9Vlateriafs and 9Vletliocfs

Chapter 2

Materials and Methods

2.1 Materials

2.2 Methods 2.2.1 Study subjects

2.2.1.1 The Discovery Panel (DSNP) ofIGVC

2.2.1.2 The validation panel ofIGVC

2.2.1.3 The patient panel for case-control studies

2.2.1.4 The control panel for case-control studies

2.2.2 Sample collection and pre-processing

2.2.31solation of genomic DNAfrom whole blood

2.2.3.1 Isolation of genomic DNA using salting out

procedure

2.2.3.2 Isolation of genomic DNA by column purification

2.2.4 Quantitation of DNA

2.2.5 Whole genome amplification

2.2.6 Polymerase chain reaction

2.2.6.1 Primer designing

2.2.6.2 Reaction details

2.2.7 Post peR clean-up and quantitation of the DNA product

2.2.7.1 Purification of DNA from agarose gel using a

commercially-available kit

2.2.7.2 Purification of DNA fragment from agarose gel

using silica method

2.2.7.3 Purification of PCR product by the PEG (Poly

Ethylene Glycol) method

2.2.8 SNP discovery by DNA sequencing

2.2.8.1 The DNA sequencing reaction

2.2.8.2 Purification of sequencing products and collection of

sequencing data

2.2.9 Genotyping

2.2.9.1 By Sequenom

2.2.9.2 By SNaPShot ™

2.2.9.3 Amplification Refractory Mutation detection System

(ARMS)-PCR

2.2.9.4 Restriction Fragment Length Polymorphism (RFLP)

2.2.10 Flow cytometryfor estimation 0/CR1 levels on RBCs

2.2.11 Cell culture

2.2.11.1 In vitro cell culture of human macrophage and T­

cell line

2.2.11.2 Cryopreservation of cell cultures

2.2.11.3 Pretreatment of cells prior to harvesting

2.2.12 Electrophoretic mobility shift assay (EMSAJ

2.2.12.1 Preparation of nuclear extract

2.2.12.3 Preparation of radio-labeled oligonucleotide probe

2.2.12.4 Binding reaction and electrophoresis

2.2.13 Estimation of cytokine levels in plasma by Enzyme·

Linked Immunosorbent Assay (EUSAJ

2.2.14 Hemoglobin electrophoresis

2.2.15 Glucose 6-phosphate dehydrogenase (G6PD) assay

2.2.16 Data analysis

2.2.16.1 Allele frequency estimations

2.2.16.2 F-statistics for genetic differentiation

2.2.16.3 Haplotype analysis

2.2.16.4 Non-parametric tests for correlations and

comparison of means

2.2.16.5 Odds Ratio estimation for risk assessment

2.2.16.6 Multivariate hierarchical clustering

2.2.16.7 Step-wise discriminant analysis

2. Materials and Methods

2.1 Materials:

Enzymes, chemicals, reagents, kits, and radio-isotopes were obtained from the

following companies:

Applied Biosystems: BigDye terminator sequencing standard kit v3.1, BigDye

terminator cycle sequencing kit v3.1, Hi-Di formamide (genetic analysis grade),

Matrix standard set DS-02, GeneScan-500 LIZ size standard, GeneScan-120 LIZ

size standard, SNaPshot multiplex kit, Multi capillary DS-33 (dye set G5) matrix

standard kit, Performance Optimized Polymer (POP7), EDTA running buffer (10 X),

BigDye terminator 5 X sequencing buffer v3.1, Ampli Taq Gold polymerase.

BD-Biosciences: Human IL-6, IL-12, IL-10 and IFNy ELISA sets (OptEIA), 10 ml

vacutainer tubes.

Biological Industries: DNA gel extraction kit, FBS.

Custom synthesized oligo nucleotides: TCGA (The Centre for Genomic

Application) India, lOT, Metabion.

Eppendorf: 2.5 x PCR master mix, dNTPs.

GE Healthcare (Amersham): GenomiPhi whole genome amplification kit, sucrose,

sodium chloride, tris-saturated phenol, Proteinase K, sodium dodecyl sulfate, triton

X-100, EDTA, sodium acetate, calf intestinal alkaline phosphatase, T4

polynucleotidyl kinase, agarose, poly (dI-dC), PMSF, Sephadex G-50 (DNA grade), X­

ray films (Hyperfilm-MP), Tween-20.

