a new p53 target gene, rkip, is essential for dna damage … · 2016. 12. 19. · (millipore,...

A New p53 Target Gene,RKIP, Is Essential for DNADamage–Induced CellularSenescence and Suppressionof ERK Activation1,2

Su-Jin Lee, Sun-Hye Lee, Min-Ho Yoonand Bum-Joon Park

Department of Molecular Biology, College of NaturalScience, Pusan National University, Pusan,Republic of Korea

Abstractp53, a strong tumor suppressor protein, is known to be involved in cellular senescence, particularly premature cellularsenescence. Oncogenic stresses, such as Ras activation, can initiate p53-mediated senescence, whereas activationof the Ras-mitogen-activated protein kinase (MAPK) pathway can promote cell proliferation. These conflicting factsimply that there is a regulatory mechanism for balancing p53 and Ras-MAPK signaling. To address this, we evaluatedthe effects of p53 on the extracellular signal-regulated kinase (ERK) activation and found that p53 could suppress ERKactivation through de novo synthesis. Through several molecular biologic analyses, we found that RKIP, an inhibitor ofRaf kinase, is responsible for p53-mediated ERK suppression and senescence. Overexpression of RKIP can inducecellular senescence in several types of cell lines, including p53-deficient cells, whereas the elimination of RKIP bysiRNA or forced expression of ERK blocks p53-mediated cellular senescence. These results suggested that RKIP isan essential protein for cellular senescence. Moreover, modification of the p53 serine 46 residue was critical for RKIPinduction and ERK suppression as well as cellular senescence. These results indicated that RKIP is a novel p53 targetgene that is responsible for p53-mediated cellular senescence and tumor suppressor protein expression.

Neoplasia (2013) 15, 727–737

IntroductionSenescence is one of the cell’s responses to damage. It is induced byvarious stresses such as replicative stress, oncogene activation, telomeredysfunction, and DNA damage [1–6]. In addition, cellular senes-cence is considered as an initial barrier to tumor formation. Indeed,during the tumorigenesis, a large portion of adenoma is regressed bysenescence [6,7].The molecular mechanism behind cellular senescence has not been

fully demonstrated until now. According to previous reports, p53 andp16/Rb pathways are known to be involved in senescence [8]. Induc-tion of p16 and p53 has been observed in murine senescent tissues[6,7,9–11]. In addition, p53 is a well-defined tumor suppressor genethat can induce apoptosis, cell cycle arrest, as well as senescence [12].The main role of p53 is a transcriptional factor that binds to the pro-moter regions of target genes (including p21, PUMA, BAX, PAI-1,etc.) to enhance their expression. In contrast, p53 expression is tightlyregulated by posttranscriptional modifications, which are phosphoryla-tion, acetylation, methylation, ubiquitylation, and sumoylation [13].Among them, phosphorylation of p53 by several kinases (such asATM, Chk1/2, and HIPK) on distinct sites following stresses such as

DNA damage or oncogene activation is essential for regulation ofp53 expression. Although significant increases of p53 have not beenobserved during the normal aging process, transgenic mice exhibitingeither a truncated form of p53 with mutations in the MDM2-bindingdomain or a constitutive p53 C-terminal region that escapes MDM2binding show an aged phenotype [14,15]. Another transgenic mouseexhibiting a BRCA1 mutation also displays this aged phenotype dueto p53 activation in response to endogenous DNA damage [16]. How-ever, simple overexpression of p53 or an elevated expression of p53 due

Abbreviations: Adr, adriamycin; Etop, etoposide; IGF-1, insulin-like growth factor 1Address all correspondence to: Bum-Joon Park, PhD, Jangjeon-dong, Geumjeong-gu,Busan, 609-735, Republic of Korea. E-mail: [email protected] work was supported by the Bio-Scientific ResearchGrant funded by the PusanNationalUniversity (PNU, Bio-Scientific Research Grant) (PNU-2008-101-20080596000). Theauthors declare no conflict of interest.2This article refers to supplementary materials, which are designated by Figures W1 toW5 and are available online at www.neoplasia.com.Received 6 November 2012; Revised 23 March 2013; Accepted 4 April 2013

Copyright © 2013 Neoplasia Press, Inc. All rights reserved 1522-8002/13/$25.00DOI 10.1593/neo.121862

www.neoplasia.com

Volume 15 Number 7 July 2013 pp. 727–737 727

to a deletion of MDM2 cannot induce senescence [17,18], suggestingthat p53-induced senescence only occurs under abnormal condition.Oncogene activation can induce cell cycle promotion as well as

p53-dependent senescence [19–21]. Until now, how these oppositeevents could have occurred by oncogene activation has not been fullydemonstrated. According to a recent report, a negative feedback loopinduced by Ras-Raf-extracellular signal-regulated kinase (ERK) leads toRas-mediated senescence [22]. Considering the fact that oncogenicRas-induced senescence is fully dependent on p53 [20,23,24], nega-tive feedback loop would be related with p53 function. Thus, wepropose the following hypothesis: Cellular senescence is achieved byp53-mediated Ras-mitogen-activated protein kinase (MAPK) signalingsuppression. To address this hypothesis, we examined the effect of p53on MAPK kinase signaling and found that the Raf kinase inhibitorRKIP is a new target gene of p53. Overexpression or induction ofRKIP, which can follow DNA damage or oncogene-induced p53 acti-vation, evokes cellular senescence, whereas RKIP suppression throughsiRNA can inhibit cellular senescence. Moreover, induction of RKIPand subsequent cellular senescence is dependent on modificationof the p53 serine 46 (S46) residue. Considering the frequent reducedlevels of RKIP observed in human cancer tissues, RKIP potentiallyworks as a tumor suppressor linked to induction of cellular senescence.

Materials and Methods

Cell Lines and RegentsA549, MKN45, MKN74, and PC3 were obtained from ATCC

(Rockville, MD), and HCT116 cell lines were kindly provided byB. Vogelstein and K. Kinzler (The Swim Across America Laboratoryat Johns Hopkins and the Howard Hughes Medical Institute at JohnsHopkins Kimmel Cancer Center, Baltimore, MD). Cell lines werecultured in RPMI 1640 (Thermo Scientific, Rockford, IL) with 10%FBS (Thermo Scientific) and 1% antibiotics (Thermo Scientific).Mouse embryonic fibroblast (MEF) cells were cultured in Dulbecco’smodified Eagle’s medium (Thermo Scientific) supplemented with 10%FBS (Thermo Scientific) and 1% antibiotics (Thermo Scientific). Allcell lines were maintained in humidified incubator at 37°C with 5%CO2. Adriamycin (Adr), etoposide (Etop), hydroxyurea, and IGF-1 wereobtained from Sigma (St Louis, MO). Raf kinase inhibitor 1 was ob-tained from Calbiochem (Merck, Darmstadt, Germany). For Westernblot analysis and immunofluorescence staining, anti–phospho-p53(S15, S46 and S392), anti–phospho-ERK, and RKIP were purchasedfrom Cell Signaling Technology (Danvers, MA). Antibodies againstDcR2, p53 (DO-1), and actin were purchased from Santa CruzBiotechnology (Santa Cruz, CA).

