNA nanodevice for quantifying chloride ... · A pH independent DNA nanodevice for quantifying chloride transport in organelles of living cells Sonali Saha, Ved Prakash,](https://reader034.vdocuments.site/reader034/viewer/2022050200/5f5373b88b52e155ac17f38d/html5/thumbnails/27.jpg)
27
There is no literature report for the chemical modification of lucigenin (precursor of BAC) or BAC in
presence of paraformalhedyde. In fact, the only functional groups on BAC are the quinolinium nitrogen
and the carboxy moiety, neither of which are reactive to formaldehyde or any of its polymeric forms
under these aqueous reaction conditions. The quantitative overlap between the in vitro and intracellular
calibration profile for Clensor (that normalizes to an independent fluorophore such as Alexa 647)
confirms that fixation protocol does not affect the chloride-sensitive module of Clensor (i.e., BAC).
Similar correspondence between in vitro and intracellular calibration profile was also observed for a
DNA-based pH sensor, in hemocytes where the cells were subjected to a similar fixation protocol prior to
pH clamping 10
.
The Verkmann group has performed chloride clamping without fixation on cell lines such as J774.1
macrophages and CHO cells that much more robust and strongly adherent5,9
. For comparison, we have
now performed chloride clamping on J774 cells with and without fixation (Fig. S9b-d). The negligible
difference in R/G fold change observed in J774 cells with and without fixation prior to clamping indicates
that Clensor’s characteristics or performance is essentially invariant whether one includes a fixation step
or not (Fig. S9d).
© 2015 Macmillan Publishers Limited. All rights reserved
![Page 28: A pH-independent DNA nanodevice for quantifying chloride ... · A pH independent DNA nanodevice for quantifying chloride transport in organelles of living cells Sonali Saha, Ved Prakash,](https://reader034.vdocuments.site/reader034/viewer/2022050200/5f5373b88b52e155ac17f38d/html5/thumbnails/28.jpg)
28
0 10 20 300
10
20
No
. o
f en
do
so
mes
R/G
60 mM
0
10
20 mM
a
d
b
20 30 40 50 60
1.0
1.2
1.4
[Cl-] (mM)
No
rma
lize
d m
ea
n R
/G In vitro
Intracellular
0
Alexa 647 BAC
202
0 m
M60 m
M
0.0
0.5
1.0
1.5
Intracellular
Fo
ld c
han
ge in
R/G
(20 -
60 m
M C
l- )
In vitro
c
Supplementary Figure S10 | Quantitative performance of ClensorTf
within the endosomes
of S2R+ cells. a, Alexa 647 channel and respective pseudocolour R/G map of S2R+ cells
labelled with ClensorTf
and clamped at 20 mM and 60 mM Clˉ. Scale bar: 10 m. b, Histograms
showing typical spread of R/G ratios of endosomes clamped at 20 mM (green) and 60 mM (red)
Clˉ. (n ≥ 10 cells, ≥ 30 endosomes). c, In vitro and intracellular fold change in R/G ratios of
ClensorTf
at 20 mM and 60 mM Clˉ. d, The normalized R/G intensity (Alexa 647/BAC) ratios
inside the endosomes, plotted as a function of [Clˉ], yield the intracellular calibration profile
(red), which is overlaid on the in vitro chloride calibration profile (black). In vitro and intracellular
R/G values were normalized against 20 mM Clˉ. Error bars indicate the mean of three
independent experiments s.e.m. (n >10 cells, ≥30 endosomes)
© 2015 Macmillan Publishers Limited. All rights reserved
![Page 29: A pH-independent DNA nanodevice for quantifying chloride ... · A pH independent DNA nanodevice for quantifying chloride transport in organelles of living cells Sonali Saha, Ved Prakash,](https://reader034.vdocuments.site/reader034/viewer/2022050200/5f5373b88b52e155ac17f38d/html5/thumbnails/29.jpg)
29
Intracellular performance of ClensorTf
: To check the intracellular functionality of ClensorTf
, a standard
Clˉ calibration profile was generated by clamping the [Clˉ] of endosomes to that of an externally added
buffer. Representative bitmap images shown in Fig. S10a reveal that at different [Clˉ] distinct R/G map
are observed as expected. Fig. S10b shows a histogram of a population of endosomes clamped at 20 mM
and 60 mM [Clˉ]. Endosomal R/G ratios as a function of [Clˉ] presented a linear profile with the expected
~1.5 fold change in R/G values between 20 mM and 60 mM [Clˉ] (Fig. S10c). The R/G versus [Clˉ]
calibration was used to determine recycling endosomal [Clˉ] under physiological conditions in S2R+
cells. The intracellular standard R/G profile showed excellent correspondence with the in vitro curve,
indicating that post internalization ClensorTf
also recapitulates its sensing properties inside cells
quantitatively.