GIBCO BRL: Antibiotic/Antimycotic premix

Jonaki, India: [a}2P]dATP

MBI-Fermentas: HindIII restriction endonuclease.

Merck: acetone, isopropanol, methanol.

Molecular Probes: Oregon green-tagged goat anti-mice IgG (H+L).

New England Biolabs: 100 bp and 1 kb DNA marker.

Qualigens: acetic acid, acetone, hydrochloric acid, sulphuric acid, glycerol, EDTA,

sodium carbonate, sodium chloride.

36

Pierce: Anti-human TNF, IL-4 and IL-13 purified mAb, Recombinant human TNF,

IL-4 and IL-13, Human TNF, IL-4 and IL-13 ELISA standards (recombinant), Anti­

human TNF, IL-4 and IL-13 biotin-labeled-mAb, TMB substrate solution, HRP­

conjugated streptavidin.

P./alciparum malaria diagnostic kits: ParaHit (Span Diagnostics, India), OptiMal

(DiaMed AG, Switzerland).

Promega: Taq DNA polymerase, dNTPs.

Santa Cruz: Human anti-ETS-l antibody

Serotech: Anti-human CRl monoclonal antibody

Span Diagnostics: ABO Blood group determination kit.

Sigma: Taq DNA polymerase, DMSO, glucose, sodium bicarbonate, saponin,

glycerol, ethidium bromide, xylene cyanol, bromophenol blue, L-glutathione

oxidized, tris-saturated phenol, agarose, potassium iodide, polyethylene glycol-

8000, silicon dioxide, Ponceau stain, cellulose-acetate sheets, tri-chloro acetic acid,

acrylamide, bis-acrylamide, ammonium persulfate, TEMED, glasswool, BSA, Igepal

(Nonidet P-40), HEPES, LPS, ionomycin, glucose 6-phosphate, NADP, RPMI-1640

media, formaldehyde, citric acid, DIT, EDTA, potassium chloride, sodium di­

hydrogen phosphate, di-sodium hydrogen phosphate, bicinconinic acid (BCA)

protein assay kit, sodium azide, dialysis tubing, developer, fixer, TMB substrate

solution for ELISA.

SRL: tris-base, sodium hydroxide, acrylamide, sodium bicarbonate, boric acid.

Whatman: FTA cards, FTA purification reagent.

37

2.2 Methods:

2.2.1 Study subjects 2.2.1.1 The Discovery Panel (DSNP) of IGVC

To discover novel SNPs as well as to identify known SNPs in diverse Indian

populations, an initial panel comprising blood samples of 43 individuals drawn from

43 representative populations of the country was constructed (Fig. 2.1). This

'discovery SNP panel' or the 'DSNP panel', included samples from both tribal and

non-tribal groups and also from various castes and religious groups, collected from

five geographical zones of India. This panel was constructed to identify/discover

SNPs in a heterogeneous population pool and to maximize the scope of SNP

discovery as compared to a set of samples from the same population. The

distribution of all the DSNP panel samples across India along with their region of

collection is shown in Fig. 2.1. All these samples were collected jointly by the

participating laboratories from six CSIR institutes (CDRI; Central Drug Research

Institute, ITRC; Industrial Toxicology Research, IGIB; Institute of Genomics and

Integrative Biology, CCMB; Center for Cellular & Molecular Biology, IICB; Indian

Institute of Chemical Biology, IMTECH; Institute of Microbial Technology) as a part

of Indian Genome Variation Consortium (IGVC) and shared among all centers.

2.2.1.2 The validation panel of IGVC

The frequency of the SNPs discovered in the DSNP panel was estimated in a larger

set of population groups which constituted the 'Validation Panel'. The validation

panel comprised of a total of 1871 individuals from 55 ethnically contrasting

populations across India. These populations represent endogamous populations

from the Indo-European (IE), Dravidian (DR), Austro-Asiatic (AA) and Tibeto­

Burman (TB) linguistic lineages from North, South, East, West, Central and North­

East zones of India. In each linguistic group, minimally two isolated and large

populations were identified for sample collection. A minimum of 50 samples from

large populations and 25 from isolated populations were collected. From an initial

number of 2014 samples, the final validation data was collected on 1871 samples

representing 1240 males and 631 females. All the samples in this panel were jointly

38

e

DSNP17 ~

~ r e DSN 24

DSNP4 e . " '. ,\ DSNP23

DSNP31 . .