Vectors and TransfectionpCMV-RKIP-HAwas provided byG. Keum (DavidGeffen School of

Medicine at University of California, Los Angeles, CA), and p53K302Rand p53K382R [25] were obtained from P. P. Pandofi (Harvard Univer-sity, Boston,MA). p53 S46A and S46Dwere provided by D. B. Donner(University of California, San Francisco, CA) [26]. Si-p53 was providedby L. D.Mayo (Herman B.Wells Center for Pediatric Research, IndianaUniversity School of Medicine, Indianapolis, IN). The pcDNA-ERKexpression vector was obtained from D. S. Min (Pusan National Uni-versity, Busan, Korea). For transfections, we used the jetPEI trans-fection agent (Polyplus Transfection, New York, NY) following themanufacturer’s protocol. The vector (1.5 μg) was mixed with 1.5 μl ofjetPEI reagent in 150 mM NaCl solution. After incubation for 15 min-

utes at room temperature, the mixture was added to the cell. After3 hours, the serum-free medium was replaced with 10% FBS–containingmedium. The si-RKIP oligomer directed against RKIP, which haspreviously been used for RKIP suppression [27], was provided byCosmogenetech (Seoul, Korea). For RKIP suppression, we generatedsi-RKIP, CACCAGCATTTCGTGGGATGGTCTTTCAAGAG-AAGACCATCCCACGAAATGCTGGTG and si-control (Si-C),GCGCGCTTTGTAGGATTCGTTTTCAAGAGAAACGAATCC-TACAAAGCGCGC.

Western Blot AnalysisCells, transfected or treated with chemicals, were lysed with RIPA

(containing a protease inhibitor cocktail) and were centrifuged at14,000 rpm for 30 minutes. Twenty micrograms of cell extracts wasseparated by sodium dodecyl sulfate–polyacrylamide gel electrophoresisand transferred onto a polyvinylidene difluoride (PVDF) membrane(Millipore, Billerica, MA). Blots were blocked in TBS buffer containing0.05% Tween 20 and 3% nonfat dry milk for 1 hour at room tem-perature. The membrane was incubated 1 hour to overnight at 4°Cwith an appropriated primary antibody, followed by reaction with asecondary antibody at room temperature for 1 hour. The proteins werevisualized using West-zol (Intron, Seoul, Korea) as recommended bythe manufacturer.

Immunofluorescence StainingAfter being seeded on cover glasses, cells were transfected with

indicated vectors or treated with chemicals. After fixing with meth-anol for 10 minutes at 4°C, cells were incubated with blocking buffer[phosphate-buffered saline (PBS) + anti-human Ab (1:500)] for 1 hour.After washing with PBS twice, cells were incubated with anti–phospho-ERK and anti-DcR2 in blocking buffer (1:200) for 2 hours andsequentially with anti-mouse Ab–fluorescein isothiocyanate or anti-rabbit Ab–fluorescein isothiocyanate in blocking buffer (1:1000) for2 hours and mounted. Nucleus was stained with 4′,6-diamidino-2-phenylindole (DAPI). Immunofluorescence signal was detected throughfluorescence microscopy (Zeiss, Oberkochen, Germany).

Staining of Senescence-Associated β-Galactosidase ActivityFor senescence-associated β-galactosidase activity staining (SA-β-Gal

staining), cells were incubated with indicated chemicals or transfectedwith indicated vectors for 24 hours. After washing with serum-free me-dium, cells were incubated for an additional 24 hours in serum-freemedium. The cells were then washed with PBS (pH 7.2) and fixed. Afterwashing, cells were stained in X-gal staining solution. All reagents weresupplied by the SA-β-Gal Staining Kit (Cell Signaling Technology).

RNA Isolation and Reverse Transcription–PolymeraseChain ReactionFor mRNA analysis, we isolated total RNA using an RNeasy Mini

Kit (Qiagen, Germantown, MD), and 1 μg of RNA was convertedinto cDNA using MMLV RT (Invitrogen, Carlsbad, CA) and randomhexamer. After dilution, we used the cDNA for subsequent polymerasechain reactions (PCRs) using i-start Taq (Intron). The PCR conditionsincluded a denaturing step at 95°C for 5 minutes, followed by 34cycles of denaturation at 95°C for 1 minute, annealing at 60°C for1 minute, and elongation at 72°C for 1 minute. Reverse transcription(RT)–PCR was performed with specific primers of target genes. Theprimers used in this study were given as follows: RKIP (forward),5′-ATGCCGGTGGACCTCAGCAAGT-3′; RKIP (reverse),

728 RKIP Induces Cellular Senescence Lee et al. Neoplasia Vol. 15, No. 7, 2013

5′-CTTCCCAGACAGCTGCTCGTAC-3′; dual-specific phosphatase14 (DUSP14; forward), 5′-ATGAGCTCCAGAGGTCACAGC-3′;DUSP14 (reverse), 5′-TCCCCCAGTAAGGCATCAGGT-3′;p21 (forward), 5′-CGTGAGCGATGGAACTTCGAC-3′; p21(reverse), 5′-GATGTAGAGCGGGCCTTTGAG-3′; glyceraldehyde3-phosphate dehydrogenase (GAPDH) (forward), 5′-ATCTTCCAG-GAGCGAGATCCC-3′; GAPDH (reverse), 5′-AGTGAGCTTCCC-GTTCAGCTC-3′.

3-(4,5-Dimethylthiazol-2-yl)-2,5-DiphenyltetrazoliumBromide Assay and Cell Proliferation AnalysisTo measure the cell viability, cells were transfected with indicated

vectors for 72 hours. For 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-tetrazolium bromide (MTT) assay, cells were incubated with 0.5 mg/ml MTT solution (Calbiochem) for 4 hours at 37°C. After removingexcess solution, the precipitated materials were dissolved in 200 μlof DMSO and quantified by measuring absorbance at 540 nm.For cell proliferation analysis, after removing the medium, cells werestained with trypan blue solution (Gibco, Darmstadt, Germany) for10 minutes at room temperature.

Chromatin ImmunoprecipitationCells treated with Adr, Etop, or hydroxyurea for 2 hours were fixed

with 1% paraformaldehyde for 0.5 hour. After washing, the cellswere sonicated. After pre-clearing with normal IgG, the lysates wereincubated with p53 (DO-1) antibody and protein A/G agarose bead(Invitrogen) for 1.5 hours at each step. The cells were collected bycentrifugation and washed twice with PBS, after which precipitatedDNA-protein complexes were incubated in DNA extract buffer con-taining protease A for 2 hours at 50°C. Next, we added equal volumesof phenol/chloroform/isoamyl alcohol (25/24/1) solution and isolatedthe DNA. After washing with alcohol, we used the isolated DNA asour PCR template. The primers used in this study were given as fol-lows: RKIP-1 (forward), 5′-ATCTTCCTGCTTTGGCCTCCC-3′;RKIP-1 (reverse), 5′-CTGCCGAGTTCTCGGGAACAG-3′; RKIP-2(forward), 5′-ATCTTCCTGCTTTGGCCTCCC-3′; RKIP-2(reverse), 5′-CTCGACACACGCAGGCTGAAC-3′; DUSP14-1 (for-ward), 5′-ACTGCTCAGCAATTCTGAGGC-3′; DUSP14-1 (re-verse), 5′-GGGCATTTGAGGGCTCATTTC-3′; DUSP14-2(forward), 5′-ACCTGTTCCAGCAAGCGTCAG-3′; DUSP14-2(reverse), 5′-GTCTCTTACCCTGCCTCACAC-3′; DUSP5(forward), 5′-AGTGAGCTTGGGGGCAGAAAC-3′; DUSP5(reverse), 5′-GAGGAGCTGTTTTCTGGTCCC-3′; p21-1 (forward),5′-CTCATGAGGACTCAGCAGAGC-3′ ; p21-1 (reverse),5′-ACATCCTGCCAGGCACATCAG-3′; p21-2 (forward), 5′-CTTAACCACCAGGATACAGCC-3′; p21-2 (reverse), 5′-ACAGTCTGACAGTTCCTCCAG-3′.

