Vol. 10, No. 11MOLECULAR AND CELLULAR BIOLOGY, Nov. 1990, p. 5921-59260270-7306/90/115921-06$02.00/0Copyright C) 1990, American Society for Microbiology

A Hypoxic Consensus Operator and a Constitutive ActivationRegion Regulate the ANBI Gene of Saccharomyces cerevisiae

CHARLES V. LOWRY,'* MARIA ESPERANZA CERDAN,2 AND RICHARD S. ZITOMER'

Department of Biological Sciences, State University ofNew York at Albany, 1400 Washington Avenue,Albany, New York 12222,1 and Departamento de Bioquimica y Biologia Molecular,

Colegio Universitario de la Coruna, La Coruna, Spain2

Received 30 April 1990/Accepted 16 July 1990

We have identified a consensus operator sequence, YYYATTGTTCTC, which mediates the repressionimposed by the ROX1 factor upon the members of the hypoxic gene regulon, which includes ANBi, HEM13,COXSb, and CYC7. The members of the regulon were repressed with widely varying stringency, and thevariation was correlated with the number and fidelity of operator sequences observed. ANB1 had two operatorsoperating with unequal efficiency, each containing two copies of the operator sequence. Synthetic operatorsequences introduced into an operator deletion were effective as monomers but much more so as dimers,consistent with cooperativity. The native operators both imposed ROXJ repression on the GAL] gene, in eitherorientation, but the synthetic operators did not, indicating that the sequence context may be important. Therepression and activation of ANBi are independent spatially and functionally, since deletion of the operatorsdid not reduce expression and since both the operator and activation regions functioned separately in the GALlUAS. The ANB1 UAS was constitutive, containing several elements distributed over a 300-bp region. Therewere two dT-rich segments, one of 51 bp and one of 165 bp, the latter capable of activating transcription byitself. Flanking segments containing GRF2 (REBi) and ABF1 (GF1) sites may contribute to activation but werenot essential. The UAS showed a strongly preferred orientation.

In bakers' yeast, the family of "hypoxic" genes, whichinclude ANB1, COXSb, HEM13, and CYC7, are regulated bythe ROX1 protein, a repression factor which is induced byheme, which is synthesized only in aerobic cells (16). Theterm hypoxic refers to the fact that these genes are prefer-entially expressed under anaerobic conditions (6, 11, 14, 30,35, 36) and to the likelihood that three of their products areinvolved in respiration under low oxygen tension: HEM13codes for an enzyme in the heme pathway, and COXSb andCYC7 code for isoenzymes of respiratory proteins-subunitV of cytochrome oxidase and cytochrome c, respectively.Rather than encoding respiratory proteins, ANB1 and theheme-activated TIF44 gene (previously tr-J) code for isoen-zymes homologous to the translational initiation factoreIF4d (17, 26; C. Lowry, D. Quack, K. Kolor, and R.Zitomer, unpublished). Whether their function in proteinsynthesis is specialized for aerobic or anaerobic conditions isunknown.

Despite having a common repressor, each of the hypoxicgenes is regulated with a different stringency (9, 14, 35, 36).The wide variation could reside in differences betweenoperator elements targeted by the ROXI repression system.Recent studies have partially identified elements of theregulatory regions of ANBI (18) but left the nature of therepression sites and upstream activation sequence (UAS)ambiguous. A more comprehensive analysis of elementsregulating the ANB1 promoter is presented here. We showthat ROX1 acts through a pair of operator segments andpinpoint a hypoxic consensus sequence within them requiredfor repression. We have also characterized the complexconstitutive activation region of ANBI and show that theoperator and the UAS can function independently.

* Corresponding author.

MATERIALS AND METHODSStrains. The yeast strains used were AH12-7, AH12-7 roxi

(roxl::LEU2) (14), RZ53-6 (MATot leu2-3 leu-2-112 ura3-52adel-100 trpl-289), and RZ53-6rl, which contains a roxideletion (14).