DSNP25 ,

a DSNP28 ~

a

DSNP27 .. 'b

Fig. 2.1 : Map of India depicting the distribution of DSNP panel samples across the country .

.. Austro-Asiatic

.. Dravidian

.. Indo-European

.. Tibeto-Burman

Fig. 2.2 : Map of India depicting the of 55 valida tion panel populations. Color key indicating the four lingu istic classes is provided.

MGlteY~G1Ls G1v\'d Metltlods

collected by all the participating laboratories of the IGVC (Table 2.1). A population

coding convention was followed in which each population was assigned a language

code, followed by geographical zone and ethnic group (LP, IP, or SP). LPs are caste

groups (mostly large populations), IPs are isolated populations belonging to tribal

groups and SPs are religious groups. Fig. 2.2 shows the distribution of the 55

populations across India.

Table 2.1: Population codes for the validation panel wi th zones of collection and

contributing laboratories.

Geographical Population code Institute zone

Central AA-C-IPl, DR-C-LPl, AA-C-IP4, AA-C-IP5, DR-C-IPI CCMB AA-E-IP2, AA-E-IP3 CCMB

East IE-E-LP2 CDR! AA-E-IPl, DR-E-IPl, IE-E-LPl, IE-E-LP3, IE-E-LP4 nCB IE-NE-LPI nCB DR-S-IPl, DR-S-LPl, IE-S-IPl, DR-S-LP2, DR-S-IP2 CCMB

South DR-S-IP4, DR-S-IP3 CCMB DR-S-LP5, DR-S-LP3, DR-S-LP4 IGIB AA-W-IPl, IE-W-IPl, IE-W-IP2 CCMB

West IE-N-LP8 CDR! " IE-W-LP3, IE-W-LPl, IE-W-LP2, IE-W-LP4, OG-W-IP IGIB

IE-N-LP3, IE-N-LP6, IE-N-SP3 CDR! IE-N-IP2, IE-N-LPlO, IE-N-LPll, IE-N-SP4 ITRC

North IE-N-LP5, IE-N-SP5, IE-N-IPl, IE-N-LPl, IE-N-LP2 IGIB IE-N-LP7, IE-N-LP9, IE-N-SPl, IE-N-SP2, TB-N-IPI IGIB TB-N-SPl,TB-N-SP2 IGIB

North-East IE-NE-IPl, AA-NE-IPl, TB-NE-LPI nCB

2.2.1.3 The patient panel for case-control studies

For the disease association study, blood samples of patients suffering from

Plasmodium Jalciparum malaria were collected from the endemic region of

Chattisgarh and Orissa where there is high and perennial malaria transmission and

from the non-endemic regions of Uttar Pradesh where falciparum malaria

transmission is low and seasonal. In Chattisgarh, samples were collected from

patients diagnosed with falciparum malaria at the community health center of the

Kanker district and the primary health center of Taroki village of the Antagarh

tehsil. In Orissa, patient sampling was done from two sites. Blood samples from

patients with falciparum malaria registered at the Ispat General Hospital (IGH),

40

Rourkela were collected from the respective wards/ICUs. Blood samples from non­

severe malaria patients were mostly collected from the NIMR (National Institute of

Malaria Research) field station, Rourke1a. For the non-endemic regions, patient

samples were collected from the wards of KGMU (King George Medical University)

hospital, Lucknow during the peak malaria season. Initial diagnosis of the disease,

on all the sites/hospitals, was done by using rapid detection kits OptiMal and

ParaHit followed by confirmation by examination of thin and thick blood smears. In

case there was a contradiction between results of the rapid diagnostic test and

blood smear, a confirmatory PCR-diagnostic test was carried out (Patsoula et ai., 2003). World Health Organization guidelines (WHO, 2000) were followed for the

diagnosis and categorization of 'severe' and 'mild' malaria patients. Non-severe

malaria patients were blood smear-positive, had fever and lacked symptoms that

characterized severe malaria. Severe malaria cases (blood smear positive with one or

more symptoms listed in Table 2.2) were categorized as cerebral and non-cerebral.

Cerebral malaria was characterized by impaired consciousness (coma) with fever.

Anyone of the following symptoms together with a positive blood smear and fever

indicated severe (non-cerebral malaria): severe anaemia, acidotic breathing,

pulmonary oedema, hypoglycaemia, increased serum creatinine and bilirubin levels.

Table 2.2: WHO guidelines for diagnosing severe malaria.