Results

DNA Damage Induces Cellular SenescenceTo determine whether the Ras-MAPK pathway plays a role in p53-

dependent cellular senescence, we treated the p53-positive humanA549 lung cancer cell line with a DNA-damaging agent. Because theA549 cell line harbors endogenous oncogenic K-Ras and wild-typep53, cellular senescence is triggered by Adr, which is a topoisomerase IIinhibitor as well as a DNA-intercalating agent [28–31]. Adr treatmentdecreased p-ERK expression, whereas p53 expression was increased(Figure 1A). To verify that the reduced p-ERK expression observed

was a common response to DNA-damaging agents, we examined theeffect of another topoisomerase II inhibitor, Etop, on ERK activation.In previous studies, Adr and Etop have shown mutually incompatibleeffects on p-ERK expression [32]. Indeed, contrary to the effects ofAdr treatment, p-ERK expression increased in response to Etop treat-ment (Figure 1B). According to a previous study, DNA strand breakageslead to apoptosis and cell cycle arrest, whereas senescence results fromDNA damage such as DNA alkylation or intercalation [2]. To comparethe senescence-promoting ability of the two chemicals, we performedSA-β-Gal staining. Adr but not Etop induced cellular senescence (Fig-ure 1, C–E). Because p16/INK and DcR2 are commonly used senes-cence markers [7,33–35], we checked the expression of DcR2 andfound that Adr treatment increased levels of DcR2 (Figure 1, F andG). As the A549 cell line is p16/p14 negative, these results suggestedthat Adr induced cellular senescence in a p16/Rb-independent manner.

Suppression of p-ERK Is a p53-Dependent EventTo verify that p-ERK reduction is achieved in a p53-dependent

manner, we checked the reduction of p-ERK by Adr-treatment inHCT116 p53 isogenic cell lines [36]. In contrast to reduction ofp-ERK and increase of SA-β-Gal–positive cells in response to Adrinp53-positive cell lines, p53-null cells (HCT116 p53−/−) did not showthe reduction of p-ERK and senescence (Figure 2, A and B). However,reconstruction of p53 in HCT 116 p53−/− cells by transfection ofwild-type p53 could restore the Adr-induced senescence (Figure 2C).These results suggest that Adr induced senescence and p-ERK suppres-sion is achieved in a p53-dependent manner.

RKIP Is Induced by Adr but Not EtopBecause the major function of p53 is transcriptional factor [37,38],

we checked the involvement of transcriptional activity of p53 onp-ERK inhibition. Blocking the de novo synthesis of p53 by cyclo-hexamide treatment could block the p-ERK suppression (Figure W1A).We next measured the RNA expression of several Ras-Raf-MAPKinhibitors, including DUSP14, DUSP5, and RKIP. Indeed, DUSP14and DUSP5 have been revealed as p53 target genes [39,40], and RKIPis known to be an inhibitor of Raf-MAPK [41]. The transcripts ofDUSP14 and RKIP were increased by Adr treatment (Figure 2D).Since DUSP5 expression was not altered by Adr treatment (data notshown), we excluded it from our further analyses. In addition, RKIPresponded more specifically to Adr treatment than to Etop treatment,whereas DUSP14 expression did not show obvious difference be-tween Adr- and Etop-treated cells (data not shown). Indeed, RKIPexpression at translation level was obviously induced by Adr treatmentin a time- and dose-dependent manner (Figure 2, E and F). In contrast,Etop did not induce RKIP at the similar condition (Figure 2, E andG).Moreover, DcR2 was increased along with RKIP expression (Fig-ure 2F ), suggesting that RKIP was a mediator of cellular senescence.To confirm this result, we treated Adr on the human gastric cancer cellline MKN45, which harbors wild-type p53 and wild-type K-Ras. Aswe expected, Adr treatment induced the RKIP expression along withsuppression of p-ERK (Figure W1B). These results implicate thatRKIP is a major candidate for reducing p-ERK expression and inducingcellular senescence in response to Adr treatment.

RKIP Is a Direct Target Gene of p53Previously, we showed that reduction of p-ERK showed the

dependence with p53 (Figure 2A), and RKIP was induced by Adr(Figure 2D). Thus, we checked the relevance between p53 and RKIP

Neoplasia Vol. 15, No. 7, 2013 RKIP Induces Cellular Senescence Lee et al. 729

induction. First of all, we measured the expression of RKIP in Adr-treated HCT116 p53 isogenic cell lines and found that induction ofRKIP at transcription and translation levels was fully dependent onp53 status (Figures 3A and W1C ). To confirm this, we transfectedp53 into p53-null HCT116 cells and measured the expression of RKIP.

Overexpression of wild-type p53 could induce the RKIP expression(Figures 3B and W1D). However, ectopic expression of a mutant formof p53 (R175H) did not induce RKIP (Figures 3B and W1D). More-over, p53 knockdown diminished Adr-induced RKIP expression(Figure 3C ). These results indicated that RKIP induction was fully

Figure 1. Adr induced p-ERK suppression and senescence. (A) Western blot analysis of A549 cells showed that p-ERK was reduced aftertreatment with Adr (2 μg/ml) for the indicated amount of time. Actin was shown as a loading control. (B) Western blot analysis of A549 cellsshowed that p-ERK was induced after treatment with Etop (5 μM) for the indicated amount of time. Actin was shown as a loading control.(C) SA-β-Gal staining of A549 cells showed that Adr but not Etop induced cellular senescence. A549 cells were incubated with Adr (2 μg/ml)or Etop (5 μM) for 24 hours in serum-free media. After fixing, cells were stained with SA-β-Gal staining solution. (D) Photograph of SA-β-Galstaining well. (E) Quantification of SA-β-Gal–positive cells. At least 200 cells were counted from three independent experiments, and themean results are represented as a bar graph. (F) Western blot analysis of A549 cells showed that DcR2 was increased by Adr treatment.Cells were incubated with the indicated concentrated chemicals for 4 hours. (G) Immunostaining of A549 cells showed the effect of Adror Etop on DcR2 and p-ERK. After treatment with Adr (2 μg/ml) or Etop (5 μM) for 4 hours, cells were fixed and stained with anti-DcR2 andanti–p-ERK. Nucleus was stained with DAPI.


dependent on p53. To verify that RKIP is direct target of p53, wesearched the RKIP promoter region and found two putative p53 con-sensus binding sequence (CBS; Figure W2). To determine whetherthese sites were occupied by p53, we performed chromatin immuno-

precipitation (ChIP) assay in RKIP promoter, comparing with the p21and DUSP14-2 promoters as positive controls and GAPDH, DUSP5,and DUSP14-1 as negative controls. Of the two p53 CBS in theRKIP promoter region, the second CBS was amplified by ChIP PCR

