a new simplified method of gene typing

Tissue Antigens 1994: 44: 300-305 Prinred in Denmark . All rights reserved

Copyrigh: 0 Munksgaard 1994

T I S S U E A N T I G E N S ISSN 0001-2815

A new simphfied method of gene typing D. Chia, I? Terasaki, H. Chan, A. Acalinovich, E. Maruya, H. Saji, K. Ware. A new simplified method of gene typing. Tissue Antigens 1994: 44: 300-305. 0 Munksgaard, 1994

Abstract: SSP-PCR (sequence-specific primer) DNA typing was performed in Terasaki trays using 1.5 p1 of DNA, and the ethidium-stained PCR product was measured by direct fluorometric reading. Elimination of the gel electrophoresis step greatly simplified the SSP method. 17 sero- logical DR specificities were discriminated for 239 DNA samples utilizing the new method, standard SSP, sequence-specific oligonucleotide probe (SSOP), and restriction fragment length polymorphism (PCR-RFLP). Re- sults showed 98% concordance between the SSP-PCR assay and conven- tional methods. DRBl alleles were determined by PCR-RFLP in 59 samples, by SSP in 110 samples, and by consensus (all methods) in the remaining samples.

Introduction

The PCR assay (1) has revolutionized the detection of DNA polymorphisms. DNA typing by the SSP- PCR method has been used previously for the diagnosis of sickle-cell anemia (2), al-antitrypsin de- ficiency (3), cystic fibrosis (4), and familial defective apolipoprotein B-100 (5) . This approach has also been utilized for the detection of Class I1 HLA alleles (6,7). Compared to the SSOP method (8, 9), the SSP method is preferable, as it requires an amplification step, but no hybridization step. In spite of this, the SSP method has previously been at a disadvantage because it necessitated electrophoresis of the PCR product. This problem was circumvented by ethidium homodimer staining (10, 11, 12), which allowed the direct visualization of PCR product, as the PCR reactions were performed in standard 96-well microtiter trays.

This study describes the performance of SSP- PCR in a Terasaki tray (well volume is decreased to 10 pl) with direct visualization of PCR product (TT-SSP). The miniaturization of this assay allows a 10-fold reduction of DNA sample volume, and results in a dramatic increase in the number of tests that may be performed. In addition, many of the

David Chia, Paul Terasaki, Henry Chan, Andrew Aealinovich, Etsuko Maruya, Hiroh Saji and Krista Ware UCLA Tissue Typing Laboratory, Department of Surgery, School of Medicine, Los Angeles, California, U.S.A., and Kyoto Red Cross Blood Center, Kyoto, Japan

Key words: gene typing - SSP-PCR - TFPCR -

Received 11 April, revised, accepted for publication 8 June 1994

HLA-DRB1

automated devices developed for microcytotoxicity testing may be used in the TT-SSP assay.

Material and Methods Synthesis and purification of primers

Primers were designed using the nucleic acid sequence published by Marsh & Bodmer (13), and were modified as described previously (11). The primers were then synthesized using a Cyclone Plus DNA Synthesizer (Millipore, Bedford, MA), and were purified by HPLC (Varian, Sugarland, TX) using a POROS 20 QE ion-exchange column (PerSeptive Biosystem, Cambridge, MA). Poly- (dG-dC)-(dG-dC), poly-(dA-dT)-(dA-dT), and poly-(dA-dG)-(dC-dT) (Pharmacia, Piscataway, NJ) were mixed at a 1: 1:l concentration by weight. The mixture was then boiled a t 100°C, rapid-cool- ed in an ice bath, and the resultant solution was used to determiner primer concentration. 4 p1 of ethidium homodimer- 1 (Molecular Probe, Eugene, OR) was then added at a concentration of 10 pg/ ml to each 2 p1 of primer. Fluorescence of the primer standard was then measured with 535 nm excitation, a 575 nm dichromic mirror, and 635 nm

300

Simplified gene typing

Primer mixture in wells

0.8 -- 1.2 ng/ul of each primer 0.4 mM dNTP mix 4.0 mM MgC12 100 mM KC1 20 mM Tris-HC1, pH 8.3 0.002% w/v gelatin

Sample Taq Pol

1.5 ul primer mixture per well 10 ul mineral oil per w e l l

V I

Add sample DNA-Taq Polymerase mixture

1 . 5 ul DNA-Taq polymerase / mixture per well DNA (8 ng/ul) ymerase (0.05 units/ul)

PCR t React ,ion

PHC-3 Thermal Cycler (Techne Inc.) 1.) 96'C for 1 min.. 2.) 5 c y c l e s : 97.5'C for 15 s e c . ; 65'C for 20 sec.; 7 2 ' C for 20 sec.. 3.) 27 cycles : 97.5'C €or 15 sec.; 63'C for 20 sec.; 72'C for 20 sec.. 4 . ) 7 2 ' C for 2 min..