Clinical manifestations and laboratory Frequency* Finding Children Adults

Prostration +++ +++

Impaired consciousness +++ ++

Respiratory distress (acidotic breathing) +++ +

MUltiple convulsions +++ +

Circulator collapse + +

Pulmonary oedema +/- +

Abnormal bleeding +/- +

Jaundice + +++

Haemoglobinurea +/- +

Severe anemia +++ +

* On a scale from + to +++; + / - mdlcates mfrequent occurrence

41

ct.1crpteV:2 MClter~ClLs Cll/\,d Mett.1ods

2.2.1.4 The control panel for case-control studies

In light of the ethnic and linguistic diversity of the Indian population, the control

panel for any case-control study should be carefully designed. The genetic

structure, distribution of alleles and selection pressures vary across the country. To

address the issue of population stratification and consequent false disease

correlation inferences, ethnically-matched sets of patients and controls were taken

for our study. For the non-endemic regions, blood samples were collected from

healthy unrelated volunteers living in different parts of Uttar Pradesh. A total of 90

individuals were included in the control group from the non-endemic region. The

control group of the endemic region comprised of 102 unrelated healthy individuals

from the sites from which patient samples were collected. All the control samples

were in the age group of 18-55 years. The main affected popUlations of the endemic

region were the tribal groups of the Austro-Asiatic (Munda, Bhumij) and Dravidian

(Oraon) linguistic lineage while the patients in the non-endemic region were

pFimarily from large populations (caste and religious groups) of the Indo-European

(Kayastha, Kanyakubj and Saryuparin Brahmin, Yadav, Shia, Sunni, Vaishya etc.)

lineage. The control panel for each region comprised equivalent numbers from both

these groups and included popUlations represented in the patient pool.

2.2.2 Sample collection and pre-processing

The present study was approved by the ethical committees of all the participating

institutes. Informed written consent was obtained from every volunteer or guardian

prior to the collection of blood sample. All the samples were coded to maintain

anonymity. 2-8 ml of venous blood was drawn from each individual in sterile

vacutainer tubes and collected in citrate buffer (3.8% sodium citrate, pH6.5, for 5

ml blood 0.5 ml of buffer was taken) to prevent coagulation. As soon as the sample

was collected, plasma was separated and stored in -70'C or in liquid nitrogen

(during field collection). For the samples included in the case-control study, two

aliquots of 20 ~l each of packed RBCs were made and frozen at the collection site.

These were used for hemoglobin electrophoresis and glucose 6-phosphate

dehydrogenase assay. For determination of RBC CRI levels, 20 ~ll of packed RBCs

were also fixed in formaldehyde at the site and transported to the laboratory on ice.

The pre-processing of collected samples is summarized in a flow-chart (Fig. 2.3).

42

Cl-'1Ii!:pter :2 Mli!ter~Ii!Ls li!V\,cI Metl-'1ocls

blood in ci

Plasma stored in -70°C j LN2 in aliquots

20 pI of packed cells were fIXed in formaldehyde and

stored on ice.

20 pI of packed cells stored at 40C for Hb electrophoresis

20 pI of packed cells stored in -200CjLN2 for G6PD assay

Rest of the cells suspended in 1 X PBS and used for DNA

isolation.

Fig. 2.3: Flow chart depicting the sample pre-processing steps just after collection.

2.2.3 Isolation of genomic DNA from whole blood

2.2.3.11solation of genomic DNA using salting out procedure Genomic DNA was extracted from peripheral blood leucocytes using salting-out

procedure (Miller et ai., 1988). Briefly 2-10 ml of venous blood was drawn from

individuals and collected in citrate buffer. Plasma was separated immediately after

collection and stored at -70'C or in liquid nitrogen (during field collection). Blood

cells were suspended in 1 X phosphate buffer saline (for 1L, 5.75 g of Na2HP04,

1.482 g of NaH2P04 and 9.0 g of NaCI was taken and pH was adjusted to 7.3) to

make up volume upto 5 ml. One volume of ice-cold cell lysis buffer (1.28 M sucrose,

4Q mM tris-CI pH 7.5, 20 mM MgCb, 4% Triton X-100) and two volumes of ice-cold

distilled water was added. The suspension was mixed by inverting the tubes several

times until it became translucent and was incubated on ice for 10 min. This was

followed by centrifugation at 3600 rpm for 15 min at 4'C to pellet the nuclei. The

supernatant was discarded and the pellet was suspended in nuclei lysis buffer (10

mM Tris-CI pH 7.5, 400 mM NaCI, 2 mM EOTA pH 8.0). For initial volume of 5 ml

blood, 6 ml of the buffer was added. After slight vortexing, 0.4 ml SOS (from SOS