Figure 2. RKIP is induced by Adr but not Etop. (A) Western blot analysis of HCT116 isogenic cells showed that p-ERK was decreasedin p53-positive (HCT116 p53+/−) cells but not in p53-deficient (HCT116 p53−/−) cells after treatment with Adr (2 μg/ml) for the indicatedamount of time. Actin was shown as a loading control. (B) SA-β-Gal staining of HCT116 isogenic cells showed that Adr induced cellularsenescence in HCT116 p53+/− cells but not in HCT116 p53−/− cells. Etop did not induce cellular senescence in both cell lines. Cellswere incubated with Adr (2 μg/ml) or Etop (5 μM) for 24 hours and subjected to SA-β-Gal staining. (C) SA-β-Gal staining of HCT116 p53−/−cells showed that Adr induced cellular senescence in the presence of p53. Cells were transfected with wild-type p53 for 24 hours andincubated with 1 μg/ml Adr for 24 hours. After fixing, cells were stained with SA-β-Gal staining solution. (D) RT-PCR analysis of A549 cellsshowed that transcripts of RKIP and DUSP14 were increased in treatment with Adr (2 μg/ml) for the indicated amount of time. p21 wasused as a positive control, and GAPDH was used as the loading control. (E) Western blot analysis of A549 cells showed that RKIP wasinduced after treatment with Adr. Cells were incubatedwith Adr (2 μg/ml) or Etop (5 μM) for the indicated amount of time. Actinwas shownas a loading control. (F) Western blot analysis of A549 cells showed that RKIP and DcR2 were increased after treatment with Adr for theindicated time and concentration. Actin was shown as a loading control. (G) Western blot analysis of A549 cells showed that RKIP andDcR2 were not altered after treatment with Etop for the indicated time and concentration. Actin was shown as a loading control.


in Adr-treated cells (Figure 3D). On the basis of these results, wesuggested that RKIP was a direct p53 target gene.

RKIP Is Also Induced by Oncogene Activation or GrowthFactor StimulationTo verify that RKIP induction is common to p53-dependent cel-

lular senescence, we examined RKIP expression under growth factor–and oncogene-induced senescent cells. Insulin-like growth factor 1(IGF-1)–induced senescence is also mediated by the p53 pathway[15,42], and oncogenic Ras-induced senescence is fully dependent on

p53 status [20,21]. Indeed, RKIP expression was induced in IGF-1–stimulated senescent A549 cells (Figure 3, E and F ). Moreover, theinduction of RKIP and DcR2, in response to IGF-1, was only observedin HCT 116 p53+/− cells but not in HCT 116 p53−/− cells (Fig-ure 3G ). In addition, oncogenic Ras could induce RKIP expressionin a p53-dependent manner (Figure 3H ).

RKIP Induces Senescence through ERK SuppressionTo determine whether RKIP induction is required for Adr-induced

senescence, we performed the RKIP knockdown experiment using

Figure 3. RKIP is a direct target of p53. (A)Western blot analysis of HCT116 p53 isogenic cell lines showed that RKIP was induced in HCT116p53+/− cells after treatment with Adr (2 μg/ml) for the indicated time. Actin was shown as a loading control. (B) Western blot analysis ofHCT116 p53−/− cells showed that RKIP was induced in the presence of wild-type p53. Cells were transfected with wild-type or transcrip-tional activity–deficient mutant p53 and treated with Adr (2 μg/ml) for 4 hours. (C) Western blot analysis of HCT116 p53+/− cells showedthat RKIP was not induced after the treatment with Adr following the elimination of p53. Cells were transfected with siRNA against p53 for24 hours and incubated with Adr (2 μg/ml) or Etop (5 μM) for 4 hours. Endogenous p53 was successfully silenced by siRNA treatment, andactin was shown as a loading control. (D) A ChIP assay showed that p53 bound to RKIP promoter. After treatment with the indicatedchemicals for 2 hours, A549 cells were sonicated and then incubated with anti-p53. Following extraction of p53-associated DNA, the pro-moter regions were amplified using specific primers. p21 and DUSP14were used for positive controls, and GAPDH and DUSP5were shownfor negative controls. (E) Western blot analysis of A549 cells showed that RKIP was increased in the growth factor stimulation. Cells weretreated with IGF-1 (5 μg/ml) under serum-free condition for the indicated time. Actin was shown as a loading control. (F) SA-β-Gal staining ofA549 showed that IGF-1 induced cellular senescence. Cells were incubatedwith IGF-1 (5 μg/ml) for 24 hours under serum-free condition andsubjected to SA-β-Gal staining. (G) Western blot analysis of p53 isogenic cell lines showed that IGF-1 as well as Adr induced RKIP and DcR2in HCT116 p53+/− cells. Cells were incubated with Adr (2 μg/ml) or IGF-1 (5 μg/ml) for 4 hours. Actin was shown as a loading control.(H) Western blot analysis of p53 isogenic cell lines showed that oncogenic activation increased RKIP and DcR in HCT116 p53+/− cells.Cells were transfected with H-RasG12V and DN-Ras for 24 hours. Actin was shown as a loading control.


siRNA in A549 cells [27]. Elimination of RKIP could increase ERKactivation and suppress the cellular senescence (Figure 4, A and B).Conversely, RKIP overexpression inhibited ERK activation and in-duced the cellular senescence (monitored by SA-β-Gal and DcR2 ex-pression) in two kinds of p53-deficient cell lines (HCT116 p53−/− cellsand PC3; human prostate cancer cell line; Figures 4, C–E , andW3A). In contrast, suppression of Ras-Raf-ERK pathway using Rafkinase inhibitor could induce the cellular senescence (Figure W3B).These results suggested that elevated expression of RKIP itself is enoughfor induction of senescence and it is mediated by suppression of the

Raf-MAPK pathway. To confirm this, we transfected the ERK ex-pression vector and checked the senescence. Ectopic expression ofERK retained ERK phosphorylation and suppressed RKIP-inducedcellular senescence (Figures 4, F and G , and W3, C and D). To getmore evidence about the physiological role of RKIP, we checked theeffect of RKIP on cell proliferation in several kinds of cell lines usingtrypan blue staining and MTT assay. As we expected, overexpressionof RKIP could suppress the cell proliferation (Figure W4, A andB), whereas RKIP knockdown could promote the cell proliferation(Figure W4, A and C ). Considering these results, RKIP promotes

