a national survey to verify freedom from white spot syndrome virus and yellow head virus in

1

Size 7.25 x 10 inches

Biosecurity and Risk Assessment

Biosecurity: A New Word for an Old Concept 3Peter Beers, Vanessa Findlay and Ramesh Perera

A National Survey to Verify Freedom from White Spot Syndrome 15Virus and Yellow Head Virus in Australian CrustaceansI.J. East, P.F. Black, V.L. Findlay and E.-M. Bernoth

‘To Hazard or Not to Hazard, That is the Question’: 27How Unknowns in Science Affect the Identification of Hazardsin an Import Risk AnalysisSarah N. Kleeman

The Role of Risk Analysis and Epidemiology in the Development of 35Biosecurity for AquacultureEdmund Peeler

Minimizing the Risks of Aquatic Animal Disease Incursions: Current 47Strategies in Asia-PacificMelba G. Bondad-Reantaso and Rohana Subasinghe

2


3


Biosecurity: A New Word for an Old Concept

PETER BEERS, VANESSA FINDLAY AND RAMESH PERERAAquatic Animal Biosecurity, Biosecurity Australia, PO Box 858,

Canberra ACT 2601

ABSTRACT

Biosecurity is a fashionable word that is being used in a number of different circumstances,these are explored. The concept of biosecurity is used to cover the management of risksarising from biological organisms and agents that may cause harm to living organisms andother aspects of the environment. Following the spread of diseases such as whitespotsyndrome virus and Taura syndrome virus in prawns, Akoya disease in pearl oysters andepizootic ulcerative syndrome in fish, the need for improvement in aquatic animalbiosecurity has been recognised. The principles underpinning the development of abiosecurity program are identified. Biosecurity programs should have a strong scientificbasis and use risk assessment to evaluate risk management approaches so as to ensure thatthe adopted measures provide appropriate protection without unduly hindering businessopportunities.

INTRODUCTION

Biosecurity is a major theme of the Fifth Symposium on Diseases in Asian Aquaculture.This acknowledges the importance of biosecurity to the successful production and harvestingof aquatic animals and some of the recent problems that have resulted from the spread ofdiseases.

As a nation that exports about 70% of its primary production, Australia regards biosecurityas very important. Increasing numbers of live aquatic animals and their products, many ofwhich are not highly processed, are being exported from Australia. Access to many ofAustralia’s export markets, particularly for terrestrial animals and plants, is dependent onthe maintenance of a high health status. The introduction to Australia of internationallysignificant pests and diseases would have a severe impact on access to those export markets.

In common with the rest of the world, aquaculture is of increasing significance in Australia.Although the Australian aquaculture industry is not large on a global scale, aquaculture isthe fastest growing primary industry in Australia. As in other parts of the world, there isincreasing concern about protecting aquaculture, wild fisheries and the aquatic environmentin general, from introduced pests and diseases. Historically in Australia pests and diseasesof aquatic animals did not command much attention and few biosecurity measures for aquaticanimals existed prior to the 1970s, but there is now a call for improved aquatic animalbiosecurity policies.

Beers, P., V. Findlay and R. Perrera. 2005. A New Word for an Old Concept. In P. Walker, R. Lester and M.G. Bondad-Reantaso(eds.). Diseases in Asian Aquaculture V, pp. 3-13. Fish Health Section, Asian Fisheries Society, Manila.

Diseases in Asian Aquaculture V

Peter Beers et al

4


In 1999, this growing concern culminated in the development of a nationally agreed strategicplan for aquatic animal health called AQUAPLAN (AFFA, 1999). It has eight componentprojects:

1. International Linkages2. Quarantine

3. Surveillance, Monitoring and Reporting

4. Preparedness and Response

5. Awareness

6. Research and Development

7. Legislation, Policies and Jurisdiction

8. Resources and Funding

AQUAPLAN is in essence a national level biosecurity plan. It contains objectives, acommunication and information sharing strategy, community awareness programs,surveillance and monitoring programs to detect disease problems, response mechanisms,uses scientific and technical information as a basis for the plan, an administrative frameworkand identified resources for implementation. As is essential with all biosecurity plans,AQUAPLAN is subject to regular review and revision to ensure that it meets contemporaryneeds.

Similar driving forces are at work internationally. Aquaculture has been growing rapidly tofill the widening gap between fisheries production and the demand for fisheries product,but knowledge gaps and the failure to implement adequate biosecurity measures have ledto significant production losses. The need for more effective aquatic animal biosecurity isbeing recognised and discussed in many international fora.

This paper explores what biosecurity is, why the approach to biosecurity for aquatic animalsis changing, the principles that underlie a good biosecurity program and future directionsfor aquatic animal biosecurity.

WHAT IS BIOSECURITY?

Literally biosecurity means ‘life protecting’, but its use appears to be restricted to issuesrelated to preventing the introduction, establishment or spread of unwanted biologicalorganisms or agents.

Biosecurity is a word that has become fashionable in recent times and is being used regularlyin a range of circumstances. The word biosecurity is unlikely to be found in a dictionary,however it is accepted and used by many people as it serves their purpose. Its meaning isreadily understood, most probably because it is a new term used to describe what has beenpractised for a long time in a number of different guises.

New Zealand’s Biosecurity Act of 1993 is one of the first official uses of the word (anon.,1993). Biosecurity is not defined by this Act, but its meaning is clear from the context.New Zealand’s Biosecurity Council has defined biosecurity as “the protection of NewZealand’s economy, environment and people’s health from pests and diseases. It includestrying to prevent new pests and diseases arriving, and eradicating or controlling those alreadypresent.”


5


Biosecurity has also been debated in the United Kingdom Parliament during a recentamendment of the Animal Health Act subsequent to the foot-and-mouth disease outbreak(anon., 2002). Although biosecurity was not defined, its meaning can be gathered from itsuse - “Biosecurity measures are measures taken to prevent the spread of causative agents ofdisease. Causative agent includes any virus, bacterium and any other organism or infectioussubstance which may cause or transmit disease.”

Australia has established the agency Biosecurity Australia. One of its roles is to “permitsafe trade while protecting Australia’s plant, animal (including aquatic animal) and humanhealth, and the environment through scientifically based biosecurity policy.” The otherimportant change in this regard is that Australia now refers to biosecurity instead of whathad historically been termed ‘quarantine’ under the relevant national (federal) legislation,the Quarantine Act. The use of the word ‘quarantine’ in this way has caused confusioninternationally as in most other countries quarantine is used to refer to the (mandatory)isolation of people, animals, plants or goods for a period during which their health status isdetermined or they are rendered ‘safe’. Biosecurity is a more appropriate word which moreaccurately covers the range of issues dealt with by the Australian Quarantine Act.

The word biosecurity has become more widely used since the attack on the World TradeCentre last year and it is frequently used in association with terms such as food security andbioterrorism. In the latter case it refers to protection against the use of pathogens, such asanthrax, to infect the civilian population or to infect animal and plant populations to disruptproduction and trade. Biosecurity is also used with regard to xenotransplantation and thethreat of the transmission of agents between species.

The common theme running through all these situations, is the concept of taking appropriatemeasures or putting procedures in place to manage the probability of a biological organismor agent spreading to an individual, population or ecosystem and the harm that may result.

The biological organism or agent in these circumstances encompasses:

1. a recognised disease agent of humans, animals or plants (eg viruses, bacteria, fungi,prions, parasites);

2. a new or novel disease agent of humans, animals or plants;

3. a recognised pest species that causes economic damage; or

4. a species that would cause ecological degradation, reduce biodiversity, or other adverseenvironmental effects.

The population at-risk of harm caused by the unwanted biological organism or agent (usuallypests and disease agents) are humans, plants or animals or some combination of these,though in some circumstances it could conceptually extend to the causing of harm to thephysical environment alone. The geographic spread of the at-risk population could be theentire planet, a group of countries (e.g., European Union), a region involving parts of severalcountries (e.g., Mekong River basin), a single country, a sub-national region, a farmingenterprise or establishment, a production unit (e.g., a pond) or an individual plant or animal.Biosecurity can be applied at all of these levels and appropriate programs should be developedas necessary for each level.

Peter Beers et al

6


AQUATIC ANIMAL BIOSECURITY

An improvement in biosecurity practices is an increasingly pressing issue for fisheries andaquaculture managers, particularly as the value of aquatic animal production grows. Resourceprotection, food security, trade, production/profitability and investment/development issuesare driving this change.

A stock-take of biosecurity outcomes for aquatic animals worldwide would show that somesystems perform poorly, while other systems are successful.

Recent examples of major losses suffered by aquatic animals from pest or disease spreadinclude the carp mortalities in Java, the infectious salmon anaemia outbreaks (and subsequentdisease control programs) in Norway, the United Kingdom and North America, the whitespotsyndrome virus and Taura syndrome virus epidemics in prawn aquaculture, the spread ofepizootic ulcerative syndrome (EUS) in Asia and Akoya disease in Japanese pearl oysters.There are many other less spectacular examples of disease loss, which are important at alocal level as they result in loss of production, perhaps resulting in unemployment or foodshortages, loss of market access or market share, leading to bankruptcy or industry failure,reduction in industry development and investment, or environmental degradation. The flow-on effects to downstream processors and local communities can be severe.

Biosecurity practices are well developed in the intensive terrestrial animal industries,particularly the pig (swine) and poultry industries. Disease associated mortalities in thepast, made more acute by increasingly intensive husbandry practices, have demonstratedthe negative impacts of poor biosecurity practices. Even for diseases that do not result inhigh mortality levels, small percentage decreases in production, for example in feedconversion efficiency, can significantly impinge on an enterprise’s profitability when largenumbers of animals are involved. The situation in aquaculture is no different.

Worldwide, communities are demanding protection of the natural environment includingthe conservation of biodiversity and fisheries stocks. Many see aquaculture as a threateningprocess to wild stocks because of the movement of pests and diseases and changes in theprevalence of diseases brought about by aquaculture. As wild fishery resources are exploitedat their maximal sustainable levels, or beyond, those with access want to see ‘their resource’protected from threats, including from the spread of pests and diseases.

International trade rules have altered with the introduction of the World TradeOrganization’s Agreement on the Application of Sanitary and Phytosanitary Measures (WTOSPS Agreement) (WTO, 1994). New rights and obligations affect the way membergovernments develop and implement biosecurity measures. In developing countries theaquaculture production of species such as shrimp is often for export and has become animportant source of foreign exchange. Sudden loss of export markets can have a devastatingeffect on communities and economies. On the other hand fishers, farmers and investors inthe importing country, demand government action to protect against the introduction offoreign pests and diseases which threaten local production.

Biosecurity concerns for aquatic animals are heightened by the recognition of new pest anddisease threats and the serious losses that have resulted, the so-called ‘dread factor’. Theexpansion of aquaculture into new species and locations, coupled with intensification, has


7


created new problems. ‘New age, real time communication’ has allowed the rapiddissemination of information, often incomplete stories that are sensationally presented.Reports in the industry and scientific press, while tending to focus on severe examples,may provide a fuller picture, but their publication and critical assessment can be delayed.The seriousness of the situation can be overstated to raise the profile of the problem, oftento gain an advantage in the search for further financial support. The rapid transmission of adistorted description can elicit a fear response by producers in other countries not familiarwith the issues. This in turn can lead to demands for increased government protection andconsumers switching to other commodities, even when there is no direct threat to theirhealth.

PRINCIPLES OF A GOOD BIOSECURITY PROGRAM

The basic premise that underpins a biosecurity program is not complex; it is, in essence, thepractical application of information to the management of identified risks. A biosecurityprogram is developed through the scientific analysis of information with the aim of adoptingprocedures to manage risks to an acceptably low level, ie through a risk assessment approach.The use of sound epidemiological principles and a logical, structured approach will resultin a more accurate outcome. The management of biosecurity risk has a cost, including thedirect cost of applying the measures, the indirect cost of loss of access to materials, changesin product quality and the diversion of resources from other useful functions. A riskassessment approach to the development of biosecurity programs allows for the identificationof the most cost effective way to manage risks.

A biosecurity program that does not take into account the potential pest or disease impact,the expected benefits of the program, the cost of implementing the program, and its likelyeffectiveness could be wasting resources. Such an assessment should factor in future benefitsthat may accrue. There is little point in spending more in managing the risk of a pest ordisease incursion, if its establishment would result in lower losses than the exclusion programcosts to run.

The key elements in developing a biosecurity program should include:

� identification of the at-risk population that is to be protected by the program;� identification of the threats/hazards;� identification of the pathways by which the hazards could be introduced, establish or

spread in the at-risk population;� assessment of the likelihood of the hazards being introduced, establishing or spreading

in the at-risk population;� assessment of the level of harm that would result;� if the risk is unacceptable, assessment of the effectiveness of the risk management

measures that could be used to mitigate the risk;� documentation of the program, its performance and auditing of the program;� regular critical review of the program to ensure that the objectives are current and the

measures are still the most appropriate;� preparation of contingency plans;� involvement of the program’s participants in its development and operation; and� provision of adequate resources to implement the program.

Peter Beers et al

8


The same basic principles apply to developing a biosecurity program whether the programis for an entire country or a single tank of animals.

In the case of commercial enterprises, the biosecurity program should be part of a broaderbusiness risk management program for the enterprise covering other risks such as cash-flow problems, physical damage (e.g. cyclones, floods) and marketing problems. Forgovernments, a biosecurity program may be part of a wider industry development program.

As an initial step, the objectives of the biosecurity program need to be identified to ensurethat the program is well targeted. This includes a description of the population at-risk, thepotential threats and identification of the pathways by which pests and diseases could beintroduced.

Technical information needed for risk assessment

Accurate information is looked-for in undertaking biosecurity assessments; the better theinformation, the more accurate the assessment and appropriate the risk managementmeasures. Biosecurity programs can only be as effective as the information on which theyare based. In essence, scientific information can help refine risk management measures byallowing better targeting of the risks. For example, expert knowledge of the life cycle of thepest or disease agent, its interaction with the host and environment can frequently identifyplaces where its life cycle can be easily broken, with greater certainty and more costeffectively. It can also provide alternative approaches to managing the pest or disease agentwithout the cost and inconvenience of isolating the host, such as breeding for geneticresistance or using host species or varieties that are resistant to disease, the use of strategicvaccination, and altering the environment to break the pest lifecycle.

Scientific information can be drawn from many sources including the peer-reviewedliterature, from practical observation and experience, good practices used by other industries,demonstration farms, or from specific studies. Before use, all information should be criticallyevaluated for relevance and experimental design limitations. The risk assessment processcan be used to identify gaps in the available data and their significance, thus providingfuture research direction and priorities.

Gaps in the scientific information are something with which aquatic animal biosecurity riskassessors are very familiar. For many aquatic species, knowledge of their pests and diseasesis at best rudimentary. There is an increasing list of new pests and disease agents and newhosts for well-known pathogens. This trend can only be expected to continue. Research isnecessary to gather baseline information, which can be used to help interpret new diseaseevents and findings, and assist in determining if revised biosecurity risk managementmeasures are needed.

Risk management

Decisions still need to be made irrespective of whether the scientific information is sufficientor not – it is not an option to delay taking action to protect the at-risk population. In suchcircumstances the best available information and expert opinion should be used as the basisof the biosecurity program. In situations where the available information about the pestsand disease agents of an aquatic animal species is substantially deficient, general operating


9


practices and principles can be adopted to address the theoretical biosecurity risks. Theprinciples used to manage known risks can often be effectively applied to emerging diseaseagents while further specific information is obtained. Frequently, epidemiologicalinformation about related pests and disease agents can provide guidance to measures thatmay be effective. In such circumstances, pending better data becoming available, it is usualto take a precautionary approach because of the uncertainty surrounding the effectivenessof the measure. Similarly, measures used to manage risk from one pest or disease agentmay be effective in controlling the spread of other pests and disease agents.

A biosecurity program should only use necessary measures to manage the risks and notimpose unnecessary impediments. There is a balance between the benefits of maintaining/improving the current pest and disease status and costs of implementing the measures. Indetermining which measures to apply, consideration should also turn to the feasibility ofsuccessfully implementing the measures, including the availability of technology andreliability of the infrastructure. If the measures are unpopular or provide incentives to breakthem, such as a financial benefit, trade may be driven underground and result in lesserlevels of biosecurity protection than could otherwise be achieved by less stringent measures.Biosecurity risk managers should choose risk management measures for which complianceis easy to confirm or police.

In practice, there are many ways to manage biosecurity risk. Common approaches includethe exclusion of genetic material or isolation of the population at-risk; testing to confirmdisease status; vaccination; altering the environment to make it unsuitable for the pest ordisease agent; treating the animal/product to kill the pest or disease agent; use of diseasefree zones or other restrictions on source; controlling the use of product to minimise exposure;and using reproductive materials instead of live animals. Risk assessment is the mostappropriate way of determining which measure or combination of measures is the mosteffective at achieving the program’s objectives.

Documentation

The biosecurity plan should be written down. This will provide continuity when there arestaff changes and a basis for evaluation and review of effectiveness over time. Biosecurityprograms should be regularly reviewed to ensure they remain current and meet new oraltered risks. Record keeping of the program’s performance provides a source of informationfor reviews and a basis for retrospective studies if the system fails. A system designed toprovide measurable outputs for audit purposes will assist in this regard.

The role of the participants in the biosecurity program and specific actions they need totake should also be documented. The provision of standard definitions for important termsensures a common understanding by the participants. Confusion is likely to lead toinappropriate actions, error and increased biosecurity risks.

Emergency response

There is always a chance of failure with biosecurity programs. Often this is a result ofinsufficient information for an accurate assessment of risk or human error. Biosecurityprograms usually only seek to manage risk, not to eliminate it. It is usually not economically

Peter Beers et al

10


feasible to eliminate risk. To reduce the impact of biosecurity failure, a sound epidemiologicalapproach needs to be taken to the investigation of disease outbreaks to ensure rapididentification of the agent concerned. For the eventuality that pests and diseases enter,response plans should be prepared to minimise impact and isolate and eliminate the pest ordisease agent rapidly. In preparing a response plan consideration should be given to damagethat may eventuate and whether the response plan could cause more harm through restrictionson trade. The rapid dissemination of authoritative information can facilitate prompt responsesand minimise impacts.

Communication

Communication, education and awareness are critical to a successful biosecurity program.The participants in a biosecurity program, whether beneficiaries or employees, need tounderstand their role and have sufficient training and resources available to effectivelyaccomplish their role in the program. Their views and practical experiences should becaptured and used in the design of the biosecurity program. Other community memberswho may benefit from, or who may adversely affect the functioning of, a biosecurity programneed to be aware of the program so that they can contribute responsibly. A targetedcommunication strategy is required; modern communication technologies can assist indisseminating information quickly to a wide audience.

Biosecurity programs can and should be adopted by all enterprises holding aquatic animals.In the majority of situations enterprises, particularly commercial production units, can notoperate their biosecurity programs in isolation. For example, neighbouring aquacultureestablishments and other users of the water resources may contaminate the water supply orincrease the load of disease agents in the local environment. Governments often do nothave the resources to fully enforce all the biosecurity measures which it may have put inplace. Industry needs to cooperate with government to ensure effective operation ofbiosecurity measures. Individual farmers should also work together to identify and addresscommon risks.

Resources

For a biosecurity program to operate effectively and achieve its goals, adequate resourcesto implement the program and maintain its operation are essential. If resources are inadequateit is better to review and revise the program to ensure that the most cost effective measures,with the greatest chance of success, are put in place.A biosecurity program can also be developed from the perspective of using it as a sellingpoint to gain a market advantage and differentiate product in the marketplace. In thesecircumstances, market research can be performed to understand how the market wouldreact and whether there is a sufficient price differential to justify the costs of the program.

