a novel egfr isoform confers increased invasiveness to ...€¦ · 18/10/2013 · 1 supplementary...
TRANSCRIPT
1
Supplementary Material
A novel EGFR isoform confers increased
invasiveness to cancer cells
Min Zhou, Hai Wang, Keke Zhou, Xiaoying Luo, Xiaorong Pan, Bizhi Shi, Hua Jiang, Jiqin Zhang,
Kesang Li, Hua-Mao Wang, Huiping Gao, Shun Lu, Ming Yao, Ying Mao, Hong-Yang Wang,
Shengli Yang, Jianren Gu, Chuanyuan Li, and Zonghai Li
2
List of contents
Supplementary Figures .............................................................................................3 Figure S1. Related to Figure 1..................................................................................... 3 Figure S2. Related to Figure 2..................................................................................... 5 Figure S3. Related to Figure 3..................................................................................... 6 Figure S4. Related to Figure 4..................................................................................... 8 Figure S5. Related to Figure 5..................................................................................... 9 Figure S6. Related to Figure 6................................................................................... 11 Supplementary Tables ............................................................................................12 Table S1. Clinical characteristics of patients with low or high expression of EGFR or EGFRvA in 52 glioma patients....................................................................................12 Table S2. Higher expressed genes in U87MG EGFRvA cells versus U87MG EGFR cells............................................................................................................................14 Table S3. Lower expressed genes in U87MG EGFRvA cells versus U87MG EGFR cells ...........................................................................................................................18 Table S4. Primers used in this study .........................................................................22 Supplementary Materials and Methods ................................................................25 Supplementary References .................................................................................. 31
3
Figure S1. EGFRvA is widely expressed in various cancer cell lines and tissues. (A)
Products of long distance reverse transcription PCR (RT-PCR) for EGFRvA. The complete
open reading frame (ORF) was amplified and sequenced. (B) Detection of EGFR and
EGFRvA mRNA in tumor cell lines by RT-PCR. β-actin was used as an internal control. (C)
Quantitative analysis of the expression of EGFR and EGFRvA mRNA in normal tissues by
qRT-PCR. Relative mean expression of EGFR and EGFRvA was normalized to their
4
expression level in brain. Data are means ± SEM. (D) Immunoblotting analysis of GFP,
EGFR or EGFRvA-transfected NIH/3T3 cells. EGFRvA and EGFR were detected by 1F3-52
and 7F4, respectively. Polyclonal antibody SC-03 recognizing both EGFRvA and EGFR was
used to detect total EGFR. (E) Immunocytochemical staining of EGFR and EGFRvA in A431
and MDA-MB-468 cells. NIH/3T3 EGFR and NIH/3T3 EGFRvA served as controls. Scale bar,
90 µm.
5
Figure S2. The upregulation of EGFRvA in glioma tissues compared with paired adjacent
non-neoplastic brain tissues and a poor prognosis in patients with high-grade gliomas, (A)
Western blot analysis of EGFR and EGFRvA in 6 pairs of glioma tissues (T) and
corresponding adjacent noncancerous tissues (N). (B) A poor prognosis in patients with
high-grade gliomas,
6
Figure S3. EGFRvA promotes cell migration and invasion in vitro and in vivo. (A-B) EGFRvA
promotes cell proliferation in vitro. Growth curves of U87MG transfectants (A) and NIH/3T3
transfectants (B). * , P < 0.01 when compared with GFP control. Data are mean ± SEM. (C)
7
Representative images of transwell migration and invasion assays of U87MG transfectants.
Scale bar, 100 µm. (D) Transwell migration and invasion assays of NIH/3T3 transfectants.
Data are mean ± SEM. (E) Body weight change (Weight Day 18 - Weight Day 0) of the three
group mice. Data are mean ± SEM. (F) Representative Micro-CT images of the thorax of
mice at the mid-lung level. Scale bar, 5 mm. (G) Representative gross lung (upper panel) and
H&E-stained lung sections (lower panel) from mice subcutaneously injected with indicated
U87MG transfectants. Black arrowheads and dashed lines mark metastatic nodules. Scale
bars, 5 mm. (H-M) The extrapulmonary metastatic foci induced by U87MG EGFRvA cells
were observed adjacent to the spine (H), on the diaphragm (I), chest wall (J), or in the chest
cavity (K), peritoneum lymph nodes (L) and mesenteric lymph nodes in the abdominal cavity
(M). Scale bar, 5 mm.
8
Figure S4. EGFRvA caused the activation of STAT3 and increased expression of HB-EGF.
(A) Key molecules of the EGFR signaling pathway were analyzed by Western blot using the
indicated antibodies. (B) Immunofluorescence analysis of p-STAT3, HB-EGF, MMP-2 and
MMP-9 in U87MG GFP, U87MG EGFR and U87MG EGFRvA cells. Scale bar, 40 µm.