Figure 4. RKIP is essential for senescence. (A) Western blot analysis of A549 cells showed that treatment with Adr did not reduce p-ERKin the absence of RKIP. Cells were transfected with Si-C or Si-RKIP for 8 hours, and p-ERK expression was measured following treatmentwith Adr (2 μg/ml, 2 hours). Actin was shown as a loading control. (B) SA-β-Gal staining of A549 cells showed that Adr did not inducecellular senescence in the absence of RKIP. After transfection with si-RKIP or Si-C for 8 hours, A549 cells were incubated with Adr (2 μg/ml)for 24 hours. After washing and fixing, cells were stained with SA-β-Gal staining solution. (C) Western blot analysis of HCT116 p53−/− cellsshowed that overexpression of RKIP decreased p-ERK. Cells were transfected with RKIP for 48 hours. Actin was shown as a loading control.(D) SA-β-Gal staining of HCT116 p53−/− cells showed that overexpression of RKIP induced cellular senescence. Cells were transfected withRKIP or empty vector (EV) vector for 48 hours. After washing and fixing, cells were stained with SA-β-Gal staining solution. (E) Immunostainingof HCT116 p53−/− cells showed that RKIP overexpression increased DcR2. After transfection with RKIP for 48 hours, cells were fixed andstainedwith anti-DcR2. Nucleuswas stainedwith DAPI. (F)Western blot analysis of HCT116 p53+/− andMKN45 cells showed that enhancedERK expression prevented the reduction of p-ERK by RKIP. Cells were transfected with RKIP alone or in combination with ERK for 24 hours.Actin was shown as a loading control. (G) SA-β-Gal staining of HCT116 p53+/− and MKN45 cells showed that enhanced ERK expressionovercame the RKIP-mediated cellular senescence. Cells were transfected with RKIP alone or in combination with ERK for 24 hours. Afterwashing and fixing, cells were stained with SA-β-Gal staining solution.


Figure 5. Phosphorylation of the p53 S46 residue is critical for RKIP induction and senescence. (A) Western blot analysis of A549 cellsshowed that phosphorylation of S46 residue of p53 (p–p53 S46) was induced by treatment with Adr but not with Etop. Phosphorylationof other serine residues (S20 and S392) was induced by treatment with Etop as well as Adr. Cells were incubated with Adr (2 μg/ml) or Etop(5 μM) for 4 hours. Actin was shown as a loading control. (B) Western blot analysis of HCT116 p53−/− cells showed that S46D inducedRKIP and DcR2, while S46A did not. Cells were transfected with the indicated vectors for 24 hours. Actin was shown as a loading control.(C) SA-β-Gal staining of HCT116 p53−/− cells showed that S46D promoted cellular senescence with or without Adr treatment. Cells weretransfected with the indicated vectors for 24 hours and treated with Adr (2 μg/ml) for another 24 hours. After washing and fixing, cells werestained with SA-β-Gal staining solution. (D) Western blot analysis of HCT116 p53−/− cells showed that acetyl p53 was not relevant to RKIPinduction. Cells were transfected with the K302R and K382R for 24 hours. Actin was shown as a loading control. (E) Western blot analysisof A549 cells showed that treatment of IGF-1 as well as Adr induced p–p53 S46 and RKIP. Cells were incubated with Adr (2 μg/ml) or IGF-1(5 μg/ml) for the indicated time. Actin was shown as a loading control. (F) Western blot analysis of HCT116 p53−/− cells showed that theelimination of RKIP abolished the effect of S46D on p-ERK and DcR2. Cells were transfected with S46D alone or in combination with siRNAagainst RKIP for 24 hours. Actin was shown as a loading control. (G) Immunostaining of HCT116 p53−/− cells revealed that inductionof DcR2 by S46D was not shown in the absence of RKIP. Cells were transfected with S46D alone or in combination with siRNA againstRKIP for 24 hours. After transfection, cells were fixed and stained with anti-DcR2. Nucleus was stained with DAPI.


cellular senescence and suppresses cell proliferation through inhibitionof ERK activity.

Modification of the S46 Residue of p53 Is Critical for RKIPInduction and SenescenceTreatment with Adr but not Etop induced RKIP expression and

cellular senescence (Figure 2). Moreover, RKIP was a direct target ofp53 (Figure 3D). Thus, our next question is how p53 regulates RKIPtranscript. p53 function and stability are regulated by phosphorylationof its serine/threonine residues, in response to DNA damage or othercellular stresses, resulting in apoptosis, cell cycle arrest, and senescence[43–46]. To clarify the differential outcomes, observed in responseto Adr or Etop treatment, we examined p53 modification, in par-ticular phosphorylation. Interestingly, treatment of Adr but not Etopinduced the phosphorylation of p53 at S46 residue (Figures 5A andW5A). To know that S46 modification is responsible for RKIP induc-tion and senescence, we transfected the phospho-mimic (S46D) ornonphosphorylated (S46A) p53 mutant vector into HCT116p53−/−cells. The S46D p53 mutant, but not the S46A mutant, inducedRKIP and DcR2 expression (Figures 5B and W5B). In addition, wecould observe the increase of SA-β-Gal–positive cells in p53 S46D–transfected cells, regardless of Adr treatment (Figure 5C). In contrast,we did not find the relevance between p53 acetylation and RKIP induc-tion (Figure 5D), although p53 acetylation during cellular senescencehas been proposed [25], and we did not check all kinds of acetyl p53.We could also observe the induction of p-S46 p53 as well as RKIP bytreatment of IGF-1 (Figure 5E ). Moreover, overexpression of S46Dpromoted cellular senescence in an RKIP-dependent manner (Figure 5,F and G ). These results suggested that phosphorylation of the S46residue of p53 would be required for RKIP-mediated senescence.

DiscussionCellular senescence has emerged as a critical barrier against cancerprogression. Indeed, oncogenes such as H-RasG12V, K-RasG12D, orB-RafV600E can induce cellular senescence in mouse models as wellas human cancers [7,9,19,47–49]. Thus, promoting the cellular senes-cence would be useful for tumor suppression.In this study, we found that the Raf kinase inhibitor RKIP serves as

an inducer of cellular senescence through suppression of the cellularproliferation pathway. According to previous reports, RKIP is involvedin progression through the G2/M checkpoint [27] and tumor metas-tasis [50–52]. In addition, RKIP expression is reduced in several typesof human cancers [53–58]. Here, we demonstrate that RKIP is a directtarget of p53 and is responsible for p53-induced cellular senescence.Although p53 is a multifunctional tumor suppressor protein that isinvolved in cell cycle suppression, apoptosis, inhibiting angiogenesis,suppressing metastasis, and promoting senescence [8,12], it is not clearhow p53 activity is differentially regulated, in particular induction ofsenescence. Regarding this, we suggest that p53 is differentially modi-fied at posttranslation level and that phosphorylation of the S46 residueis essential for inducing cellular senescence and RKIP expression (Fig-ure 5). These results provide a basic clue for understanding how dif-ferent triggers regulate p53, although we cannot yet suggest a detailedmechanism for how senescence triggers selective modification of thep53 S46 residue.We have also shown that cells can discern the different kinds of

cellular stresses. In fact, Adr treatment, but not Etop treatment, caninduce senescence obviously. While we do not yet know the detailed

mechanism of this action, Adr can induce RKIP expression and S46modification of p53 (Figures 3 and 5A). These results imply that thereis a kinase that can modify the p53 S46 residue in response to Adr-mediated DNA damage. Concerning this, two S46-responsive kinases,HIPK2 and DYRK, have been proposed [59–61]. However, bothkinases are believed to be involved in p53-mediated apoptosis. Thus,there may be additional kinases that are more directly involved incellular senescence.In our study, we also show the induction of RKIP in response to