These same principles apply no matter the size of the population at risk. Aquacultureestablishments should not rely on Government controls being totally effective. These maybreak down from time to time for any number of reasons. Biosecurity risk managementmeasures at the local level may provide sufficient barrier to prevent infection in the shortterm until the emergency response plan is activated.


11


Aquatic animal industries can build on the models developed by the other intensive animalfarming industries. Intensification has meant that they too have had to develop systems todeal with biosecurity issues ñ the same principles apply although there may be addedcomplications arising from the number of aquatic animal species, sharing of water supplies,knowledge gaps, etc.

THE SPS AGREEMENT

Trade is an increasingly important driving force for aquatic animal biosecurity. The SPSAgreement provides an internationally enforceable set of rights and obligations on the useof biosecurity measures by governments. Member countries of the WTO have a basic rightto take necessary, scientifically justified measures to protect human, animal and plant lifeor health or their territory from damage by a pest, but these measures must be no more traderestrictive than necessary. Trading partners (or exporting countries) can demand that measuresare justified and that alternative ways of managing risk are considered.

Sufficient scientific information is required to justify the imposition of measures bygovernments or to argue that alternative measures provide sufficient safeguard. The existenceof effective official monitoring and surveillance programs is important in this regard. Suchprograms must use appropriate methodologies for sampling and testing, be backed by suitabletransport and laboratory infrastructures, and have systems for collating and reporting theresults.

There is one difference between the measures that non-governmental enterprises may useand the mandatory government controls at national and sub-national levels. This differenceresults from the international obligations that arise for WTO member countries from theSPS Agreement. For governments, the objective in managing biosecurity risk must bedetermined across the whole range of biosecurity activities. Governments must seekconsistency in the level of protection they achieve (the so called appropriate level ofprotection or ALOP). Other than in the setting of their general objective (ALOP) for theentire biosecurity program, i.e., for aquatic animal biosecurity as a whole, Governmentsare limited in the consideration they can give to benefits in their decision-making. Non-governmental enterprises on the other hand are not limited in what they take into account;nor do they have to ensure that they approach the management of risks in a consistentmanner. They can undertake a cost benefit analysis for each measure and vary their approachto risk management as it suits them. For example, a farmer can choose to accept a higherlevel of risk in particular circumstances where the expected benefits are seen as to be worththe risk (such as bringing in new genetic material).

DEVELOPING COUNTRIES

Developing countries can commence their biosecurity programs at a level which can bemore easily and effectively implemented in their circumstances. An important initial step isto educate farmers about the risks, good risk management practices and how to reduce therisk of disease spreading between neighbours. The establishment of local networks canhelp raise awareness and foster a cooperative approach to problems.

Peter Beers et al

12


Biosecurity programs should be developed with achievable objectives, commensurate withthe available resources and technologies, and with regard to the robustness and reliabilityof the system. Programs should take into account the impact of the measures on the farmersand ensure there are clear benefits to the farmers, so that they will be willing to participate.The program should be regularly reviewed to ensure it is still appropriately structured, ismeeting the needs of participants, is using appropriate technologies, remains cost effectiveand is addressing the current threats.

THE FUTURE

The level of biosecurity protection provided to the natural and built aquatic environmentwill increase because of the investment at risk and the property value given to the wildfishery and environmental values. The movement towards science-based risk assessmentto develop biosecurity measures will gather pace because of the need to justify the measuresto trading partners, investors, resource managers and the community more generally.

Consumer demand for high quality, healthy product will be another driving factor towardsimproved biosecurity. Rapid communications will mean that industry and governmentswill have to work closely together and be more responsive to consumer requirements.

The interdependence of aquaculture establishments sharing a common water resource, andtherefore common biosecurity threats, will lead to greater levels of local and regional co-operation in managing associated risks.

More emphasis in aquatic animal health research will be placed on generating informationto support biosecurity assessments to improve their accuracy and better-targeted riskmanagement measures.

There will be a movement back to basic investigatory studies. Although more sophisticatedmethodologies are very useful, provide specific information and are cost effective, theirspecificity doesn’t allow for the collection of more general observational information,especially in poorly studied aquatic animal species. With aquatic animal species much basicinformation is still needed to allow accurate biosecurity risk assessment and risk management.

CONCLUSIONS

Farmers have always cared for their stock, providing feed, shelter, water and health care.As scientific knowledge increases and the world becomes smaller, these basic husbandryskills must be expanded to include elements of prevention and harm minimisation. Improvedapproaches will be based on scientific assessment, including consideration of the costs andbenefits; competitive pressures for continual improvement; and societal expectations.

Appropriate biosecurity management could have prevented many of the serious lossesexperienced in aquaculture in recent years. Biosecurity risks are increasing every year asaquaculture develops, new species are cultured and new host-pathogen-environmentinteractions are tested.

Biosecurity makes good use of science, makes good sense and is good practice when usedappropriately. It can be a cost effective way of managing pest and disease risks.


13


REFERENCES

AFFA (Agriculture, Fisheries and Forestry – Australia). 1999. Aquaplan: Australia’s National StrategicPlan for Aquatic Animal Health 1998-2003. Department of Agriculture, Fisheries and Forestry,Canberra.

Anonymous. 1993. Biosecurity Act, 1993 No. 95. New Zealand Government, Wellington.

Anonymous. 2002. Debate on Amendment 20, Third Reading of the Animal Health Bill, House ofLords, Monday 4 Nov. 2002. Lords Hansard Volume 640 (Part 199). United KingdomParliament, London.

WTO (World Trade Organization). 1994. Agreement on the Application of Sanitary and PhytosanitaryMeasures. WTO, Geneva.

14


15


A National Survey to Verify Freedom from White Spot SyndromeVirus and Yellow Head Virus in Australian Crustaceans

I.J. EAST1, P.F. BLACK2, V.L. FINDLAY3 AND E.-M. BERNOTH1

1Aquatic Animal Health, Office of the Chief Veterinary Officer, Agriculture,Fisheries and Forestry – Australia, GPO Box 858, Canberra, ACT 2601

2Animal Health Sciences, Office of the Chief Veterinary Officer, Agriculture,Fisheries and Forestry ñ Australia, GPO Box 858, Canberra, ACT 2601

3Aquatic Animal Biosecurity, Biosecurity Australia, Agriculture, Fisheries andForestry – Australia, GPO Box 858, Canberra, ACT 2601

ABSTRACT

An Australia-wide survey was conducted to determine the infection status of Australiancrustaceans for white spot virus (WSSV), yellow head virus (YHV) and gill-associatedvirus (GAV). The survey was designed using the FreeCalc software package to detect awithin-site prevalence of greater than 10% with 95% confidence for each virus. The siteprevalence for each virus was assumed to be 10%. Samples of the predominant crustaceanspecies were collected from 66 locations throughout Australia and tested for WSSV. Samplesfrom thirty locations were collected and tested for GAV and YHV. Testing for all virusesinvolved the use of Polymerase Chain Reaction (PCR) techniques. Neither WSSV norYHV were detected in any Australian crustaceans. GAV was detected in samples collectedfrom the previously known range of this virus along the Pacific Coast of Queensland andalso from Weipa in the Gulf of Carpentaria.

INTRODUCTION

White spot syndrome virus (WSSV) and yellow head virus (YHV) are the major pathogensthat affect the prawn farming industry throughout south and southeast Asia. WSSV is adouble-stranded DNA virus that is potentially lethal to most of the commercially cultivatedpenaeid shrimp species and can also cause sub-clinical infections in a range of othercrustacaeans including crabs, lobsters and freshwater crayfish (Flegel, 1997). YHV is asingle-stranded RNA virus that affects Penaeus monodon and has been shown experimentallyto infect other penaeid prawns (OIE, 2000). Both WSSV and YHV can cause outbreaks ofdisease that propogate rapidly and that can result in 100% mortality within a few days.

YHV was first reported in Thailand in 1990 (Limsuwan, 1991), and WSSV first occurred inChinese Taipei and the Chinese mainland between 1991 and 1992 (Nakano et al., 1994).Since that time, both viruses have spread throughout all prawn farming regions of south


East, I.J., P.F. Black, V.L. Findlay and E.-M. Bernoth. 2005. A national survey to verify freedom from white Spot syndromevirus and yellow head virus in Australian crustaceans. In P. Walker, R. Lester and M.G. Bondad-Reantaso (eds). Diseases inAsian Aquaculture V, pp. 15-26. Fish Health Section, Asian Fisheries Society, Manila.

I.J. East et al

16


and southeast Asia from Pakistan in the west to Indonesia in the east (OIE, 2001). In 1999,WSSV spread to central and south America. Australia, New Zealand and the islands of theSouth Pacific are currently free of both WSSV and YHV (OIE, 2001). In 1997, a virus thatwas morphologically indistinguishable from YHV and that had caused mass mortalities infarmed Penaeus monodon was reported from Australia (Spann et al., 1997). The virus wasnamed gill-associated virus (GAV) and was subsequently shown to have approximately85% nucleotide sequence identity with YHV (Cowley et al., 1999).

Increasing world trade in agricultural commodities has lead to concern about the potentialto introduce exotic diseases through the movement of these commodities. An example ofthis was the demonstration that green prawns imported into the USA were shown to containviable WSSV and YHV (Nunan et al., 1998). The 1995 outbreak of WSSV and YHV in theUnited States may have been associated with the inappropriate disposal of waste generatedfrom the processing of imported green prawns (Lightner et al., 1997).

The potential threat that imported green commodity prawns poses to Australia wasdemonstrated when, in November 2000, animals from two aquaculture research facilities inDarwin returned positive PCR tests indicative of WSSV infection. The possible source ofinfection was traced to imported green commodity prawns used as feed in both establishments.Although no clinical evidence of WSSV was observed, the Consultative Committee onEmergency Animal Diseases (Australia’s technical committee for management of the responseto emergency disease incidents) considered it prudent, due to the possible presence of viableWSSV in green commodity prawns and the possible diversion of these prawns into theaquaculture feed and bait markets, to conduct a national survey to determine whether WSSVexisted in crustacean populations within Australia. Due to the considerable effort involvedin collection of the samples, the opportunity was taken to also examine the samples for thepresence of YHV and GAV. In this paper, we report on the outcomes of a survey conductedto examine the infection status of Australian crustaceans for WSSV, YHV and GAV.

MATERIALS AND METHODS

A national survey was undertaken to determine whether WSSV, YHV and GAV were presentin Australian crustacean populations. The survey design utilised a two-stage sampling strategyas described by Cameron and Baldock (1998). In the absence of a defined sampling framefor wild crustacean populations (“herds”) within Australia, two assumptions were made:

1. There are 500, independent, non-interacting populations of crustaceans withinAustralian coastal waters. This figure was a conservative estimate based on the lengthof the Australian coastline being 36,735 km (ABS, 1996) and studies on prawn larvaladvection to estuarine nursery grounds that demonstrated that the limit of recruitmentwas no more than 65 km from the estuary (Rothlisberg et al., 1996).

2. Sampling at a range of geographically distant sites adequately represented randomsampling at the site level of the survey.

Expected prevalence of disease

It was assumed for the purposes of this survey, that if WSSV, YHV or GAV were present inAustralia, then it would be present in a minimum of 10% of the crustacean populations

A National Survey to Verify Freedom from White SpotSyndrome Virus and Yellow Head Virus in Australian Crustaceans

17


(sites). Within WSSV-infected wild populations of crustaceans in Asia, the prevalence ofWSSV varies widely. Typical examples include 6.7% in male Penaeus japonicus from coastalJapan (Wang et al., 1998), 26% in P. semisulcatus from the southwest coast of Taiwan(Chen et al., 2000), 60% in larvae of Scylla serrata from Taiwan (Hsu et al., 1999), and67% and 74% in P. monodon brooders from Taiwan (Kou et al., 1999). Cowley et al. (2000)reported that GAV was present in wild populations at a prevalence of greater than98%. Walker (2000) also reported an extremely high prevalence (> 90%) in wild caughtP. monodon broodstock from four sites along the North Queensland coast. Little data isavailable on the prevalence of YHV in wild crustacean populations. The prevalence ofYHV in farmed P. monodon in the Philippines varied from 13 to 66% (Natividad et al.,2002). Based on these published works, it was assumed that the proportion of infectedanimals within a population would exceed 10%.

Confidence required

The survey was designed to provide a 95% confidence of detecting at least one infectedcrustacean population within Australia given the assumptions outlined. We also wanted tominimise the chance of wrongly concluding that WSSV or YHV might be present. Falsepositive reactions can occur with any diagnostic test, and these present a particular problemsince each reactor must be investigated to determine whether the result is a true positive.Accordingly, a protocol for investigating positive reactions was developed for this survey.

Testing regime

The standard PCR analysis of the Office International des Epizooties (OIE) (OIE, 2000)was completed in one of four separate regional laboratories. Any samples that gave apreliminary positive result in testing were retested at either CSIRO Livestock Industries,Australian Animal Health Laboratory (CSIRO-AAHL) or Long Pocket Laboratories. Thesurvey was designed to allow any samples that tested positive by PCR in both laboratoriesto be further assessed by bioassay.

Test sensitivity and specificity

None of the PCR tests used in this survey have been validated with field samples to determinethe true specificity and sensitivity of the technique. However, validated PCR tests routinelyhave specificities and sensitivities greater than 95% (Müller-Doblies et al., 1998; Peteret al., 2000). Although the specificity for the two PCR tests used was not known, the completetest regime of retesting preliminary positive samples and the subsequent use of bioassay ifrequired, was assumed to have an overall specificity of 100%. Based on the known sensitivityof other validated PCR tests, the sensitivity of the PCR testing regime was assumed to be95%.

Number of samples required

The number of sites to sample and the number of animals per site to sample depend on arange of factors including the expected prevalence of disease (at the site and within sitelevel), the desired confidence level, the sensitivity and specificity of the tests used (Cameronand Baldock, 1998; Garner et al., 1997) and the total number of crustacean populations.

I.J. East et al

18


The data used to determine sample size is shown in Table 1. Given the values outlined fortest specificity, sensitivity and confidence level, a two-stage survey was designed using theFreecalc software program (Cameron and Baldock, 1998). As discussed by Garner et al.(1997), there is some flexibility in selecting the number of populations (sites) to sampleand the number of individual animals per site, to satisfy the desired confidence level. Takingboth convenience and cost into account, it was decided that the survey would require thecollection of 30 individuals of the one species at each survey site from a minimum of 30sites in total. Based on published reports that WSSV is found in a wide range of crustaceans(Lo et al., 1996; Otta et al., 1999; Wang et al., 1998), target species for the survey were thepredominant crustacean species in each area.

Collection of samples

All penaeid prawn samples collected were juvenile or sub-adults as recommended by theOIE (OIE, 2000). Crabs were collected using standard baited pots, and prawns were collectedby beam trawl. Some samples were purchased from licenced professional fishermen. Animalswere euthanased and either gill tissue (2-3 mm3) or pleopod immediately placed intopreservation medium (ethanol:glycerol:water, 70:20:10) and stored at ambient temperature.Preserved samples were then transported to the testing laboratories.

Extraction of total nucleic acid

Tissue weight was determined. The tissue was gently homogenised in 9.5 vol of CTABbuffer (2% w/v hexadecyl-trimethyl-ammonium bromide, 1.4 M NaCl, 20 mM EDTA,100 mM Tris-HCl (pH 7.5), 0.25% v/v 2-mercaptoethanol) and incubated to solubilise theTNA. A sample of the homogenate was extracted once with phenol/chloroform/iso-amylalcohol [24:24:1] and then once with chloroform/iso-amyl alcohol [24:1]. The final aqueous

Site level ParametersSite sensitivity 0.95Site specificity 1.00Number of sites More than 500Minimum expected site prevalence 10%Type 1 error (?) 0.05Type 2 error (?) 0.05Confidence 0.95Power 0.95Number of sites to test 30Crustacean levelSensitivity 0.95Specificity 1.00Population crustaceans at a site More than 500Minimum expected site prevalence 10%Type 1 error (?) 0.05Type 2 error (?) 0Confidence 0.95Power 1.00Number of crustaceans to test 30Total number to test 900

Table 1. Parameters for sample size calculation.


19


phase was added to 0.9 vol of 100% iso-propanol and the TNA was precipitated by freezingat ñminus 20°C or below and then collected by centrifugation at 12,000 x g for 15 min atroom temperature. The pellet was washed in 70% ethanol, air-dried and then resuspendedin sterile distilled water with a volume equivalent to 2X the original tissue weight (i.e. for50 mg resuspend in 100 µl). This sample was diluted to provide a final concentration of 80ng/µl TNA for PCR analysis.

Decapod nested-PCR assay

The TNA sample extracted for analysis of WSSV was used for analysis of decapod DNA.Decapod Master Mix, which contains PRIMER SET DP3-2, was overlaid with oil and 0.1volume of test TNA sample or control sample was added to the tube and mixed bycentrifugation immediately before adding to a thermal cycler pre-heated to 80?C. PCRamplification was 1 x (94°C for 2 min.) then 60 x (96°C for 20 s, 55°C for 30 s, 62°C for20 s, 70°C for 90 s) and finally 1 x (70°C for 5 min., 30°C for 10 min.). After thermalcycling, 10 µl of the PCR reaction mix was removed and examined by agarose gelelectrophoresis for the large decapod fragment of 830 bp and for the nested decapod fragmentof 240 bp.

Standard WSSV nested-PCR assay

TNA extracts were analysed by the 2-step nested-PCR method of Lo et al. (1996, 1997)The sequence of the primers used in PCR analysis is shown in Table 2.

Table 2. Sequence of primers used in PCR analysis of tissues for WSSV.

Primer set Target Code Sequence (5’-3’)

WS2 WSSV (146F1) ACTACTAACTTCAGCCTATCTAG

WSSV (146R1) TAATGCGGGTGTAATGTTCTTACGA

WS3 WSSV (146F2) GTAACTGCCCCTTCCATCTCCA

WSSV (146R2) TACGGCAGCTGCTGCACCTTGT

WS5 WSSV (1s5)CA CTCTGGCAGAATCAGACCAGACCCCTGAC

WSSV (1a16) TTCCAGATATCTGGAGAGGAAATTCC

DP3-2 Decapod (20s2) CTGCCTTATCA(G/A)CTTTCGAT(G/T)GTAGG

Decapod (20a2) ACTTCCCCCGGAACCCAAAGACT

Decapod (20s9) GGGGGCATTCGTATTGCGA

PCR for degraded WSSV DNA

The following unpublished method for detection of degraded WSSV DNA was developedby Richard Hodgson and Peter Walker of CSIRO Livestock Industries. The master mix,which contains primer set WS5 (see Table 2), was overlaid with oil and 0.1 volume of test

I.J. East et al

20


TNA sample or control sample was added to the tube and mixed by centrifugation immediatelybefore adding to a thermal cycler preheated to 85?C. PCR amplification was 1 x (94?C for 2min) then 60 x (96°C for 20 sec, 55°C for 30 sec, 62°C for 20 sec, 70°C for 90 sec) andfinally 1 x (70°C for 5 min, 30°C for 10 min). After thermal cycling, 10µl of the reaction mixwas removed and examined by agarose gel electrophoresis for the presence of at least one ofthe specific WSSV products of 480 bp or the nested products of 420, 385 280 and 198 bp.

Real-Time PCR

Cuticular epithelium from three abdominal segments (or at least one entire gill) was placedin an Eppendorf tube and ground with a disposable plastic pestle. 500 µl of TNET was thenadded to form a homogeneous mixture, and 12.5 µl of proteinase K (2 mg/ml) and 5 µl of10% SDS were also added. This mixture was then digested for 1-3 hr at 37°C (with frequentshaking). The digested mixture was extracted with phenol, and DNA was recovered fromthe subsequent aqueous phase using the “QIAamp Viral RNA Mini Kit” for cell-free extracts(QIAGEN, Valencia, CA, USA) (this kit can also be used for DNA viruses).