9
Figure S5. The positive feedback regulation between HB-EGF and p-STAT3 in
EGFRvA-expressing cells. (A) Western blot analysis of EGFR Y992 and Y1045
phosphorylation in HB-EGF treated U87MG EGFR and U87MG EGFRvA cells. Cells treated
with EGF were used as positive controls. (B) Western blot analysis of p-STAT3 in the cell
10
lysates from U87MG cells treated with the culture supernatant of the indicated cells in the
absence (upper and middle panel) or presence (lower panel) of 10 µg/ml HB-EGF
neutralizing antibody for different times. IgG from mouse served as a negative control. (C)
Human HB-EGF promoter. Human HB-EGF promoter sequences were obtained from NCBI
MapViewer. Putative STAT3-binding sites are shown in red. The capital letters denote the 5'
region of HB-EGF encoding the mRNA transcript. (D) ChIP assay showing STAT3 binding to
the HB-EGF promoter. The chromatins were prepared from MD-MB-468 cells and the
immunoprecipitated DNA fragments within HB-EGF promoter by STAT3 antibody were
detected by PCR analysis.
11
Figure S6. Cell viability and cell adhesion of U87MG EGFRvA cells treated with STAT3
inhibitor AG490, and siRNA-mediated knockdown of STAT3 in U87MG transfectants. (A) Cell
viability and cell adhesion assays of U87MG EGFRvA cells treated with increasing
concentrations of AG490. Data are mean ± SEM. (B) siRNA-mediated knockdown of STAT3
was confirmed by qRT-PCR. Data are mean ± SEM.
12
Supplementary Tables
Table S1. Clinical characteristics of patients with low or high expression of EGFR or EGFRvA in 52 glioma patients
Characteristic
Low EGFR expression
(EGFR below median)
n = 26
High EGFR expression
(EGFR above median)
n = 26
P value
Low EGFRvA expression
(EGFRvA below median)
n = 26
High EGFRvA expression
(EGFRvA above median)
n = 26
P value
Age (years，mean ± SD) 38.29 ± 17.46 47.31 ± 19.45 0.098a 43.52 ± 17.18 42.14 ± 20.59 0.803a
Sex
Male 16 14 0.575b 13 17 0.262b
Female 10 12 13 9
Stage
Ⅰ-Ⅱ 15 7 0.025c 17 5 0.001c
Ⅲ-Ⅳ 11 19 9 21
Median survival
(months after operation)
15.1 14.2 0.235c 17.4 12.5 0.005c
13
aP values were measured with student’s t test. bP values were derived from Pearson chi-square tests. cP values were derived from log rank test.
14
Table S2. Higher expressed genes in U87MG EGFRvA cells versus U87MG EGFR cells
No. Genes Ratio Description
1 PDE1A 7.9042
Calcium/calmodulin-dependent 3',5'-cyclic nucleotide
phosphodiesterase 1A
2 HIST1H4I 7.2628 Histone H4
3 CBWD2 6.7816 COBW domain-containing protein 2
4 KCNC2 6.7431
Shaw-related voltage-gated potassium channel protein 2 isoform
KV3.2c
5 NTN4 5.9598 Netrin-4 precursor
6 CAND1 5.9092 Cullin-associated NEDD8-dissociated protein 1
7 ACTR3B 5.5942 actin-related protein 3-beta isoform 2
8 CACNB1 5.4914 Voltage-dependent L-type calcium channel subunit beta-1
9 ARL4C 5.2431 ADP-ribosylation factor-like protein 4C
10 PPARG 5.0289 Peroxisome proliferator-activated receptor gamma
11 WNK2 4.7088 Serine/threonine-protein kinase WNK2
12 SRPX2 4.4692 sushi-repeat-containing protein, X-linked 2
13 TCEAL1 4.2817 Transcription elongation factor A protein-like 1
14 CHP1 3.8001 Calcium-binding protein p22
15 PCSK2 3.6554 Neuroendocrine convertase 2 precursor
16 NP_689653.3 3.5664 CDNA FLJ32549 fis, clone SPLEN1000049
17 FGF1 3.5028 Acidic fibroblast growth factor (aFGF)
18 IGF1 3.4219 Insulin-like growth factor IA precursor