© 2015 Macmillan Publishers Limited. All rights reserved
![Page 30: A pH-independent DNA nanodevice for quantifying chloride ... · A pH independent DNA nanodevice for quantifying chloride transport in organelles of living cells Sonali Saha, Ved Prakash,](https://reader034.vdocuments.site/reader034/viewer/2022050200/5f5373b88b52e155ac17f38d/html5/thumbnails/30.jpg)
30
Supplementary Figure S11 | Distribution of R/G
values along the endolysosomal pathway in
living cells. (a – c) Box plots showing the [Clˉ]
distributions for (a) EE, (b) LE and (c) LY in
hemocytes of the indicated genetic background. n ~
15 cells, ~ 75 endosomes/lysosomes. The box
represents 25-75% of the population, the line within
the box represents the median and filled circle
represents the mean of the data obtained for each
indicated genotype. Mann-Whitney U test; * P-value
< 0.05, ** P-value < 0.0001, NS: not significant.
0
5
10
15
NS
**
c RNAi
b mutant
b RNAi
CS
R/G
LY
*
0
5
10
15
c RNAi
b mutant
b RNAi
CS
*
R/G
LE
*NS
0
5
10
15
*
NS
c RNAi
b mutant
b RNAi
CS
R/G
EE
NS
a
b
c
© 2015 Macmillan Publishers Limited. All rights reserved
![Page 31: A pH-independent DNA nanodevice for quantifying chloride ... · A pH independent DNA nanodevice for quantifying chloride transport in organelles of living cells Sonali Saha, Ved Prakash,](https://reader034.vdocuments.site/reader034/viewer/2022050200/5f5373b88b52e155ac17f38d/html5/thumbnails/31.jpg)
31
Mean [Clˉ] s.e.m. (mM) Mean pH s.e.m.
EE LE LY EE LE LY*
CS 37.0 1.6 60.4 2 108.5 1.4 5.9 0.06 5.2 0.11 5 .012
DmClC-b
RNAi37.8 2 50.1 0.5 70.9 2.8 5.8 0.09 5.4 0.14 5 0.26
DmClC-c
RNAi28.9 0.8 63.6 1.4 113.9 5.3 6.4 0.03 5.5 0.3 5 0.09
Supplementary Table S3 | Summary of mean [Clˉ] and pH in EEs, LEs and LYs in hemocytes
of the indicated genetic background. Values of [Clˉ] corresponding to the observed R/G values
were extracted from the intracellular calibration profile shown in Fig. 3d. pHEE and pHLE
measurements using the dual excitation method were performed using FD10 and compartment
identification was achieved by colocalization with ClensorA647
. Asterisk indicates pHLY
measurements were performed using I4LYA488/A647. n > 20 cells, ~ 100 endosomes. Data indicate
the mean of three independent experiments ± s.e.m.
Endosomes (min)Mean [Cl-] s.e.m (mM)
-NPPB +NPPB
EE (5) 37.0 1.6 9.3 1.5
LE (60) 60.4 2 33.8 2.5
LY (120) 108.5 1.4 86.5 3.5
Supplementary Table S4 | Variation in [Clˉ] in the EEs, LEs and LYs reported by Clensor upon
treatment with NPPB. –NPPB and +NPPB indicate endo-lysosomal [Clˉ] determined from cells
incubated in 1X M1 buffer and 1X M1 buffer containing 400 M NPPB respectively.