The real-time PCR was then set up in a 96-well plate format, with water being used as anegative control, and nucleic acid from the gills of a WSSV experimentally-infected prawnbeing the positive control. Each control and sample was examined in triplicate. Amplificationand analysis of samples was done with the AB 7700 (PE Applied Biosystems) by the methodpreviously described (Dhar et al., 1999).

PCR for yellow head virus and gill associated virus

Samples for YHV and GAV detection were processed according to the method of Cowleyet al. (2002). PCR amplification of YHV specific and GAV specific DNA was conducted bythe method of Cowley et al. (2002) or by the commercialised version of the same method(IQ2000 test kit, Farming Intelligene Technology, Taiwan) according to the manufacturer’sinstructions.

RESULTS

In the final survey, a total of 3,081 samples representing 65 batches of at least 30 specimenanimals from 56 geographically separate locations throughout Australia were collected andtested for the WSSV. The samples included 51 batches of wild crustacean encompassingthe entire Australian coastline (Fig.1) and 17 commercial crustacean farms, hatcheries andresearch facilities that had populations sourced from the wild or F1 populations originatingfrom broodstock sourced from the wild. For YHV and GAV, a total of 32 batches totalling1,006 samples from 30 sites were tested.

WSSV Testing

The location of the sites sampled, the species of crustacean sampled, the sample size andthe testing results are summarised in Table 3. Of the 65 batches sampled and tested forWSSV infection, 62 sites were negative for WSSV during initial testing whilst preliminarypositive results were obtained from three sites. Each positive sample was only positiveafter the second step of the nested-PCR test, and the results observed were consistent witha level of WSSV close to the lower limit of detection of the test. Duplicate tissues from the


21


samples that returned preliminary positive results were dispatched to a second independentlaboratory for retesting. All duplicate tissues submitted for retesting tested negative withboth the Lo PCR and Real Time PCR tests at the second laboratory; therefore, a bioassaywas not necessary to resolve the infection status of any samples.

YHV/GAV Testing

The results of testing for YHV and GAV at 30 sites around Australia are summarised inTable 3. All populations sampled were negative for YHV. Seven sites tested positive forGAV. Five of these sites were located on the Pacific coast of Australia north of latitude 27°South and the other two were on the western side of the Gulf of Carpentaria. Each of thesefindings was consistent with the known distribution of GAV within Australia (Walker, 2000).

SiteNo.

State

1 New Botany Bay Penaeus 30 negative negative negativeSouth plebejusWales

2 Manly Plagusia 35 negative negative negativechabrus

3 Port Jackson Penaeus 397 negative negative negativeplebejus/Metapenaeus macleayi

50 Lake Tilba Prawn spp. 30 negative negative negative52 Farm 11 Penaeus monodon 270 negative N.D.2 N.D.53 Farm 2 Penaeus monodon 50 negative N.D. N.D.54 Farm 3 Penaeus monodon 50 negative N.D. N.D.55 Farm 4 Penaeus monodon 50 negative N.D. N.D.56 Farm 5 Penaeus monodon 150 negative N.D. N.D.4 Queen Logan River Scylla serrata 40 negative N.D. N.D.

sland5 Moreton Bay Prawn spp. 37 negative negative positive6 Townsville Scylla serrata 31 negative negative negative7 Townsville Penaeus indicus 57 negative negative positive8 Innisfail Penaeus monodon 53 negative negative positive9 Cairns Penaeus monodon 30 negative negative positive10 Weipa Penaeus 30 negative negative positive

merguiensis11 Staaten River Scylla serrata 30 negative negative positive57 Farm 6 Penaeus monodon 50 negative N.D N.D.58 Farm 7 Penaeus monodon 50 negative N.D N.D.59 Farm 8 Penaeus monodon 45 negative N.D N.D.60 Farm 9 Penaeus monodon 35 negative N.D N.D.61 Farm 10 Cherax 30 negative N.D. N.D.

quadricarinatus

Site Species SampleSize

WSSVStatus

YHVStatus

GAVStatus

Table 3. Location, host species and results of testing various species of crustacean for white spot syndromevirus, yellow head virus and gill-associated virus at sixty-six locations within Australia.

I.J. East et al

22


62 Bribie Island Scylla serrata 30 negative negative positiveAquacultureResearch Centre

63 Bribie Island Portunus pelagicus 35 negative negative negativeAquacultureResearch Centre

64 QDPI Research Cherax 30 negative N.D N.DStation quadricarinatus

12 Northern Blackmore River Scylla serrata 30 negative N.D. N.D. Territory13 Elizabeth River Carcinus maenas 30 negative N.D. N.D.14 Nightcliff Jetty Carcinus maenas 30 negative N.D. N.D.15 Rapid Creek Scylla serrata 30 negative N.D. N.D.16 Shoal Bay Prawn spp. 46 negative N.D. N.D.65 Farm 11 Penaeus monodon 30 negative N.D. N.D.17 Western Wyndham – off Penaeus latisulcatus 30 negative negative negative Australia shore18 Wyndham – mud Penaeus 30 negative N.D. N.D.

flats merguiensis19 Broome TAFE Metopograpsus spp. 30 negative N.D. N.D.20 Broome Penaeus monodon 30 negative negative negative21 Cable Beach, Leptodius spp. 30 negative N.D. N.D.

Broome22 Willy Creek Metopograpsus spp. 30 negative N.D. N.D.23 Exmouth Metopograpsus spp. 30 negative N.D. N.D.24 Exmouth Metapenaeus sp. 30 negative N.D. N.D.25 Exmouth Gulf 1 Penaeus latisulcatus 30 negative N.D. N.D.26 Exmouth Gulf 2 Penaeus monodon 30 negative N.D. N.D.27 Denham (January) Leptodius spp. 30 negative N.D. N.D.28 Denham (August) Leptodius spp. 30 negative N.D. N.D.29 Geraldton Leptograpsus 30 negative N.D. N.D.

variegates30 Fremantle Portunus pelagicus 30 negative N.D. N.D.31 Fremantle Penaeus latisulcatus 30 negative negative negative32 North Cockburn Metapenaeus spp. 30 negative N.D. N.D.

Sound33 South Cockburn Metapenaeus spp. 30 negative N.D. N.D.

Sound34 Mandurah Estuary Penaeus latisulcatus 30 negative N.D. N.D.35 DeGray River, Penaeus merguiensis 30 negative negative negative

Port Headland36 DeGray River, Penaeus monodon 30 negative negative negative

Port Headland37 Eagle Hawk Is. Metapenaeopsis spp. 30 negative negative negative38 Nickol Bay, Penaeus latisulcatus 30 negative negative negative39 Solitary Is. Onslow Penaeus esculentus 30 negative negative negative40 Albany Portunus pelagicus 30 negative N.D. N.D.


23


51 Carnarvon Metapenaeus 30 N.D. negative negativeendeavouri

66 Farm 12 Penaeus monodon 30 negative N.D. N.D.67 Farm 13 Penaeus monodon 30 negative N.D. N.D.41 Victoria Altona Crab spp. 30 negative negative negative42 Geelong Crab spp. 30 negative negative negative43 Lakes Entrance Crab spp. 30 negative negative negative48 Portland Crab spp. 30 N.D. negative negative49 Warnambool Crab spp. 30 N.D. negative negative44 Tasmania Margate Wharf Carcinus maenas 35 negative negative negative45 Kingston Crab spp. 30 negative negative negative68 TAFI Aquaculture Jasus verreauxi 30 negative negative negative46 South Spencer Gulf Penaeus latisulcatus 110 negative negative negative

Australia47 St Vincent’s Gulf Penaeus latisulcatus 135 negative negative negative

Total 3170Commercial enterprises are not identified for reasons of commercial confidentiality.N.D. – Not done – sample was not tested for this virus

Figure 1. Location of sampling sites for wild crustaceans within Australia. Location numbers correspondto the site numbers listed in Table 3.

I.J. East et al

24


DISCUSSION

This study was designed to determine whether Australian crustaceans were infected withWSSV, YHV or GAV. After testing of samples from 3170 crustaceans collected from 59locations throughout Australia, neither WSSV nor YHV was confirmed in any sample. Thus,our results demonstrate that, at the 95% confidence level, we can conclude that if present,WSSV and YHV occur at an overall prevalence of less than 1.0% (i.e., less than 10% siteprevalence and less than 10% within site prevalence). The presence of GAV within its knowngeographical range along the northern Pacific coastline of Australia was confirmed by oursurvey. The detection of GAV in Scylla serrata extends the known host range of this virus.

The inclusion of 12 commercial Penaeus monodon farms in the survey was instructivebecause, historically, expression of WSSV and YHV as clinical disease has occurred oncommercial farms where stocking rates are high and animals are more likely to be stressed.Neither virus was detected on any of the commercial farms, and clinical signs associatedwith WSSV and YHV have never been observed within Australia. Twelve months prior tothe conduct of the current survey, all Australian commercial prawn farms carrying stockwere surveyed and found to be free of WSSV (East, unpublished data). In addition to thecurrent survey, an independent survey for WSSV has also been conducted in the area ofDarwin Harbour adjacent to the two aquaculture facilities where WSSV PCR-positivesamples were detected. That survey has confirmed that WSSV is not present in DarwinHarbour (anon, 2002).

The threat of disease introduction through the use of wild broodstock has lead to theintroduction of pre-stocking screening programs in Thailand (Withyachumnarnkul, 1999)and research programs to close the breeding cycle of P. monodon in captivity (Preston,2002). However, until such alternatives are completely effective, wild broodstock with aknown disease status are the most effective way of ensuring that disease does not have amajor economic impact on the Australian prawn farming industry. Australian crustaceansprovide a valuable source of specific pathogen free broodstock for the aquaculture industriesof the world. Some producers in Vietnam are now sourcing P. monodon broodstock fromWestern Australia (Brian Jones, pers. comm.), and P. monodon post-larvae have beenexported to several countries throughout Asia and the Pacific. In conclusion, Australiancrustaceans remain free of WSSV and YHV infection, and these viruses remain exotic toAustralia.

ACKNOWLEDGMENTS

The authors wish to thank each of the Australian State and Territory government jurisdictionsand their staff who collected and processed sample animals. We also wish to thank the staffof the laboratories that completed the PCR testing program particularly Dr Peter Walker,who made unpublished methods available to the various testing laboratories.


25


REFERENCES

Anonymous. 2002. Animal Health News from the Northern Territory. Department of Business,Industry and Resource Development. January 2002, p5.

ABS. 1996. Year Book, Australia, 1996. Australian Bureau of Statistics, Canberra. 3 p.

Cameron, A.R. and Baldock, F.C. 1998. A new probability formula for surveys to substantial freedomfrom disease. Preventive Veterinary Medicine 34, 1-17.

Chen, L.L., Lo, C.F., Chiu, Y.L., Chang, C.F. and Kou, G.H. 2000. Natural and experimental infectionsof white spot syndrome virus (WSSV) in benthic larvae of mud crab Scylla serrata. Diseasesof Aquatic Organisms 40, 157-161.

Cowley, J.A., Dimmock, C.M., Wongteerasupaya, C., Boonsaeng, V., Panyim, S. and Walker, P.J.1999. Yellow head virus from Thailand and gill-associated virus from Australia are closelyrelated but distinct prawn viruses. Diseases of Aquatic Organisms 36, 153-157.

Cowley, J.A., Dimmock, C.M., Spann, K.M., and Walker, P.J. 2000. Detection of Australian gill-associated virus (GAV) and lymphoid organ virus (LOV) of Penaeus monodon by RT-nestedPCR. Diseases of Aquatic Organisms 39, 159-67.

Cowley, J.A., Cadogan, L.C., Wongteerasupaya, C., Hodgson, R.A.J., Spann, K.M., Boonsaeng, V.,and Walker, P.J. 2004. Differential detection of gill-associated virus (GAV) from Australiaand yellow head virus (YHV) from Thailand by multiplex RT-nested PCR. Journal ofVirological Methods 117, 49-59.

Dhar, A.K., Roux, M.M. and Klimpel, K.R. 1999. Detection and quantification of infectioushypodermal and hematopoietic necrosis virus and white spot virus in shrimp using real-timequantitative PCR and SYBR green chemistry. Journal of Clinical Microbiology 39, 2835-2845.

Flegel, T.W. 1997. Special topic review: major viral diseases of the black tiger prawn (Penaeusmonodon) in Thailand. World Journal of Microbiology and Biotechnology 13, 433-442.

Garner, M.G., Gleeson, L.J., Holyoake, P.K., Cannon, R.M. and Doughty, W.J. 1997. A nationalserological survey to verify Australia’s freedom from porcine reproductive and respiratorysyndrome. Australian Veterinary Journal 75, 596-600.

Hsu, H.C., Lo, C.F., Lin, S.C., Liu, K.F., Peng, S.E., Chang, Y.S., Chen, L.L., Liu, W.J. and Kou,G.H. 1999. Studies on effective PCR screening strategies for white spot syndrome virus(WSSV) detection in Penaeus monodon brooders. Diseases of Aquatic Organisms 39, 13-19.

Kou, G.H, Hsu, H.C, Liu, K.F, Su, M.S and Lo, C.F. 1999. Effective PCR screening strategies forwhite spot syndrome virus (WSSV) detection in Penaeus monodon brooders. FourthSymposium on Disease in Asian Aquaculture, Cebu, Philippines. November 1999. Book ofAbstracts. Fish Health Section, Asian Fisheries Society, Manila, Philippines.

Lightner, D.V., Redman, R.M., Poulos, B.T., Nunan, L.M., Mari, J.L. and Hasson, K.W. 1997. Riskof spread of penaeid shrimp viruses in the Americas by the international movement of liveand frozen shrimp. Scientific and Technical Review of the Office International des Epizooties16, 46-160.

Limsuwan, C. 1991. Handbook for cultivation of black tiger prawns. Tansetakit Co. Ltd., Bangkok.

Lo, C.F., Ho, C.H., Peng, S.E., Chen, C_H., Hsu, H.C., Chiu, Y.L., Chang, C.F., Liu, K.F., Su, M.S.,Wang, C.H., and Kou, G.H. 1996. White spot syndrome baculovirus (WSBV) detected incultured and captured shrimp, crabs and other arthropods. Diseases of Aquatic Organisms 27,215-225.

26


Lo, C.F., Ho, C.H., Chen, C.H., Liu, K.F., Chiu, Y.L., Yeh, P.Y., Peng, S.E., Hsu, H.E., Liu, H.C.,Chang, C.F., Su, M.S., Wang, C.H., and Kou, G.H. 1997. Detection and tissue tropism ofwhite spot syndrome baculovirus (WSBV) in captured brooders of Penaeus monodon with aspecial emphasis on reproductive organs. Diseases of Aquatic Organisms 30, 53-72.

Müller-Doblies, U.U., Li, H., Hauser, B., Adler, H. and Ackermann, M. 1998. Field validation oflaboratory tests for clinical diagnosis of sheep-associated malignant catarrhal fever. Journalof Clinical Microbiology 36, 2970-2972.

Nakano, H., Koube, H., Umezawa, S., Momoyama, K., Hiraoka, M., Inouye, K., and Oseko, N.1994. Mass mortalities of kuruma shrimp, Penaeus japonicus, in Japan in 1993:Epizootiological survey and infection trails. Fish Pathology 29, 135-139.

Natividad, K.D.T., Magbanua, F.O., Migo, V.P., Alfafara, C.G., Albaladejo, J.D., Nadala, E.C.B.Jr.,Loh, P.C. and Tapay, L.M. 2002. Prevalence of yellow head virus in cultured black tigershrimp (Penaeus monodon Fabricus) from selected shrimp farms in the Philippines. In Lavilla-Pitogo, C.R. and Cruz-Lacierda, E.R. (eds.). Diseases in Asian Aquaculture IV. Asian FisheriesSociety, Quezon City, Philippines. p. 45-58.

Nunan, L.M., Poulos, B.T. and Lightner, D.V. 1998. The detection of White Spot Syndrome Virus(WSSV) and Yellow Head Virus (YHV) in imported commodity shrimp. Aquaculture 160,19-30.

OIE . 2001. Quarterly Aquatic Animal Disease Reports (Asia and Pacific Region) for 1998-2001.Office International des Épizooties, Tokyo.

OIE. 2000. Diagnostic Manual for Aquatic Animal Diseases, 3rd ed. Office International desÉpizooties, Paris. pp.165-172.

Otta, S.K., Shubha, G., Joseph, B., Chakraborty, A. and Karunasagar, I. 1999. Polymerase chainreaction (PCR) detection of white spot syndrome virus (WSSV) in cultured and wildcrustaceans in India. Diseases of Aquatic Organisms 38, 67-70.

Peter, T.F., Barbet, A.F., Alleman, A.R., Simbi, B.H., Burridge, M.J. and Mahan, S.M. 2000. Detectionof the agent of heartwater, Cowdria ruminantium, in Amblyomma ticks by PCR: validationand application of the assay to field ticks. Journal of Clinical Microbiology 38, 1539-1544.

Preston, N. 2002. Prawn domestication project. Proceedings of the Australian Prawn FarmersAssociation Annual General Meeting 2002, Sydney, 19-20 July 2002.

Rothlisberg, P.C., Craig, P.D. and Andrewartha, J.R. 1996. Modelling penaeid prawn larval advectionin Albatross Bay, Australia: defining the effective spawning population. Marine and FreshwaterResearch 47, 157-168.

Spann, K.M., Cowley, J.A., Walker, P.J. and Lester, R.J.G. 1997. A yellow-head-like virus fromPenaeus monodon cultured in Australia. Diseases of Aquatic Organisms 31,169-179.

Walker, P.J. 2000. Report to farmers - gill associated virus. Outcomes of CRC project A.1.4 -Characterisation and diagnostic probe development for yellow head-like viruses infectingAustralian cultured prawns. Cooperative Research Centre for Aquaculture. Sydney, Australia.10 p.

Wang, Y.C., Lo, C.F., Chang, P.S. and Kou, G.H. 1998. Experimental infection of white spotbaculovirus in some cultured and wild decapods in Taiwan. Aquaculture 164, 221-231.

Withyachumnarnkul, B. 1999. Results from black tiger shrimp Penaeus monodon culture pondsstocked with postlarvae PCR-positive or -negative for white-spot syndrome virus (WSSV).Diseases of Aquatic Organisms 39, 21-27.

I.J. EAST et al

27


‘To Hazard or Not to Hazard, That is the Question’:How Unknowns in Science Affect the Identification of

Hazards in an Import Risk Analysis

SARAH N. KLEEMANAquatic Animal Biosecurity, Biosecurity Australia

Agriculture Fisheries Forestry Australia, GPO Box 858,Canberra ACT 2601 Australia

ABSTRACT

The process of hazard identification, in the context of an import risk analysis (IRA), involvesthe recognition of disease agents and pests that could be associated with trade in acommodity. For a pathogen to be classified as a potential hazard the following criteriashould be met. The pathogenic agent should be: 1) appropriate to the imported commodity;2) capable of producing adverse consequences in the importing country; 3) likely to bepresent in the exporting country; and 4) exotic to the importing country, or, if present, besubjected to mandatory control or eradication measures. Hazard identification is, in essence,a decision-making process resulting in the classification of a pathogen as ‘a hazard’ or ‘nota hazard’. A pathogenic agent determined not to be a hazard is not considered further in anIRA. In this regard, the analysis must be transparent by providing clear reasons for theexclusion or the inclusion of a pathogen. However, it is often the case that the data availableon a pathogen is incomplete or inconclusive, yet value judgements (and justifications)must still be made by analysts as to whether the above criteria are met. This paper discussesvarious solutions to tackling uncertainty and lack of knowledge in the identification ofpotential hazards, using Australia’s current import risk analysis on non-viable bivalvemollusc as a practical example.