43

J

MClterLClLs Cll/\,d MetVlOds

stock 10%) and 25 III of 20 mg/ml solution of proteinase K enzyme was added to the

suspension. Tubes were incubated at 65'C for 2-3 h after which the digested protein

products were precipitated by the addition of 5 M NaCI (for 5 ml blood, 3 ml of NaCI

was taken). After centrifugation for 15 min at 3200 rpm at room temperature, the

clear supernatant was transferred to another tube. DNA was precipitated with either

one volume of isopropanol or two volumes of ethanol. The DNA spool was then

washed with 70% ethanol, air-dried, dissolved in TE (10 mM tris-CI, pH 8.0 and 1

mM EDTA) and stored at -20'C.

2.2.3.2 Isolation of genomic DNA by column purification

In cases where blood samples were below 2 ml (mostly severe malaria patients),

genomic DNA was extracted using QIAmp DNA Blood midi kit (QIAGEN) according

to the supplier's protocol. Briefly, 200 III of QIAGEN protease solution and 2.4 ml of

buffer AL (supplied with the kit) was added to the blood sample and mixed

vigorously. Tubes were incubated at 70'C for 10 min after which 2 ml of ethanol

was added to the samples followed by thorough mixing. The tube contents were

transferred to the QIAmp Midi column placed in a 15 ml tube and centrifuged at

3000 rpm for 3 min. The filtrate was discarded and 2 ml of buffer AWl (supplied

with the kit) was added to the column after which tubes were centrifuged at 5000

rpm for 1 min. Without discarding the flow-through, 2 ml of buffer AW2 (supplied

with the kit) was added to the column and the contents were centrifuged at 5000

rpm for 15 min. The column was transferred onto a fresh 15 ml tube and the DNA

was eluted with 300 III AE buffer (supplied with the kit) after incubating the tubes

at room temperature for 5 min followed by centrifugation at 5000 rpm for 2 min.

The eluted DNA was stored at -20'C.

2.2.4 Quantitation of DNA

Genomic DNA was quantified by determining the optical density (OD) at 260 nm

and 280 nm after diluting the DNA 10-50 fold in TE buffer. The purity of DNA (level

of protein contamination) was assessed using the A26o/ A280 ratio. 1 III of the DNA

was checked on 0.8% agarose gel stained with ethidium bromide so as to determine

the integrity of genomic DNA. The stock DNA solution was stored at -20'C until

further use and a working stock was made after diluting the DNA to -50 ng/ Ill.

44

2.2.5 Whole genome amplification Most of the patient samples and some of the control samples had low in DNA yield.

The GenomiPhi whole genome amplification protocol was used to amplify the

genomic DNA of these samples. The GenomiPhi kit utilizes bacteriophage Phi29

DNA polymerase and hexamer primers to exponentially amplify single or double

stranded DNA templates using 'strand displacement reaction'. 1 ~l (1-50 ng) of the

sample was mixed with 9 ~t1 of the sample buffer provided with the kit and the DNA

was denatured at 95'C for 3 min after which the mixture was kept in ice for some

time. The amplification reaction was prepared by mixing 9 ~l of the reaction buffer

and 1 ~l of the enzyme mix (both provided with the kit) and added to the cooled

sample mix. Samples were incubated at 30'C overnight (16-18 h) after which they

were kept at 65'C for 10 min to deactivate the enzyme. 20 ~l of deionized water was

added to the samples and the DNA was precipitated with the addition of 4 ~l of

sodium acetatejEDTA buffer (1.5 M sodium acetate pH 8.0, 0.2 M EDTA) and 100 ~l

of ethanol. Samples were kept overnight at room temperature for precipitation. To

purify the precipitated DNA, samples were centrifuged at 12000 rpm for 15 min at

room temperature. The supernatant was removed and the DNA pellet was washed

with 70% alcohol, air dried and suspended in 10-20 ~l of TE and stored at -20'C.

2.2.6 Polymerase chain reaction 2.2.6.1 Primer designing

The primers used for initial PCRs for DNA sequencing with the DSNP panel were

designed using Primer Select module of the DNAStar software package (Lasergene).