Adding fluorescence dye

2 ul of Ethidium dye per w e l l / Ethidium Homodimer (14 ng/ul)

+ V V

Fluorescence measurement of PCR product

Tray read on Lambda Scan reader (One Lambda, Canoga Park, CA.) Excitation filter : 535 nm. Dichromatic mirror : 575 nm. Emission filter : 635nm.

t Result

Figure 1. Schematic for Terasaki Tray PCR

301

Chia et a].

Table 1. Primer sequences used for l l - S S P

No. Alleles 5' Primers 3' Primers

1 2 3 4 5 6 7 8 9

10 11 12 13 14 15 16 17 PC

DRB1.0101, 0103 DRB1'0102 DRBl"O301, 0302, 0303 DRB1'0401, 0405, 0407, 0408, 0409 ORBt'0402,0403,0404,0406,0410,0411,0412 DRBl'O701, 0702 DRBl'O801, 0802, 08022, 08031, 08032, 0804 DRB1.09011, 09012 DRB1'1001 DRB1'11011,11012, 1102, 1103, 11041, 11042 DRB1'1201,1202 DRB1'1301, 1302, 1304, 1102 DRB1'1303 DRB1'1401. 1404,1405, 1407,1408, 1410 DRB1'1402, 1406, 1409 DRB1'1501. 1502,1503 DRB1'1601, 1602 Alpha

CllGTGGCAGCTAAGlTTGAA CTTGTGGCAGCllAAGll lGAA G l T T C l l G G AGTACTCTACGTC ACGTITCllGGAGCAGGllAAAC ACGlTCllGGAGCAGGTTAAAC CCTGTGGCAGGGTAAGTATA AGTACTCTACGGGTGAGTGll GACGGAGCGGGTGCGGTA CGGllGCTGGAAAGACGCG GlTTCTTGGAGTACTCTACGTC ACGGAGCGGGTGCGGlTA G l T T C l l G G AGTACTCTACGTC G m C l l G G AGTACTCTACGTC GlTCCTGGACAGATACllCC TACTTCCATAACCAGG AGGAGA CGTITCCTGTGGCAGCCTAAGA CGXKCTGTGGCAGCCTAAGA GATCCCCCTGAGGTGACCGTG

~ ~~

TGCACTGTGAAGCTCTCAC CTGCACTGTGAAGCTCTCCA TGCAGTAGTTGTCCACCCG TGCACTGTGAAGCTCTCAC CTGCACTGTGAAGCTCTCCA CCCGTAGllGTGTCTGCACAC CGCCTGTCTTCCAGGAT CCCGTAG'TTGTGTCTGCACAC TGCACTGTGAAGCTCTCAC TCTGGCTGTCCAGTACTCCT CCGTAGTTGTGTCTGCAA CCGCTCGTCTCCAGGAT TGTCCACCGCGGCCCGCTT CTGC AATAGGTGTCC ACCT ACCGCGGCCCGCCTCTG CCGCGCGTGCTCCAGGAT AGGTGTCCACCGCGGCG CTGGGCCCGGGGGTCATGGCG

emission filters (Omega Optical, Brattleboro, VT) in a Lambda Scan reader (One Lambda, Canoga Park, CA). The primer standard was shown to be- have linearly at concentrations from 4.5 to 20 pg/ ml at multiple lamp settings.

DNA isolation

A group of 59 samples with known DRBl (determined by PCR-RFLP) and 70 DNA samples from the UCLA cell exchange panel were utilized in this study. Additionally, 1 10 samples were collected from 1.5 ml of blood following lysis of red cells by ammonium chloride. Leukocytes were isolated, treated with 2.5% SDS and 1.9 M guanidine hydro- chloride at 65°C for 30 min, and their DNA was precipitated using 100% ethanol. The extracted DNA was then dissolved in TE buffer (100 mM Tris, pH 8.5, 1mM EDTA). The DNA concentration of the sample was determined by combin- ing 4 p1 of ethidium homodimer-1 (10 mg/ml) for each 2 pl of DNA samples and compared them to dilutions of a standard solution of salmon sperm DNA (Pharmacia).

