a ‘genome to paddock’ approach to controlling blackleg of ... · prior to meiosis; mutates...
TRANSCRIPT
![Page 1: A ‘Genome to Paddock’ Approach to Controlling Blackleg of ... · prior to meiosis; mutates multi copy DNA; transition from C:G to T:A – stop codons • Nature Communications](https://reader034.vdocuments.site/reader034/viewer/2022043006/5f8e5b98c23223137a331c93/html5/thumbnails/1.jpg)
A ‘Genome to Paddock’ Approach to
Controlling Blackleg of Canola
Steve Marcroft, Marcroft Grains Pathology, Horsham,
Andrew Ware, SARDI,
Angela Van de Wouw, Phil Salisbury & Barbara Howlett,
the University of Melbourne
![Page 2: A ‘Genome to Paddock’ Approach to Controlling Blackleg of ... · prior to meiosis; mutates multi copy DNA; transition from C:G to T:A – stop codons • Nature Communications](https://reader034.vdocuments.site/reader034/viewer/2022043006/5f8e5b98c23223137a331c93/html5/thumbnails/2.jpg)
2
Canola in Australia: high intensity, long growing
season in temperate climate
2.4 m ha sown in 2012; large amount of
blackleg-infested stubble inoculum in 2013
High disease pressure
![Page 3: A ‘Genome to Paddock’ Approach to Controlling Blackleg of ... · prior to meiosis; mutates multi copy DNA; transition from C:G to T:A – stop codons • Nature Communications](https://reader034.vdocuments.site/reader034/viewer/2022043006/5f8e5b98c23223137a331c93/html5/thumbnails/3.jpg)
• Prolific sexual and asexual reproduction
• Large populations of windborne ascospores (inoculum)
– Fungal populations evolve very quickly
– Major gene resistance results in strong selection
pressure towards isolates virulent to that resistance
gene
– Frequency of virulent isolates in populations increases
– On Lower Eyre Peninsula blackleg resistance
‘overcome’ in 2003; prevented (averted) in 2012
Leptosphaeria maculans is a high risk
pathogen for ‘overcoming’ resistance
![Page 4: A ‘Genome to Paddock’ Approach to Controlling Blackleg of ... · prior to meiosis; mutates multi copy DNA; transition from C:G to T:A – stop codons • Nature Communications](https://reader034.vdocuments.site/reader034/viewer/2022043006/5f8e5b98c23223137a331c93/html5/thumbnails/4.jpg)
‘Breakdown’ of resistance in 2003 • in 2000 ‘sylvestris’ cultivars released with major seedling
genes, Rlm1 & LepR3 (no disease); cultivars sown extensively
Eyre Peninsula
![Page 5: A ‘Genome to Paddock’ Approach to Controlling Blackleg of ... · prior to meiosis; mutates multi copy DNA; transition from C:G to T:A – stop codons • Nature Communications](https://reader034.vdocuments.site/reader034/viewer/2022043006/5f8e5b98c23223137a331c93/html5/thumbnails/5.jpg)
2001 and 2002 2003
‘Sylvestris’ cultivars
![Page 6: A ‘Genome to Paddock’ Approach to Controlling Blackleg of ... · prior to meiosis; mutates multi copy DNA; transition from C:G to T:A – stop codons • Nature Communications](https://reader034.vdocuments.site/reader034/viewer/2022043006/5f8e5b98c23223137a331c93/html5/thumbnails/6.jpg)
2003: Beacon
Steve Marcroft
90% yield losses ($30 m) in Eyre Peninsula
Seed withdrawn from sale
2003: Sylvestris
![Page 7: A ‘Genome to Paddock’ Approach to Controlling Blackleg of ... · prior to meiosis; mutates multi copy DNA; transition from C:G to T:A – stop codons • Nature Communications](https://reader034.vdocuments.site/reader034/viewer/2022043006/5f8e5b98c23223137a331c93/html5/thumbnails/7.jpg)
Breakdown of disease resistance
• Increased frequency of isolates attacking cultivars with sylvestris- resistance, not new strain: – isolates collected before 1988 caused disease
– breakdown occurred in other areas where sylvestris cultivars sown extensively
• Why does virulence evolve so rapidly in the blackleg fungus?