INTRODUCTION

Hazard identification - the scientific process of recognising pathogenic agents that may beintroduced with the importation of a commodity - is a dichotomous process. A pathogenicagent is either classified as a ‘hazard’ or ‘not a hazard’, based on certain criteria.A pathogenicagent that is determined ‘not a hazard’ is not considered further in an import risk analysis(IRA). Those agents identified as ‘hazards’ are further analysed to determine more preciselythe probability of establishment in the importing country and the resulting impacts, i.e., theoverall ‘risk’.

According to the OIE Code (OIE, 2000a), for a pathogenic agent to be identified as apotential hazard, it should comply with all of the following criteria:


Kleeman, S.N. 2005. ‘To hazard or not to hazard, that is the question’ : How unknowns in science affect the identification ofhazards in an import risk analysis. In P. Walker, R. Lester and M.G. Bondad-Reantaso (eds). Diseases in Asian Aquaculture V,pp. 27-34. Fish Health Section, Asian Fisheries Society, Manila.

Sarah N. Kleeman

28


� the pathogenic agent should be appropriate to the animal species to be imported, orfrom which the commodity is derived;

� the pathogenic agent could produce adverse consequences in the importing country;

� the pathogenic agent may be present in the exporting country; and

� the pathogenic agent should not be present in the importing country. If present, thepathogenic agent should be associated with a notifiable disease, or should be subjectto control or eradication measures.

In keeping with international obligations, the analysis should be transparent. Scientificallyjustifiable reasons must be given so that the exporting country is provided with clear anddocumented reasons for inclusion of an agent as a hazard in an IRA. In this regard, thequality and confidence of the decision is reliant on the scientific information on which it isbased. For example, information on host range, geographic distribution, taxonomic affinitiesbetween related species/strains and the pathogenicity of an agent are fundamental to applyingthe above criteria; yet with regard to many aquatic animal pathogens, these aspects remainpoorly understood.

This paper will discuss how these matters are dealt with in the practical conduct of an IRA,where decisions must be made and justified (consistent with international obligations) inspite of the unavailability of relevant scientific information. Biosecurity Australiacommunicates the information and opinions regarding hazards in a Technical Issues Paper.The Technical Issues Paper for Australia’s IRA on non-viable bivalve molluscs has recentlybeen released for stakeholder comment (Biosecurity Australia, 2002) and is used here as apractical example.

WELL RESEARCHED VS POORLY RESEARCHED PATHOGENIC AGENTS

Where a disease agent is well researched, hazard criteria may be readily applied. For example,Haplosporidium nelsoni, the aetiological agent of MSX disease in Eastern oysters(Crassostrea virginica), has attracted significant research effort over the past few decadesand continues to do so. The pathogen has not been recorded from Australia; is known tocause mass mortalities of C. virginica on the East Coast of North America; naïve hosts aresusceptible to disease; historical evidence suggests that the disease has spread via stocktranslocations (Burreson et al., 2000) and the disease continues to spread into new geographicareas (ProMED-mail, 2002). On this basis, H. nelsoni has been considered a hazard inBiosecurity Australia’s non-viable bivalve mollusc IRA.

The task of hazard identification becomes difficult when making decisions on pathogenswhere gaps exist in the knowledge available. Lack of knowledge on a disease agent may bedue to the pathogen not attracting a great deal of research interest or research support. Ingeneral, the knowledge available on bivalve mollusc diseases largely reflects the importanceof bivalve aquaculture in various regions and the availability of expertise to diagnose orstudy disease. In Africa, the former Union of the Soviet Socialist Republics, Asia and Centraland South America, the health status of bivalves is almost totally unknown or unreported.In addition to this, many aspects of some bivalve diseases remain poorly understood despiteconcerted research efforts. For example, despite several decades of active research, thecomplete lifecycle of the protozoan parasites belonging to the genera Haplosporidium and

‘To Hazard or Not to Hazard, That is the Question’:How Unknowns in Science Affect the Identification of Hazards in an Import Risk Analysis

29


Marteilia remain unknown. The inability to conduct experimental infections in the laboratoryprevents studies on the range of hosts that may be potentially susceptible to these pathogens.

Information available on disease agents that are well researched does, however, allow forvalued assumptions to be made when considering related disease agents that have notattracted a great deal of research interest. The following case history is provided.Haplosporidium nelsoni is known to infect Eastern oysters and Pacific oysters (Crassostreagigas). While the pathogen is highly pathogenic to Eastern oysters, it has only been recordedat very low prevalence in C. gigas and has little apparent effect on this host. All availableevidence suggests that H. nelsoni was introduced to the East Coast of the United States viastock translocations of C. gigas from Asia, where the pathogen switched hosts into thenaïve Eastern oyster species in which it is pathogenic (Burreson et al., 2000). On this basis,it was considered justifiable in the Technical Issues Paper to consider all Haplosporidiumspecies to have similar characteristics and therefore be potentially pathogenic to naïve bivalvespecies in Australia (thereby meeting hazard criterion 2), even in cases where theHaplosporidium species is not reported to cause disease. Thus, Haplosporidium tapetis inclams in Europe is considered a hazard, even though the pathogen has not been reported tocause serious disease (Chagot et al., 1987; Figueras et al., 1992).

ERRING ON THE SIDE OF CAUTION

Interpretations and parallels that are drawn from relevant circumstances and experiencesare certainly valuable in allowing analysts to make decisions in the absence of information.However, the confidence that can be placed on these assumptions must be determined. Thisis true for any scientific process. For example, data presented in scientific papers areaccompanied by error bars, indicating the level of confidence that can be placed on theknowledge gained. Uncertainty in knowledge becomes all the more crucial where theconsequence of a decision arising from that information may be significant, such as theintroduction of a disease. As such, suitably cautious interpretations have to be made. If themissing information is critical and the consequences severe, then one should err on the sideof caution until further information is made available.

For example, Bonamia exitiosus occurs in dredge oysters in New Zealand (Hine, 2001). Aspecies of Bonamia also causes significant problems in Australian flat oyster populationsand it has long been presumed that the two are the same species, although definitivetaxonomic studies have not established this. If the two Bonamia’s are considered to be thesame species, B. exitiosus cannot be considered a hazard as it does not meet criterion 4.However, recent evidence has revealed some differences in the histopathology of the NewZealand and Australian Bonamia’s (J. Handlinger, pers. comm.). Therefore, if one was toerr on the side of caution, B. exitiosus should be considered a hazard that is separate fromthe Australian species until studies have confirmed that they are the same.

The practice of applying conservative judgment is a subjective procedure, however, it isone that a country is allowed to do in keeping with international rights and obligations. Thedegree to which a country chooses to err on the side of caution is a reflection of the level ofbiosecurity that country chooses to apply to trade. The IRA process and methodology remainunchanged, but decisions must meet safeguards that are put in place to ensure that negative

Sarah N. Kleeman

30


trade affects are minimised (e.g., the SPS Agreement1 condition that refers to consistency inrisk management).

Reasonable decisions and poodles in bananas

In justifying erring on the side of caution, judgements must be reasonable and not extremist.The cartoon by Gary Larson provides a comical reminder of what is unreasonable in makingdecisions (Fig. 1). Certainly a country exporting bananas would consider it unreasonablefor an importing country to list poodles as a hazard in a banana IRA.

Figure 1. How poodles first came to North America

1 WTO Agreement on the Application of Sanitary and Phytosanitary Measures


31


Humour aside, pest or disease issues have the potential to be used as trade barriers. TheWTO SPS Agreement provides the legal framework to prevent member countries fromusing disease agents as trade barriers, where protective measures put in place by an importingcountry must be based on scientific assessment according to international standards andtechniques. However, in some cases, the inconclusive or incomplete nature of the scientificinformation on which a decision may be made makes the issue of ‘reasonable’ or ‘unreasonable’ difficult to establish until further scientific research can resolve the issue.

For example, the potential for Pacific oysters to carry Bonamia sp. infection has beenhighlighted by some countries as a concern with regard to trade of C. gigas from Bonamiaendemic regions. In considering the importation of Pacific oysters from Tasmania, theEuropean Commission considered that, among other issues, “the possible role of carrier ofBonamia sp. has not been evaluated for Crassostrea gigas.” (DG(SANCO)/1289/2000).However, Bonamia species have only been recorded from Ostrea and Tiostrea oyster species.Is this a “poodles in bananas” situation? Bonamia species have never been recorded fromPacific oysters; however, whether C. gigas is refractory to infection has not been conclusivelyresolved through targeted experimental studies. Certainly, the ability for Pacific oysters tocarry other protozoans such as H. nelsoni in low and unnoticeable numbers raises a cautionarytale, but is it reasonable to extend this assumption to other parasite groups? Haplosporidiumspecies and Bonamia species, while both belonging to the Phylum Haplosporidia, are differentenough that extending parallels between the groups may be unjustified. For example, theyshow different modes of transmission (Haplosporidium species have indirect lifecycles,Bonamia species have direct lifecycles) and stages of development (Haplosporidium speciesproduce spores, Bonamia species do not).

Exceptions to the rule

In developing guidelines in the Technical Issues Paper to take into account instances whereinformation is lacking, it was sometimes the case that in considering the hazard status of aparticular pathogen these strategies or guidelines conflicted. For example, where a diseaseor pathogen had not been reported in over a decade, it was considered that no adverseconsequences could be identified and that there was little justification to list that pathogenas a hazard. On this basis, the disease Marteiliosis of Calico scallops was not considered ahazard, given that the Marteilia species responsible for the mortalities has not been reportedfrom the coast of Florida since 1988 (Moyer et al., 1993). However, following therecommendations in the OIE Diagnostic Manual for Aquatic Animal Diseases (2000b), aguideline was also determined in the Technical Issues Paper for Marteilia species, where itwas considered that until more is known these parasite groups, their presence in any bivalveshould be regarded as potentially serious.

Given that active surveys have not been conducted in recent years, it is possible that thepathogen is still present in scallop populations off the coast of Florida in low and unnoticeablenumbers. It is also possible that the scallop mortalities in 1988 were an isolated event as aresult of introduction of the disease from Europe, but that the pathogen failed to establish inFlorida waters, perhaps due to the absence of a suitable alternate host. In this case, is itoverly cautious to consider that this pathogen be listed as a hazard or is it reasonable?

Sarah N. Kleeman

32


Dealing with new information

While it is true that the knowledge available on bivalve mollusc diseases worldwide islacking, research conducted by many laboratories in Europe, North America and Australasiahave revealed significant findings over the past few years. New parasite species and diseaseshave become apparent, taxonomic conundrums have been resolved and new hosts andgeographic ranges have been recorded. In this regard, the IRA process must be dynamicand able to account for new information as it arises. In many cases, new information hasbeen generated through the advent of new technologies, such as molecular techniques. Forexample, the existence of the Paramyxean parasite Marteilia maurini, separate from Marteiliarefringens (aetiological agent of Abers disease), has been debateable. Recently, gene analysishas confirmed that the two parasites are separate species with different levels of pathogenicityin different hosts (Le Roux et al., 2001).

DNA analysis has, however, highlighted some regulatory challenges. The relatedness ofPerkinsus species worldwide has proven difficult to determine and has presented muchconfusion in the assessment of these pathogens with respect to stock movements. Geneanalysis was undertaken to address this and it was found that Perkinsus olseni from Australia,Perkinsus atlanticus from Europe and Perkinsus sp. from Australia, Asia and NZ are likelyto be the same species complex Perkinsus olseni/atlanticus (Robledo et al., 2000; Murrellet al., 2002). Consequently, P. olseni/atlanticus does not fulfil hazard criterion 4, given thewide geographical distribution of the pathogen and its presence in Australia. However,grouping species on the basis of genetic information has been questioned by some workerson the basis that it is possible that a particular gene region targeted may not be informativeto species level. Is this a case of valid concern regarding the suitability of a particularscientific method and the confidence that can be placed on it, or is it a hesitance in acceptingnew information when making decisions in areas where the consequences may be severe(i.e., introduction of a new disease strain)2?

Expiry dates on scientific information

Scientific methods are constantly improving and changing. A high resolution microscopeand a molecular diagnostic method may reveal the presence of a pathogen unable to beobserved using older equipment and methodologies. Alternatively, the same process maybe able to discount the presence of a disease agent where a mortality event has occurred.With regard to molluscs, the cause of mortalities is often uncertain. It is sometimes the casethat either no infective agent is identified or the role of an identified organism is not provencausal to mortalities. In these cases, other factors such as heat stress or acid water conditionsmay be responsible.

In previous years, some poorly defined mortality events of bivalve molluscs were recordedin the literature under a new disease name. In these cases, an analyst must consider these‘diseases’ as a potential hazard. In the Technical Issues Paper for the non-viable bivalve

2 Perkinsus olseni/atlanticus appears to behave differently in different countries. The pathogen has not been recorded fromEuropean abalone species. Yet in Australia, the pathogen causes severe pathological effects in abalone populations and hasbeen linked to mortalities (Lester, 1986), although this may be due to the different conditions in which the pathogen livesrather than different strains with different levels of pathogenicity.


33


mollusc IRA, ‘diseases’ that were recorded in the literature and that were considered relevantto the above situation were grouped together in a category named ‘poorly described diseases’.These ‘diseases’ were considered not to be hazards if there were no indications of an infectiousnature from the epidemiology, and/or an adverse impact in Australia could be identifiedbased on the available scientific information. However, in the event that new informationcomes to light confirming the presence of an aetiological agent, that information would beincorporated into the IRA.

The unknown disease agents

One of the biggest criticisms of the IRA process is that hazard identification is restricted todealing only with identifiable and known disease agents. As mentioned previously, thedisease status of bivalve molluscs in many geographic regions is poorly understood. Further,undiagnosed mass mortalities of cultured bivalve molluscs occur each year worldwide andit is likely that serious diseases will emerge in other bivalve groups and species as intensiveculture expands. In an attempt to account for this in the bivalve mollusc Technical IssuesPaper, a general category for undefined mass mortality events has been considered. Whilethis category cannot, and should not, be stated as a “hazard” (in that hazard criteria cannotbe applied), Biosecurity Australia is examining the feasibility of linking such events toidentified hazards that demonstrate, for example, a similar epizootiology, and that haveundergone risk assessment. Where other criteria are relevant, for example the host speciesof concern is also present in the importing country, management strategies developed forthe similarly-behaving known disease may then be applied in the interim until the massmortality event is defined or described.

CONCLUSION

Import risk analysis, including the hazard identification stage, is a science-based process.Analysts must make decisions that are supported by sufficient scientific information, basedon scientific principles and that are objective, defensible and transparent. Where informationis incomplete or lacking, strategies or guidelines can be developed so that appropriateprofessional judgements can be applied. In dealing with new information, the process mustbe a dynamic one. It may be the case that new information may contradict with previouslyheld beliefs. “Hazards” may become “not hazards” or vice versa. Further to this, the issuesrelating to whether or not it is reasonable to err on the side of caution in making valuedassumptions or accepting new information must be addressed.

It must be emphasised, however, that hazard identification is just one stage in the riskanalysis process. Erring on the side of caution at this stage of the IRA is often less importantin terms of the outcome because a detailed evaluation on a pathogenic agent is made in therisk assessment phase. However, in order to make the process manageable, pathogens canbe (and should be) omitted from the IRA if sufficient information and expert judgmentsdeem it justifiable. The validity of such a decision rides on the importance of peer reviewand feedback through stakeholder comment.

The reality is that unknowns in science will always exist, but the job still has to be done. Toquote Dr Carl Sagan (1997) in his novel The Demon-Haunted World – Science as a Candle inthe Dark – “Science is far from a perfect instrument of knowledge. It’s just the best we have.”

34


REFERENCES

Biosecurity Australia. 2002. Import Risk Analysis (IRA) of Non-Viable Bivalve Molluscs. TechnicalIssues Paper. Animal Biosecurity Policy Memorandum 2002/44, 25 September 2002. URL:http://www.affa.gov.au/biosecurityaustralia.

Burreson, E., Stokes, N., and Friedman, C. 2000. Increased virulence in an introduced pathogen:Haplosporidium nelsoni (MSX) in the eastern oyster Crassostrea virginica. Journal of AquaticAnimal Health 12, 1-8.

Chagot, D., Bachére, E., Ruano, F., Comps, M. and Grizel, H. 1987. Ultrastructural study of sporulatedinstars of a haplosporidian parasitizing the clam Ruditapes decussatus. Aquaculture 67, 262-263.

DG(SANCO)/1289. 2000. Report of a mission carried out in Australia from 24 October to 3 November2000 for the assessment of the animal health status of bivalve molluscs and the public healthconditions of production of fishery products and bivalve molluscs. URL: http://europa.eu.int/comm/food/fs/inspections/vi/reports/australia/index_en.html

Figueras, A., Robledo, J.A. and Novoa, B. 1992. Occurrence of haplosporidian and perkinsus-likeinfections in carpet-shell clams, Ruditapes decussatus (Linnaeus, 1758), of the Ria de Vigo(Galicia, NW Spain). Journal of Shellfish Research 11, 377-382.

Hine, P.M., Cochennec-Laureau, N. and Berthe, F.C.J. 2001. Bonamia exitiosus n. sp. (Haplosporidia)infecting flat oysters Ostrea chilensis in New Zealand. Diseases of Aquatic Organisms 47,63-72.

Le Roux, F., Lorenzo, G., Peyret, P., Audemard, C., Figueras, A., Vivares, C., Gouy, M. and Berthe,F. 2001. Molecular evidence for the existence of two species of Marteilia in Europe. Journalof Eukaryotic Microbiology 48, 449-454.

Lester, R.J.G. 1986. Abalone die?back caused by protozoan infection? Australian Fisheries 45, 26?27.

Moyer, M., Blake, N. and Arnold, W. 1993. An ascetosporan disease causing mass mortality in theAtlantic calico scallop, Argopecten gibbus (Linnaeus, 1758). Journal of Shellfish Research12, 305-310.

Murrell, A., Kleeman, S., Barker, S. and Lester, R. 2002. Synonymy of Perkinsus olseni Lester andDavis, 1981 and Perkinsus atlanticus Azevedo, 1989 and an update on the phylogenetic positionof Perkinsus. Bulletin of the European Association of Fish Pathologists 22, 258-265.

OIE. 2000a. International Aquatic Animal Health Code, 3rd ed. Office International des Epizooties(OIE), Paris. 153 p.

OIE. 2000b. Diagnostic Manual for Aquatic Animal Diseases, 3rd ed. Office International DesEpizooties, Paris. 153 p.

ProMED-mail. 2002. MSX Disease, Oysters - Canada (Maritimes). ProMED-mail 2002; 19 Nov:20021119.5849. URL: http://www.promedmail.org. Accessed 19 November 2002.

Robledo, J., Coss, C. and Vasta, G. 2000. Characterization of the ribosomal RNA locus of Perkinsusatlanticus and development of a polymerase chain reaction-based diagnostic assay. Journalof Parasitology 86, 972-978.

Sagan, C. 1997. The Demon-Haunted World. Science as a Candle in the Dark. Random House Inc,USA.

Sarah N. Kleeman

35


The Role of Risk Analysis and Epidemiology in theDevelopment of Biosecurity for Aquaculture

EDMUND PEELERCentre for Environment, Fisheries and Aquaculture Science,

Weymouth, UK, DT4 8UB

ABSTRACT

Biosecurity is a management strategy to minimise the risk of disease introduction, and iscritical to development of a successful aquaculture industry. In this paper, it is argued thatthe combination of epidemiological research and risk analysis methodology is required todevelop appropriate biosecurity programmes. Risk analysis ensures that a logical, transparentapproach is adopted to identify and prioritise disease hazards and pathways of introductionand exposure. In aquaculture, it has been mainly used to assess risks of disease introductionat a country or regional level, and has been little used at the farm level. Risk analysis isonly as good as the data it uses, and primarily, epidemiological data is required.Epidemiological investigations that underpin risk analysis fall into two main categories:disease outbreak investigations and structured observational studies. The outbreakinvestigation and risk factor studies for infectious salmon anaemia (ISA) are used to illustratehow risk analysis and epidemiological investigations can be combined to develop improvedbiosecurity. It is argued that the development of biosecurity programmes for other diseasescould benefit from similar epidemiological studies. Finally, it is shown that risk analysiscan identify critical gaps in the data needed for the development of biosecurity, and,therefore, direct future epidemiological investigations.