Plasmids. YCpCYCI(2.4)Sx was derived from YCpCYCI(2.4) (12) by conversion of the SmaI site 3' to ANBI to aBamHI site. YCpANBI-SM was derived from YCpCYCI(2.4)Sx by replacing the SmaI-MluI fragment containing theCYCI gene with an EcoRI linker.YCpAZ8 was derived from YCpANBI-SM by insertion of

the filled-in EcoRI-DraI fragment carrying the lacZ genefrom pMC1403 (24) into the filled-in BstEII site ofYCpANBI-SM, placing the 5' end of ANBI in frame withlacZ. The SalI site in the pBR322 segment of YCpAZ8 wasdestroyed by end filling.YCpGZ11 was derived from pRY121-LR1-1, obtained

from Bob West (32), which carries a GAL1-lacZ fusion andcontains a deletion of UASG (-560 to -189). The SmaI-Saclfragment, which carries the GAL1O gene and the 5' portionof the GALl-lacZ fusion, was inserted into plasmid YCplZat the SmaI and Sacl sites so that the 5' end of theGALI-lacZ is substituted for the CYC1 segment of YCplZ(36), restoring the GALl-lacZ fusion. YCpGZ1-15 was de-rived in analogous fashion from pRY121-LR1-15 (32), whichcontains a deletion of a 41-bp segment 3' to UASG (-269 to-228), which is intact.Construction of deletion and insertion plasmids. Three sets

of Bal 31 deletions were constructed in YCpAZ8: (i) a setextending 3' from the EcoRI site, (ii) a set extending 3' fromthe XhoI site, and (iii) a set extending 5' from the XhoI site.

Additional deletions were constructed by combining se-lected fragments from the YCpAZ8 deletion set as indicatedin Fig. 1.Fragments carrying the ANBJ operators from -152 to

-234 (operator B segment, RsaI-XhoI fragment of YCpAZ

5921

5922 LOWRY ET AL.

(A) SmaI(-EcoRI) -550 -500CCGGGAATTTTAGATTCAGGTAGGAAATTGATTACATAAATACTGTTACCCTGAATCATATTCGACGATGTCGTCTCACACGGAAATATAATTCATTTCT

-450 . . . -400TGGTTTTCCAAAAAAATTTTCATTTTTTTTSCACTTTTTTGTTTCGTCCTCCTTTTTTTTTTTTTATTTTTTTTCCTGTGTTCACCTTTtTTTTrTTTTTTT

* -350 . . . . ODerator A . . Xhol .

TCAGTTTACAACTTTCTGCATTCTTTTCTGTGTTTTTTTTTTTTTCGTTTTTCCATTGTTCGTTCGTTGCCTGTTTTTTTGCCCTATTGTTCTCGAGCCT-250 . . . . Operator B

AAAAATTTTTTCCTTTCCTGCTTTCCTTTCTTCGTTCAAAG "TTTCCTATTCCATTGTTCTCTTCGGTAAACTCJATTGlTTGCTCGGAACTCAGATATATTC********************* ***

-150 . . . - 100AGGTCAATTTACTGTACTTCAATTGACTTTTTTCTTGAAATTTCAACTTGCCTTTTCAACTTGTTCTTCTTTTTTAMTCTTATTCTACACTTTAGTTCCC

-50 . .+1TTACCT TGTTCCTAATTAT TGTCTAGCAAAAAGAAAACATACACCTATTTCATTCACACACTAAAACatgtctgacgaagaacacacctt t

(B) AH12-7 I-gal

YCpAZ8 0.1(-270/-235) Al 0.1(-270/-186) A2 0.4(-313/-277) A8 5(-313/-186) A2A8 21(-313/-303) A8Al7 0.4

(-31 3/-303,-270/-1 86) A2A8A17 4

dT OpA OpB TATA ATG

(C) AHI2-7(Aroxl)

YCpAZ8 22(-270/-235) Al 14(-270/-186) A2 22(-313/-277) A8 24(-388/-277) A9 19(-434/-277) All 15(-516/-277) A16 6(-531/-277) A13 0.9(-565/-508) A14 19(-565/-487) Al 5 16(-565/-302) A17 6(-565/-277) A19 1(-516/-235)A_A16 0.5

(-565/-302,-270/-235) A1A17 0.2(-565/-487,-270/-235) AlA15 10(-565/-478,-31 3/-186) A2A8A21 9

(-313/-186) A2A8 19

FIG. 1. Regulatory segments in the ANBI upstream region. (A) Upstream sequence of the ANB1 gene. (B) Deletions constructed inplasmid YCpAZ8 and introduced into strain AH12-7 and their effect on expression of the ANBI-lacZ fusion under aerobic conditions. (C)Effect of UAS deletions introduced on YCpAZ8 into the roxi deletion strain AH12-7 (Aroxl). ,-gal, 3-Galactosidase activity; OpA and OpB,operators A and B; dT, dT-rich region. Starred sequences are consensus repression sequences; underlined sequence is a consensus sequenceof unknown function.