[Clˉ] measurement under chemical perturbation: To see if Clensor is capable of detecting changes in
Clˉ accumulation in specific endosomal stages under perturbed conditions, we treated hemocytes with 400
© 2015 Macmillan Publishers Limited. All rights reserved
![Page 32: A pH-independent DNA nanodevice for quantifying chloride ... · A pH independent DNA nanodevice for quantifying chloride transport in organelles of living cells Sonali Saha, Ved Prakash,](https://reader034.vdocuments.site/reader034/viewer/2022050200/5f5373b88b52e155ac17f38d/html5/thumbnails/32.jpg)
32
DmClC-b (CG8594)
ClC-7
ClC-6
ClC-3
ClC-4
ClC-5
DmClC-c (CG5284)
ClC-1
ClC-2
ClC-Ka
ClC-Kb
DmClC-a (CG6942)
M NPPB (5-nitro-2-(3 to phenylpropylamino)benzoic acid), which is a well-known non-specific Clˉ
channel blocker. It is known that endosomal Clˉ conductance is partially inhibited by NPPB at a high
concentration of 100 M in isolated endosomes 21–23
. It has also been shown 300 M NPPB partially
inhibits endosomal Clˉ accumulation and acidification in intact cells 24
. We labelled hemocytes with 2 μM
Clensor for 5 min at room temperature. Then the cells were chased for 5, 60 and 120 min at 20 °C in 1X
M1 buffer containing 400 M NPPB and [Clˉ] were measured at those chase time points (Table S4). The
table shows that, as expected, endosomal Clˉ accumulation is abrogated in presence of NPPB compared to
untreated cells at each stage of endosomal maturation 9. Endosomal [Clˉ] falls to 9.3 ± 1.5 mM in the EEs,
33.8 ± 2.5 mM in the LEs and 86.5 ± 3.5 mM in the LYs upon NPPB treatment. This data suggests that
Clensor can reliably capture the differences in Clˉ accumulation caused due to chemical perturbation at
every stage of endosomal maturation along the endolysosomal pathway.
Supplementary Figure S12 | Phylogenetic tree comparing the CLC proteins from D.
melanogaster (bold) with mammalian CLC channels (italics).
© 2015 Macmillan Publishers Limited. All rights reserved
![Page 33: A pH-independent DNA nanodevice for quantifying chloride ... · A pH independent DNA nanodevice for quantifying chloride transport in organelles of living cells Sonali Saha, Ved Prakash,](https://reader034.vdocuments.site/reader034/viewer/2022050200/5f5373b88b52e155ac17f38d/html5/thumbnails/33.jpg)
33
DmClC-b
Tubulin
DmClC-c
Tubulin
DmClC-b
Tubulin
DmClC-c
Tubulin
ba
DmClC channels and transporters: The D. melanogaster genome encodes three CLC family Clˉ
channels and transporters (CG6942, CG8594, and CG5284) that represent all three known branches of the
mammalian CLC gene family 25
. Among them plasma membrane resident DmClC-a is most closely
related to ClC-2 and is fairly well characterized 26
. However, nothing was known about putative
intracellular CLC family proteins, DmClC-b and DmClC-c.
Supplementary Figure S13| Western blot showing depletion of DmClC-b and DmClC-c
proteins by RNAi. a, Immunoblot of total protein isolated from S2R+ cells treated with or
without dsRNA to DmClC-b. Lanes marked as S2R+: total protein from S2R+ cells (100 g
protein/ lane). Lanes marked as DmClC-b RNAi: total protein from S2R+ cells treated with
dsRNA to DmClC-b (100 g protein/ lane). Upper panel: probed with anti-DmClC-b (1:100
dilution), lower panel: probed with anti-CLCN3 (1:500 dilution). b, Immunoblot of total protein
isolated from S2R+ cells treated with or without dsRNA to DmClC-c. Lanes marked as S2R+:
total protein from S2R+ cells (100 g protein/ lane). Lanes marked as DmClC-c RNAi: total
protein from S2R+ cells treated with dsRNA to DmClC-c (100 g protein/ lane). Upper panel:
probed with anti-DmClC-b (1:100 dilution), lower panel: probed with anti-CLCN3 (1:500 dilution).
Tubulin was used as loading control.