19 MYH1 3.3756 Myosin-1
15
20 KCNE4 3.3178 Potassium voltage-gated channel subfamily E member 4
21 SERPINB1 3.2563 Leukocyte elastase inhibitor
22 HB-EGF 3.0638 Heparin-binding EGF-like growth factor precursor
23 NP_001035160.1 3.0380 seven transmembrane helix receptor
24 OLFM1 3.0105 Noelin precursor
25 FNDC3A 2.9603 Fibronectin type-III domain-containing protein 3a
26 HSPB8 2.8863 Heat-shock protein beta-8 (HspB8)
27 OLFM3 2.8797 Noelin-3 precursor (Olfactomedin-3)
28 TIMP4 2.8509 Metalloproteinase inhibitor 4 precursor (TIMP-4)
29 C4orf32 2.8481 CDNA FLJ39370 fis, clone PEBLM2007437
30 HAS2 2.8358 Hyaluronan synthase 2
31 PLAUR 2.8165 Urokinase plasminogen activator surface receptor precursor (uPAR)
32 KLHL5 2.8134 Kelch-like protein 5
33 PDGFA 2.7252 Platelet-derived growth factor A chain precursor
34 Q8N8W3 2.7148 CDNA FLJ38763 fis, clone KIDNE2014119
35 RAB27B 2.7073 Ras-related protein Rab-27B (C25KG)
36 PENK 2.6660 Proenkephalin A precursor
37 RHPN1 2.6506 Rhophilin-1 (GTP-Rho-binding protein 1)
38 PBEF1 2.6335 Nicotinamide phosphoribosyltransferase
39 TADA2L 2.6295 Transcriptional adapter 2-like (ADA2-like protein)
40 FBLN2 2.6083 Fibulin-2 precursor
41 AMICA1 2.5796 Junctional adhesion molecule-like precursor
42 HAPLN1 2.5589 Hyaluronan and proteoglycan link protein 1 precursor
16
43 FGF2 2.5524 Basic fibroblast growth factor (bFGF)
44 STMN4 2.5211 Stathmin-4 (Stathmin-like protein B3)
45 HNRPA0 2.5133 Heterogeneous nuclear ribonucleoprotein A0
46 NP_001005751.1 2.4883 CDNA FLJ10824 fis, clone NT2RP4001086
47 CST1 2.4528 Cystatin-SN precursor (Cystatin-1)
48 NUDT4 2.4357 "Diphosphoinositol polyphosphate phosphohydrolase 2
49 TAS1R1 2.4240 Taste receptor type 1 member 1 precursor
50 SLC20A1 2.4201 Sodium-dependent phosphate transporter 1
51 UPP1 2.4126 Uridine phosphorylase 1
52 ZNF598 2.3811 Zinc finger protein 598
53 RND3 2.3805 Rho-related GTP-binding protein RhoE
54 C7orf36 2.3763 Uncharacterized protein C7orf36
55 UBIAD1 2.3671 UbiA prenyltransferase domain-containing protein 1
56 KTI12 2.3629 KTI12 homolog, chromatin associated
57 ST3GAL5 2.3624 Lactosylceramide alpha-2,3-sialyltransferase
58 FANK1 2.3621 Fibronectin type 3 and ankyrin repeat domains protein 1
59 GDPD2 2.3416
Glycerophosphodiester phosphodiesterase domain-containing protein
2
60 NP_001010861.1 2.3349 phosphatidic acid phosphatase type 2d isoform 2
61 NP_057628.1 2.3265 Ras-associated protein Rap1
62 PDK1 2.3073 Pyruvate dehydrogenase kinase isoform 1
63 SNAP25 2.3006 Synaptosomal-associated protein 25 (SNAP-25)
64 PLOD2 2.2838 Procollagen-lysine,2-oxoglutarate 5-dioxygenase 2 precursor
17
65 LRRN3 2.2614 Leucine-rich repeat neuronal protein 3 precursor
66 UBE2H 2.2596 Ubiquitin-conjugating enzyme E2 H
67 UBE4B 2.2488 Ubiquitin conjugation factor E4 B
68 ABCB4 2.2455 Multidrug resistance protein 3
69 BTG1 2.2426 BTG1 protein (B-cell translocation gene 1 protein)
70 TPRKB 2.2291 PRPK (p53-related protein kinase)-binding protein
71 PRKAR1A 2.2224 cAMP-dependent protein kinase type I-alpha regulatory subunit
72 MGP 2.1979 Matrix Gla-protein precursor (MGP)
73 MICAL3 2.1766 Protein MICAL-3
74 DPH5 2.1636 Probable diphthine synthase
75 MAG 2.1591 Myelin-associated glycoprotein precursor (Siglec-4a)
76 TNMD 2.1443 Tenomodulin (TeM)
77 PAQR7 2.1282 Membrane progestin receptor alpha