![Page 8: A ‘Genome to Paddock’ Approach to Controlling Blackleg of ... · prior to meiosis; mutates multi copy DNA; transition from C:G to T:A – stop codons • Nature Communications](https://reader034.vdocuments.site/reader034/viewer/2022043006/5f8e5b98c23223137a331c93/html5/thumbnails/8.jpg)
Leptosphaeria maculans genome
• Rouxel & Balesdent, INRA & Howlett, Genoscope; URGI, France; Oliver (Perth)
• 12,500 genes; 45 Mb -closely related Stagonospora nodorum (37 Mb)
• Repetitive DNA: 36% genome (9% S. nodorum) – Degenerated transposable elements: truncated &
Class I LTR retrotransposons & Class II TIR DNA transposons
– Repeat induced point (RIP) mutations: occurs prior to meiosis; mutates multi copy DNA; transition from C:G to T:A – stop codons
• Nature Communications (2011)
8
![Page 9: A ‘Genome to Paddock’ Approach to Controlling Blackleg of ... · prior to meiosis; mutates multi copy DNA; transition from C:G to T:A – stop codons • Nature Communications](https://reader034.vdocuments.site/reader034/viewer/2022043006/5f8e5b98c23223137a331c93/html5/thumbnails/9.jpg)
Patchwork genome: gene –rich (GC) &
gene-poor, repeat-rich (AT) blocks
Gene-rich blocks (1 gene per 2.4 kb)
• ‘Invaded plastic’ genome: genes readily gained, lost or mutated
9
Repeat-rich blocks Gene poor (1 gene/ 30 kb) degenerated transposons. Contain only 3.5% of total genes but 20% of effector
(avirulence) genes-AvrLm1 (Rlm1)
![Page 10: A ‘Genome to Paddock’ Approach to Controlling Blackleg of ... · prior to meiosis; mutates multi copy DNA; transition from C:G to T:A – stop codons • Nature Communications](https://reader034.vdocuments.site/reader034/viewer/2022043006/5f8e5b98c23223137a331c93/html5/thumbnails/10.jpg)
ACTACTACTACTACTACTACT ACTACTACTACTACTACTACT
ACTACTACTACTACTACTACT ACTACTACTACTACTACTACT
ACTACTACTACTACTACTACT ACTACTACTACTACTACTACT Avr
ACTACTACTACTACTACTACT ACTACTACTACTACTACTACT
If repeats align correctly during meiosis:
Avirulence genes are located in repetitive regions of genome
Avr
Avr
Avr
or
Avirulence genes identical in parents and
progeny
![Page 11: A ‘Genome to Paddock’ Approach to Controlling Blackleg of ... · prior to meiosis; mutates multi copy DNA; transition from C:G to T:A – stop codons • Nature Communications](https://reader034.vdocuments.site/reader034/viewer/2022043006/5f8e5b98c23223137a331c93/html5/thumbnails/11.jpg)
ACTACTACTACTACTACTACT
OR
If repeats align incorrectly during meiosis
Option 1: Gene duplication and may then
undergo RIP mutation
Option 2: Deletion of Avirulence gene
ACTACTACTACTACTACTACT ACTACTACTACTACTACTACTACTACT--------------- Avr
--------ACTACTACTACTACTACTACT CTACT-------------- Avr
ACTACTACTACTACTACTACT ACTACTACTACTACTACTACTACTACT--------------- Avr Avr
Avirulence genes are located in repetitive regions of genome
![Page 12: A ‘Genome to Paddock’ Approach to Controlling Blackleg of ... · prior to meiosis; mutates multi copy DNA; transition from C:G to T:A – stop codons • Nature Communications](https://reader034.vdocuments.site/reader034/viewer/2022043006/5f8e5b98c23223137a331c93/html5/thumbnails/12.jpg)
Breakdown of Sylvestris resistance
• Sequenced AvrLm1 in isolates
– 137 collected before breakdown of sylvestris resistance (< 2004)
– 158 collected after breakdown (2004 and later)
• Eight fold increase in isolates with deletions of
AvrLm1 during and after resistance breakdown
• Blackleg fungal populations change rapidly
• Need to develop strategies to avoid resistance
breakdown
• Field and pot trials show that cultivars with different
resistance genes can be rotated to avoid resistance
breakdown