© 2015 Macmillan Publishers Limited. All rights reserved
![Page 34: A pH-independent DNA nanodevice for quantifying chloride ... · A pH independent DNA nanodevice for quantifying chloride transport in organelles of living cells Sonali Saha, Ved Prakash,](https://reader034.vdocuments.site/reader034/viewer/2022050200/5f5373b88b52e155ac17f38d/html5/thumbnails/34.jpg)
34
c
a
b
500 bp
700 bp
1000 bp
M 1 2 3
CS T
DmClC-b
Tubulin
DmClC-c
Tubulin
Lane 1:
Lane 2:
Lane 3:
dy1 w*; P{EP}ClC-bG2453
EE LE LY
Mean [Clˉ] s.e.m. (mM) 37.9 1.4 46.8 3.4 58.6 4.1
Mean pH s.e.m.5.8 0.3 5.4 0.12 5 0.09*
Supplementary Figure S14| Molecular characterization of flies containing the EP-element
insertion in DmClC-b, y1
w*
; P{EP}ClC-bG2453
. a, Schematic showing the primer binding sites
in each PCR reaction shown in Fig. S14b. Green arrows show EP element specific primers. Red
arrows show DmClC-b specific primers. Red box indicates position of the EP element. b, PCR
amplicons of genomic DNA of wild type and transgenic fly for the indicated primer set. The
genomic DNA samples from wild type (lane 1) and the transgenic (y1
w*
; P{EP}ClC-bG2453
) flies
(lane 2 and lane 3). Lane numbers correspond to primer sets shown in Fig. S14a. Lane M: 100
bp DNA ladder. c, Immunoblot of total protein isolated from larvae of wild type and transgenic
© 2015 Macmillan Publishers Limited. All rights reserved
![Page 35: A pH-independent DNA nanodevice for quantifying chloride ... · A pH independent DNA nanodevice for quantifying chloride transport in organelles of living cells Sonali Saha, Ved Prakash,](https://reader034.vdocuments.site/reader034/viewer/2022050200/5f5373b88b52e155ac17f38d/html5/thumbnails/35.jpg)
35
(y1
w*
; P{EP}ClC-bG2453
) flies. Lanes, CS: total protein from wild type (100 g protein/ lane); T:
total protein from transgenic flies (100 g protein/ lane). Upper panel: probed with anti-DmClC-b
(1:100 dilution), lower panel: probed with anti-CLCN3 (1:500 dilution). d, Summary of mean [Clˉ]
and pH in EEs, LEs and LYs in hemocytes isolated from the transgenic flies. Asterisk indicates
that measurement has been carried out using I4LYA488/A647. Data indicate the mean of three
independent experiments ± s.e.m.
[Clˉ] measurements under genetic perturbation: To complement the studies done in DmClC-b RNAi
depleted system, we chose a transgenic fly line (y1 w
*; P{EP}ClC-b
G2453; Bloomington Drosophila Stock
Center at Indiana University, see Table S6) where the DmClC-b gene is supposed to be disrupted by the
insertion of 7.98 Kb EP element in the second intron of this gene. We first characterized this transgenic
fly line, by confirming the genomic location of this inserted transposon using PCR (see Table S5 for
primer sets) with primers spanning the sequences flanking the insertion (DmClC-b FP and DmClC-b RP,
Table S5) as shown in Fig. S14a. When DNA from wild-type flies was used as a template, a predicted
product of ~0.92 kb was produced (Fig. S14b; lane 1). When genomic DNA from transgeneic flies was
used as template, products of ~ 420 bp and ~ 653 bp with the P element specific primers were observed as
expected (Fig. S14b; lane 2 and 3).
Further, western blot analysis of the total protein isolated from the 3rd
instar larvae of this transgenic line
shows significant reduction of DmClC-b protein levels in these larvae compared to wild type, whereas the
level of DmClC-c remained unaffected in both the cases (Fig. S14c). After confirming the depletion of the
DmClC-b gene in this transgenic line, we carried out Clˉ measurement in hemocytes along the ALBR
pathway using Clensor. For quantifying [Clˉ] the observed R/G values were converted to their
corresponding [Clˉ] values from the intracellular chloride calibration profile shown in Fig. 3d. For pHEE
and pHLE measurements, hemocytes were labelled with a mixture of FD10 (2 mg/mL, 50 μL) and
ClensorA647 (1 μM, 50 μL) for 5 min and imaged at previously indicated chase times. For pHEE and pHLE
© 2015 Macmillan Publishers Limited. All rights reserved
![Page 36: A pH-independent DNA nanodevice for quantifying chloride ... · A pH independent DNA nanodevice for quantifying chloride transport in organelles of living cells Sonali Saha, Ved Prakash,](https://reader034.vdocuments.site/reader034/viewer/2022050200/5f5373b88b52e155ac17f38d/html5/thumbnails/36.jpg)
36
measurements, Ex480/Ex430 ratios were obtained from only those endosomes that co-localized with
ClensorA647 and converted to their corresponding pH values from the intracellular calibration curve (Fig.