8M1) and from -349 to -271 (operator A segment, XhoI- synthesizer; annealed double strands carried single-strandedBsmI fragment of YCpAZ8) were inserted into the XhoI site XhoI and SalI ends and were ligated into the unique XhoIof YCpGZ1-15 at -228, 3' to UASG. Fragments carrying the sites of the two vectors.UAS region were inserted into the XhoI site of YCpGZAl at Analysis of gene expression. For analysis of expression-189. from the ANBI-lacZ fusion (YCpAZ8), overnight cultures ofOligonucleotides for insertion into either YCpAZ8A2A8 or yeast transformants were grown in selective medium (CM-

YCpGZ1-15 were synthesized on an Applied Biosystems trp [12]), diluted 30-fold into YPD, and grown at 30°C for 5 h

MOL. CELL. BIOL.

ANBI GENE OPERATOR AND UAS 5923

before being assayed for ,B-galactosidase (36). For analysis ofexpression from the GALI-lacZ fusion (YCpGZA1 andYCpGZ1-15), overnight cultures in CM-trp were washedwith YPG medium (2% Bacto-peptone [Difco], 1% yeastextract, 2% glycerol), diluted 10-fold, and grown for 7 h inYPG medium containing 0.5% lactate for cells carryingYCpGZA1 or in the same medium supplemented with 2%galactose for cells carrying YCpGZ1-15. Each experimentwas repeated three or more times, and after normalizationfor systematic variation between experiments, sample errorswere less than 20%; for values of 0.1 U or less, the error was

less than 0.1 U.

RESULTS

Location of the operator segments in ANBI. We previouslydemonstrated that repression of transcription is mediated bythe product of the ROXI gene, whose expression is inducedby heme, and that repression works through a 300-bp seg-ment of DNA lying about 270 bp from the translational startsite (12). Recent analysis by Mehta and Smith (18) of part ofthe ANB1 upstream region roughly pinpointed a repressionelement which accounted for part of the oxygen repression.In order to identify sequence elements responsible for re-

pression of transcription, we constructed a series of dele-tions upstream from an ANBJ-lacZ fusion.

Deletion of an operator would be expected to causeconstitutive expression, provided that the UAS itself isconstitutive. A deletion extending 45 bp 5' from the XhoI site(YCpAZ8A8, hereafter called A8) derepressed ,B-galactosi-dase production 50-fold to about 20% of the level in aconstitutive roxl null strain (compare expression from A8 inFig. 1B and C), indicating that the deleted region (the Aoperator segment) contains repression sequences. Anotherdeletion, A2, extending 85 bp 3' from the XhoI site to -186,also caused a slight increase in expression, about fourfold,suggesting that this region (the B operator segment) alsorepresses transcription. When the two deletions were com-bined, in A2A8, aerobic expression was fully derepressed(compare A2A8 in Fig. 1B and C). Deletion Al, extending 35bp 3' from the XhoI site, had no derepressing effect either byitself or when combined with the A operator deletion in A1A8(not shown). This further localized the B operator to a 50-bpsegment (-235 to -186) separated by at least 35 bp from theA operator; thus, the repression region is bipartite. The Aoperator corresponds to the segment identified by Mehta andSmith (18), whose analysis did not include the region carry-ing the B operator. The fact that the level of expression fromthe double deletion was the same as that in roxi cells (Fig.1C, line 1) and in anaerobic cells (not shown) indicates thatthe two operators fully account for aerobic repression and atthe same time that the UAS is itself separate and fullyconstitutive.The A operator was stronger than the B operator, since

repression was 50-fold in the absence of the B operator (A2)but only 4-fold in the absence of the A operator (A8). Weconfirmed that the effects on ANBI-lacZ expression ob-served were exerted at the level of transcript accumulationby showing that when these two deletions were presentupstream from the ANBI gene, qualitatively similar dere-pressing effects on ANB1 mRNA levels occurred (as deter-mined by Northern [RNA blot] analysis; data not shown).

Native operator segments repress GALl. To test the func-tion of the operator segments in a heterologous gene, weinserted fragments carrying them into a GALl-lacZ fusion,YCpGZ1-15, between UASG and the transcription start.