INTRODUCTION

Biosecurity is the protection of a country, region or farm against the introduction of exoticpathogens. It is an essential element of a farm’s disease control programme. Preventingdisease introduction is more cost-effective and easier than control and elimination of anintroduced pathogen. A sound biosecurity programme is only possible if founded on athorough understanding of the disease and its epidemiology. Epidemiology is the study ofthe frequency, determinants and distribution of disease (Martin et al., 1987). The purposeof veterinary epidemiology is highly pragmatic, i.e., the resolution of animal health problems.Risk analysis can be considered an applied area of veterinary epidemiology. It is a methodto assess the probability and consequences of undesirable events. Risk analysis methodswere originally developed by the nuclear and space industries; in the last few years, riskanalysis have been applied in the field of animal health (anon., 1993), and only recently inaquaculture (Rodgers, 2001). Risk analysis makes systematic use of the available informationas an aid to decision making. It has the potential to be used in a number of areas of aquaticanimal health, including: a) analysis of disease transmission between farmed and wild


Peeler, E. 2005. The role of risk analysis and epidemiology in the development of biosecurity for aquaculture. In P. Walker,R. Lester and M.G. Bondad-Reantaso (eds). Diseases in Asian Aquaculture V, pp. 35-45. Fish Health Section, Asian FisheriesSociety, Manila.

Edmund Peeler

36


populations, b) the potential transmission of pathogens via the use of composted or ensiledfish waste and c) the risk of disease introduction at the farm, region or country level. Todate, the main application of risk analysis in the animal health field has been stimulated bythe Agreement on the Application of the Sanitary and Phyto-sanitary Measures (the SPSAgreement) of the World Trade Organization (WTO) (WTO, 1994). This has focused onrisks associated with trade in animal and animal products and is known as import riskanalysis (IRA). The SPS Agreement requires an IRA to justify levels of protection greaterthan those provided by international agreement. The advantages of risk analysis are that itis rigorous, transparent and produces defensible results. It forces a thorough and logicalapproach to be adopted in considering the likelihood of undesirable events, and takes intoaccount not only the likelihood but also the consequences of the event.

In this paper, it is argued that an understanding of epidemic theory, epidemiological researchand the application of risk analysis methodology are essential for developing efficient andcost-effective biosecurity programmes.

INHERENT RISK AND BIOSECURITY

Aquaculture sites have an inherent risk of disease introduction. Sites that use spring orborehole water, or recirculation systems carry an inherently negligible risk of diseaseintroduction. Mariculture and freshwater sites using river water carry a significant riskbecause of contact with wild fish populations and the proximity of other aquaculture facilities.The level of this risk is approximately proportional to the density of farming upstream orwithin the proximity of the farm. This inherent risk cannot be completely eliminated.However, a range of biosecurity measures can be employed to reduce other risks of diseaseintroduction associated with the purchase of live fish, contact with other farms, etc. Themajor risks of disease introduction are associated with the purchase of live fish and contactwith other aquaculture sites. A good understanding of the epidemiology of disease and theapplication of risk analysis methods can assist the farmers in focusing their biosecurityprogrammes on the main risks.

EPIDEMIC THEORY

When designing biosecurity programmes, the principal concern is transmission of diseasebetween farms. Different processes lead to different patterns of disease transmission. In themarine environment, passive exchange is likely to be limited by tidal excursions aroundmarine farms. Freshwater farms are at risk from pathogens emanating from farms upstream.This spread can be effectively limited by sufficient physical separation between farms, butwill increase with farm density. Epidemic diseases passing through wild populations canaffect farmed fish populations. Natural or anthropogenic vectors may spread disease betweenfarms. This pattern of spread is largely independent of farm density and farmed populationsmay play little part in the epidemiology of the disease. Natural vectors include birds or wildfish that may travel between farms. Natural vectors may be mechanical carriers, e.g., seagulls with infectious pancreatic necrosis (IPN) viruses in their guts (McAllister and Owens,1992), or true carriers excreting the pathogen, e.g., sea trout carrying ISA virus (Nylundand Jakobsen, 1995). Anthropogenic vectors include boats, other equipment or personnel,e.g., divers that travel between farms. An understanding of the spread of disease has resultedin the development of area management plans for Scottish salmon farms.

The Role of Risk Analysis and Epidemiology in the Development of Biosecurity for Aquaculture

37


OBSERVATIONAL EPIDEMIOLOGICAL STUDIES

Observational epidemiological studies in support of biosecurity falls into two maincategories: (a) disease outbreak investigations and (b) structured observational studies ofdisease risk factors.

Epidemiological investigations of aquatic animal disease outbreaks

Investigations of disease outbreaks are usually designed to identify the cause of the outbreakand routes of transmission. The application of epidemiological approaches to investigatingdisease outbreaks is illustrated with reference to ISA in Scotland and infectioushaematopoietic necrosis virus (IHNV) in British Colombia, Canada.

Infectious salmon anaemia in Scotland

ISA was first recognised in Norwegian farmed Atlantic salmon (Salmo salar L.) in 1984(Thorud and Djupvik, 1988). The causal agent was proven to be a virus (Dannevig, Falkand Namork, 1995), and subsequently shown to be an enveloped RNA virus of the familyOrthomyxoviridae (Falk et al., 1997). ISA outbreaks have been confirmed in Canada (Mullinset al., 1998; Lovely et al., 1999), Scotland (Rodger et al., 1998), Chile and the Faeroes andin the USA (Bouchard et al., 2001). It is listed under “diseases notifiable to OIE”. Fishaffected with ISA suffer anaemia and are often observed swimming near to the surface ofthe water swallowing air. A high level of mortality is common, 80 % mortality occurred inthe first outbreak in Norway (Jarp and Karlsen, 1997). Investigations of the ISA outbreak inScotland identified the use of well boats, for moving and harvesting fish, as an importantfactor in the spread of the disease (Murray, 2002). This finding led to a risk analysis ofharvesting techniques (Munro et al., 2003). These investigations are being used to developimproved biosecurity measures, e.g., a code of practice for well boat operators. Followingthe outbreak, a code of practice for salmon farmers “to avoid and minimise the impact ofISA” was developed based on experiences of the ISA outbreak and good fish healthmanagement (anon., 2000a).

Infectious haematopoietic necrosis virus in British Colombia

IHNV is a rhabdovirus that primarily causes disease in the genus Oncorhynchus. It wasfirst isolated in the Pacific northwest region of the USA, where it is endemic in wild sockeyesalmon (Onchorhychus nerka) (Wolf, 1988). Epidemics have occurred on the west coast ofNorth America among farmed stocks of chinook salmon (O. tschawytscha) and rainbowtrout (O. mykiss) (Winton, 1991). Since 1987, the disease has been detected in severalEuropean countries ( Bovo, Ceschia and Giorgetti 1991; Enzmann et al., 1992; Hattenberger-Baudouy et al., 1988), and Asia (Wang et al., 1996). In 1992, the virus was isolated for thefirst time from Atlantic salmon in seawater sites in British Colombia, Canada (Armstronget al., 1993). In 1996, companies farming salmon in British Colombia implemented amanagement plan for the control of disease. An investigation of an IHNV outbreak in BritishColombia and the impact of the management plan has been published (St-Hilaire et al.,2002). The spatial and temporal analysis of the outbreaks and the genetic similarity of thevirus isolates demonstrated that virus was spread from farm to farm, and wild salmon werenot an important source. The research also established that fallowing was an effective meansof reducing disease outbreaks.

Edmund Peeler

38


Risk factor studies

It is well established that disease occurrence is the outcome of the interaction between thepathogen, host and environment. Some epidemiologists find it more useful to consider thepathogen as a component of the environment (Martin et al., 1987). However, fish healthresearch has focused on isolating and investigating the pathogen, at the expense of studies ofhost and environmental factors (Smith, 1999). Well-designed observational epidemiologicalstudies can make an invaluable contribution to identifying and quantifying environmentaland host risk factors for disease. The results of these studies can be used to develop hypothesesthat can be further tested in the field or laboratory for biosecurity and disease control strategies.The few published risk factor studies of aquatic animals have been reviewed by Georgiadiset al. (2001). In Table 1, the results of risk factor studies for diseases of farmed salmon aresummarised. ISA provides an excellent example of the potential contribution risk factorstudies can provide to both the identification of route of introduction and establishment ofthe disease (Table 3). The risk factors identified by Jarp et al. (1994) and Vagsholm et al.(1994) clearly indicated that currents or tides from an infected farm or slaughterhousephysically transported the virus to neighbouring farms. Other routes of transmission betweenfarms also appeared important, including mechanical transmission by divers visiting manysites (Hammell and Dohoo, 1999) or other members of the workforce who moved betweensites (Vagsholm et al., 1994), and boats delivering feed (Hammell and Dohoo, 1999). Othermanagement factors identified may have contributed to the establishment of the disease onthe farm once it was introduced, e.g., intra-peritoneal vaccination, mixing year classes(Vagsholm et al., 1994) and high fat feed (Hammell and Dohoo, 1999).

Table 1. Stages of an import risk analysis.

Stage Description

1. hazard identification identification of the major exotic aquatic diseases

2. release assessment description of pathways necessary for introduction

3. exposure assessment description of pathways necessary for the exposure of host aquaticspecies to the introduced exotic pathogen, and the spread orestablishment of the hazard.

4. consequence assessment identification of the consequences of disease introduction andestablishment

5. risk management policies to reduce likelihood of introduction and mitigate theconsequences (e.g., biosecurity programme)

The majority of risk factor studies have been of Atlantic salmon production, and in particularISA. The recent study by Corsin et al. (2001) of factors associated with white spot syndromevirus (WSSV) in shrimp is the exception. The study generated a number of interestingresults, including associations between using a commercial feed and proximity to seawater,that have resulted in further investigations.


39


RISK ANALYSIS

Risk analysis methods, known as IRA, in the field of aquatic animal health have mainlybeen used to assess the risks of introducing exotic diseases into a country. A search of theliterature has identified ten published IRA for aquatic animals at a country level (Anon.,2000b; Beers and Wilson, 1993; Bruneau, 2001; Kahn et al., 1999a, 1999b; MacDiarmid,undated; Manfrin et al., 2001; Mortensen, 2000; Pharo and MacDiarmid, 2001; Stone etal., 2001; Wilson, 1993;). Four of these publication appeared as papers given at a conferencesponsored by the Office des Epizooties (OIE) (OIE, 2001)). The remaining publications arereports produced by the Australian or New Zealand Ministries of Agriculture. Most of thesestudies were undertaken for trade or regulatory purposes. At a regional level the onlypublished paper is by Paisley et al. (1999), who took a quantitative approach to assessingthe risk of introducing Gryodacytylus salaris into an uninfected river (Tana) in Norway.

To date risk analysis has been little used at the farm-level, however, the methodology hasgreat potential to be applied to assessing the risks of disease introduction and thus assist indeveloping biosecurity programmes at the farm level. The five stages of an IRA (Table 1)(Rodgers, 2001) provides a logical and transparent framework to identify all the data needed

Table 2. Data required for an import risk analysis.

Pathogen characteristics

route of infectioninfectious dose

carrier state / subclinical infectiontissues affected in clinically affected individuals / carrierssurvivability (i.e. susceptibility to temperature, dessication)

reproductive ratio (R0) (i.e., rate of transmission)

Characteristics of farmed aquatic animal

species, strain or genotype and age of the host speciesvaccination and treatment history

Characteristics of live fish introduced into the farm

volume of live fish introductions

number of sources of live fish and their health statusage of introduced fishperiod of quarantine after introduction

species, strain or genotype and age of the host speciesvaccination and treatment historywater source where reared (borehole / spring / river)

water temperature and salinity of water where reared

Other routes of introduction

contact with other fish farms, e.g., shared personnel, delivery lorries / boatscontact with wild fish populationsproximity to slaughterhouses discharging waste

proximity to other aquaculture facilities

Edmund Peeler

40


Table 3. Risk factors for aquatic diseases of farmed Atlantic salmon.

Disease Risk factor associated with increased level of disease ReferenceIPN mixing smolts from many freshwater hatcheries (Jarp et al., 1994) 1

(post smolt) new site (<1 yr old)(hatchery) late season transfer of smolts

fjord zone (vs. coastal zone) (Jarp et al., 1993) 1

migration of anadromous fish into freshwater supplyof the hatcherysharing personnel with other farmshigh concentration of infected farms near hatchery

ISA within 5 km of a salmonid slaughterhouse / number (Jarp and Karlsen, 1997;of adjacent slaughterhouses Vagsholm et al., 1994) 1

within 5 km of an ISA infected farm / numberof infected adjacent holdingshigh number of hatcheries delivering smoltshigh density of fish markets near the farm (Jarp and Karlsen, 1997) 1

divers visiting multiple sites (Hammell and Dohoo,1999) 2

shared workforce (Vagsholm et al., 1994) 1

reared in seawaterreturn of salmon from slaughterhouseintra-peritoneal vaccinationretarded growthmoist feed not fed after transfer (Hammell and Dohoo,

1999) 2

feed delivered by boat by feed company3

high fat feed fedmixed year classes

Spinal low smolt weight (Vagsholm and Djupvik,deformaties fjord sites (compared with oceanic) 1998) 1

an increase in 3 months between vaccination andseawater introductionslow growth rateslaughter from August to March

Skin lesions an increase in 3 months between vaccination and (Vagsholm and Djupvik,seawater introduction 1998) 1

plant oil vaccine adjuvant (vrs. mineral oil)lower weight at slaughter

Abdominal mineral oil vaccine adjuvant (vrs. plant oil) (Vagsholm and Djupvik,adhesions epithiolocystis 1998) 1

decrease in the number of days at seafjord sites (compared with oceanic)low smolt weight

Cataracts spring compared with autumn entry (increased (Ersdal et al., 2001) 1

severity)southern (vrs. northern counties)low smolt weight

1 Norway, 2 Canada, 3 delivery boats travelled between farms, IPN infectious pancreatic necrosis, ISA infectious salmonanaemia.


41


to assess the risk of a hazard, in this instance the introduction of a disease. Some data willbe missing and thus one output of a risk analysis will be the prioritisation of future research.At the farm level epidemiological information from observational studies, such as riskfactors studies as discussed above, is particularly important to identify potential routes ofintroduction and factors that may favour establishment of the disease. Risk analysis canintegrate epidemiological data with other information (Table 2), including pathogencharacteristics, the volume of movements of live aquatic animals and other movements(e.g., people and vehicles) on and off the farm.

The outputs of a risk analysis have other advantages for the production of a biosecurityprogramme. As a rule, only limited resources are available for the development of improvedbiosecurity. A quantitative risk analysis will quantify the risks of disease introduction andestablishment presented by different routes, whilst a qualitative analysis will lead to a ranking.Outputs from both approaches provide a means to determine the priorities for biosecurityprogrammes.

In many instances a number of aquaculture facilities use the same water resource. Sincemany aquatic animal pathogens are able to survive outside their host, they can be carriedbetween farms by currents or tides. Therefore, the development of regional biosecurityprogrammes, often known as area management plans, is crucial. Outbreaks of ISA in Scotlandand IHNV in Canada have resulted in area management plans. In Scotland, area managementplans are based not only on fundamental aspects of oceanographic conditions, but also onspecific local conditions (anon., 2000). Epidemiological studies that take as the unit ofinterest the region, not the farm, can similarly contribute the development of area managementplans.

In addition to using risk analysis to assist in producing a biosecurity programme, at a farmor regional level, epidemiological research may highlight specific areas where risk analysiscan be applied to produce fish health policy recommendations. For example, the ScottishISA outbreak investigation identified the movement of live fish by well boats as an importantroute of farm to farm transmission (Murray, 2002). Consequently, a risk analysis of harvestingmethods, including the use of well boats, was undertaken (Munro et al., 2003) which resultedto recommendations for harvesting salmon to minimise ISA transmission..

DISCUSSION AND CONCLUSIONS

Veterinary epidemiology had evolved into a holistic discipline largely in response to thefailure of traditional approaches to resolve a number of terrestrial animal health problems,mainly of intensive livestock production (Schwabe, 1982). Today many aquacultureproduction systems face serious disease problems, e.g., ISA and IPN in salmon production,WSSV in shrimp aquaculture. Epidemiology provided a new way to approach terrestrialanimal health problems, and it has the same potential in aquaculture. In this paper theimportance of epidemiology and risk analysis in the development of biosecurity programmeshas been argued. Epidemiological theory discussed at the outset of this paper provides aconceptual framework on which to build biosecurity programmes to minimise the risk ofdisease introduction. Epidemiological studies can help identify potential sources of infection,routes of introduction and factors associated with the likelihood of establishment. Therehave been relatively few observational studies of aquatic animal disease, ISA is the notable

Edmund Peeler

42


exception. Epidemiological investigations have contributed greatly to our understanding ofISA and the development of biosecurity programmes to reduce the risk of its introduction.The development of control programmes, including biosecurity, for other diseases wouldalso undoubtedly benefit from similar epidemiological studies. Risk analysis has only recentlybeen applied in aquatic animal health, and predominantly to assess the risk of diseaseintroduction at the country level. However, it is also highly pertinent for use at a farm orregional level. Risk analysis methods can integrate the results of epidemiological studieswith other data to quantify or rank the importance of different routes of entry. This providesthe basis for the development of a biosecurity programme.

The introduction of new pathogens into a farm can cause severe financial hardship, andmay lead to the failure of the business. In the future, the threat of disease introductions willincrease with the inexorable rise in international trade in livestock products and people, andthe extension of aquaculture into new territory. Governments and the aquaculture industryhave responsibilities to minimise the risk of disease introductions. There is an onus on thefarmer to take the precautions necessary to minimise the risk of disease introduction at thefarm level. Extension and researcher workers have a responsibility to establish partnershipswith farmers to undertake the necessary research, and use the results to produce cost-effectivebiosecurity programmes. Risk analysis can be used to both develop biosecurity programmesand identify critical gaps in the existing information, and thus influence the direction offuture research.


43


REFERENCES

Anonymous. 1993. Risk analysis, animal health and trade. Scientific and Technical Review of theOffice International des Epizooties 12, 434.

Anonymous. 2000a. Final Report of the Joint Government / Industry Working Group on InfectiousSalmon Anaemia (ISA) in Scotland. Scottish Executive.

Anonymous. 2000b. Prawns and Prawn Products: Draft Import Risk Aanalysis. Agriculture, Fisheriesand Forestry, Australia. Canberra. 185 p.

Armstrong, R., Robinson, J., Rymes, C. and Needham, T. 1993. Infectious haematopoeitic necrosisin Atlantic salmon in British Colombia. Canadian Veterinary Journal 34, 312-313.

Beers, P. T. and Wilson, D. W. 1993. Import risk assessment for salmon meat.† Scientific and TechnicalReview of the Office International des Epizooties 12, 1147-1152.

Bouchard, D. A., Brockway, K., Giray, C., Keleher, W. and Merrill, P. L. 2001. First report of infectioussalmon anemia (ISA) in the United States. Bulletin of the European Association of FishPathologists 21, 86-88.

Bovo, G., Ceschia, G. and Giorgetti, G. 1991. Infectious haematopoietic necrosis: situation after 3years from the first outbreak in Italy. Bollettino Societa Italiana di Patologia Ittica 5, 31-36.