S15a). pHLY was determined using I4LY
A488/A647 (1 μM, 50 μL) (Fig. S15b). Notably, the phenotypes were
even more severe compared to DmClC-b RNAi depleted cells as expected with mean [Clˉ] decreasing to
46.8 ± 3.4 mM in LEs and 58.6 ± 4.1 mM in LYs (Fig. 14d).
5.0 5.5 6.0 6.5 7.01
2
3
4
E
x4
80
/E
x4
30
pH4.5 5.0 5.5 6.0 6.5 7.0
2
4
6
8
10 In vitro
Intracellular
No
rma
lize
d D
/A
pH
a b
Supplementary Figure S15 | a, Intracellular calibration profile of FD10 in hemocytes. Ratios of
the intensity inside endosomes at 530 nm when FITC is excited at 480 nm and 430 nm
(Ex
480/Ex
430) are plotted as a function of pH. b, Intracellular calibration profile of I4LYA488/A647 in
hemocytes. The normalized donor/acceptor (D/A) intensity (Alexa-488/Alexa-647) ratios inside
the endosomes, plotted as a function of pH (red), yield the intracellular calibration profile which
is overlayed on the in vitro pH profile (black).
© 2015 Macmillan Publishers Limited. All rights reserved
![Page 37: A pH-independent DNA nanodevice for quantifying chloride ... · A pH independent DNA nanodevice for quantifying chloride transport in organelles of living cells Sonali Saha, Ved Prakash,](https://reader034.vdocuments.site/reader034/viewer/2022050200/5f5373b88b52e155ac17f38d/html5/thumbnails/37.jpg)
37
Supplementary Figure S16 | Representative confocal images showing localization of
DmClC-b and DmClC-c by immunofluorescence. a, S2R+ cells transiently expressing GFP-
Rab5 (first column, green), YFP-Rab7 (second column, green), LAMP1-GFP (third column,
© 2015 Macmillan Publishers Limited. All rights reserved
![Page 38: A pH-independent DNA nanodevice for quantifying chloride ... · A pH independent DNA nanodevice for quantifying chloride transport in organelles of living cells Sonali Saha, Ved Prakash,](https://reader034.vdocuments.site/reader034/viewer/2022050200/5f5373b88b52e155ac17f38d/html5/thumbnails/38.jpg)
38
Name Sequences (5ʹ to 3ʹ) Description
CF1 CGGATCGATATGCTAAGCTGT Forward primer: RT PCR loading control RpL32
CB1 GCGCTTGTTCGATCCGTA Reverse primer: RT PCR loading control RpL32
F1b CGGAACTTTTCGTGACCATC Forward primer: RT PCR DmClC-b gene
B1b TGGACAAATGCCATGCTTTA Reverse primer: RT PCR DmClC-b gene
F1c ATTTCACGTTCACGGGTCTC Forward primer: RT PCR DmClC-c gene
B1c ATGGTCATTCGAAGCACTCC Reverse primer: RT PCR DmClC-c gene
RNAiCR1F TAATACGACTCACTATAGGGCATCTGGTATGTGCTGTG Forward primer: DmClC-c RNAi template round 1
RNAiCR1R TAATACGACTCACTATAGGGACGAAAAAGAGCACGGAATG Reverse primer: DmClC-c RNAi template round 1
RNAiCR2F ATTCGCCCTTTAATACGACTCACTATAGGGCATC Forward primer: DmClC-c RNAi template round 2
RNAiCR2R ATTCGCCCTTTAATACGACTCACTATAGGGACG Reverse primer: DmClC-c RNAi template round 2
RNAiBR1F TAATACGACTCACTATAGGGGAGTTTCAGCTGCTTTTGG Forward primer: DmClC-b RNAi template round 1
RNAiBR1R TAATACGACTCACTATAGGGGCCACGGCATTATATTCGTT Reverse primer: DmClC-b RNAi template round 1
RNAiBR2F ATTCGCCCTTTAATACGACTCACTATAGGGGGA Forward primer: DmClC-b RNAi template round 2
RNAiBR2R ATTCGCCCTTTAATACGACTCACTATAGGGGCC Reverse primer: DmClC-b RNAi template round 2
PE5-1 AATTCGTCCGCACACAAC 5ʹ EP specific
PE3-1 TCGCACTTATTGCAAGCA 3ʹ EP specific
DmClC-b FP-1 CTGCTAATGGGCAACAAT Forward primer: DmClC-b gene
DmClC-b RP-1 ATTGGACCCTCCTTTCCT Reverse primer: DmClC-b gene
Genotype Reference
CS Bloomington Drosophila Stock Center at Indiana University
y1 w*; P{EP}ClC-bG2453 Bloomington Drosophila Stock Center at Indiana University
y1 v1; P{TRiP.JF01844}attP2 Bloomington Drosophila Stock Center at Indiana University
y1 w*; P{EP}ClC-cG4477 Bloomington Drosophila Stock Center at Indiana University
y1 v1; P{TRiP.JF02360}attP2 Bloomington Drosophila Stock Center at Indiana University
w1118; P{Cg-GAL4.A}2 Bloomington Drosophila Stock Center at Indiana University
y1 w*; P{UASp-YFP.Rab5}02 Bloomington Drosophila Stock Center at Indiana University
y1 w*; P{UASp-YFP.Rab7}21/SM5 Bloomington Drosophila Stock Center at Indiana University
W1118; P [w+, uasGFP-
LAMP]2M/Cyo;TM6b, Hu boss /Sb
boss1
A gift from H. Krämer (University of Texas Southwestern
Medical Center, Dallas, TX) J. Cell Sci. 2005, 118, 3663-3673.