IGF-1 and oncogenic Ras transfection (Figure 3, G and H ). In addi-tion, consistently with previous reports that IGF-1– or oncogenic Ras-induced cellular senescence has been proposed to be mediated by p53[15,20], RKIP induction in response to growth factors or oncogenicRas is mediated by p53 (Figure 3, G and H ). Interestingly, despiteof weak induction of p53, the phosphorylation of the S46 residue ofp53 by IGF-1 treatment shows a similar level with Adr treatment con-dition (Figure 5E). These results indicated that RKIP induction wasfully dependent on modification of the p53 S46 residue. We couldalso obtain the similar results from the p53 mutant experiment. De-spite of similar stability of p53 S46D and S46A mutants, they showquite different effect on the induction of RKIP and senescence (Fig-ure 5, B and C). These results explained why simple increases of p53expression do not induce senescence, whereas modified p53 shows astrong effect on cellular senescence [14,15]. During senescence in-duction, either levels of S46-phosphorylated p53 or its mimetic weremore critical than the total intracellular amounts of p53.On the basis of our results (Figure 5) and other’s reports, phosphor-

ylation of p53 S46 residue is critical for cellular senescence and apop-tosis [59–61]. However, S46 residue is not conserved between murineand human. In fact, we did not observe the induction of RKIP inresponse to Adr in mouse embryonic fibroblast (Figure W5C ). Thesefacts imply that the human system may require more complicatesenescence regulation mechanism because of long life span. However,how cellular senescence of mouse cells is regulated by p53 should beinvestigated by further investigation.According to a previous report, RKIP expression is reduced in human

gastric cancers [56,57]. Although the RKIP locus, 12q24, is not knownto be loss of heterozygosity (LOH) in human cancer, RKIP reductionhas been linked with genomic deletion [62]. This result suggests thatdeletion of RKIP can be achieved through microdeletion. Moreover,RKIP expression exhibits an inverse relationship with cancer grades[57]. Higher expressed RKIP in non-neoplastic tissues is reduced toundetectable level in malignant gastric cancer tissues. These resultssuggest that RKIP is not just a metastasis suppressor but also a blockerof tumor initiation. Taken together, our results indicated that RKIP,a novel target of p53, is responsible for p53-mediated senescence.

AcknowledgmentsThis research was supported by Basic Science Research Programthrough the National Research Foundation of Korea funded by theMinistry of Education, Science and Technology (2011-0003383).

References[1] Cristofalo VJ, Lorenzini A, Allen RG, Torres C, and Tresini M (2004). Replica-

tive senescence: a critical review. Mech Ageing Dev 125, 827–848.[2] Lombard DB, Chua KF, Mostoslavsky R, Franco S, Gostissa M, and Alt FW

(2005). DNA repair, genome stability, and aging. Cell 120, 497–512.[3] Balaban RS, Nemoto S, and Finkel T (2005). Mitochondria, oxidants, and

aging. Cell 120, 483–495.


[4] Mooi WJ and Peeper DS (2006). Oncogene-induced cell senescence—haltingon the road to cancer. N Engl J Med 355, 1037–1046.

[5] Irminger-Finger I (2007). Science of cancer and aging. J Clin Oncol 25,1844–1851.

[6] Braig M, Lee S, Loddenkemper C, Rudolph C, Peters AH, Schlegelberger B,Stein H, Dörken B, Jenuwein T, and Schmitt CA (2005). Oncogene-inducedsenescence as an initial barrier in lymphoma development. Nature 436,660–665.

[7] Collado M, Gil J, Efeyan A, Guerra C, Schuhmacher AJ, Barradas M, Benguría A,Zaballos A, Flores JM, Barbacid M, et al. (2005). Tumour biology: senescence inpremalignant tumours. Nature 436, 642.

[8] Campisi J (2005). Senescent cells, tumor suppression, and organismal aging: goodcitizens, bad neighbors. Cell 120, 513–522.

[9] Chen Z, Trotman LC, Shaffer D, Lin HK, Dotan ZA, Niki M, Koutcher JA,Scher HI, Ludwig T, Gerald W, et al. (2005). Crucial role of p53-dependentcellular senescence in suppression of Pten-deficient tumorigenesis. Nature 436,725–730.

[10] Michaloglou C, Vredeveld LC, Soengas MS, Denoyelle C, Kuilman T,van der Horst CM, Majoor DM, Shay JW, Mooi WJ, and Peeper DS (2005).BRAFE600-associated senescence-like cell cycle arrest of human naevi. Nature436, 720–724.

[11] Lazzerini Denchi E, Attwooll C, Pasini D, and Helin K (2005). DeregulatedE2F activity induces hyperplasia and senescence-like features in the mousepituitary gland. Mol Cell Biol 25, 2660–2672.

[12] Harris SL and Levine AJ (2005). The p53 pathway: positive and negative feed-back loops. Oncogene 24, 2899–2908.

[13] Lavin MF and Gueven N (2006). The complexity of p53 stabilization andactivation. Cell Death Differ 13, 941–950.

[14] Tyner SD, Venkatachalam S, Choi J, Jones S, Ghebranious N, Igelmann H,Lu X, Soron G, Cooper B, Brayton C, et al. (2002). p53 mutant mice thatdisplay early ageing-associated phenotypes. Nature 415, 45–53.

[15] Maier B, Gluba W, Bernier B, Turner T, Mohammad K, Guise T, Sutherland A,Thorner M, and Scrable H (2004). Modulation of mammalian life span by theshort isoform of p53. Genes Dev 18, 306–319.

[16] Cao L, Li W, Kim S, Brodie SG, and Deng CX (2003). Senescence, aging, andmalignant transformation mediated by p53 in mice lacking the Brca1 full-lengthisoform. Genes Dev 17, 201–213.

[17] García-Cao I, García-Cao M, Martín-Caballero J, Criado LM, Klatt P, FloresJM, Weill JC, Blasco MA, and Serrano M (2002). “Super p53” mice exhibitenhanced DNA damage response, are tumor resistant and age normally. EMBO J21, 6225–6235.

[18] Mendrysa SM, O’Leary KA, McElwee MK, Michalowski J, Eisenman RN,Powell DA, and Perry ME (2006). Tumor suppression and normal aging inmice with constitutively high p53 activity. Genes Dev 20, 16–21.

[19] Serrano M, Lin AW, McCurrach ME, Beach D, and Lowe SW (1997). Onco-genic ras provokes premature cell senescence associated with accumulation ofp53 and p16INK4a. Cell 88, 593–602.

[20] Ferbeyre G, de Stanchina E, Lin AW, Querido E, McCurrach ME, Hannon GJ,and Lowe SW (2002). Oncogenic ras and p53 cooperate to induce cellularsenescence. Mol Cell Biol 22, 3497–3508.

[21] Sun P, Yoshizuka N, New L, Moser BA, Li Y, Liao R, Xie C, Chen J, Deng Q,Yamout M, et al. (2007). PRAK is essential for ras-induced senescence andtumor suppression. Cell 128, 295–308.

[22] Courtois-Cox S, Genther Williams SM, Reczek EE, Johnson BW, McGillicuddyLT, Johannessen CM, Hollstein PE, MacCollin M, and Cichowski K (2006).A negative feedback signaling network underlies oncogene-induced senescence.Cancer Cell 10, 459–472.