Bruneau, N. 2001. A quantitative risk assessment for the introduction of Myxobolus cerebralis toAlberta, Canada, through the importation of live salmonids. In Rodgers, C.J. (ed.). RiskAnalysis in Aquatic Animal Health. Proceedings of an International Conference held in Paris,France, 8-10 February 2000. World Organisation for Animal Health, Paris. pp. 41-50.

Dannevig, B. H., Falk, K. and Namork, E. 1995. Isolation of the causal virus of infectious salmonanaemia (ISA) in a long-term cell line from Atlantic salmon head kidney. Journal of GeneralVirology 76, 1353-1359.

Enzmann, P. J., Konrad, M. and Rapp, J. 1992. Epizootiological studies on viral haemorrhagicsepticaemia in brown trout Salmo trutta fario. Diseases of Aquatic Organisms 12, 143-146.

Ersdal, C., Midtlyng, P. J. and Jarp, J. 2001. An epidemiological study of cataracts in seawaterfarmed Atlantic salmon Salmo salar. Diseases of Aquatic Organisms 45, 29-236.

Falk, K., Namork, E., Mjaaland, S., Rimstad, E. and Dannevig, B. H. 1997. Characterisation ofinfectious salmon anaemia virus, an orthomyxo-like virus isolated from Atlantic slamon (Salmosalar L.). Journal of Virology 71, 9016-9023.

Georgiadis, M. P., Gardner, I. A. and Hedrick, R. P. 2001. The role of epidemiology in the prevention,diagnosis and control of infectious disease of fish. Preventive Veterinary Medicine 48, 287-302.

Hammell, K. L. and Dohoo, I. R. 1999. The epidemiology of hemorrhagic kidney syndrome - infectioussalmon anaemia in Atlantic salmon in Atlantic Canada. In Thrusfield, M. and Goodall, E.(eds.). Proceedings of a meeting of the Society for Veterinary Epidemiology and PreventiveVeterinary Medicine held at the University of Bristol, 24-26 March 1999. pp. 211-221.

Hattenberger-Baudouy, A. M., Danton, M. and Merle, G. 1988. Infectious haematopoietic necrosis(IHN) in Salmonidae. 2. Epidemiological data in France. Pisciculture Francaise 91, 10-13.

Jarp, J., Gjevre, A. G., Olsen, A. B. and Bruheim, T. 1994. Risk factors for furunculosis, infectiouspancreatic necrosis and mortality in post-smolt Atlantic salmon, Salmo salar L. Journal ofFish Diseases 18, 67-78.

Jarp, J. and Karlsen, E. 1997. Infectious salmon anaemia (ISA) risk factors in sea-cultured Atlanticsalmon Salmo salar. Diseases of Aquatic Organisms 28, 79-86.

Edmund Peeler

44


Jarp, J., Tangen, K., Willumsen, F. V., Dyupvik, H. O. and Tveit, A. M. 1993. Risk factors forinfection with Aeromonas salmonicida subsp. salmonicida in Norwegian freshwater hatcheries.Diseases of Aquatic Organisms 17, 81-86.

Kahn, S. A., Beers, P. T., Findlay, V. L., Peebles, I. R., Durham, P. J., Wilson, D. W. and Gerrity, S. E.1999a. Import Risk Analysis on Non-viable Salmonids and Non-salmonids Marine Finfish.Australian Quarantine and Inspection Service, Canberra.

Kahn, S. A., Wilson, D. W., Perera, R. P., Hayder, H. and Gerrity, S. E. 1999b. Import Risk Analysison Live Ornamental Finfish. Australian Quarantine and Inspection Service, Canberra.

Lovely, J. E., Dannevig, B. H., Falk, K., Hutchin, L., MacKinnon, A. M., Melville, K. J., Rimstad, E.and Griffiths, S. G. 1999. First identification of infectious salmon anaemia virus in NorthAmerica with haemorrhagic kidney syndrome. Diseases of Aquatic Organisms 35, 145-148.

MacDiarmid, S. C. (Undated) The Risk of Introducing Exotic Diseases of Fish into New Zealandthrough the Importation of Ocean Caught Pacific Salmon from Canada. Ministry of Agricultureand Fisheries, New Zealand.

Manfrin, A. S., Frios, S., Perin, R., Qualtieri, K. and Bovo, G. 2001. Tropical fish importations fromthird countries: the potential of introducing human and aquatic animal pathogens. In Rodgers,C.J. (ed.). Risk Analysis in Aquatic Animal Health. Proceedings of an International Conferenceheld in Paris, France, 8-10 February 2000. World Organisation for Animal Health, Paris. pp.167-170.

Martin, S. W., Meek, A. H. and Willeberg, P. 1987. Veterinary Epidemiology - Principles and Methods,1st Ed. Iowa State University Press, Ames, Iowa.

McAllister, P. E. and Owens, W. J. 1992. Recovery of infectious pancreatic necrosis virus from thefaeces of wild piscivorous birds. Aquaculture 106, 227-232.

Mortensen, S. 2000. Scallop introductions and transfers, from an animal health point of view.Aquaculture International 8, 123-138.

Mullins, J. E., Groman, D. and Wadowska, D. 1998. Infectious salmon anaemia in salt water atlanticsalmon (Salmo salar L.) in New Brunswick, Canada. Bulletin of the European Association ofFish Pathologists 18, 110-114.

Munro, P. D., Murray, A. G., Fraser, D. I. and Peeler, E. J. 2003. An evaluation of the relative risks ofinfectious salmon anaemia transmission associated with different salmon harvesting methods.Ocean and Coastal Management 46, 157-174.

Murray, N. 2002. Import Risk Analysis - Animal and Animal Products. Ministry of Agriculture andForestry, Wellington, New Zealand.

Nylund, A. and Jakobsen, P. 1995. Sea trout as a carrier of infectious salmon anaemia virus. Journalof Fish Biology 47, 174-176.

Paisley, L. G., Karlsen, E., Jarp, J. and Mo, T. A. 1999. A Monte Carlo simulation model for assessingthe risk of introduction of Gyrodactylus salaris to the Tana river, Norway. Diseases of AquaticOrganisms 37, 145-152.

Pharo, H. J. and MacDiarmid, S. C. 2001. Qualitative risk analysis of the risk of disease introductionthrough importation of salmon for human consumption. In Rodgers, C.J. (ed.). Risk Analysisin Aquatic Animal Health. Proceedings of an International Conference held in Paris, France,8-10 February 2000. World Organisation for Animal Health, Paris. pp. 51-60.

Rodger, H. A., Turnbull, T., Muir, T., Millar, S. and Richards, R. H. 1998. Infectious salmon anaemiain the United Kingdom. Bulletin of the European Association of Fish Pathologists 18, 115-116.


45


Rodgers, C.J. (ed.) 2001. Risk Analysis in Aquatic Animal Health. Proceedings of an InternationalConference held in Paris, France, 8-10 February 2000. World Organisation for Animal Health,Paris, 346 p.

Schwabe, C. 1982. The current epidemiological revolution in veterinary medicine. Part 1. PreventiveVeterinary Medicine 1, 5-15.

Smith, P. 1999. An overview of current fish disease research: hyper-reality in a post-modern world?Bulletin of the European Association of Fish Pathologists 19, 310-312.

St-Hilaire, S., Ribble, C. S., Stephen, C., Anderson, E., Kurath, G. and Kent, M. L. 2002.Epidemiological investigation of infectious hematopoietic necrosis virus in salt water net-pen reared Atlantic salmon in British Columbia, Canada. Aquaculture 212, 1-4.

Stone, M. A. B., MacDiarmid, S. C. and Pharo, H. J. 2001. Import Health Risk Analysis: Salmonidsfor human consumption. In Rodgers, C.J. (ed.). Risk Analysis in Aquatic Animal Health.Proceedings of an International Conference held in Paris, France, 8-10 February 2000. WorldOrganisation for Animal Health, Paris. pp. 230-239.

Thorud, K. and Djupvik, H. 1988. Infectious salmon anaemia in Atlantic salmon (Salmo salar L.).Bulletin of the Association of European Fish Pathologists 8, 109-111.

Vagsholm, I. and Djupvik, H. O. 1998. Risk factors for spinal deformities in Atlantic salmon, Salmosalar L. Journal of Fish Diseases 21, 47-53.

Vagsholm, I., Djupvik, H. O., Willumsen, F. V., Tveit, A. M. and Tangen, K. 1994. Infectious salmonanaemia (ISA) epidemiology in Norway. Preventive Veterinary Medicine 19, 277-290.

Wang, W. S., Lee, J. S., Shieh, M. T., Wi, Y. L., Huang, C. J. and Chien, M. S. 1996. Detection ofinfectious hematopoietic necrosis virus in rainbow trout Oncorhynchus mykiss from an outbreakin Taiwan by serological and polymerase chain reaction assays. Diseases of Aquatic Organisms26, 237-239.

Winton, J. R. 1991. Recent advances in detection and control of infectious haematopoietic necrosisvirus in aquaculture. Annual Review of Fish Diseases 1, 83-93.

Wolf, K. 1988. Infectious haematopoietic anaemia. In Wolf, K. (ed.) Fish Viruses and Fish ViralDiseases. Cornell University Press, Ithaca, New York. pp. 83-114.

WTO. 1994. Agreement on the application of sanitary and phytosanitary measures. In The Results ofthe Uruguay Round of Multilateral Trade Negotiations: The Legal Texts. General Agreementon Tariffs and Trade (GATT), World Trade Organization, Geneva. pp. 69-84.

46


47


Minimizing the Risks of Aquatic Animal DiseaseIncursions: Current Strategies in Asia-Pacific

MELBA G. BONDAD-REANTASOAquatic Animal Research Pathologist, Maryland Department of Natural

Resources, Cooperative Oxford Laboratory, 904 S. Morris Street,Oxford, Maryland 21654, USA

(previously with the Network of Aquaculture Centres inAsia-Pacific (NACA), Bangkok, Thailand

ROHANA P. SUBASINGHESenior Fishery Resources Officer (Aquaculture), Food and AgricultureOrganization of the United Nations (FAO), Vialle Terme di Caracalla,

00100 Rome, Italy

ABSTRACT

In this new millennium, on-going strategies aimed at minimizing the risks of aquatic animaldisease incursions in Asia-Pacific expanded and adjusted to the disease problems currentlyfaced by the aquaculture sector. This paper briefly (a) discusses some of the most serioustrans-boundary aquatic animal pathogens and diseases affecting Asian aquaculture; and (b)highlights regional and national efforts on responsible health management for mitigatingthe risks associated with aquatic animal movement. A regional approach is fundamentalsince many countries share common social, economic, industrial, environmental, biologicaland geographical characteristics. The development and implementation of the ‘Asia RegionalTechnical Guidelines on Health Management for the Responsible Movement of Live AquaticAnimals’, Aquatic Animal Disease Surveillance and Reporting System, National Strategieson Health Management, Aquatic Animal Pathogen and Quarantine Information System,and the establishment of the Asia Regional Advisory Group on Aquatic Animal Health arediscussed. Capacity and awareness building on aquatic animal epidemiology, science-basedrisk analysis for aquatic animal transfers, diagnostics, molluscan health management andemergency response to disease outbreaks are highlighted. Whilst most of these strategiesare directed in support of regional and national government policies, implementation willrequire pro-active involvement, effective cooperation and strategic networking betweengovernments, farmers, researchers, scientists, development and aid agencies, and relevantprivate sector stakeholders at all levels. Health management is a shared responsibility andtheir contributions are essential to the health management process.

Deseases in Asian Aquaculture V

Bondad-Reantaso, M.G. and R.P. Subasinghe. 2005. Minimizing the risks of aquatic animal disease incursions: Currentstrategies in Asia-Pacific. In P. Walker, R. Lester and M.G. Bondad-Reantaso (eds). Diseases in Asian Aquaculture V, pp. 47-62. Fish Health Section, Asian Fisheries Society, Manila.

Melba G. Bondad-Reamtaso and Rohana Subasinghe

48


INTRODUCTION

Aquatic animal health management strategies in Asia-Pacific aimed at minimizing the risksof disease incursions have expanded and adjusted to the current health problems faced bythe aquaculture sector. The past three decades have witnessed remarkable expansion,intensification and diversification of the aquaculture sector which has become enormouslyreliant on external inputs through movements of live aquatic animals and animal products(broodstock, eggs, fry/fingerlings, seed, and feed). Asian aquaculture advanced from atraditional practice to a science-based activity and developed into a significant foodproduction sector, contributing to national economies and providing better livelihoods forrural and farming families. The role of the fish farmer has also changed from simply raisingfish to being a part of a production chain for the delivery of safe, high quality products tothe end user. Increasing world trade liberalisation and globalisation as well as improvedtransportation efficiency contributed to a great extent to this trend. The aquaculture sectorthus became a key supplier of aquatic food, provider of direct and indirect employment,and a great source of foreign trade earnings.

However, diseases caused by pathogens, resulting from unregulated and negligent movementof live aquatic animals, hindered sustainable aquaculture. Some of the most serious problemsfaced by the sector are those pathogens and diseases spread and introduced throughmovements of hatchery produced stocks, new species for aquaculture and development andenhancement of the ornamental fish trade.

Socio-economic and other associated impacts of diseases are shown in Table 1 for shrimpaquaculture and Table 2 for finfish aquaculture. The number of countries providing estimatesof losses due to diseases are increasing and particularly evident among major shrimpproducing countries which were gravely affected by diseases during the last decade. At theglobal level, combined estimated losses in production value due to shrimp diseases from 11countries for the period 1987 to 1994 was US$ 3019 M (Israngkura and Sae-Hae, 2002).

The lack of cohesive policies and regulatory frameworks in most Asian countries, as wellas inadequate technical information to develop guidelines for safe trans-boundary movementof live aquatic animals, were major factors.

REGIONAL AND GLOBAL EFFORTS TOWARDS RESPONSIBLEHEALTH MANAGEMENT

Various global instruments/agreements/codes of practice/guidelines (either voluntary orobligatory) exist which provide certain levels of protection all aimed at minimizing therisks of pathogens/diseases associated with aquatic animal movement. These are: (a) OIE’s International Aquatic Animal Health Code (OIE 2003); (b) the Code of Practice on theIntroductions and Transfers of Marine Organisms (ICES 1995) of ICES1; and (c) the Codesof Practice and Manual of Procedures for Consideration of Introductions and Transfers of

1 International Council for the Exploration of the Seas2 European Inland Fisheries Advisory Commission3 Food and Agriculture Organization of the United Nations4 World Trade Organization

Minimizing the Risks of Aquatic Animal Disease Incursions: Current Strategies in Asia-Pacific

49


Table 1. Examples of socio-economic and other impacts of diseases in shrimp aquaculture in selectedAsian and Latin American countries.

Country Disease/Pathogen Losses and other impacts Reference1992Thailand Yellowhead Disease US$ 30.6 M in 1992 Nash et al., 1995

(YHD)1993China PR Shrimp Diseases US$ 420 M in 1993 Wei Qi, 2002

60% decline in production from 210 000 mt Yulin, 2001to 87 000 mt in 1993

Vietnam Shrimp diseases US$ 100 M in 1993 Khoa et al., 2001(MonodonBaculovirus (MBV),White Spot Disease(WSD) and YHD

1994-1998Australia Shrimp diseases: US$ 32.5 M lost value of P. monodon Walker, 2001

Mid-crop Mortality production during the period 1994-1998Syndrome (MCMS),Gill-associatedVirus (GAV)

Thailand YHD and WSD US$ 650 M in 1994; 12 % production decline Chanratchakoolfrom 250 000 mt in 1994 to 220 000 mt in et al., 20011995; shrimp losses for 1997 nearly reached50% of total farm output value. Figuresexclude losses in related businesses such asfeed production, processing and exporting,feed production, ancillary services and lostincome for labourers

Honduras Taura Syndrome Production decline by 18%, 31% and 25% Corrales et al.,Virus (TSV) in 1994, 1995 and 1996, respectively. 2001

India YHD Production loss of 10 000 to 12 000 mt during Mohan andWSD 1994-1995 caused by two viral epizootics; Basavarajappa,

US$ 17.6 M economic loss in 1994 alone 2001Malaysia WSD Annual losses since 1995 estimated at US$ 25 M Yang et al., 2001Bangladesh WSD US$ 10 M production losses in 1996; Rahman, 2001

export losses; massive unemploymentPanama TSV 1996 outbreak resulted to 30% reduction in Morales et al.,

production 2001Costa Rica TSV TSV outbreak in 1996 caused reduction in Vargas, 2000

survival rate from 65% to 15%.Philippines Shrimp diseases Decline in export from 30 462 mt to 10 000 mt Albaladejo, 2001

(viral and bacterial in 1997; great reduction in number ofinfection) hatcheries

Sri Lanka WSD Production loss of 1 B Rs in foreign income Siriwardena,during 1996 outbreak; 90% of production 2001units closed

Mixed infection of 68% and 70% drop in shrimp exports in terms Siriwardena, 2001WSD and YHD of quantity and value in 1998

1999Ecuador WSD US$ 280.5 in 1999 equivalent to 63 000 mt; Alday de

closing of hatchery operations; 13% laying Graindorge andoff of labor force (26 000 people); 68% Griffith, 2001reduction in sales and production of feedmills and packing plants

Honduras WSD 13% reduction in labor force Corrales et al., 2001Nicaragua WSD 5-10% survival rate Drazba, 2001Panama WSD US$ 40 M worth of export loss; closure of Morales et al., 2001

major hatcheries; loss of jobs (5000 peopledirectly and indirectly involved in the industry)


50


Marine and Freshwater Organisms (Turner 1988) of EIFAC2. There are also relevant articlesincluded in the Code of Conduct for Responsible Fisheries (CCRF) of FAO3 (FAO 1995),the Convention on Biological Diversity (CBD 1992) and WTO’s4. Sanitary and Phyto-sanitary (SPS) Agreement (WTO 1994). Since present international protocols are not alwayspractically applicable to the disease concerns of aquatic food production and trade in theAsia region, the need for effective health management protocols that focus on the speciesand disease problems of the region was recognized. A regional approach was consideredthe most appropriate, since many countries in the region share common social, economic,industrial, environmental, biological and geographical characteristics. A regionally adoptedhealth management program will also facilitate trade and protect aquatic production andthe environment upon which they depend from preventable disease incursions.

Table 2. Examples of socio-economic and other impacts of diseases in finfish aquaculture in selectedAsian countries.

Country Disease/Pathogen Losses and other impacts Reference1983-1993Thailand Epizootic ulcerative US$ 100 million Chinabut, 1994

syndrome1989-1993Malaysia Diseases of cage-cultured US$ 1.3 M in potential income - Wong and Leong, 1987

grouper, snapper and combined loss estimates of private cited in Arthur andseabass sector and government farms Ogawa, 1996

Thailand Seabass diseases US$ .8 M in 1989 ADB/NACA, 1991Thailand Grouper diseases US$ 1.07 M in 1989 ADB/NACA, 1991China Bacterial diseases of fish > US$ 120 M annual losses Wei Qi, 2002

(Aeromonas hydrophila, between 1990-1992Yersinia ruckeri and Vibriofluvialis)

Thailand Jaundice disease in catfish US$4.3-21.3 M in 1992 Chinabut, 2002aMalaysia Vibriosis US$ 7.4 M – outbreak in 1990 Shariff, 1995 cited in

Arthur and Ogawa, 1996Singapore Grouper diseases S$ 360 500 in 1993 Chua et al., 19931994-1998Japan Marine fish disease US$ 114.4 M Arthur and Ogawa, 19961998-2002Thailand Alitropus typus US$ 234-468/cage culture of Chinabut, 2002b

Tilapia in 1998-1999Philippines Grouper diseases 75% reduction in household Somga et al., 2002

income, 19.4% increased debt(n=72)

Singapore Grouper iridovirus >50% mortality among Malabar Chang, 2001grouper

China Viral nervous necrosis (VNN) 100% mortality among 3 species Zhang, 2001of grouper

Singapore 80 to 100% mortality among fry Chang, 2001and fingerlings

Indonesia 100% mortality among larvae in Yuasa andnational hatcheries in 1999-2000 Koersharyani, 2001

Indonesia Suspected Koi herpes virus 50 billion Rupiah NACA, 2002(KHV)


51


Development and Implementation of the ‘Asia Regional Technical Guidelines on HealthManagement for the Responsible Movement of Live Aquatic Animals’and the ‘BeijingConsensus and Implementation Strategy’

Between 1998-2002, FAO and NACA5 together with 21 participating governments6 throughthe government-designated National Coordinators on Health (NCs) with technical andfinancial assistance from regional and international organizations (e.g., OIE, AAHRI7,ACIAR8, FHS-AFS9) and experts on aquatic animal health developed and implemented aRegional Programme on aquatic animal health management through FAO’s TechnicalCooperation Programme for a project (TCP/RAS 6714 and 9605) “Assistance for theresponsible movement of live aquatic animals in Asia”.