TABLE 1. Function of ANBI operator and UAS elementsin GALJ-lacZ fusion

P-GalactosidaseFunction Plasmid Insert activity' (U)

WT Aroxi

Operator YCpGZ1-15 None 320 280A (-341/-271) 4 280A (inverted) 1 270B (-234/-152) 24 200B (inverted) 19 240

UAS YCpGZA1 None 0.1-565/-313 23-313/-565 (inverted) 0.8-565/-270 15-270/-565 (inverted) 2-508/-270 23-270/-508 (inverted) 3

aAssays of cells of strain RZ53-6 (wild type [WT]) or RZ53-6rl (A&roxi).

Repression of galactose-induced expression was evident inwild-type cells but not in roxi cells (Table 1), showing thatboth segments carry ROXI-specific operators and, thus, thatROXI represses through these segments.A hypoxic repression sequence. Inspection of the se-

quences within the A and B repression regions ofANBI andcomparison with the upstream regions of the three otherhypoxic genes indicated two likely candidates for consensussequences which interact with the ROXI repression factor.The first was YYYATTGTTCTC, where Y indicates apyrimidine, which was represented twice in each operatorsegment of ANBI and at least once in the three otherhypoxic genes (Table 2). The second consensus sequencewas TCGTTCGTTGCCT, represented once in ANBI,COX5b, and CYC7 and twice in HEM13. Functional distinc-tion between the sites was ambiguous in the results of Mehtaand Smith (18), and parts of both sequences were included inthe proposed repression site. The ambiguity arose becausetheir study did not include the B operator, which containstwo YYYATTGTTCTC sequences but not TCGTTCGTTGCCT, and because their multiple-point mutagenesis hitboth sequences in the A operator.To determine whether one or both sequences plays a role

in repression, we cloned synthetic oligonucleotides intoplasmid YCpAZA2A8, which carries a full deletion of theANB1 operators, so that insertion of a functional repressorsite should impose ROXI-dependent repression. An oligo-nucleotide carrying CCCATTGTTCTC caused ROXJ-de-pendent repression ofANBI (Table 3), indicating that it is anessential part of the operator). However, TCGTTCGTTGCCT had no effect (Table 3), and additionally, a deletion ofa segment containing the same sequence in COXSb had nopronounced effect on aerobic repression of that gene (M.Hodge, K. Singh, and M. Cumsky, personal communica-tion). Hence it would appear that this sequence is neithersufficient nor necessary for repression, although it may playa role in combination with YYYATTGTTCTC.

Repression was much stronger with two copies of theoperator sequence in tandem than with one, 5.5-fold repres-sion versus 1.4-fold (Table 3). The synthetic oligonucleotidewas designed to place the consensus sequence dimer pairson the same side of the DNA helix, as they are on both theA operator (31 bases between equivalent nucleotides) andthe B operator (21 bases), since this topology might favorcooperative binding. If repression at the two sites wereindependent, we would predict about 50% inhibition (1 -

VOL. 10, 1990

5924 LOWRY ET AL.

TABLE 2. Consensus operator sequence in hypoxic regulon

Gene Sequenc Repression Type of repression(reference) que (fold) (reference)

ANBI (this study) -192 gtaaaCTCATTGTTgCTC -175 >100 02, ROXI-213 ctattTCCATTGTTCTC -197-280 tttgcCCTATTGTTCTC -264-311 gttttTCCATTGTTCGT -295

HEM13 (34) -180 ctttgCCCATTGTTCTC -164 5-40 02 (35)-280 cgcctTTTCTGGTTCTC -264-470 taattTCAATTGTTTAG -454

COX5b (6) -157 attggTCTATTGTTTAA -173 (< ) 7-10 02, ROXI (9)-321 gatttTGTATTGTTCTA -305

CYC7 (19) -121 agatcGGAATAGTTCTC -105 2-4 ROXI (14)-495 gtcgaGTAATTGT-CTC -490 2-4 No 02 repression (36)

Consensus YYYATTGTTCTC

a Identical or homologous bases are in capital letters; other bases are in lowercase letters. Each sequence is a separate operator or UAS for the indicated gene.The arrow indicates inverse orientation. Y indicates a pyrimidine.