12
![Page 13: A ‘Genome to Paddock’ Approach to Controlling Blackleg of ... · prior to meiosis; mutates multi copy DNA; transition from C:G to T:A – stop codons • Nature Communications](https://reader034.vdocuments.site/reader034/viewer/2022043006/5f8e5b98c23223137a331c93/html5/thumbnails/13.jpg)
Staying Ahead of Blackleg
Kurt Lindbeck
Angela Van de Wouw, Barb
Howlett, Phil Salisbury,
Ravjit Khangura
Andrew Ware
Angela Van de Wouw
Steve Marcroft
Vicki Elliott
13
![Page 14: A ‘Genome to Paddock’ Approach to Controlling Blackleg of ... · prior to meiosis; mutates multi copy DNA; transition from C:G to T:A – stop codons • Nature Communications](https://reader034.vdocuments.site/reader034/viewer/2022043006/5f8e5b98c23223137a331c93/html5/thumbnails/14.jpg)
Resistance genotyping (grouping) of Australian lines and cultivars
• Use set of differential isolates
(different Avirulence genes) to
classify all National Variety Trial lines
according to resistance gene
complement (adult and seedling)
• Seven resistance groups:
– R genes previously identified (eg.
Rlm1, Rlm4 and Rlm9; LepR1-3)
– Unknown/new resistance genes
14
Marcroft et al (2012) Crop and
Pasture Science 63, 338-350
![Page 15: A ‘Genome to Paddock’ Approach to Controlling Blackleg of ... · prior to meiosis; mutates multi copy DNA; transition from C:G to T:A – stop codons • Nature Communications](https://reader034.vdocuments.site/reader034/viewer/2022043006/5f8e5b98c23223137a331c93/html5/thumbnails/15.jpg)
Monitoring blackleg virulence & efficacy of
resistance genes across Australia
Single isolates
• Genotype for Avr genes
• Assess disease on range of cultivars in glasshouse
Populations
• Assess disease in field sites and crops
• Genotype ascospores released from stubble onto tape
• Assess disease on range of cultivars in glasshouse infected with ascospores released from stubble
![Page 16: A ‘Genome to Paddock’ Approach to Controlling Blackleg of ... · prior to meiosis; mutates multi copy DNA; transition from C:G to T:A – stop codons • Nature Communications](https://reader034.vdocuments.site/reader034/viewer/2022043006/5f8e5b98c23223137a331c93/html5/thumbnails/16.jpg)
eastern Australia
Surveys of disease severity of cultivars (with
different resistance genes); blackleg monitoring
Internal stem infection
Western Australia
![Page 17: A ‘Genome to Paddock’ Approach to Controlling Blackleg of ... · prior to meiosis; mutates multi copy DNA; transition from C:G to T:A – stop codons • Nature Communications](https://reader034.vdocuments.site/reader034/viewer/2022043006/5f8e5b98c23223137a331c93/html5/thumbnails/17.jpg)
Monitoring blackleg virulence
Single isolates
• Genotype for Avr genes
• Assess disease on range of cultivars in glasshouse
Populations
• Assess disease in field sites and crops
• Genotype ascospores released from stubble onto tape (high throughput)
• Assess disease on range of cultivars in glasshouse infected with ascospores released from stubble
![Page 18: A ‘Genome to Paddock’ Approach to Controlling Blackleg of ... · prior to meiosis; mutates multi copy DNA; transition from C:G to T:A – stop codons • Nature Communications](https://reader034.vdocuments.site/reader034/viewer/2022043006/5f8e5b98c23223137a331c93/html5/thumbnails/18.jpg)
Monitoring virulence of blackleg populations • Stubble collected from different areas across
Australia, placed in wind tunnel & ascospores captured on tape
• DNA extracted and analysed by quantitative PCR for presence/absence of band for AvrLm1, AvrLm6
• Total number spores estimated by qPCR of ITS region