The ‘Technical Guidelines’, the first major output of the Regional Programme, contain aset of Guiding Principles on movement of living aquatic animals within and across nationalboundaries and proposes practical and effective strategies to minimize the risks ofintroduction, spread and establishment of trans-boundary aquatic animal diseases. Technicalprotocols on a number of health management measures (e.g., disease diagnostics, healthcertification and quarantine, pathogens to be considered, surveillance and reporting, zoning,import risk analysis, contingency plan, institutional and policy frameworks, capacity buildingand implementation) are included. The ‘Technical Guidelines’ are accompanied by anImplementation Strategy, a Manual of Procedures (FAO/NACA 2001) and an Asia DiagnosticGuide to Aquatic Animal Diseases (Bondad-Reantaso et al., 2001).

The ‘Technical Guidelines’ are the first of a regional technical guidelines providing supportto the implementation of the relevant provisions of FAO’s CCRF, endorsed by the ASEANWorking Group on Fisheries as an ASEAN policy document and the ASEAN-SEAFDECMillenium Conference “Fish for the People”; and supported by the APEC Fisheries WorkingGroup through a number of aquaculture health projects.

Aquatic Animal Surveillance and Disease Reporting

The Asia-Pacific Quarterly Aquatic Animal Disease Reporting System (QAAD Asia-Pacific),established with the OIE Regional Representation for the Asia-Pacific to improveinternational disease reporting, is a second major output of the Regional Programme. Untillast quarter of 2002, 17 quarterly issues were published (see for example NACA/FAO,1999; OIE, 2000), and the reporting system is continuing with good progress, long-termfinancial assistance granted by the NACA member governments, and technically supportedby the Asia Regional Advisory Group on Aquatic Animal Health (AG) and NACA Secretariat.As a result, a clearer, progressive health profile for diseases important to the Asian region isemerging which represents important building blocks of information required for instituting

5 Network of Aquaculture Centres in Asia-Pacific6 Australia, Bangladesh, Cambodia, China PR, DPR Korea, Hong Kong SAR China, India, Indonesia, Iran, Japan, Korea RO,Lao PDR, Malaysia, Myanmar, Nepal, Pakistan, Philippines, Singapore, Sri Lanka, Thailand, and Vietnam.7 Aquatic Animal Health Research Institute8 Australian Centre for International Agriculture Research9 Fish Health Section of the Asian Fisheries Society


52


control and eradication as well as early warning, risk assessment, contingency plans andemergency preparedness programs for aquatic animal diseases and epizootics. Surveillanceand reporting systems serve as a ‘value added’ label to aquaculture and fisheries products,as they reflect a country’s commitment and ability to collect and provide documentedinformation and evidence on the health, origin and quality of each commodity. Countrieswith a sound aquatic animal health infrastructure and a demonstrated record of surveillance,containment and disease control programs provide them a significant trade benefit.

ACIAR recently published a surveillance toolbox for aquatic animal diseases, a practicalmanual and software package that is valuable in collecting reliable, high quality informationabout aquatic animal diseases using rapid, inexpensive techniques suitable for developingcountries (Cameron, 2002).

NATIONAL STRATEGY ON AQUATIC ANIMAL HEALTH AND EXAMPLES

National strategies on aquatic animal health management, a third major output of the RegionalProgramme, provide a framework for the national level implementation of the ‘TechnicalGuidelines’, and contain the action plans of government at the short, medium and longterm, following the concept of “phased implementation based on national needs”.Participating countries of the Regional Programme are at different stages of developmentof the National Strategy. Australia’s five-year national strategic plan for aquatic animalhealth, “AQUAPLAN”, was already in place prior to the implementation of the RegionalProgramme (AFFA, 1999). It comprises eight key program under which Australia’sgovernment and private sectors have identified priority projects to achieve the programobjectives (AFFA 1999). These are: (a) international linkages, (b) quarantine, (c) surveillance,monitoring and reporting, (d) preparedness and response, (e) awareness, (f) research anddevelopment, (g) legislation, policies and jurisdiction, and (h) resources and funding. Underthe program, the following documents have been released: (a) Australian Aquatic AnimalDisease Identification Field Guide (March 2000); (b) AQUAPLAN Zoning Policy Guidelines(August 2000, January 2001)); (c) AQUAVETPLAN Enterprise Manual (December 2000);and (d) AQUAVETPLAN Furunculosis Disease Strategy Manual (June 2001).

Other countries such as Hong Kong SAR and Singapore also have existing national strategiesin place. These countries were provided an opportunity to further strengthen their nationalstrategies according to the various regional activities and new aquatic animal health conceptsintroduced under the Regional Programme. Other countries such as India, Indonesia,Myanmar, Nepal, Philippines, Thailand and Vietnam conducted national level consultationswith relevant government agencies involved in aquatic animal health management, as afirst step in the process building on the resources available for its development andimplementation. Priority setting based on a comprehensive assessment of the needs foraquatic animal health management is the first essential step. There are, of course, costsinvolved and although opportunities exist to seek funding and technical assistance fromdonor agencies, the primary responsibility of finalising the National Strategy and identifyingand allocating resources rests within the responsible authorities. Political will is essential.


53


AQUATIC ANIMAL PATHOGEN AND QUARANTINEINFORMATION SYSTEM

The Aquatic Animal Pathogen and Quarantine Information System (AAPQIS), a fourthmajor output of the Regional Program, was aimed to (a) provide a mechanism for assessinginformation on aquatic animal pathogens and diseases, with tools to help map, track andcross-reference literature at the regional level to support government’s disease controlprograms, and (b) to serve as information resources for risk analysis as well as referenceinformation for aquatic animal disease diagnosticians and researchers. The informationcontained in the information database are derived from scientific literature by a team ofestablished experts in different fields of aquatic animal health. AAPQIS has now becomeFAO’s self-sustained and self-improved information system on aquatic animal health andis currently undergoing revision and improvement using state-of-the-art technology. AAPQISin Latin America, Mediterranean, Africa and North America are currently being developed.

ESTABLISHMENT OF THE ASIA REGIONAL ADVISORYGROUP ON AQUATIC ANIMAL HEALTH

The Regional Advisory Group on Aquatic Animal Health (AG), one of the majorrecommendations in the Beijing Consensus and Implementation Strategy, was formalizedin 2001. The AG, representing an official group of experts on aquatic animal health,institutionalized and financed by the national governments, under NACA’s inter-governmental framework, meets annually to provide high level technical advice to NACAfor better health management in the region. Through the AG and its activities, formal technicalassistance and advice are now provided by FAO, NACA and OIE to Asian governments, inthe implementation of the ‘Technical Guidelines’.

CAPACITY AND AWARENESS BUILDING

Subasinghe et al. (2001) identified communication as a key strategy for an effective healthmanagement programme. This is based on a continuum of open communication andmultidirectional information exchange and interaction/feedback at all levels of aquacultureactivity, from the production stock to the international level. This strategy, achieved throughthe various capacity and awareness building activities, is one area that will continue tosupport efforts at providing resolutions to aquatic animal health problems in the region.Described below are some further updates of on-going activities to build and improvecapacity concerning concepts/approaches that are recently being applied in aquatic animalhealth management.

Aquatic animal epidemiology

This is a new concept introduced into the region in 1996 through a training course (ACIARMasterclass on Aquatic Animal Epidemiology) for a select group of senior aquatic animalhealth specialists. Epidemiology is now being applied in the disease reporting system andintegrated in various research investigations and diagnostics (Lilley et al., 1998; Corsin etal., 2001; Morgan, 2001; Mohan et al., 2002). Most recently, epidemiology was one of thekey approaches used in the emergency investigation of a serious disease outbreak of koiand common carps in Indonesia. There will be more demand for aquatic animal


54


epidemiologists in the region and the use of epidemiology will significantly improve healthmanagement, risk analysis and disease control.

Risk analysis in aquatic animal movement

MacDiarmid (1997) defined ‘risk analysis’ as a tool intended to provide decision-makerswith an objective, repeatable and documented assessment of the risks posed by a particularcourse of action. It is intended to answer the following questions: what can go wrong?, howlikely is it to go wrong?, what would be the consequence of its going wrong?, what can bedone to reduce either the likelihood or the consequence of its going wrong?

Import risk analysis (IRA) is the process by which importing authorities determine whetherlive aquatic animal imports or their products (e.g. genetic material, feed stuff, biologicalproducts, pathological material) pose a threat to the aquatic resources of their country. Theprocess identifies the hazards associated with the movement of a particular commodity andmitigative options assessed; the results of the analyses are communicated to the authoritiesresponsible for approving or rejecting the import. IRA is usually undertaken by the CompetentAuthority (CA) for the importing country; IRAs can, nonetheless, range from an individualfarmer analyzing and assessing the risks associated with a potential, specific importation,to a full range IRA carried out by a multidisciplinary team (FAO/NACA, 2001). It issystematic, iterative, transparent, science-based and the process involves four major steps:(a) hazard identification, (b) risk assessment, (c) risk management; and (d) riskcommunication - a step that takes place throughout the entire IRA process.

To comply with WTO-SPS obligations, governments are encouraged to implement import/export decisions based on international standards or using science-based IRAs. Due topractical difficulties in interpreting the provisions in the SPS Agreement, it is importantthat countries, at the first instance, familiarize, understand and embrace the concept firstand not be discouraged by the expected intricacy of the process (FAO/NACA, 2001).Countries will be confronted with a range of conditions and scenarios when conducting anIRA and regulations will vary from country to country. For developing countries, the greateststruggle will be information (both quantity and quality), capacity of staff, disease surveillanceto demonstrate country/regional freedom from specific disease agents, legislation anddecisions for determining what constitutes “acceptable risks”.

Since 1997, when the EAFP10 organized, at its 8th EAFP Conference, the EAFP RiskAssessment in Aquaculture, there followed activities all aimed at better understanding andgaining skills in conducting IRAs for aquatic animal health. These include the (a) OIEInternational Conference on Risk Analysis in Aquatic Animal Health (OIE, 2001); and the(b) APEC FWG 01/2002 “Capacity and Awareness Building on Import Risk Analysis (IRA)for Aquatic Animals”. The latter which involved two regional workshops (First Workshop,23 governments, 1-6 April 2002, Bangkok, Thailand; Second Workshop, 20 governments,12-17 August 2002, Mazatlan, Mexico) that brought together policy makers, administrators,aquatic animal health scientists and private sector representatives in order to build awarenessand capacity to understand and undertake risk analysis for aquatic animals at national and

10 European Association of Fish Pathology


55


regional levels. This Project will (a) produce a Manual on IRA for Aquatic Animals toprovide guidance to economies and governments in conducting IRAs for the internationaltrade of aquatic animals; (b) establish a network of people with skills and capacities onIRAs for increased contacts between individuals and governments in undertaking improvedbiosecurity measures in the international trade of aquatic animals;; and (c) improve capacityin surveillance, monitoring and reporting of aquatic animal diseases and contingency plansfor emergency disease situations.

Diagnostics

Because of the scale of resource expertise and infrastructure required (e.g., training, facilities)for disease diagnostics, FAO/NACA (2000) recommends the use of three levels of diagnostics(Levels I, II, and III) which have broad-scale application to disease detection and diagnostics.Countries are encouraged to move from one level to the next as capacities are improved andas resources become available.

Recently, molecular-based technologies (Level III diagnosis) are advancing rapidly. Thesetools include both immunoassays and DNA-based methods (e.g. fluorescent anti-body tests,enzyme-linked immunosorbent assays, radio-immunoassay, in-situ hybridization, dot blothybridization and polymerase chain reaction). Walker and Subasinghe (2000) reviewedtheir use in disease diagnosis and pathogen detection and evaluated the research needs fortheir standardization and validation. While these tools provide quick results, with highsensitivity and specificity, and are particularly valuable for infections which are difficult todetect using standard histology and tissue-culture techniques, they have limitations in termsof appropriate applications, standardized sampling, testing procedures and interpretation ofresults (Walker and Subasinghe, 2000). Such techniques are also of narrow value to newlyemerging diseases where the causative agent is unknown ñ in which case - histology, a non-specific general technique, is still the most appropriate method to accurately interpretpathology that will focus on the potential causative agent/s. While further development ofthese technologies will no doubt enhance rapid detection and diagnosis of disease crucialfor early and effective disease control, there will be practical problems in their applications.A case example is the prevalent use of PCR in shrimp disease diagnostics. There are goodevidence that PCR is a highly effective method and if appropriately applied for viral screeningof broodstock and post-larvae and with good farming practices, the risk of disease occurrenceand crop failure can be reduced. However, various factors (e.g., high level of technicalskills required to use PCR techniques; the wide range of tests available with varying targetsites and sensitivities; misconception about PCR solving shrimp disease problems; and thecurrent trend of using the technology for field kit use by non-specialists) have lead to difficultyin interpretation of results and farmer confusion. Current efforts in Asia-Pacific are gearedtowards (a) standardizing procedures for sample preparation, storage, extraction and analysis;(b) uniform training for technicians; (c) inter-calibration exercise for laboratories; and (d)continuing farmer education on disease prevention and good farm and health management.


56


Molluscan health management

While finfish and shrimp disease diagnostic capacities in the region are advancing rapidly,efforts at capacity building on molluscan health management in the region started only in1999. Through financial support from FAO, technical coordination of NACA, and expertassistance from various institutions/organizations11, the Asia-Pacific Molluscan HealthManagement Program was launched in 1999. The Program consists of three Phases (PhaseI - 1999, II - 2002 and III - 2004) and is aimed at building capacity on molluscan health. Atthe end of the Program, we will expect: (a) a small group of Asian scientists trained onmolluscan health management (Levels I, II and III); (b) an accurate picture of molluscandisease situation based on extensive country surveys; (c) an electronic mail based discussiongroup and extensive network of molluscan health specialist in the region supported byglobal experts; and (d) an institutional depository of molluscan disease resource materialsand resource centers on molluscan health.

Emergency response to disease outbreaks

A recent regional experience in responding to an emergency disease situation is that of asuspected case of KHV incursion in Indonesia in June 2002. Within a two week period afterreceiving a formal request for assistance from the Government of Indonesia, NACAmobilised its resources, called for assistance from its network of partners and individualexperts and coordinated and formed an Emergency Task Force. An international task forceof 3 members (an epidemiologist, a virologist and aquatic animal health specialist) wasimmediately deployed to Indonesia and together with a local task of Indonesia’s Departmentof Marine Affairs and Fisheries, conducted an investigation of the outbreak through fieldobservations (i.e., field visits, local/district officials and farmer interviews) and laboratoryexaminations (e.g., histopathology, virology, PCR, and electron microscopy supported bynumber of laboratories12) of collected samples. The general direction of the Task Forceinvestigation was to determine the possible involvement of KHV (Ariav et al., 1999, Hedricket al., 2002), a disease whose characteristics were found to be similar to the current diseaseepizootic. The Task Force findings revealed that an infectious agent/s is involved in theoutbreak (from epidemiological observations of sudden onset, rapid spread, specificity tokoi and common carp, analogy with KHV outbreaks), that the disease was introduced toIndonesia through fish importation and spread into other areas through fish movements. AsKHV was detected through PCR from all case samples, KHV might have played a role inthe observed mortalities. Other agents may also be well involved such as parasites, bacteria(based on pathology report) and other environmental factors. The Government of Indonesiawas advised to temporarily restrict the movement of koi and common carps through aMinisterial Circular which took effect in July 2002. An intensive information disseminationwas also undertaken to raise awareness and inform the public sector about relevantinformation, including risks to human health, available at that time. The Government of

11 Technical support provided by SEAFDEC-AQD, OIE, IFREMER-France, DFO-Canada, NIWA/MAFF-New Zealand,Australia’s AFFA, University of Queensland, University of Tasmania, Queensland Museum and Darwin’s DPIE, Korea’sCheju University and Maryland Department of Natural Resources – Cooperative Oxford Laboratory.12 Institute of Aquaculture, University of Stirling, Scotland, U.K.; University of California (Davis), U.S.A.; AAHRI, Thailand;Intervet, Singapore and Netherlands


57


Indonesia was also advised to report the matter to OIE and a report was immediately sent toOIE in 26 June 2002. A positive outcome of this epizootic is the approval of an emergencyassistance to the Government of Indonesia through a Technical Cooperation Project “HealthManagement in Freshwater Aquaculture” funded by FAO to further assist Indonesia infinding resolution to this emergency situation.

The experience in this recent epizootic provided some valuable insights: (a) the importanceof regional and international cooperation; (b) the need to increase awareness on emergingdiseases in other parts of the globe and the possibility of it’s spreading to the Asian region;(c) the need to improve diagnostic capabilities at both national and regional levels; (d) pro-active reporting of serious disease outbreaks as a mechanism for early warning; (e) theneed to have contingency plans both and national and regional levels; (f) the need to improvecompliance and implementation of policies reached at regional and international levels; (g)emergency preparedness as a core function of government services; and (h) financial planningtowards immediate provision of funds for emergency disease situations be seriouslyconsidered both at national and regional levels.

Conclusions

The current strategy in Asia-Pacific emphasizes responsible health management to minimizethe risks of disease incursions brought about by movement of live aquatic animals and theirproducts. The ëTechnical Guidelines’ provide valuable guidance for national and regionalefforts in reducing these risks and a strong platform for mutual cooperation at national,regional and international levels. The strong technical and political support from regional,inter-governmental and global organizations such as AAHRI, ACIAR, APEC, ASEAN,FAO, FHS/AFS, NACA, OIE and SEAFDEC, and shared commitment from nationalgovernments, are all positive signs.

Countries intending to import live aquatic animals are bound to abide by a number ofinternational agreements and other relevant regional guidelines. Improved compliance isnecessary. Aquaculture suffered enormous losses and there are now important lessons learnedfrom the past. The sector will continue to intensify and this will based heavily on movementof live aquatic animals and its products. Trade is important and will continue because it is anecessity for aquaculture development at both subsistence and commercial levels. Intensifiedtrade will, however, also foster increased global exposure to disease agents, the impacts ofwhich may be irreversible. On the other hand, strict or excessive controls will also lead totrade underground. Despite the various activities and advocacies done both at national andregional levels, the region is still facing continuous disease incursions. The risks of majordisease incursion and newly emerging diseases will continue to threaten the sector, andunless appropriate health management measures are continuously put in place andimplemented, the government and private sectors will be faced with more costs in terms ofproduction losses, and efforts to contain and eradicate them than would have spent inpreventing their entries into the system. There is no clear cut strategy - strong political willand national commitment from responsible administration, intensified regional and globalcooperation and pro-active involvement, effective cooperation and strategic networkingbetween governments, farmers/industry, researchers, scientists, experts, development and


58


aid agencies, and relevant stakeholders at all levels towards harmonizing aquatic animalhealth management measures and promoting responsible trans-boundary movement ofaquatic animals and products will reduce the risks. Health management is a sharedresponsibility and each stakeholder’s contribution is essential to the health managementprocess.