All the primer pairs used for discovering SNPs with the DSNP panel covered all the

exons of the gene along with a portion of the flanking introns. This was done to

increase the probability of finding SNPs in the genomic region which may serve as

disease markers and would be helpful in creating the LD map the gene. A summary

of primer pairs designed for each gene sequenced in the DSNP panel is given in the

Table 2.3. For SNaPShot and ARMS-PCR applications, primers were designed with

the Oligo software program. All the primers were custom synthesized.

45

Table 2.3: Number of PCR-primers designed for each gene analyzed with DSNP panel.

Gene Promoter/Exons/Introns in the gene No. of primer pairs designed

TNF 1 promoter, 4 exons, 3 introns 2 for promoter

4 for gene region

CD36 2 promoters, 13 exons, 12 introns 2 for promoters

14 for gene region

ICAMl 1 promoter, 7 exons, 6 introns 5 for gene region

PECAMl 1 promoter, 16 exons, 15 introns 14 for gene region

2.2.6.2 Reaction details

PCRs from genomic DNA were performed as a first step for all the downstream

genotyping applications. The standard PCR cocktail of 25 ~ was made of following

ingredien ts:

Reaction Components Stock concentration Final concentration

Taq Polymerase Buffer lOX IX

MgCb 25mM 1.5-2.0 mM

Forward Primer 100 pmoles 5 pmoles

Reverse Primer 100 pmoles 5 pmoles

Genomic DNA 50 ng/l1l 10-25 ng/l1l

dNTPmix lOmM 200 11M

Taq DNA Polymerase 5U 1U

Generally all PCR reactions were carried out for 35 cycles with the following cycling

conditions:

Initial denaturation

Denaturation

Annealing

Extension

Final extension

95'C for 10 min

94' C for 30-60 sec

50-65'C for 30 sec

72'C for 30 sec-2 min

72'C for 8 min

All the PCRs were performed on ABI9700 thermal cyclar.

46

2.2.7 Post peR clean-up and quantitation of the DNA product

The PCR-amplified DNA products were checked on 1% agarose gel and purified by

one of the following methods:

2.2.7.1 Purification of DNA from agarose gel using a commercially-available

kit

The required DNA band was excised from ethidium bromide stained gel with a

blade. Three volumes of 6M NaI solution (provided with the DNA isolation kit,

Biological Industries) per gel slice volume was added to the excised agarose piece

and incubated at 55'C for 5-10 min with occasional mixing till the gel dissolved

completely. 3 III of homogeneous glass powder suspension (provided with the kit)

was added to the agarose:DNA:NaI solution and mixed well. The suspension was

incubated at 55'C for 5-10 min with occasional mixing so as to adsorb DNA on the

glass powder suspension. The adsorbed DNA was pelleted after centrifuging the

tubes at 12000 rpm for 1 min and the pellet was washed three times with 200 III of

the wash buffer (for 50 ml buffer, 2.5 ml of concentrated wash buffer was taken and

mixed with 22.5 ml of sterile distilled water and 25 ml of ethanol and stored at -

20'C). The pellet was air dried to aspirate residual alcohol after which the glass

pellet was resuspended in 12-15 III of autoc1aved deionized water and incubated for

10-15 min at 55'C. The eluted DNA was transferred to a fresh tube after

centrifugation at 12000 rpm for 1 min.

2.2.7.2 Purification of DNA/ragmentfrom agarose gel using silica method

The DNA band was excised from ethidium bromide stained-ge1. 180 III of 6M KI (for

50 ml, 49.8 g of KI powder was dissolved in TE, 10 mM tris-Cl pH 8.0 and 0.1 mM

EDTA) and 20 III of 10% silica (for 10 ml, 1 g silicon dioxide powder was dissolved in

6 M KI solution) suspension was added to the excised agarose piece and incubated

at 55'C for 5-10 min with occasional mixing till the gel dissolved completely and

DNA was adsorbed on the silica suspension. The adsorbed DNA was pelleted after

centrifugation at 12000 rpm for 1 min and the pellet was washed once with 200 III

of 50% ethanol and once with acetone. The pellet was air dried to aspirate residual

acetone and ethanol and the silica suspension was resuspended in 12-15 III of

autoc1aved deionized water and incubated for 10-15 min at 55'C. The eluted DNA

was transferred to a fresh tube after centrifugation at 12000 rpm for 1 min.