[0.7 x 0.7]); the fact that inhibition was higher (82%)suggests that the effects of the two operator sequences arecooperative, although the presence of the second sequencemay alter the context of the first in such a way as tosynergize repression by some other route than cooperativity.An independent confirmation of the operator sequence

was provided by a 12-bp deletion within operator A, A8A17.It had a small (but consistent) 4-fold derepressing effect, butwhen combined with the operator B deletion, derepressionwas increased to 40-fold (compare A2 with A2A8A17 in Fig.1B), confirming that the 12-bp deletion eliminated part of anoperator element, ATTGTT of the 5'-most repeat. Appar-ently the presence of three of four repeats in A8A17 permit-ted almost full repression, but in the A2A8A17 deletion therewas one site and repression was weak.

Interestingly, the synthetic operator sequence had noeffect on activation by the GAL] UAS (Table 3). Nucleotidesflanking the consensus elements in the native operators andnot included in the oligonucleotide may be necessary forrepressor function; short runs of dA - dT upstream fromeach consensus sequence are an obvious possibility. Alter-natively, factors bound to the adjoining GAL] regulatoryregion may interfere with repressor binding to the operatorsequence when it is inserted by itself but not when it isembedded within the longer A or B segment.

Multiple activation elements of ANBI. We tested deletionsfor effects on activation with a roxi strain to eliminateinterference by the repression system. The activation regionextended over a wide region, and only large deletions,

extending 254 bp 5' from the XhoI site (A13) or 288 bp 3'from the EcoRI site (A19) abolished expression. Smallerdeletions extending though the region, viz. A9, All, A16, andA13, eliminated increments of activity, suggesting that muchof the activation arises from the dT-rich region, -484 to-319, as occurs in a number of other genes (22, 23, 27).When the regions flanking this segment were deleted, leavingonly the dT-rich DNA, -478 to -313, and 11 bp of DNA 5'to the TATA box, 40% expression was retained, showingthat the segment was sufficient to activate transcription,although it is possible that non-dT sequences embeddedwithin it are responsible for activation.

Elements flanking the major dT-rich region appeared toplay a role in activation. (i) The deletion just described,A2A8A17, which eliminates flanking regions and leaves thedT-rich region almost intact, was reduced 60% in activity.(ii) Al, which eliminates part of a 51-bp DED48-like (15, 27)dT-rich segment, -268 to -217, reduced activity by 40%.(iii) Segment -531 to -516 contains a GRF2 (REBJ) (3, 20,31) consensus sequence, which has been shown to synergizetranscriptional activation by DED48 (3). A16 was partiallyactive even though the 165-bp dT-rich region was absent,and the 51-bp dT-rich region was inactive by itself (A13); asimple interpretation of the activation from A16 is that thedeletion synergistically juxtaposed the GRF2 site to theDED48-like sequence, neither of which was active by itself(A13 and A1A6). Segment -302 to -277 may contain asequence which functions in the same way with the 51-bpdT-rich segment (comparing A17 and AlA17). No pro-

TABLE 3. Synthetic consensus sequence reconstitutes operator

P-Galactosidase activity (U)Plasmid Insert

WT Arox)

YCPAZ8a None 0.2 29YCPAZ8A2A&8a None 17 21

TCGACCCATTGTTCTCTTGCb 12 24CAAGAGAACAATGGGTCGA (inverted) 7(TCGACCCATTGTTCTCTTGC)2 3 22(TCGAGTTCGTTCGTTGCCTGG)2C 16 21TCGACCCATTGTTCTCTTGCTCGAGTTCGTTCGTTGCCTGG 11

YCpGZ1 15d None 320(TCGAACCCATTGTTCTCTTGC)2 320

a Transformants of strain AH12-7 (wild type [WT]) or AH12-7 (Aroxi).b Underlined sequence, consensus of ANBI operator sequences (see Table 2).c Underlined sequence, -310 to -295 of ANBI (Fig. 1A).d Transformants of strain RZ53-6.

MOL. CELL. BIOL.