78 ERCC1 2.1195 DNA excision repair protein ERCC-1
79 DLL1 2.0379 Delta-like protein 1 precursor
80 DUSP6 2.0366 Dual specificity protein phosphatase 6
81 AMFR 2.0335 Autocrine motility factor receptor, isoform 2
82 EXOC6 2.0291 Exocyst complex component 6
83 SIN3A 2.0226 Paired amphipathic helix protein Sin3a
84 ARIH2 2.0105 Protein ariadne-2 homolog (ARI-2)
85 NFYB 2.0097 Nuclear transcription factor Y subunit beta
86 EIF2B3 2.0041 Translation initiation factor eIF-2B subunit gamma
18
Table S3. Lower expressed genes in U87MG EGFRvA cells versus U87MG EGFR cells
No. Genes Ratio Description
1 RFTN1 0.1245 Raftlin (Raft-linking protein)
2 PDGFRL 0.1274 Platelet-derived growth factor receptor-like protein precursor
3 NGFR 0.1664 Tumor necrosis factor receptor superfamily member 16 precursor
4 BTBD14A 0.1740 BTB/POZ domain-containing protein 14A
5 SLC2A8 0.1848 Solute carrier family 2, facilitated glucose transporter member 8
6 ADRB2 0.2202 Beta-2 adrenergic receptor
7 PCDH9 0.2272 Protocadherin-9 precursor
8 CDH13 0.2283 Cadherin-13 precursor
9 PIF1 0.2333 Uncharacterized protein C15orf20
10 GAB3 0.2378 Gab3 protein
11 PALMD 0.2385 Palmdelphin (Paralemnin-like protein)
12 Q9HD52 0.2577 Uncharacterized gastric protein ZA52P
13 DNA2L 0.2620 DNA2-like helicase
14 PLEKHA7 0.2743 pleckstrin homology domain containing, family A member 2
15 NT5DC2 0.3231 5'-nucleotidase domain-containing protein 2
16 CYSLTR1 0.2809 Cysteinyl leukotriene receptor 1 (CysLTR1)
17 ONECUT2 0.2997 One cut domain family member 2
18 ALDH3A1 0.3021 "Aldehyde dehydrogenase, dimeric NADP-preferring
19 SPSB3 0.3029 SPRY domain-containing SOCS box protein SSB-3
20 RASGRP2 0.3118 RAS guanyl releasing protein 2 isoform 2
21 IL1RAP 0.3149 Interleukin-1 receptor accessory protein precursor
19
22 ACAA2 0.3173 3-ketoacyl-CoA thiolase, mitochondrial
23 LOXL3 0.3173 Lysyl oxidase homolog 3 precursor
24 PDE6G 0.3190 Retinal rod rhodopsin-sensitive cGMP 3
25 LGR4 0.3236 Leucine-rich repeat-containing G-protein coupled receptor 4 precursor
26 RGMA 0.3252 Repulsive guidance molecule A precursor
27 ZDHHC14 0.3283 Probable palmitoyltransferase ZDHHC14
28 NP_569736.1 0.3346 Jun dimerization protein
29 GPR37 0.3497 Probable G-protein coupled receptor 37 precursor
30 SRGAP3 0.3519 SLIT-ROBO Rho GTPase-activating protein 3
31 ZNF228 0.3589 Zinc finger protein 228
32 C9orf93 0.3699 Uncharacterized protein C9orf93
33 PAK1 0.3814 Serine/threonine-protein kinase PAK 1
34 NP_060822.1 0.3872 CDNA FLJ11184 fis, clone PLACE1007507
35 FAM22G 0.3889 Protein FAM22G precursor
36 MIA 0.3889 Melanoma-derived growth regulatory protein precursor
37 NBPF3 0.3989 neuroblastoma breakpoint family, member 3
38 SEMA6A 0.4007 Semaphorin-6A precursor
39 TDG 0.4017 G/T mismatch-specific thymine DNA glycosylase
40 NEK1 0.4058 Serine/threonine-protein kinase Nek1
41 MRPS18C 0.4075 28S ribosomal protein S18c, mitochondrial precursor
42 ZNF521 0.4087 zinc finger protein 521
43 HOXA9 0.4135 Homeobox protein Hox-A9 (Hox-1G)
44 C10orf71 0.4165 C10orf71 protein
20
45 PMS2 0.4173 PMS1 protein homolog 2 (DNA mismatch repair protein PMS2)
46 NP_878274.1 0.4177 selectin ligand interactor cytoplasmic-1
47 OR5T3 0.4187 Olfactory receptor 5T3
48 C1orf213 0.4226 "CDNA FLJ90508 fis, clone NT2RP3004202
49 HIST1H2AK 0.4256 Histone H2A type 1 (H2A.1)