REFERENCES

ADB/NACA. 1991. Fish health management in Asia-Pacific. Report of a Regional Study andWorkshop on Fish Disease and Fish Health Management. ADB Agriculture Department ReportSer. No. 1, Network of Aquaculture Centres in Asia-Pacific, Bangkok, Thailand. 627 p.

AFFA. 1999. AQUAPLAN. Australia’s National Strategic Plan for Aquatic Animal Health 1998-2003. Canberra, Government of Australia, 34 p.

Albaladejo, J.D. 2001. Philippines: National review on management strategies for major diseases inshrimp aquaculture. In Subasinghe, R., Arthur, R., Phillips, M.J. and Reantaso, M. (eds.).Thematic Review on Management Strategies for Major Diseases in Shrimp Aquaculture.Proceedings of a Workshop held in Cebu, Philippines on 28-30 November 1999. WB/NACA/WWF/FAO. pp. 67-73.

Alday de Graindorge, V. and Griifit, D. 2001. Ecuador: National review on management strategiesfor major diseases in shrimp aquaculture. In Subasinghe, R., Arthur, R., Phillips, M.J. andReantaso, M. (eds.). Thematic Review on Management Strategies for Major Diseases in ShrimpAquaculture. Proceedings of a Workshop held in Cebu, Philippines on 28-30 November 1999.WB/NACA/WWF/FAO. pp. 17-19.

Ariav, R., Tinman, S., Paperna, I. and Bejerano, I. 1999. First Report of newly merging viral diseaseof Cyprinus carpio species in Israel. 9th International Conference on Diseases of Fish andShellfish. European Association of Fish Pathologists, 19-24, September 1999, Rhodes, Greece.

Arthur, J.R. and Ogawa, K. 1996. A brief overview of disease problems in the culture of marinefinfishes in east and Southeast Asia. In Main, K.L. and Rosenfeld, C. (eds.). AquacultureHealth Management Strategies for Marine Fishes. Proceedings of a Workshop in Honolulu,Hawaii, October 9-13, 1995. The Oceanic Institute, Hawaii. pp. 9-31.

Alday-Sanz, V. and Flegel, T.W. 1997. The risk of introducing yellow-head and white-spot viralinfections from Asia to the Americas. Proceedings of the 4th Ecuadorian Aquaculture Congress.CD-ROM Pap. No. 1.

Bondad-Reantaso, M.G., McGladdery, S.E., East, I. and Subasinghe, R.P. (eds). 2001. Asia DiagnosticGuide to Aquatic Animal Diseases. FAO Fisheries Technical Paper No. 402, Supplement 2.FAO, Rome. 236 p.

Cameron, A. 2002. Survey Toolbox for Aquatic Animal Diseases. A Practical Manual and SoftwarePackage. ACIAR Monograph No. 94, 375 p.

CBD. 1992. Convention on Biological Diversity. 5 June 1992, 29 p. (http://www.biodiv.org/convention/articles.asp)

Chang, S.F. 2001. Grouper viral diseases and research in Singapore. In Bondad-Reantaso, M.B.,Humphrey, J., Kanchanakhan, S. and Chinabut, S. (eds.). Report and Proceeding of APECFWG Project 02/2002 “Development of a Regional Research Programme on Grouper VirusTransmission and Vaccine Development”. 18-20 October 2000, Bangkok, Thailand. Asia-Pacific Economic Cooperation (APEC), Aquatic Animal Health Research Institute (AAHRI),Fish Health Section of the Asian Fisheries Society (FHS/AFS) and the Network of AquacultureCentres in Asia-Pacific (NACA), Bangkok, Thailand. pp. 66-67.


59


Chanratchakool, P., Fegan, D.F. and Phillips, M.J. 2001. Thailand: National review on managementstrategies for major diseases in shrimp aquaculture. In Subasinghe, R., Arthur, R., Phillips,M.J. and Reantaso, M. (eds.). Thematic Review on Management Strategies for Major Diseasesin Shrimp Aquaculture. Proceedings of a Workshop held in Cebu, Philippines on 28-30November 1999. WB/NACA/WWF/FAO. pp. 85-90.

Chinabut, S. 2002a. Jaundice disease in catfish, as case study demonstrating a decline in incidenceas a result to research output. In Arthur, J.R., Phillips, M.J., Subasinghe, R.P., Reantaso, M.B.and MacRae, I.H. (eds.). Primary Aquatic Animal Health Care in Rural, Small-Scale,Aquaculture Development. FAO Fish. Tech. Pap. No. 406. FAO, Rome. pp. 77-80.

Chinabut, S. 2002b. A case study of isopod infestation in tilapia cage culture in Thailand. In Arthur,J.R., Phillips, M.J., Subasinghe, R.P., Reantaso, M.B. and MacRae, I.H. (eds.). Primary AquaticAnimal Health Care in Rural, Small-Scale, Aquaculture Development. FAO Fish. Tech. Pap.No. 406. FAO, Rome. pp.201-202.

Chinabut, S. 1994. EUS in Thailand. In Roberts, R.J., Campbell, B. and MacRae, I.H. (eds.)Proceedings of the ODA Regional Seminar on Epizootic Ulcerative Syndrome, 25-27 January1994, Aquatic Animal Health Research Institute, Bangkok, Thailand, 25-27 January 1994.pp. 58-60.

Chua, F., Loo, J.J., Wee, J.W. and Ng, M.L. 1993. Findings from a fish disease survey: an overviewof the marine fish disease situation in Singapore. Singapore Journal of Primary Industries 21,26-37.

Corrales, H.L., Watson, C.L. and Wigglesworth, J. 2001. Honduras: National review on managementstrategies for major diseases in shrimp aquaculture. In Subasinghe, R., Arthur, R., Phillips,M.J. and Reantaso, M. (eds.). Thematic Review on Management Strategies for Major Diseasesin Shrimp Aquaculture. Proceedings of a Workshop held in Cebu, Philippines on 28-30November 1999. WB/NACA/WWF/FAO. pp. 20-23.

Corsin, F., Turnbull, J.F., Hao, N.V., Mohan, C.V., Phi, T.T., Phuoc, L.H., Tinh, N.T.N. and Morgan,K.L. 2001. Risk factors associated with white spot syndrome virus infection in a Vietnameserice-shrimp farming system. Diseases of Aquatic Organisms 47, 1-12.

Drazba, L. 2001. Nicaragua: National review on management strategies for major diseases in shrimpaquaculture. In Subasinghe, R., Arthur, R., Phillips, M.J. and Reantaso, M. (eds.). ThematicReview on Management Strategies for Major Diseases in Shrimp Aquaculture. Proceedingsof a Workshop held in Cebu, Philippines on 28-30 November 1999. WB/NACA/WWF/FAO.pp. 24-28.

FAO. 1995. Code of Conduct for Responsible Fisheries. FAO, Rome. 41 p.

FAO/NACA. 2000. Asia Regional Technical Guidelines on Health Management for the ResponsibleMovement of Live Aquatic Animals and the Beijing Consensus and Implementation Strategy.FAO Fisheries Technical Paper No. 402. FAO, Rome. 53 p.

FAO/NACA. 2001. Manual of Procedures for the Implementation of the Asia Regional TechnicalGuidelines on Health Management for the Responsible Movement of Live Aquatic Animals.FAO Fishheries Technical Paper No. 402. Suppl. 1. FAO, Rome. 106 p.

Flegel, T.W. 1998. Special topic review: major viral diseases of the black tiger prawn (Penaeusmonodon) in Thailand. World Journal of Microbiology and Biotechnology 13, 433-442.

Hedrick, R.P., Gilad, O., Yun, S., Spandenberg, J.V., Marty, G.D., Nordhausen, R.W., Kebus, M.J.,Bercovier, H., Eldar, A. 2002. A herpesvirus associated with mass mortality of juvenile andadult koi, a strain of common carp. Journal of Aquatic Animal Health 12, 44-57.


60


Israngkura, A. and Sae-Hae, S. 2002. A review of the economic impacts of aquatic animal diseases.In Arthur, J.R., Phillips, M.J., Subasinghe, R.P., Reantaso, M.B. and MacRae, I.H. (eds.).Primary Aquatic Animal Health Care in Rural, Small-Scale, Aquaculture Development. FAOFishheries Technical Paper No. 406. FAO, Rome. pp. 253-286.

ICES. 1995. ICES Code of practice on the introduction and transfers of marine organisms – 1994.ICES Co-operative Research Report No. 204.

Khoa, L.V., Hao, N.V. and Huong, L.T.L. 2001. Vietnam: National review on management strategiesfor major diseases in shrimp aquaculture. In Subasinghe, R., Arthur, R., Phillips, M.J. andReantaso, M. (eds.). Thematic Review on Management Strategies for Major Diseases in ShrimpAquaculture. Proceedings of a Workshop held in Cebu, Philippines on 28-30 November 1999.WB/NACA/WWF/FAO. pp. 91-94.

MacDiarmid, S.C. 1997. Risk analysis, international trade and animal health. In Molak, V. (ed.).Fundamentals of Risk Analysis and Risk Management. CRC Lewis Publishers, Boca Raton.pp. 377-387.

Mohan, C.V., Corsin, F., Thakur, P.C., Padiyar, P.A., Madhusudan, M., Turnbull, J.F., Hao, N.V. andMorgan, K.L. 2002. Usefulness of dead shrimp specimens in studying the epidemiology ofwhite spot syndrome virus (WSSV) and chronic bacterial infection. Diseases of AquaticOrganisms 50, 1-8.

Mohan, C.V. and Basavarajappa, H.N. 2001. India: National review on management strategies formajor diseases in shrimp aquaculture. In Subasinghe, R., Arthur, R., Phillips, M.J. and Reantaso,M. (eds.). Thematic Review on Management Strategies for Major Diseases in ShrimpAquaculture. Proceedings of a Workshop held in Cebu, Philippines on 28-30 November 1999.WB/NACA/WWF/FAO. pp. 51-58.

Morales, R., Becerra, L. and Lara, C. 2001. Panama: National Review on Management Strategiesfor Major Diseases in Shrimp Aquaculture. In Subasinghe, R., Arthur, R., Phillips, M.J. andReantaso, M. (eds.). Thematic Review on Management Strategies for Major Diseases in ShrimpAquaculture. Proceedings of a Workshop held in Cebu, Philippines on 28-30 November 1999.WB/NACA/WWF/FAO. pp. 29-31.

Morgan, K.L. 2001. Epizootic ulcerative syndrome: an epidemiological approach. In Rodgers, C.J.(ed.). Risk Analysis in Aquatic Animal Health. Proceedings of an International Conferenceheld in Paris, France, 8-10 February 2000. OIE, Paris. pp. 209-214.

NACA. 2002. NACA Newsletter. Vol. XVII, No. 4, October to December 2002. Network ofAquaculture Centres in Asia-Pacific, Bangkok, Thailand.

NACA/FAO. 1999. Quarterly Aquatic Animal Disease Report (Asia-Pacific Region), 98/3. October-December 1998. FAO Project TCP/RAS/6714, Bangkok, Thailand. 42 pp.

Nash, G., Arkarjamon, A. and Withyachumnarnkul, B. 1995. Histological and rapid haemocyticdiagnosis of yellow-head disease in Penaeus monodon. In Shariff, M., Arthur, J.R. andSubasinghe, R.P. (eds.). Diseases in Asian Aquaculture II. Asian Fisheries Society, Manila.pp. 89-98.

OIE. 2000. Quarterly Aquatic Animal Disease Report (Asia-Pacific Region). April – June 2000(2000/2). Tokyo, OIE Representation for Asia and the Pacific. 41 pp.

OIE. 2001. Risk analysis in aquatic animal health. In Rodgers, C.J. (ed.) Proceedings of an InternationalConference held in Paris, France, 8-10 February 2000. 346 pp. (Information at http://www.oie.int/eng/publicat/ouvrages/a_101.htm)


61


OIE. 2003. Aquatic Animal Health Code. 6th Edition. Office International des Épizooties, Paris.(http://www.oie.int/eng/normes/fcode/a_summry.htm)

Rahman, M. 2001. Bangladesh: National review on management strategies for major diseases inshrimp aquaculture. In Subasinghe, R., Arthur, R., Phillips, M.J. and Reantaso, M. (eds.).Thematic Review on Management Strategies for Major Diseases in Shrimp Aquaculture.Proceedings of a Workshop held in Cebu, Philippines on 28-30 November 1999. WB/NACA/WWF/FAO. pp. 45-50.

Reantaso, M.B., Phillips, M.J. and Subasinghe, R.P. 2000. Developing a surveillance program foraquatic animal diseases in Asia-Pacific: progress and constraints. In Salman, M.D., Morley,P.S., Ruch-Gallie, R. (eds.). 9th Symposium of the International Society for VeterinaryEpidemiology and Economics (ISVEE), Breckenridge, Colorado. pp. 672-674.

Reantaso, M.B., Arthur, J.R., Subasinghe, R.P. and Phillips, M.J. 2001. Aquatic animal health andbiodiversity management. In Macintosh, D.J., Hansen, L.N. and Nielsen, T. (eds.). Proceedingsof the Conference on Biodiversity Conservation and Utilisation: Policy Coherence, EthicalIssues, Management and Implementation. 13th October 1999, Eigtveds Pakhus, Copenhagen,Denmark.

Shariff, M. 1995. Fish health: an odyssey through the Asia-Pacific region. Syarahan inaugural.University Pertanian Malaysia, Serdang, Malaysia. 25 p.

Siriwardena, P.P.G.S.N. 2001. Sri Lanka: National review on management strategies for major diseasesin shrimp aquaculture. In Subasinghe, R., Arthur, R., Phillips, M.J. and Reantaso, M. (eds.).Thematic Review on Management Strategies for Major Diseases in Shrimp Aquaculture.Proceedings of a Workshop held in Cebu, Philippines on 28-30 November 1999. WB/NACA/WWF/FAO. pp. 79-84.

Somga, J.R., Somga, S.S. and Reantaso, M.B. 2002. Impacts of disease on small-scale grouperculture in the Philippines. In Arthur, J.R., Phillips, M.J., Subasinghe, R.P., Reantaso, M.B.and MacRae, I.H. (eds.). Primary Aquatic Animal Health Care in Rural, Small-Scale,Aquaculture Development. FAO Fissheries Technical Paper No. 406. FAO, Rome. 2002. pp.207-214.

Subasinghe, R.P., Bondad-Reantaso, M.B. and S.E. McGladdery. 2001. Aquaculture development,health and wealth. In Subasinghe, R.P., Bueno, P., Phillips, M.J., Hough, C., McGladdery,S.E. and Arthur, J.R. (eds.). Aquaculture in the Third Millenium. Technical Proceedings ofthe Conference on Aquaculture in the Third Millenium, Bangkok, Thailand, 20-25 February2000. pp. 167-191.

Thursfield, M. 1995. Veterinary Epidemiology, 2nd ed.. Blackwell Science Ltd., Oxford.

Turner, G. (ed.). 1988. Codes of Practice and Manual of Procedures for Consideration of Introductionsand Transfers of Marine and Freshwater Organisms. EIFAC Occasional Paper No. 23. EuropeanInland Fisheries Advisory Commission. FAO, Rome.

Vargas, R. 2001. Country Paper: Costa Rica. In APEC/FAO/NACA/SEMARNAP. 2001. Trans-boundary Aquatic Animal Pathogen Transfer and the Development of Harmonized Standardson Aquaculture Health Management. Report of the joint APEC/FAO/NACA/SEMARNAPWorkshop, Puerto Vallarta, Jalisco, Mexico, 24-28 July 2000. Network of Aquaculture Centresin Asia-Pacific, Bangkok, Thailand. pp. 100-101.

Walker, P.J. 2001. Australia: National review on management strategies for major diseases in shrimpaquaculture. In Subasinghe, R., Arthur, R., Phillips, M.J. and Reantaso, M. (eds.). ThematicReview on Management Strategies for Major Diseases in Shrimp Aquaculture. Proceedingsof a Workshop held in Cebu, Philippines on 28-30 November 1999. WB/NACA/WWF/FAO.pp. 39-44.


62


Walker, P.J. and Subasinghe, R. (eds.) 2000. DNA-based molecular diagnostic techniques: researchneeds for standardization and validation of the detection of aquatic animal pathogens anddiseases. Report and proceedings of the Expert Workshop on DNA-based MolecularTechniques: Research Needs for Standardization and Validation of the Detetction of AquaticAnimal Pathogens and Diseases. Bangkok, Thailand, 7-9 February 1999. FAO FishheriesTechnical Paper No. 395. FAO, Rome. 93 p.

Wei, Q. 2002. Social and economic impacts of aquatic animal health problems in aquaculture inChina. In Arthur, J.R., Phillips, M.J., Subasinghe, R.P., Reantaso, M.B. and MacRae, I.H.(eds.). Primary Aquatic Animal Health Care in Rural, Small-Scale, Aquaculture Development.FAO Fishheries Technical Paper No. 406. Rome, FAO. pp. 55-61.

Wong, S.Y. and Leong, T.S. 1987. Current fish disease problems in Malaysia. In Arthur, J.R. (ed.).Fish Quarantine and Fish Diseases in South and Southeast Asia: 1986 Update. Asian FishheriesSociety Special Publication No. 1. pp. 12-21.

WTO. 1994. Agreement on the application of sanitary and phytosanitary measures. In The Results ofthe Uruguay Round of Multilateral Trade Negotiations: The Legal Texts. General Agreementon Tariffs and Trade (GATT), World Trade Organization, Geneva. p. 69-84.

Yang, Y.G., Shariff, S., Lee, L.K. and Hassan, M.D. 2001. Malaysia: National review on managementstrategies for major diseases in shrimp aquaculture. In Subasinghe, R., Arthur, R., Phillips,M.J. and Reantaso, M. (eds.). Thematic Review on Management Strategies for Major Diseasesin Shrimp Aquaculture. Proceedings of a Workshop held in Cebu, Philippines on 28-30November 1999. WB/NACA/WWF/FAO. pp. 65-66.

Yuasa, K. and Koersharyani, I. 2001. Present situation of occurrence of viral nervous necrosis (VNN)in Indonesian grouper hatcheries and control measures for VNN. In Bondad-Reantaso, M.B.,Humphrey, J., Kanchanakhan, S. and Chinabut, S. (eds.). Report and Proceeding of APECFWG Project 02/2002 “Development of a Regional Research Programme on Grouper VirusTransmission and Vaccine Development”, 18-20 October 2000, Bangkok, Thailand. APEC/AAHRI/FHS-AFS/NACA. Bangkok, Thailand. pp. 86-94.

Yulin, J. 2001. China: National review on management strategies for major diseases in shrimpaquaculture. In Subasinghe, R., Arthur, R., Phillips, M.J. and Reantaso, M. (eds.). ThematicReview on Management Strategies for Major Diseases in Shrimp Aquaculture. Proceedingsof a Workshop held in Cebu, Philippines on 28-30 November 1999. WB/NACA/WWF/FAO.pp. 74-78.

Zhang, H. 2001. Status of grouper culture, fry production and grouper diseases in Guangdong, ChinaP.R. In Bondad-Reantaso, M.B., Humphrey, J., Kanchanakhan, S. and Chinabut, S. (eds.).Report and Proceeding of APEC FWG Project 02/2002 “Development of a Regional ResearchProgramme on Grouper Virus Transmission and Vaccine Development”, 18-20 October 2000,Bangkok, Thailand. APEC/AAHRI/FHS-AFS/NACA.

a national survey to verify freedom from white spot syndrome virus and yellow head virus in

Documents