ANBI GENE OPERATOR AND UAS 5925

nounced effect of deleting the two ABFJ (GF1) sites (2, 7) at-512 to -500 and -497 to -485 was observed (A15), eventhough these sites have been shown to bind protein inextracts (7).ANBI UAS can activate transcription of GAL]. To test the

ANBI UAS in a heterologous gene, we inserted segmentsfrom the upstream region into a GALI-lacZ fusion lackingUASG (32). A segment containing part of the ANBI UASregion (-565 to -313) upstream from the operator activatedexpression substantially (Table 1). The activities of GALI-lacZ and ANBI-lacZ (Fig. 1B) were not quantitatively com-parable because of different growth conditions and possi-ble differences in the stability and translation of the twomRNAs; however, qualitative comparison indicated that theANBI UAS can function in a heterologous transcription unitand confirmed that the activation and repression segmentsare independent.When subsegments of the -487 to -270 UAS region were

tested separately, the sum of their activities was less than30% of that observed for the intact segment (data notshown), suggesting that several activation elements functionsynergistically.There was a strongly favored orientation of the ANBI

UAS for activation. Fragments -565 to -513 and -565 to-270 activated expression far more efficiently in the nativeorientation, as was shown earlier for the dT-rich UASs of theRP29 gene (22) and DEDI (15). This may explain the lack ofactivation of CYCI, located near to and 5' of ANBI, duringanaerobiosis (12). Activation by segment -508 to -270,which lacks the ABFI site, also showed orientation prefer-ence, indicating that this site is not required for the effect.

DISCUSSION

Transcription of the ANBI gene is controlled by twomechanisms, constitutive activation and heme-induced re-pression. These mechanisms are mediated by separate ele-ments-a large activation region and two operator regions.Hypoxic operator. The operators are the targets for a

repressor which is either the product of the ROXI gene or afactor activated by it. We identified a 12-bp consensussequence repeated twice in two of the ROXI-responsiveoperators of ANBI. This consensus operator is found in allthe other hypoxic genes, and its ability to function in at leastone other one, COXSb, is suggested by the results of Hodgeet al. (M. Hodge, K. Singh, and M. Cumsky, personalcommunication), who found that deletion of a region carry-ing the sequence caused constitutive expression.ROXI repression normally operates in antagonism to

constitutive activation in the ANBI gene and in COXSb(Hodge et al., personal communication), but we found that itcan also block the inducible activation of GAL]. Hence,although no eucaryotic repression mechanism is well under-stood, we favor the idea that this one is versatile, effectiveagainst the variety of mechanisms which might be encoun-tered among the hypoxic genes. Other regulon-specific re-pressors are also independent of the activation mechanismsthey block (8, 29).The stringency of regulation varies widely among mem-

bers of the hypoxic gene family. The relaxed repression seenwith the HEM13, COXSb, and CYC7 genes relative to that ofANBI correlates with the reduced number and fidelity of theconsensus sequences found in these genes, as reflected bythe total number of matches to the consensus among therepeats- 45, 31, 19, and 17 bp for ANBI, HEM13, COXSb,and CYC7, respectively (scoring an insertion or a deletion as

a mismatch; see Table 2). Sequence context, which appearedto affect the oligonucleotide operator inserted into GAL], aswell as varied interaction with other regulatory factors (5,21, 30) may also modulate the efficiency of repression.

Sequence elements contributing to UAS function. TheANBI UAS is spread over a broad region and contains amosaic of elements contributing to activation. Our resultsshow that a 165-bp tract of dT-rich DNA promotes transcrip-tion and indicate that sequences flanking this segment aug-ment or amplify activation. Two types of sites known toaffect activation by dT-rich segments are present 5' to thelarge dT-rich segment, a GRF2 (REBI) binding sequence,and two tandem ABFI (GF1) sites. The role of the ABFIrepeats in ANBI regulation was not apparent, but deletion ofthe GRF2 site appeared to affect activation when the UASwas already weakened by other deletions. Activation bydT-rich DNA may involve nucleosome disruption (4, 10, 23,27, 28), but in vitro transcription experiments have indicatedthat more than disrupted chromatin is required (15). Ifnucleosome disruption is involved, trans-acting elements,such as ABFI, which affect histone assembly could regulatetranscriptional activation through dA- dT-rich segments.The ROXI factor itself could play such a role, in repression,by stabilizing nucleosomes.

LITERATURE CITED1. Buchman, A. R., W. J. Kimmerly, J. Rine, and R. D. Kornberg.

1988. Two DNA-binding factors recognize specific sequences atsilencers, upstream activating sequences, autonomously repli-cating sequences, and telomeres in Saccharomyces cerevisiae.Mol. Cell. Biol. 8:210-225.