50 TRPV4 0.4266 Transient receptor potential cation channel subfamily V member 4
51 SIGLEC8 0.4279 Sialic acid-binding Ig-like lectin 8 precursor
52 ROBO1 0.4297 Roundabout homolog 1 precursor (H-Robo-1)
53 ARHGAP30 0.4340 Rho GTPase activating protein 30 isoform 2
54 KCNA1 0.4345 Potassium voltage-gated channel subfamily A member 1
55 SCX 0.4359 Basic helix-loop-helix transcription factor scleraxis
56 DST 0.4369 Bullous pemphigoid antigen 1, isoforms 1/2/3/4/5/8
57 MOCOS 0.4373 Molybdenum cofactor sulfurase
58 ATP7A 0.4374 Copper-transporting ATPase 1
59 EFCAB2 0.4435 EF-hand calcium-binding domain-containing protein 2
60 DGCR6L 0.4469 DGCR6L protein (DiGeorge syndrome critical region 6-like protein)
61 FBXO3 0.4489 F-box only protein 3
62 ZNF2 0.4515 Zinc finger protein 2 (Zinc finger 2.2)
63 SOX2 0.4544 Transcription factor SOX-2
64 TEX28 0.4545 Testis-specific protein TEX28
65 MRPS6 0.4554 Mitochondrial 28S ribosomal protein S6 (S6mt) (MRP-S6)
66 ARID3A 0.4585 AT-rich interactive domain-containing protein 3A (E2F-binding protein 1)
67 SMARCA2 0.4603 Probable global transcription activator SNF2L2
21
68 MTRF1 0.4675 Peptide chain release factor 1, mitochondrial precursor (MRF-1)
69 GADD45A 0.4698 Growth arrest and DNA-damage-inducible protein GADD45 alpha
70 GPT2 0.4699 Alanine aminotransferase 2
71 RBM34 0.4729 RNA-binding protein 34
72 AVEN 0.4730 Cell death regulator Aven
73 CMYA1 0.4733 cardiomyopathy associated 1
74 NEDD4L 0.4745 E3 ubiquitin-protein ligase NEDD4-like protein
75 GTF2IRD1 0.4805 General transcription factor II-I repeat domain-containing protein 1
76 PAFAH1B3 0.4830 Platelet-activating factor acetylhydrolase IB subunit gamma
77 SFRP5 0.4832 Secreted frizzled-related protein 5 precursor
78 C11orf35 0.4866 Uncharacterized protein C11orf35
79 S100B 0.4889 Protein S100-B
80 BCAS3 0.4922 Breast carcinoma amplified sequence 3
81 GOLGB1 0.4968 Golgin subfamily B member 1
82 GPR161 0.4981 Probable G-protein coupled receptor 161
22
Table S4. Primers used in this study
Short strands amplification of EGFR and EGFRvA
Forward primer, round 1 5’- TCCCCTCCTGAGCTCTCTGAG -3’
Reverse primer for EGFR, round 1 5’-TGACTTGATACAGTACCGATCCGG-3’
Reverse primer for EGFRvA, round 1 5’-TGTACACACATCATGAACACTCACACA-3’
Forward primer, round 2 5’-AGTGCAACCAGCAACAATTCCA-3’
Reverse primer for EGFR, round 2 5’-GGAATCAAGCATCCTCTGGAAGAC-3’
Reverse primer for EGFRvA, round 2 5’-CAACAGAGGTACAGCAAACAACCAG-3’
Long strands amplification of EGFR and EGFRvA
Forward primer, round 1 5’-GTATTGATCGGGAGAGCCG-3’
Reverse primer for EGFR, round 1 5’-TGACTTGATACAGTACCGATCCGG-3’
Reverse primer for EGFRvA, round 1 5’-TGTACACACATCATGAACACTCACACA-3’
Forward primer, round 2 5’-ATGCGACCCTCCGGGACG-3’
Reverse primer for EGFR, round 2 5’-GGAATCAAGCATCCTCTGGAAGAC-3’
Reverse primer for EGFRvA, round 2 5’-CAACAGAGGTACAGCAAACAACCAG-3’
qRT-PCR amplification
Forward primer for EGFR and EGFRvA 5’-GCAACCAGCAACAATTCC-3’
Reverse primer for EGFR 5’-AGAGGCTGATTGTGATAGAC-3’
Reverse primer for EGFRvA 5’-TCCAGACAAGCCACTCAC-3’
Forward primer for HB-EGF 5’-TCCTCCAAGCCACAAGCACTG-3’
Reverse primer for HB-EGF 5’-TGACCAGCAGACAGACAGATGAC-3’
Forward primer for STAT3
Reverse primer for STAT3
5’-CACCACCAAGCGAGGACTGAG-3’
5’-CAGCCAGACCCAGAAGGAGAAG-3’
23
Endogenous Control
Forward primer for β-actin 5’-TCCTCCCTGGAGAAGAGCTA-3’
Reverse primer for β-actin 5’-GTACTTGCGCTCAGGAGGAG-3’