green) and YFP-Rab11 (fourth column, green) were fixed and stained with the anti DmClC-b
antibody (red). b, S2R+ cells transiently expressing GFP-Rab 5 (first column, green), YFP-Rab7
(second column, green), LAMP1-GFP (third column, green) and YFP-Rab11 (fourth column,
green) were fixed and stained with the anti CLCN 3 antibody (red). Scale bar: 5 μm
Supplementary Table S5 | PCR primer sequences used in this study
Supplementary Table S6 | Fly stocks used in the study
© 2015 Macmillan Publishers Limited. All rights reserved
![Page 39: A pH-independent DNA nanodevice for quantifying chloride ... · A pH independent DNA nanodevice for quantifying chloride transport in organelles of living cells Sonali Saha, Ved Prakash,](https://reader034.vdocuments.site/reader034/viewer/2022050200/5f5373b88b52e155ac17f38d/html5/thumbnails/39.jpg)
39
References
1. Sriram, V., Krishnan, K. S. & Mayor, S. deep-orange and carnation define distinct stages in late
endosomal biogenesis in Drosophila melanogaster. J. Cell Biol. 161, 593–607 (2003).
2. Gupta, G. D. et al. Analysis of Endocytic Pathways in Drosophila Cells Reveals a Conserved Role
for GBF1 in Internalization via GEECs. PLoS ONE 4, e6768 (2009).
3. Bhatia, D., Surana, S., Chakraborty, S., Koushika, S. P. & Krishnan, Y. A synthetic icosahedral
DNA-based host–cargo complex for functional in vivo imaging. Nat. Commun. 2, 339 (2011).
4. Sonawane, N. D., Thiagarajah, J. R. & Verkman, A. S. Chloride Concentration in Endosomes
Measured Using a Ratioable Fluorescent Cl− Indicator EVIDENCE FOR CHLORIDE
ACCUMULATION DURING ACIDIFICATION. J. Biol. Chem. 277, 5506–5513 (2002).
5. Geddes, C. D. Optical halide sensing using fluorescence quenching: theory, simulations and
applications-a review. Meas. Sci. Technol. 12, R53 (2001).
6. Biwersi, J., Tulk, B. & Verkman, A. S. Long-wavelength chloride-sensitive fluorescent indicators.
Anal. Biochem. 219, 139–143 (1994).
7. Weinert, S. et al. Lysosomal Pathology and Osteopetrosis upon Loss of H+-Driven Lysosomal Cl-
Accumulation. Science 328, 1401–1403 (2010).
8. Sonawane, N. D. & Verkman, A. S. Determinants of [Cl-] in recycling and late endosomes and Golgi
complex measured using fluorescent ligands. J. Cell Biol. 160, 1129–1138 (2003).
9. Modi, S. et al. A DNA nanomachine that maps spatial and temporal pH changes inside living cells.
Nat. Nanotechnol. 4, 325–330 (2009).
10. Modi, S., Nizak, C., Surana, S., Halder, S. & Krishnan, Y. Two DNA nanomachines map pH changes
along intersecting endocytic pathways inside the same cell. Nat. Nanotechnol. 8, 459–467 (2013).