2. Buchman, A. R., and R. D. Kornberg. 1990. A yeast ARS-binding protein activates transcription synergistically in combi-nation with other weak activating factors. Mol. Cell. Biol.10:887-897.

3. Chasman, D. I., N. F. Lue, A. R. Buchman, J. W. LaPointe, Y.Lorch, and R. D. Kornberg. 1990. A yeast protein that influ-ences the chromatin structure of UASG and functions as apowerful auxiliary gene activator. Genes Dev. 4:503-514.

4. Chen, W., S. Tabor, and K. Struhl. 1987. Distinguishing be-tween mechanisms of eukaryotic transcriptional activation withbacteriophage T7 RNA polymerase. Cell 50:1047-1055.

5. Clavillier, L., G. Pere-Aubert, M. Somlo, and P. P. Slonimski.1976. Reseau d'interactions entre des genes non lies: regulationsynergique ou antagoniste de la synthese de l'iso-1-cytochromec, de l'iso-2-cytochrome c, et du cytochrome b2. Biochimie58:155-172.

6. Cumsky, M. G., C. E. Trueblood, C. Ko, and R. 0. Poyton.1986. Structural analysis of two genes encoding divergent formsof yeast cytochrome c oxidase subunit V. Mol. Cell. Biol.7:3511-3519.

7. Dorsman, J. C., W. C. van Heeswik, and L. A. Grivell. 1988.Identification of two factors which bind to the upstream se-quences of a number of nuclear genes coding for mitochondrialproteins and to genetic elements important for cell division inyeast. Nucleic Acids Res. 16:7287-7301.

8. Herskowitz, I. 1989. A regulatory hierarchy for cell specialisa-tion in yeast. Nature (London) 342:749-757.

9. Hodge, M. R., G. Kim, C. Christian, and M. G. Cumsky. 1989.Inverse regulation of the yeast COXS genes by oxygen andheme. Mol. Cell. Biol. 9:1958-1964.

10. Kunkel, G. R., and H. G. Martinson. 1981. Nucleosomes willnot form on double-stranded RNA or over poly(dA)-poly(dT)tracts in recombinant DNA. Nucleic Acids Res. 9:6869-6888.

11. Lowry, C. V., and R. Leiber. 1986. Negative regulation of theSaccharomyces cerevisiae ANBI gene by heme, as mediated bythe ROXI gene product. Mol. Cell. Biol. 6:4145-4148.

12. Lowry, C. V., J. L. Weiss, D. A. Walthall, and R. S. Zitomer.1983. Modulator sequences mediate the oxygen regulation ofCYCI and a neighboring gene in yeast. Proc. Natl. Acad. Sci.

VOL. 10, 1990

5926 LOWRY ET AL.

USA 80:151-155.13. Lowry, C. V., and R. S. Zitomer. 1984. Oxygen regulation of

aerobic and anaerobic genes mediated by a common regulatoryfactor in yeast. Proc. Natl. Acad. Sci. USA 81:6129-6133.

14. Lowry, C. V., and R. S. Zitomer. 1988. ROX1 encodes aheme-induced repression factor regulating ANBI and CYC7 ofSaccharomyces cerevisiae. Mol. Cell. Biol. 8:4651-4658.

15. Lue, N. F., A. R. Buchman, and R. D. Kornberg. 1989. Activa-tion of RNA polymerase II transcription by a thymidine-richupstream element in vitro. Proc. Natl. Acad. Sci. USA 86:486-490.

16. Mattoon, J. R., W. E. Lancashire, H. K. Sanders, E. Carvajal,D. R. Malamud, G. R. C. Braz, and A. D. Panel. 1979. Oxygenand catabolite regulation of hemoprotein biosynthesis in yeast.p. 421-435. In W. J. Caughey (ed.), Biochemical and clinicalaspects of medicine. Academic Press, Inc., New York.

17. Mehta, K. D., D. Leung, L. Lefebvre, and M. Smith. 1990. TheANBI locus of Saccharomyces cerevisiae encodes the proteinsynthesis initiation factor eIF-4D. J. Biol. Chem. 265:8802-8807.

18. Mehta, K. D., and M. Smith. 1989. Identification of an upstreamrepressor site controlling the expression of an anaerobic gene(ANBI) in Saccharomyces cerevisiae. J. Biol. Chem. 264:8670-8675.