Primers for HB-EGF promoter
F9-HBEGF-Mlu I (-1000) 5’-CGacgcgTCCCTACACACAGGCAGAATC-3’
F8-HBEGF-Mlu I (-715) 5’-CGacgcgTGGCAGTCAAAGGCAAGG-3’
F6-HBEGF-Mlu I (-590) 5’-CGacgcgtAAGCCACTCCAGAGACTAAG-3’
F4-HBEGF-Mlu I (-490) 5’-CGacgcgtAACGGCTGGCATTCACGTGTC-3’
F2-HBEGF-Mlu I (-375) 5’-CGacgcgtATGGAGACCCCTGGTATG-3’
R-HBEGF-Bgl II (100) 5’-GAagatcTCTTGTCTTGCTCACTCAGC-3’
HB-EGF 1F 5’-TGAGAACGGCTGGCATTCAC-3’
HB-EGF 1R 5’-CATCCCTGTCACCCTCTAAGTTTC-3’
Primers for full-length STAT3
F-STAT3-Hind III (ATG) 5’-CCCaagcttGCCACCATGGCCCAATGGAATCAGC-3’
R-STAT3-Xho I (TGA) 5’-CCGctcgagCTCACATGGGGGAGGTAG-3’
Other Primers
3'-AP 5’-GGCCACGCGTCGACTAGTACTTTTTTTTTTTTTTTTT-3’
3'-AUAP 5’-GGCCACGCGTCGACTAGTAC-3’
UTR-6 5’-AGTCTCCAGTGTCCAAGCCAGG-3’
VA3UTR-F1 5’-GCTCTAGAGCAGACACAGTGAAGGGCG-3’
VA3UTR-R1 5’-GCTCTAGAGCCACGCGTCGACTAGTAC-3’
ER3UTR-F1 5’-GCTCTAGAGGAGCATGACCACGGAGG-3’
ER3UTR-R1 5’-GCTCTAGAAGAGTGGAAATGAATATAG-3’
24
VA3UTR-mut1-F(542-5p) 5’-TGTTTGTGACAGATTCACCAAAAGTTCTCTCTGCTGGC-3’
VA3UTR-mut1-R(542-5p)
VA3UTR-mut2-F(542-5p)
5’-GCCAGCAGAGAGAACTTTTGGTGAATCTGTCACAAACA-3’
5’-TGTGTGTATGTGTGTGACAACACACGATTCACCAAAAGTTCTC
TCTGCTGGC-3’
VA3UTR-mut2-R(542-5p)
5’-GCCAGCAGAGAGAACTTTTGGTGAATCGTGTGTTGTCACACA
CATACACACA-3’
25
Supplementary Materials and Methods
Chemicals
AG490 was purchased from Sigma. A neutralizing antibody against human HB-EGF was
purchased from R&D Systems.
RT-PCR
Total RNA was purchased from Clontech (normal tissues total RNA, Clontech Laboratories
Inc.) or extracted with Trizol (Tumor tissues and cell lines total RNA). One microgram samples
of total RNA were reverse-transcribed by ImProm-II Reverse Transcriptase (Promega),
followed by PCR amplification using Taq polymerase (Takara) according to the manufacturer’s
instructions. PCR was performed using the appropriate primers (Supplementary Table
S4).β-actin amplification served as an internal control.
qRT-PCR
We quantified mRNA levels by qRT-PCR analysis using a TaKaRa SYBR Premix EX TaqTM
kit (TaKaRa) and an ABI Prism 7900 Real-Time PCR System (Applied Biosystems) according
to the manufacturer’s protocols. The amounts of EGFR, EGFRvA, HB-EGF and STAT3 relative
to β-actin were determined by the comparative threshold cycle method. Absolute standard
curves were generated from plasmids encoding EGFRvA. Quantification of miR-542-5p was
performed with a stem-loop real-time PCR miRNA kit (Ribobio).
Lentivirus production and transduction
The EGFR and EGFRvA full-length cDNA sequences were amplified by PCR (long strand
amplification), confirmed by sequencing, and then inserted into a pWPT vector (a generous gift
from Dr T. Didier, University of Geneva) by replacing GFP to generate pWPT-EGFR and
26
pWPT-EGFRvA. To produce virus particles, 20 µg pWPT-EGFR or pWPT-EGFRvA was
transfected with the 15 µg packaging plasmid psPAX2 and 5 µg G-protein of the vesicular
stomatitis virus (VSV-G) envelope plasmid pMD2.G (generous gifts from Dr T. Didier) into
293T cells using a calcium phosphate transfection system. Cells were transduced with
recombinant lentiviral particles to produce polyclonal cells with stable expression of EGFR or
EGFRvA. After confirmed by Western blot, polyclonal cells were seeded into 96-well plates at
almost 1 cell/well. The monoclonal cell lines with almost the same expression level of EGFR
and EGFRvA were then selected by FACS.