[23] Ventura A, Kirsch DG, McLaughlin ME, Tuveson DA, Grimm J, Lintault L,Newman J, Reczek EE, Weissleder R, and Jacks T (2007). Restoration of p53function leads to tumour regression in vivo. Nature 445, 661–665.

[24] Xue W, Zender L, Miething C, Dickins RA, Hernando E, Krizhanovsky V,Cordon-Cardo C, and Lowe SW (2007). Senescence and tumour clearance istriggered by p53 restoration in murine liver carcinomas. Nature 445, 656–660.

[25] PearsonM, Carbone R, Sebastiani C, CioceM, Fagioli M, Saito S, Higashimoto Y,Appella E, Minucci S, Pandolfi PP, et al. (2000). PML regulates p53 acetylationand premature senescence induced by oncogenic Ras. Nature 406, 207–210.

[26] Mayo LD, Seo YR, Jackson MW, Smith ML, Rivera Guzman J, KorgaonkarCK, and Donner DB (2005). Phosphorylation of human p53 at serine 46 de-termines promoter selection and whether apoptosis is attenuated or amplified.J Biol Chem 280, 25953–25959.

[27] Eves EM, Shapiro P, Naik K, Klein UR, Trakul N, and Rosner MR (2006). Rafkinase inhibitory protein regulates aurora B kinase and the spindle checkpoint.Mol Cell 23, 561–574.

[28] Marchetti A, Cecchinelli B, D’Angelo M, D’Orazi G, Crescenzi M, Sacchi A,and Soddu S (2004). p53 can inhibit cell proliferation through caspase-mediatedcleavage of ERK2/MAPK. Cell Death Differ 11, 596–607.

[29] Crescenzi E, Palumbo G, and Brady HJ (2005). Roscovitine modulates DNArepair and senescence: implications for combination chemotherapy. Clin CancerRes 11, 8158–8171.

[30] Vigneron A, Roninson IB, Gamelin E, and Coqueret O (2005). Src inhibitsadriamycin-induced senescence and G2 checkpoint arrest by blocking theinduction of p21waf1. Cancer Res 65, 8927–8935.

[31] Rebbaa A, Zheng X, Chu F, and Mirkin BL (2006). The role of histone acetyla-tion versus DNA damage in drug-induced senescence and apoptosis. Cell DeathDiffer 13, 1960–1967.

[32] Stefanelli C, Tantini B, Fattori M, Stanic’ I, Pignatti C, Clo C, Guarnieri C,Caldarera CM, Mackintosh CA, Pegg AE, et al. (2002). Caspase activation inetoposide-treated fibroblasts is correlated to ERK phosphorylation and bothevents are blocked by polyamine depletion. FEBS Lett 527, 223–228.

[33] Zindy F, Quelle DE, Roussel MF, and Sherr CJ (1997). Expression of thep16INK4a tumor suppressor versus other INK4 family members during mousedevelopment and aging. Oncogene 15, 203–211.

[34] Krishnamurthy J, Torrice C, Ramsey MR, Kovalev GI, Al-Regaiey K, Su L, andSharpless NE (2004). Ink4a/Arf expression is a biomarker of aging. J Clin Invest114, 1299–1307.

[35] Collado M and Serrano M (2006). The power and the promise of oncogene-induced senescence markers. Nat Rev Cancer 6, 472–476.

[36] Bunz F, Dutriaux A, Lengauer C, Waldman T, Zhou S, Brown JP, Sedivy JM,Kinzler KW, and Vogelstein B (1998). Requirement for p53 and p21 to sustainG2 arrest after DNA damage. Science 282, 1497–1501.

[37] Vogelstein B, Lane D, and Levine AJ (2000). Surfing the p53 network. Nature408, 307–310.

[38] Lowe SW, Cepero E, and Evan G (2004). Intrinsic tumour suppression. Nature432, 307–315.

[39] Ueda K, Arakawa H, and Nakamura Y (2003). Dual-specificity phosphatase 5(DUSP5) as a direct transcriptional target of tumor suppressor p53.Oncogene 22,5586–5591.

[40] Wei CL, Wu Q, Vega VB, Chiu KP, Ng P, Zhang T, Shahab A, Yong HC, Fu Y,Weng Z, et al. (2006). A global map of p53 transcription-factor binding sites inthe human genome. Cell 124, 207–219.

[41] Yeung K, Seitz T, Li S, Janosch P, McFerran B, Kaiser C, Fee F, Katsanakis KD,Rose DW, Mischak H, et al. (1999). Suppression of Raf-1 kinase activity andMAP kinase signalling by RKIP. Nature 401, 173–177.

[42] Campisi J (2004). Fragile fugue: p53 in aging, cancer and IGF signaling. Nat Med10, 231–232.

[43] Blaydes JP and Hupp TR (1998). DNA damage triggers DRB-resistant phosphor-ylation of human p53 at the CK2 site. Oncogene 17, 1045–1052.

[44] Shieh SY, Taya Y, and Prives C (1999). DNA damage-inducible phosphorylationof p53 at N-terminal sites including a novel site, Ser20, requires tetramerization.EMBO J 18, 1815–1823.

[45] Shieh SY, Ahn J, Tamai K, Taya Y, and Prives C (2000). The human homologsof checkpoint kinases Chk1 and Cds1 (Chk2) phosphorylate p53 at multipleDNA damage-inducible sites. Genes Dev 14, 289–300.

[46] Wallace M, Coates PJ, Wright EG, and Ball KL (2001). Differential post-translational modification of the tumour suppressor proteins Rb and p53modulatethe rates of radiation-induced apoptosis in vivo. Oncogene 20, 3597–3608.

[47] Dankort D, Filenova E, Collado M, Serrano M, Jones K, and McMahon M(2007). A new mouse model to explore the initiation, progression, and therapyof BRAFV600E-induced lung tumors. Genes Dev 21, 379–384.

[48] Sarkisian CJ, Keister BA, Stairs DB, Boxer RB, Moody SE, and Chodosh LA(2007). Dose-dependent oncogene-induced senescence in vivo and its evasionduring mammary tumorigenesis. Nat Cell Biol 9, 493–505.

[49] Dhomen N, Reis-Filho JS, da Rocha Dias S, Hayward R, Savage K, Delmas V,Larue L, Pritchard C, and Marais R (2009). Oncogenic Braf induces melanocytesenescence and melanoma in mice. Cancer Cell 15, 294–303.

[50] Fu Z, Smith PC, Zhang L, Rubin MA, Dunn RL, Yao Z, and Keller ET (2003).Effects of raf kinase inhibitor protein expression on suppression of prostatecancer metastasis. J Natl Cancer Inst 95, 878–889.

[51] Keller ET, Fu Z, and Brennan M (2005). The biology of a prostate cancer metas-tasis suppressor protein: Raf kinase inhibitor protein. J Cell Biochem 94, 273–278.


[52] Lee HC, Tian B, Sedivy JM, Wands JR, and Kim M (2006). Loss of Raf kinaseinhibitor protein promotes cell proliferation and migration of human hepatomacells. Gastroenterology 131, 1208–1217.

[53] Chatterjee D, Bai Y, Wang Z, Beach S, Mott S, Roy R, Braastad C, Sun Y,Mukhopadhyay A, Aggarwal BB, et al. (2004). RKIP sensitizes prostate and breastcancer cells to drug-induced apoptosis. J Biol Chem 279, 17515–17523.