Table 2. Reproducibility of TT-SSP

DNA DNA 2 N=10 N=8

Mean SD CV (%) Mean SD CV (%)

DRB1'04 2972 581 20 DRB1'09 2389 574 24 2862 496 17 DRBI '15 2667 593 22 PC 3210 499 16 3144 544 18

PCR amplification

The procedure for TT-SSP is shown in Fig. 1. The reaction was performed in a 72-well polycarbonate Terasaki tray (One Lambda). The thermal cycler heating block was modified to accommodate the Terasaki tray, and mineral oil was used to seat the tray on the heating surface and ensure uniform contact. Primer pairs used in the study are listed in Table 1 (alleles 1305, and 1403 would not be detected by these primers). A primer mixture consisting of 0.8-1.2 mg/ml of each primer, 400 pM dNTPs, and PCR buffer (20 mM Tris-HCl, pH 8.3 100 mM KCl, 4 mM MgC12, and 0.002% (w/v) gelatin) was prepared, and 1.5 pl of this mixture were added to each well. Additionally, 10 p1 of mineral oil were overlaid to prevent evaporation, and 1.5 p1 of a DNA-Taq polymerase mixture (5- 8 mg/ml DNA and 5 units/l00 p1 Taq) (Perkin Elmer, Norwalk, CT) were added to each well. The PCR reaction was then conducted in a PHC-3 Thermal Cycler (Techne Inc., Princeton, NJ), using a program of 96.5"C for 1 min, 5 cycles of 97.5"C for 15 sec, 65°C for 20 sec, 72°C for 20 sec, 28 cycles of 97.5"C for 15 sec, 63°C for 20 sec, 72°C for 20 sec, and 72°C for 2 min. Finally, 2 pl of 14 pg/ml ethidium homodimer tray were added to each well of the 72-well Terasaki microtray, and fluorescence was measured as described earlier. The fluorescent value for each well was then sub- tracted from the mean value for all wells of the same DNA. If this computed value was less than zero, the reaction was considered negative. Reac- tions were considered positive if the fluorescent value was greater than 1000, and the mean value [or the same DNA was less than half of the posi-

302


Table 3. Results of 12 DNA typed by Tr-SSP

No. Alleles DNA1 DNA2 DNA3 DNA4 DNA5 DNA6 DNA7 DNA8 DNA9 DNA10 DNA11 DNA12

1 DRB1'0101, 0103 0 0 2 7 0 0 0 0 0 3 2 5 3 0 0 0 0 2 DRB1'0102 0 0 0 0 0 0 3805 0 0 0 0 0 3 DRB1'0301, 0302, 0303 0 421 2832 0 0 3034 0 0 0 11 337 628 4 ORB1 '0401.0405, 0407, 0408, 0409 2 3 9 5 2 2 6 5 0 0 0 0 0 0 0 0 0 0 5 DRB1'0402, 0403, 0404, 0406, 0410, 0411, 0412 0 0 354 0 0 0 0 0 0 0 3427 0 6 DRBl'O701, 0702 0 2 6 0 1 0 0 0 0 0 0 0 0 0 0 7 DRB1'0801. 08021, 08022, 08031, 08032, 0804 3637 0 542 0 0 0 2180 0 0 23 375 0 8 DRB1'09011, 0901 2 0 0 0 2 5 6 1 0 0 0 0 0 0 0 0 9 DRB1'1001 0 0 0 0 0 0 0 0 0 3 4 3 9 1 3 3 0

10 DRB1'11011.11012, 1102. 1103, 11041, 11042 0 0 0 0 0 1969 0 0 0 0 0 0 11 DRB1'1201, 1202 27 115 160 1795 3322 0 0 0 0 0 191 0 12 DRB1'1301, 1302, 1304, 1102 0 D 0 0 3 3 4 0 0 0 0 0 0 0 0

14 DRBl'l401, 1404, 1405, 1407, 1408, 1410 0 0 0 0 0 190 431 3402 0 0 0 118 15 DRB1'1402. 1406, 1409 0 0 0 0 0 0 0 0 3 1 8 3 0 0 0 16 DRB1'1501, 1502, 1503 0 0 0 0 0 0 0 0 0 3045 3433 2772 17 DRB1'1601, 1602 0 0 0 0 0 0 0 0 0 0 0 2 7 7 6

13 DRB1'1303 0 0 0 0 7 9 7 0 0 0 2 6 4 4 0 0 0

tive value. All samples were tested in duplicate. DNA without primer was used as a negative control, and a positive control primer pair was added (Table 1) as a check for PCR amplification failure. The use of internal control was not necessary; by doing the test in duplicate, it is unlikely that both of the duplicate would fail to amplify, while the rest of the wells in the tray did not. The negative control would be the negative alleles for that particular DNA.