Production of antibodies
Peptides corresponding to the C-terminus of EGFR and EGFRvA were synthesized and
then conjugated to maleimide-activated keyhole limpet hemocyanin (KLH) in a 1:1 (WT/WT)
ratio, which was often used to enhance hapten immunogenicity. The sequences of the
peptides were CSTAENAEYLRVAPQSSEFIGA (EGFR) and
CPSQVLPPASPEGETVADLQTQ (EGFRvA), while the cysteine at the N-terminus allowed for
conjugation with KLH. For production of mouse monoclonal antibodies against EGFR or
EGFRvA, each Balb/c mouse was administered with 100 µg peptide-KLH in Freund’s complete
adjuvant. Then, each mouse was administered with 50 µg peptide-KLH in Freund’s incomplete
adjuvant three times every three weeks. The monoclonal antibodies recognizing EGFR (7F4)
or EGFRvA (1F3-52) were screened and produced by the hybridoma technique. For
production of rabbit polyclonal antibody against EGFRvA, each New Zealand white rabbit was
administered with 1 mg peptide-KLH in Freund’s complete adjuvant. Then each rabbit was
administered with 500 µg peptide-KLH in Freund’s incomplete adjuvant three times every three
27
weeks. EGFRvA polyclonal antibody was purified by affinity chromatography from the rabbit
antiserum.
Western blot
Proteins were separated on SDS–PAGE gels and transferred to nitrocellulose membranes
(Millipore). The EGFR-specific mouse monoclonal antibody (7F4), EGFRvA-specific mouse
monoclonal antibody (1F3-52) were produced by our lab. The anti-phosphotyrosine antibody
(4G10) was obtained from Millipore. The antibodies against AKT, p-AKT, ERK, p-ERK,
HB-EGF and human EGFR (SC-03) were purchased from Santa Cruz Biotechnology. The
antibodies against STAT3 and p-STAT3 were obtained from Cell Signaling. The antibodies
against MMP-2, MMP-9, p-JAK2, JAK2 were obtained from Epitomics. The GAPDH antibody
was purchased from Kang-Chen Bio-tech. All experiments were replicated at least twice.
Immunocytochemistry/immunohistochemistry and H&E staining
For immunocytochemistry, cells were fixed with 4% paraformaldehyde/PBS and
permeabilized with 0.1% Triton X-100/PBS. Samples were blocked with 1% bovine serum
albumn/PBS and stained with anti-EGFR, anti-EGFRvA antibody or Alexa Fluor 594 phalloidin
(Invitrogen). Hematoxylin or DAPI was used for nuclear staining. For H&E and
Immunohistochemistry staining, clinical specimens and mouse tissues were fixed with 10%
buffered formalin, embedded in paraffin wax and cut in serial 4 μm sections.
Immunohistochemistry staining was performed as previously described (1). In every assay, a
positive control and a negative control were used. Stained sections were observed under an
IX71 inverted microscope (Olympus) or a confocal laser scanning microscope (FV1000,
Olympus).
28
Immunoprecipitation
Cells were cultured under normal conditions, or serum starved for 2 h and then treated with
EGF (100 ng/ml) for 8 min or HB-EGF (50 ng/ml) for 2 h. Cells were lysed with lysis buffer
containing 1 mM NaF, 2 mM Na3VO4, and protease inhibitor cocktail (Thermo). A monoclonal
antibody (Ab-3, Neomarkers) recognizing both EGFR and EGFRvA was incubated with cell
lysates at 4°C for 2 h before the addition of protein-G Sepharose. After incubation at 4°C
overnight, immunoprecipitates were washed three times, then mixed with SDS-loading buffer,
electrophoresed, and transferred to nitrocellulose membranes. Blots were probed with
antibodies, and the proteins were visualized using the ECL chemiluminescent detection
system.
Cell proliferation assay
Cells (300 per well) were seeded in a 96-well plate. Cell growth rates were measured using
a CCK-8 Kit (Dojindo Laboratories). The CCK-8 solution (10 µl) was added into 100 µl of
culture media, and the value of optical density was measured at 450 nm. Three independent
experiments were performed.
Cell viability and adhesion assay
Cells were suspended and treated with serial dilutions of AG490 for 30 min at room
temperature. The cell suspension was then added to a Matrigel coated 96-well plate (1×105
cells/well) and incubated at 37℃ in a humid atmosphere with 5% CO2 for 24 hours. For cell
viability assay, the CCK-8 solution (10 µl) was added into 100 µl of culture media. For cell
adhesion assay, washed the wells with PBS three times. Then, added 100 µl of culture media
and 10 µl of CCK-8 solution into the wells. The value of optical density was measured at 450
nm. Three independent experiments were performed.