11. Ratilainen, T., Holmén, A., Tuite, E., Nielsen, P. E. & Nordén, B. Thermodynamics of sequence-
specific binding of PNA to DNA. Biochemistry (Mosc.) 39, 7781–7791 (2000).
© 2015 Macmillan Publishers Limited. All rights reserved
![Page 40: A pH-independent DNA nanodevice for quantifying chloride ... · A pH independent DNA nanodevice for quantifying chloride transport in organelles of living cells Sonali Saha, Ved Prakash,](https://reader034.vdocuments.site/reader034/viewer/2022050200/5f5373b88b52e155ac17f38d/html5/thumbnails/40.jpg)
40
12. Johnson, I. M., Kumar, S. G. B. & Malathi, R. De-intercalation of Ethidium Bromide and Acridine
Orange by Xanthine Derivatives and Their Modulatory Effect on Anticancer Agents: A study of
DNA-directed Toxicity Enlightened by Time Correlated Single Photon Counting. J. Biomol. Struct.
Dyn. 20, 677–685 (2003).
13. Sauer, M. et al. Dynamics of the electron transfer reaction between an oxazine dye and DNA
oligonucleotides monitored on the single-molecule level. Chem. Phys. Lett. 284, 153–163 (1998).
14. Seidel, C. A. M., Schulz, A. & Sauer, M. H. M. Nucleobase-Specific Quenching of Fluorescent Dyes.
1. Nucleobase One-Electron Redox Potentials and Their Correlation with Static and Dynamic
Quenching Efficiencies. J. Phys. Chem. 100, 5541–5553 (1996).
15. Huotari, J. & Helenius, A. Endosome maturation. EMBO J. 30, 3481–3500 (2011).
16. Chao, A. C., Widdicombe, J. H. & Verkman, A. S. Chloride conductive and cotransport mechanisms
in cultures of canine tracheal epithelial cells measured by an entrapped fluorescent indicator. J.
Membr. Biol. 113, 193–202 (1990).
17. Huang, S. J., Chan, H. C. & Wong, P. Y. Adrenaline-regulated Cl- transport in cultured single rat
epididymal cells measured by an entrapped Cl-(-)sensitive fluorophore. J. Physiol. 474, 183–191
(1994).
18. Nakatsu, Y., Kotake, Y. & Ohta, S. Concentration Dependence of the Mechanisms of Tributyltin-
Induced Apoptosis. Toxicol. Sci. 97, 438–447 (2007).
19. Swetha, M. G. et al. Lysosomal Membrane Protein Composition, Acidic pH and Sterol Content are
Regulated via a Light-Dependent Pathway in Metazoan Cells. Traffic 12, 1037–1055 (2011).
20. Busch, G. L., Lang, H. J. & Lang, F. Studies on the mechanism of swelling-induced lysosomal
alkalinization in vascular smooth muscle cells. Pflüg. Arch. Eur. J. Physiol. 431, 690–696 (1996).
21. Marshansky, V. & Vinay, P. Proton gradient formation in early endosomes from proximal tubules.
Biochim. Biophys. Acta 1284, 171–180 (1996).
© 2015 Macmillan Publishers Limited. All rights reserved
![Page 41: A pH-independent DNA nanodevice for quantifying chloride ... · A pH independent DNA nanodevice for quantifying chloride transport in organelles of living cells Sonali Saha, Ved Prakash,](https://reader034.vdocuments.site/reader034/viewer/2022050200/5f5373b88b52e155ac17f38d/html5/thumbnails/41.jpg)
41
22. Schmid, A., Burckhardt, G. & Gögelein, H. Single chloride channels in endosomal vesicle
preparations from rat kidney cortex. J. Membr. Biol. 111, 265–275 (1989).
23. Sonawane, N. D. Determinants of [Cl-] in recycling and late endosomes and Golgi complex measured
using fluorescent ligands. J. Cell Biol. 160, 1129–1138 (2003).
24. Dow, J. T. & Davies, S. A. Integrative physiology and functional genomics of epithelial function in a
genetic model organism. Physiol. Rev. 83, 687–729 (2003).
25. Rose, U., Derst, C., Wanischeck, M., Marinc, C. & Walther, C. Properties and possible function of a
hyperpolarisation-activated chloride current in Drosophila. J. Exp. Biol. 210, 2489–2500 (2007).
© 2015 Macmillan Publishers Limited. All rights reserved