Results Reproducibility

The reproducibility results for the positive reactions from two different reference DNA samples

are shown in Table 2. TT-SSP testing was performed on the two samples 8 and 10 times, respec- tively, and the positive and negative reactions for both samples were easily discernible. CVs for the positive reactions ranged from 16 to 24%.

Specificity

The results of DRB1 typing for 12 reference DNA samples by TT-SSP are shown in Table 3 . The fluorescent intensity of the PCR reactions was calcu- lated as described earlier. Positive and negative reactions were readily discernible, although certain primer pairs were found to have higher back- ground levels than others. Positive reactions are listed in bold type (Table 3). We were able to suc-

Table 4. Comparison of DRB1 by PCR-RFLP, consensus from different laboratories, and SSP-PCR to l l -SSP

PCR-RFLP Consensus SSP-PCR

Alleles Numbers Typed Concordance Discordance Numbers Typed Concordance Discordance Numbers Typed Concordance Discordance

DRB1'01 4 4 0 6 5 1 19 18 1 DRB1'03 0 0 0 17 17 0 14 14 0 DRB1'04 26 26 0 19 19 0 24 24 0 DRBl'O7 0 0 0 5 4 1 17 17 0 DRB1*08 14 14 0 12 12 0 2 2 0 DRBl'O9 14 14 0 a 8 0 0 0 0 DRBl*lO 3 3 0 4 4 0 0 0 0 DRB1!11 3 3 0 15 15 0 22 21 1 DRBl'12 7 6 1 8 a 0 0 0 0 DRB1'13 a 6 2 15 15 0 37 37 0 DRB1'14 a 8 0 7 6 1 a 8 0 DRB1'15 26 26 0 11 11 0 38 38 0 DRB1'16 0 0 0 3 3 0 7 7 0 BLANK 5 5 0 10 10 0 32 29 3

SUM 118 115 3 140 137 3 220 21 5 5

Chia et al.

cessfully distinguish 17 alleles of the DRBl gene using TT-SSP.

Comparison of lT-SSP with other DNA typing methods

Table 4 shows a comparison of PCR-RFLP DRB 1 typing for 59 reference DNA samples (14) with typing using TT-SSP. Concordance was shown to be 97% between these two methods of nucleic acid- based typing. In addition, 70 DNA samples from the UCLA cell exchange program were typed both by TT-SSP and other nucleic acid methods, as shown in Table 4. TT-SSP was shown to be in 98% concordance with the consensus results from other typing assays. Finally, 110 DNA samples were typed both by SSP-PCR (1 5) and by the TT-SSP assay, as shown in Table 4. Once again, the two methods were shown to be in 98% concordance.

Discussion

The new DNA-based PCR test, TT-SSP, was shown to provide results comparable to those of PCR-RFLP and SSP techniques. In addition, TT- SSP showed 98% concordance with the consensus typing of 70 reference DNA samples typed by vari- ous methods. Based on these results, this new method is comparable to assays currently available for the typing of DRBI alleles.

The TT-SSP method is extremely simple, as it requires only the addition of DNA with Taq polymerase to a tray previously treated with primers, thermocycling, the addition of ethidium homodimer, and fluoremetric reading of the reactions. Once parameters for the assay have been determined, the test may be performed reproducibly. The quantities of DNA are critical to the performance of this assay, and should be measured carefully to avoid excessive amounts. Secondly, purified primers should be added at specific concentrations to avoid false reactions, and these primers should be designed to increase the quantity of DNA produced by PCR. The thermocycler must also be carefully standardized to work with Terasaki microtrays, to ensure uniform contact and heat transfer. Lastly, Mg++ ion concentration should be optimized for used with the primers, and a clear separation of negative and positive reactions with minimal ambiguity is necessary for the proper performance of TT-SSP.