19. Montgomery, D. L., D. W. Leung, M. Smith, P. Shalit, G. Faye,and B. D. Hall. 1980. Isolation and sequence of the gene foriso-2-cytochrome c in Saccharomyces cerevisiae. Proc. Natl.Acad. Sci. USA 72:1184-1188.

20. Morrow, B. E., S. P. Johnson, and J. R. Warner. 1989. Proteinsthat bind to the yeast rDNA enhancer. J. Biol. Chem. 264:9061-9068.

21. Pfeifer, K., T. Prezant, and L. Guarente. 1987. Yeast HAP]activator binds to two upstream activation sites of differentsequences. Cell 49:19-27.

22. Rotenberg, M. O., and J. L. Woolford, Jr. 1986. Tripartiteupstream promoter element essential for expression of Saccha-romyces cerevisiae ribosomal protein genes. Mol. Cell. Biol.6:674-687.

23. Russel, D. W., M. Smith, D. Cox, V. M. Williamson, and E. T.Young. 1983. DNA sequences of two yeast promoter-up mu-tants. Nature (London) 304:652-654.

24. Shapira, S. K., J. Chou, F. V. Richaud, and M. J. Casadaban.1983. New versatile plasmid vectors for expression of hybridproteins coded by a cloned gene fused to lacZ gene sequences

encoding an enzymatically active carboxy-terminal portion ofP-galactosidase. Gene 25:71-82.

25. Sherman, F., and J. W. Stewart. 1971. Genetics and biosynthe-sis of cytochrome c 3028. Annu. Rev. Genet. 5:257-296.

26. Smit-McBride, Z., T. E. Dever, J. W. B. Hershey, and W. C.Merrick. 1989. Sequence determination and cDNA cloning ofeukaryotic initiation factor 4D, the hypusine-containing protein.J. Biol. Chem. 264:1578-1583.

27. Struhl, K. 1985. Naturally occurring poly(dA-dT) sequences areupstream promoter elements for constitutive transcription inyeast. Proc. Natl. Acad. Sci. USA 82:8419-8423.

28. Struhl, K. 1986. Constitutive and inducible Saccharomycescerevisiae promoters: evidence for two distinct molecular mech-anisms. Mol. Cell. Biol. 6:3847-3853.

29. Sumrada, R. A., and T. G. Cooper. 1987. Ubiquitous upstreamrepression sequences control activation of the inducible argin-ase gene in yeast. Proc. Natl. Acad. Sci. USA 84:3997-4001.

30. Trueblood, C. E., R. M. Wright, and R. 0. Poyton. 1988.Differential regulation of the two genes encoding Saccharomy-ces cerevisiae cytochrome c oxidase subunit V by heme and theHAP2 and REOI genes. Mol. Cell. Biol. 8:4537-4540.

31. Wang, H., P. R. Nicholson, and D. J. Stillman. 1990. Identifica-tion of a Saccharomyces cerevisiae DNA-binding protein in-volved in transcriptional regulation. Mol. Cell. Biol. 10:1743-1753.

32. West, R. W., Jr., R. R. Yocum, and M. Ptashne. 1984. Saccha-romyces cerevisiae GALI-GALIO divergent promoter region:location and function of the upstream activating sequenceUASG. Mol. Cell. Biol. 4:2467-2478.

33. Wright, C. F., and R. S. Zitomer. 1985. Point mutations impli-cate repeated sequences as essential elements of the CYC7negative upstream site in Saccharomyces cerevisiae. Mol. Cell.Biol. 5:2951-2958.

34. Zagorec, M., J.-M. Buhler, I. Treich, T. Keng, L. Guarente, andR. Labbe-Bois. 1988. Isolation, sequence, and regulation byoxygen of the yeast HEM13 gene coding for coproporphyrino-gen oxidase. J. Biol. Chem. 263:9718-9724.

35. Zagorec, M., and R. Labbe-Bois. 1986. Negative control of yeastcoproporphyrinogen oxidase synthesis by heme and oxygen. J.Biol. Chem. 261:2506-2509.

36. Zitomer, R. S., J. W. Sellers, D. W. McCarter, P. A. Hastings,P. Wick, and C. V. Lowry. 1987. Elements involved in oxygenregulation of the Saccharomyces cerevisiae CYC7 gene. Mol.Cell. Biol. 7:2212-2220.

MOL. CELL. BIOL.