[54] Hagan S, Al-Mulla F, Mallon E, Oien K, Ferrier R, Gusterson B, García JJ, andKolch W (2005). Reduction of Raf-1 kinase inhibitor protein expression corre-lates with breast cancer metastasis. Clin Cancer Res 11, 7392–7397.

[55] Al-Mulla F, Hagan S, Behbehani AI, Bitar MS, George SS, Going JJ, García JJ,Scott L, Fyfe N, Murray GI, et al. (2006). Raf kinase inhibitor protein expressionin a survival analysis of colorectal cancer patients. J Clin Oncol 24, 5672–5679.

[56] Chatterjee D, Sabo E, Tavares R, and Resnick MB (2008). Inverse associationbetween Raf kinase inhibitory protein and signal transducers and activators oftranscription 3 expression in gastric adenocarcinoma patients: implications forclinical outcome. Clin Cancer Res 14, 2994–3001.

[57] Wang J, Yang YH,Wang AQ, Yao B, Xie G, Feng G, Zhang Y, Cheng ZS, Hui L,Dai TZ, et al. (2010). Immunohistochemical detection of the Raf kinase inhibitor

protein in nonneoplastic gastric tissue and gastric cancer tissue. Med Oncol 27,219–223.

[58] Hu CJ, Zhou L, Zhang J, Huang C, and Zhang GM (2011). Immunohisto-chemical detection of Raf kinase inhibitor protein in normal cervical tissue andcervical cancer tissue. J Int Med Res 39, 229–237.

[59] D’Orazi G, Cecchinelli B, Bruno T,Manni I, Higashimoto Y, Saito S, Gostissa M,Coen S, Marchetti A, Del Sal G, et al. (2002). Homeodomain-interacting proteinkinase-2 phosphorylates p53 at Ser 46 and mediates apoptosis. Nat Cell Biol 4,11–19.

[60] Hofmann TG, Möller A, Sirma H, Zentgraf H, Taya Y, Dröge W, Will H,and Schmitz ML (2002). Regulation of p53 activity by its interaction withhomeodomain-interacting protein kinase-2. Nat Cell Biol 4, 1–10.

[61] Taira N, Nihira K, Yamaguchi T, Miki Y, and Yoshida K (2007). DYRK2is targeted to the nucleus and controls p53 via Ser46 phosphorylation in theapoptotic response to DNA damage. Mol Cell 25, 725–738.

[62] Chang YS, Lee KY, Lee SH, Koh SH, Hong SW, and Chi SG (2007). Expres-sion and mutation analysis of RKIP (Raf-1 kinase inhibitor protein) in humangastric cancer. J Korean Surg Soc 73, 121–129.


Figure W1. RKIP induction is a p53-dependent event. (A) Western blot analysis of p53 isogenic cell lines showed that p-ERK was re-duced in response to Adr treatment by p53 transcriptional activity. After treatment with cyclohexamide for 2 hours, cells were incubatedwith Adr (2 μg/ml) for another amount time as indicated. (B) Western blot analysis of MKN45 cells (human gastric cancer cell line; wild-type p53 and wild-type K-Ras) showed that p-ERK was reduced after treatment with Adr (2 μg/ml) for the indicated amount of time. Actinwas shown as a loading control. (C) RT-PCR analysis of HCT116 p53 isogenic cell lines showed that transcripts of RKIP were increasedin HCT116 p53–positive cells (HCT116 p53+/− cells) by treatment with Adr (2 μg/ml) for the indicated amount of time. GAPDH was usedas the loading control. (D) RT-PCR analysis of HCT116 p53–deficient cells (HCT116 p53−/− cells) showed that wild-type p53 but notmutant induced RKIP expression. Cells were transfected with wild-type p53 or mutant p53 for 24 hours and incubated with Adr for2 hours. DUSP14 and p21 were used for a positive control, and GAPDH was shown as the loading control.

Figure W2. Promoter regions of RKIP, DUSP14, and DUSP5. The underlined regions indicate the location of the primers used in the ChIPassay. p53 CBS of RKIP and DUSP14. Arrows indicated location of primers for ChIP assay. Detailed sequences of the promoter regionsand their gene ID were represented.

Figure W3. RKIP is critical for cellular senescence. (A) Overexpression of RKIP promoted senescence in PC3 (human prostate cancer cellline; p53-null and mutant K-Ras). Western blot analysis showed the expression of ectopic RKIP, and SA-β-Gal staining revealed that RKIPmediated cellular senescence in PC3, consistent with the result in HCT116 p53−/− cells. Cells were transfected with RKIP for 48 hours.(B) SA-β-Gal staining of MKN45 showed that Raf kinase inhibitor 1 (10 μM) could induce senescence. Cells were incubated with Rafkinase inhibitor 1 for 24 hours with or without other chemicals. After washing and fixing, cells were stained with SA-β-Gal stainingsolution. (C) SA-β-Gal staining of A549 and MKN74 cells showed that ERK overexpression could suppress RKIP-induced senescence,consistent with the results in HCT116 p53+/− and MKN45 cells. Cells were transfected with RKIP alone or in combination with ERK for24 hours and stained with SA-β-Gal staining solution. (D) SA-β-Gal staining of HCT116 p53+/− cells showed that overexpression of ERKcould overcome the RKIP-induced senescence. In contrast, ERK alone did not show obvious effect on senescence. Cells were trans-fected with RKIP or ERK alone or in combination with RKIP and ERK for 24 hours and stained with SA-β-Gal staining solution.

Figure W4. Overexpression of RKIP inhibits cell proliferation. (A) Trypan blue staining of several cancer cell lines revealed the effect ofRKIP on cell growth. Overexpression of RKIP suppressed cell proliferation, while knockdown of RKIP promoted it in A549, MKN45, PC3,and HT-29 cells. After transfection with EV, RKIP, Si-C, or si-RKIP for 72 hours, cells were fixed and stained with trypan blue stainingsolution. (B) and (C) MTT assay of several cancer cell lines showed the effect of RKIP on cell viability. Overexpression of RKIP decreasedcell viability, while knockdown of RKIP increased it in A549, MKN45, PC3, and HT-29 cells. After transfection with EV, RKIP, Si-C, or si-RKIPfor 72 hours, cells were incubated with MTT solution for 4 hours and absorbance at 540 nm was measured.

Figure W5. S46 residue is critical for RKIP expression. (A) Western blot analysis of A549 cells showed that Adr but not Etop induced S46phosphorylation as well as RKIP. Cells were incubated with Adr or Etop in the indicated concentration for 2 hours. Actin was shown as aloading control. (B) Western blot analysis of HCT116 p53−/− cells showed that S46D induced RKIP expression, whereas S46A did not.Cells were transfected with the indicated vector for 24 hours and treated with 2 μg/ml of Adr for 2 hours. Actin was shown as a loadingcontrol. (C) Western blot analysis of p53 wild-type MEF cells showed that RKIP were not increased in treatment with Adr. Cells wereincubated with Adr (2 μg/ml) or Etop (5 μM) for the indicated amount of time. p21 was used for a positive control, and actin was shownas a loading control.

a new p53 target gene, rkip, is essential for dna damage … · 2016. 12. 19. · (millipore,...

Documents