Future thermocyclers designed specifically for this test could be produced, consisting of a larger flat plate to accommodate as many as four trays. Should 96-well Terasaki microtrays be used in place of 72-well trays, 392 TT-SSP reactions could be performed concurrently, Automated dotting machines already used for cytotoxicity testing

could be utilized to rapidly add primers to trays which would then be frozen for future use. Large- scale TT-SSP typing of cells could be readily ac- complished using current cell adding machines and automated fluorescent readers.

It is envisioned that the much simplified method of TT-SSP will be useful for the testing of many specific DNA sequences other than HLA. Trays pre-dotted with sequence-specific primers for the detection of any particular gene would be frozen, stored, and readily available for testing. A blood sample from a given individual could be simul- taneously tested for numerous disease-associated genes, including sickle-cell anemia (2), cystic fibrosis (4), and others. The same sample could also be analyzed for the presence of microbial DNA, viral DNA, and viral RNA for the diagnosis of infection.

References 1. Saiki R, Scharf S, Faloona F, et al. Enzymatic amplification

of beta-globulin genomic sequences and restriction analysis for diagnosis of sickle cell anemia. Science 1985: 230 1350- 4.

2. Wu DY, Ugozzoli L, Pal BK, Wallace RB. Allele-specific enzymatic amplification of B-globin genomic DNA for diagnosis of sickle cell anemia. Proc Natl Acad Sci USA 1989:

3. Newton CR, Graham A, Heptinstall LE, et al. Analysis of any point mutation in DNA. The amplification refractory mutation system (ARMS). Nucleic Acids Res 1989: 17:

4. Ballabio A, Gibbs RA, Caskey CT. PCR test for cystic fibrosis deletion. Nature 1990: 343: 220.

5. Schuster H, Rauh G, Muller S, et al. Allele-specific and asymmetric polymerase chain reaction amplification in combination: A one step polymerase chain reaction proto- col for rapid diagnosis of familial defective apolipoprotein B- 100. Analytical Biochemistry 1992: 204: 22-25.

6. Olerup 0, Zetterquist H. HLA-DRBI*OI subtyping by allele-specific PCR amplification: A sensitive, specific, and rapid technique. Tissue Antigens 1991: 37: 191-204.

7. Tonai RJ, Geer L, Wang Y, et a]. Oligonucleotide typing of HLA DR by allele-specific PCR amplification. 16th Annual Meeting of the American Society for Histocompatibility and Immunogenetics. Los Angeles. California. USA. 1990. Ab- stract.

8. Saiki RK, Walsh PS, Levenson CH, et al. Genetic analysis of amplified DNA with immobilized sequence-specific oligonucleotide probes. Proc Natl Acad Sci USA 1989: 86 6230-4.

9. Tiercy JM, Morel C, Freidel AC, et al. Selection of unre- lated donors for bone marrow transplantation is improved by HLA class I1 genotyping with oligonucleotide hybridization. Proc Natl Acad Sci USA 1991: 88: 7121-25.

10. Ferencik S, Grosse-Wilde H. A simple photometry detection method for HLA-DRB! specific PCR-SSP products. Eiir J Immunogenetics 1993: 20: 123-5.

1 I . Chia D. Terdsaki P, Chan H, et al. Direct detection of PCR products for HLA class I1 typing. Tissue Antigens 1993: 42:

12. Bein G, Hasse D, Schult J, et al. Semiautomated HLA- DQBl typing by fluorescent dye photometry of amplified

86: 2157-60.

2503-1 6.

I 46-9.

304

DNA on microtiter plates. Hunznn Immunology 1994: 3 9

13. Marsh SGE, Bodmer JG. HLA class I1 nucleotide sequences, 1992. Human Immunology 1992: 35: 1-17.

14. Bignon JD, Cesbron A, Cheneau ML, et al. Selective PCR- RFLP method to distinguish HLA-DR 1 from HLA-DR- “BR” (Dw Bon) allels: Applications in clinical histocompatibility testing. Tissue Antigens 1990: 36: 171-3.

15. Park MS, Tonai R. Phenotype frequencies of the class I1 (DR, DQ) DNA alleles by the patterns of sequence-specific

1-8.


primer mixtures (SSPM) in four different populations and the probable haplotypes between DRBl allele and DQBl allele. Clinical Transplunfs 1992: 8: 475-500.

Address: David Chia, Ph. D. UCLA Tissue Typing Laboratory 950 Veteran Avenue Los Angeles, CA 90024-1652 U.S.A.

305

a new simplified method of gene typing

Documents