• Pyrosequencing assay for AvrLm4 based on SNP at base 358 leading to amino acid change G120 to R120
• Frequency virulence allele measured; risk resistance breakdown determined in each region
18 Van de Wouw et al. 2010 Plant Path; 2013 J App Microbiol
![Page 19: A ‘Genome to Paddock’ Approach to Controlling Blackleg of ... · prior to meiosis; mutates multi copy DNA; transition from C:G to T:A – stop codons • Nature Communications](https://reader034.vdocuments.site/reader034/viewer/2022043006/5f8e5b98c23223137a331c93/html5/thumbnails/19.jpg)
Single isolates
• Genotype Avirulence genes (molecular assay)
• Assess disease on range of cultivars in glasshouse
Populations
• Assess disease in field sites and crops
• Genotype ascospores released from stubble onto tape
• Assess disease on range of cultivars in glasshouse infected with ascospores released from stubble (high throughput)
Monitoring blackleg virulence & efficacy of
resistance genes across Australia
![Page 20: A ‘Genome to Paddock’ Approach to Controlling Blackleg of ... · prior to meiosis; mutates multi copy DNA; transition from C:G to T:A – stop codons • Nature Communications](https://reader034.vdocuments.site/reader034/viewer/2022043006/5f8e5b98c23223137a331c93/html5/thumbnails/20.jpg)
Monitoring virulence of blackleg populations
20
Resistant Susceptible
•Stubble of different cultivars collected from different regions across Australia
•Stubble wetted and placed above pots
•Ascospore Shower technique: ascospores released from stubble infect seedlings below & disease assessed at plant maturity
Rotation of cultivars
minimises disease
Garnet infected from
A/ Garnet stubble
B/ ATR-Cobbler stubble
A B
![Page 21: A ‘Genome to Paddock’ Approach to Controlling Blackleg of ... · prior to meiosis; mutates multi copy DNA; transition from C:G to T:A – stop codons • Nature Communications](https://reader034.vdocuments.site/reader034/viewer/2022043006/5f8e5b98c23223137a331c93/html5/thumbnails/21.jpg)
Avoiding ‘breakdown’ of resistance in 2012 • After 2008 Hyola 50 and other Group D cultivars sown
extensively on Eyre Peninsula
Eyre Peninsula
![Page 22: A ‘Genome to Paddock’ Approach to Controlling Blackleg of ... · prior to meiosis; mutates multi copy DNA; transition from C:G to T:A – stop codons • Nature Communications](https://reader034.vdocuments.site/reader034/viewer/2022043006/5f8e5b98c23223137a331c93/html5/thumbnails/22.jpg)
2011: Field and pot trials predicted
resistance breakdown of Group D
cvs. (eg. Hyola 50) in 2012
22
Hyola50 infected from Hyola50 stubble
Hyola50 infected from ATR-Cobbler stubble
![Page 23: A ‘Genome to Paddock’ Approach to Controlling Blackleg of ... · prior to meiosis; mutates multi copy DNA; transition from C:G to T:A – stop codons • Nature Communications](https://reader034.vdocuments.site/reader034/viewer/2022043006/5f8e5b98c23223137a331c93/html5/thumbnails/23.jpg)
![Page 24: A ‘Genome to Paddock’ Approach to Controlling Blackleg of ... · prior to meiosis; mutates multi copy DNA; transition from C:G to T:A – stop codons • Nature Communications](https://reader034.vdocuments.site/reader034/viewer/2022043006/5f8e5b98c23223137a331c93/html5/thumbnails/24.jpg)
Breakdown of Hyola 50 Resistance Feb 2012
![Page 25: A ‘Genome to Paddock’ Approach to Controlling Blackleg of ... · prior to meiosis; mutates multi copy DNA; transition from C:G to T:A – stop codons • Nature Communications](https://reader034.vdocuments.site/reader034/viewer/2022043006/5f8e5b98c23223137a331c93/html5/thumbnails/25.jpg)
Disease severity of cultivars from different