29
Micro-CT imaging
Mice were anesthetized by intraperitoneal injection with 50 mg/kg pentobarbital and were
then scanned with a Micro-CT scanner (Skyscan 1076, in-vivo X-ray microtomograph). The
serial images obtained were reconstructed in 3D. We investigated the presence of pulmonary
metastasis based on the reconstructed 3D images.
Scoring system for spontaneous metastasis
Based on a previous study (2), a scoring system measuring the degree of metastasis was
established as follows: if no metastatic focus occurred in the lungs or other organs, the degree
was defined as no metastasis; if tumor lesions were confined to less than 30% of the lungs, the
metastases were considered to be minimal; if the lung-confined lesions exceeded 30%, the
degree of metastases was regarded as moderate; and if metastatic foci were observed in at
least one organ or tissue in addition to the lungs, the disease was categorized as having
multiple metastases, which was considered to be the most severe metastatic status.
Microarray analysis
Gene-expression profiling was performed on the CapitalBio 35 k human Genome Array
microchips which contain approximately 35,035 probe sets representing 25,100 genes and
39,600 transcripts. Data obtained from spots on each chip were normalized using the lowess
implementation procedure. Genes with expression ratios (U87MG EGFRvA versus U87MG
EGFR) greater than 2.0 or less than 0.5 were selected as differentially expressed genes.
Microarray data were deposited in the NCBI GEO database under accession number
GSE41230.
Vector constructs
30
HB-EGF promoter was generated by PCR using genomic DNA isolated from the human
glioma cell line U87MG. The 3’UTR of EGFRvA was cloned into pGEMT-Easy vector by
3’-RACE. The 3’UTR of EGFR, 3’UTR of EGFRvA and 3’UTRmut of EGFRvA were cloned
(Xba I) at the downstream of firefly luciferase gene in pGL3 vector (Promega). STAT3 gene
was cloned (Hind III / Xho I) into pcDNA3.1 vector (Invitrogen). The final constructs were
confirmed by DNA sequencing.
Chromatin immunoprecipitation
CHIP assay was performed based on the protocolfrom Millipore-Upstate Biotechnology.
Rabbit anti-STAT3 (06-596, Millipore) was used for immunoprecipitation. The primers
(HB-EGF 1F and 1R) sequences for HB-EGF promoter were listed in Supplementary Table
S4.
RNA interference, transfection and luciferase Assay
STAT3 siRNA (5’-AGUCAGGUUGCUGGUCAAA-3’) (3) and negative control siRNA
(siN05815122147) were purchased from Ribobio. Cells were transfected with 100 nM siRNA
using Lipofectemine 2000 (Invitrogen). 293T cells were transfected according to the
manufacturers’ instructions of Lipofectemine 2000 (Invitrogen). In Fig. 5D, 293T cells were
co-transfected with 300 ng of pcDNA-STAT3 and 50 ng of luciferase reporter, treated with or
without 20 ng/ml human IL-6. In Fig. 7B, 293T cells were co-transfected with 50 ng of
luciferase reporter and 5 pmol of NC (negative control) or miR-542-5p. pRL-SV40 vector
(Promega) was transfected into 293T cells as an internal control for normalizing the
transfection efficiency. After 48h, luciferase activity was measured with the dual luciferase
reporter assay system (Promega), according to the manufacturer’s instructions. The luciferase
activity of each sample was normalized to Renilla luciferase activity. The normalized luciferase
31
activity of control transfection in each experiment was set as relative luciferase activity = 1.
MDA-MB-468 cells were transfected by using Amaxa nucleofection technology (Amaxa),
according to the manufacturers’ instructions. For each nucleofection, 5 µg of plasmids and/or
200 pmol of oligonucleotides was used. Cells at 72 h post-transfection were harvested and
analyzed by Western blot. Cells at 24 h post-transfection were starved overnight and used for
the transwell migration and invasion assays. Cells at 48 h post-transfection were resuspended
and incubated at 37℃ for 16 h onto the coverslips coated with poly-L-lysine (50 µg/ml). Then,
cells on the coated coverslips were stained with Alexa Fluor 594 phalloidin (Invitrogen).
Supplementary References
1. Scartozzi M, Bearzi I, Berardi R, Mandolesi A, Fabris G, Cascinu S. Epidermal growth
factor receptor (EGFR) status in primary colorectal tumors does not correlate with EGFR
expression in related metastatic sites: implications for treatment with EGFR-targeted
monoclonal antibodies. J Clin Oncol 2004;22:4772-8.
2. Xie Q, Thompson R, Hardy K, DeCamp L, Berghuis B, Sigler R, et al. A highly invasive
human glioblastoma pre-clinical model for testing therapeutics. J Transl Med 2008;6:77.
3. Ho HH, Ivashkiv LB. Role of STAT3 in type I interferon responses. Negative regulation of
STAT1-dependent inflammatory gene activation. J Biol Chem 2006;281:14111-8.