resistance groups: Eyre Peninsula field plots
0
20
40
60
80
100
Hyola444 ATR-Marlin ATR-Stingray CB-Telfer Thumper TT
Perc
enta
ge inte
rnal in
fection
Cultivar
Group
A Group
C Group
B
Group
E
October 2012
Group
D
Hyola 50: 90% disease severity
![Page 26: A ‘Genome to Paddock’ Approach to Controlling Blackleg of ... · prior to meiosis; mutates multi copy DNA; transition from C:G to T:A – stop codons • Nature Communications](https://reader034.vdocuments.site/reader034/viewer/2022043006/5f8e5b98c23223137a331c93/html5/thumbnails/26.jpg)
Eyre Peninsula October 2012
Group D Group E
![Page 27: A ‘Genome to Paddock’ Approach to Controlling Blackleg of ... · prior to meiosis; mutates multi copy DNA; transition from C:G to T:A – stop codons • Nature Communications](https://reader034.vdocuments.site/reader034/viewer/2022043006/5f8e5b98c23223137a331c93/html5/thumbnails/27.jpg)
Wagga Wagga NSW Oct 2012
Group D
![Page 28: A ‘Genome to Paddock’ Approach to Controlling Blackleg of ... · prior to meiosis; mutates multi copy DNA; transition from C:G to T:A – stop codons • Nature Communications](https://reader034.vdocuments.site/reader034/viewer/2022043006/5f8e5b98c23223137a331c93/html5/thumbnails/28.jpg)
Financial Savings to Eyre Peninsula
farmers and Seed Companies
• 60,000 ha sown to canola in 2012
• Assuming 50% yield losses if 30% of area sown to
Group D cultivars (eg. Hyola 50) and $500 /tonne
for canola (conservative estimates)
• Benefits
– Farmers have been saved losses of $18 million
– Group D cultivars can still be sown in other
regions, so breeding companies very supportive
of recommendations to avoid resistance
breakdown
![Page 29: A ‘Genome to Paddock’ Approach to Controlling Blackleg of ... · prior to meiosis; mutates multi copy DNA; transition from C:G to T:A – stop codons • Nature Communications](https://reader034.vdocuments.site/reader034/viewer/2022043006/5f8e5b98c23223137a331c93/html5/thumbnails/29.jpg)
Summary • Blackleg fungus (Leptosphaeria maculans) is a high risk
pathogen for breakdown of resistance in canola cultivars
• Resistance breakdown accounted for by location of
avirulence genes in repetitive regions of ‘patchwork’
genome of L.maculans brassicae
• Rotation of resistance genes in cultivars minimises
disease
• ‘Genome to paddock’ approach is used to monitor race
specific virulence of populations derived from stubble
across Australia
– estimates risk of breakdown of resistance
– averted breakdown of resistance in Eyre Peninsula in 2012
29 Rouxel
Balesdent
![Page 30: A ‘Genome to Paddock’ Approach to Controlling Blackleg of ... · prior to meiosis; mutates multi copy DNA; transition from C:G to T:A – stop codons • Nature Communications](https://reader034.vdocuments.site/reader034/viewer/2022043006/5f8e5b98c23223137a331c93/html5/thumbnails/30.jpg)
![Page 31: A ‘Genome to Paddock’ Approach to Controlling Blackleg of ... · prior to meiosis; mutates multi copy DNA; transition from C:G to T:A – stop codons • Nature Communications](https://reader034.vdocuments.site/reader034/viewer/2022043006/5f8e5b98c23223137a331c93/html5/thumbnails/31.jpg)
Blackleg Resistance Groups
Group A –Rlm1 and sylvestris resistance Group B – Rlm4 Group C* – Rlm2, Rlm3, Rlm9, none Group D* – Unknown (Hyola50) seedling resistance Group E* – Unknown (Thumper) seedling resistance Group F* – Unknown (Mustang) seedling resistance Group G – Juncea resistance
*Notes • Group C cultivars have any combination of Rlm2, 3, 9 or no R genes.
When releasing the resistance groups, only cultivars with MR rating or above will be given a resistance group.