47

2.2.7.3 Purification of peR product by the PEG (Polyethylene Glycol) method For purification of PCR products by the PEG method, two volumes of PEG8000

solution (for 50 ml, 13.3 g of PEG8000, 133 III of 1M MgCb and 10 ml of 3M sodium

acetate pH 4.8 was dissolved in deionized water) was added directly to the PCR

reaction and kept at room temperature for 15 min after which DNA fragments were

precipitated by centrifugation for 1 h at 3000 rpm. The supernatant containing

unincorporated dNTPs, primers and DNA polymerase was decanted completely after

an invert spin for few seconds. The pelleted DNA was washed twice with 40 III of

70% alcohol and suspended in 10 III of deionized water after aspirating alcohol

completely.

2.2.8 SNP discovery by DNA sequencing

2.2.8.1 The DNA sequencing reaction DNA sequencing was carried out on ABI 3130xl Genetic Analyzer (Applied

Biosystems) which utilizes Sanger's dideoxy chain termination method for

determining the nucleotide sequence of a DNA fragment. All sequencing reactions

were set in 96-well plate format using BigDye terminator cycle sequencing kit v3.1

(ABI). Briefly, the 5 III cycle sequencing PCR cocktail contained:

5X Dilution buffer

Ready Reaction mix

(DNA polymerase, fluorescent

labeled ddNTPs and dNTPs)

Primer (either forward or reverse)

Template DNA

: 0.75 III

: 0.5 III

: 2 pmoles

: 10-25 ng

The thermal cycling reaction was carried out for 30 cycles with denaturation at 94'C

for 10 sec followed by annealing step at 50-60'C for 5 sec and extension at 60'C for

4 min.

2.2.8.2 Purification of sequencing products and collection of sequencing data The amplified sequencing products were purified by precipitating with ethanol and

salts. 6 III of master-mix I (10 III of deionized water and 2 III of 125 mM EDTA) and

26 III of master-mix II (50 III of ethanol and 2 III of 3 M sodium acetate pH 4.6) was

48

added to each reaction and incubated for 15 min at room temperature. The

precipitated DNA fragments were pelleted by centrifuging the reactions at 3000 rpm

for 1 h at room temperature. The pellets were washed with 100 ~l of 70% alcohol

twice and dried to aspirate residual alcohol completely. The DNA was resuspended

in 10 ~l of Hi-Di formamide and denatured for 5 min at 95'C after which, the

reactions were snap chilled on ice for few seconds. The sequencing reactions were

then loaded on the 3130xl automated DNA sequencer and the data was collected

and analyzed with FinchTV (Geospiza Inc.) and SeqMan (DNAStar) softwares.

2.2.9 Genotyping

2.2.9.1 By Sequenom

For genotyping of SNPs in the validation panel samples, matrix assisted laser

desorption/ionization (MALDI) time-of-flight (TO F) DNA mass spectrometry

(Sequenom Inc.) was used. All the genotyping with Sequenom was carried out at

TCGA (The Center for Genomic Application), New Delhi.

2.2.9.2 By SNaPShot Tl\1

For genotyping SNPs in the patient/ control panel samples, ABI SNaPShot chemistry

was used. The PCR-amplified fragments were subjected to single base extension

thermal cycling in which the genotyping primer, ending penultimate to the SNP

position, is used. The primer is extended to a single base with the addition of

fluorescently-Iabeled ddNTPs only. The method is summarized in Fig. 2.4 the

SNaPShot reaction can be multiplexed, that is more than one SNP can be typed in a

single reaction. We were able to optimize 3-plex assays in our laboratory. Equimolar

quantities of all the primers were taken in the reaction mix. The primers used for

SNaPShot assays are tabulated in Table 2.4. If the SNPs that have to be typed were

present on different DNA templates, it was ensured that each template was present

in equimolar quantity in the multiplex reaction mix. 5 ~l of the reaction contained

0.5 ~l of the SNaPShot ready reaction mix (for 2-plex reactions), 10 pmoles of the

genotyping primer premix (containing all the pooled primers for multiplexing) and

25 ng of the template. The single base pair extension PCR was carried out for 40

cycles of denaturation at 96'C for 10 sec followed by annealing at 50-60'C for 5 sec

and extension at 60'C for 30 sec. After the PCR, amplified fragments were purified

49

DNA template

Position 1 the SNP

5'----------- G/A 3' Genotyping primer

G

ddGTP ddCTP ddATP

ddTTP

_1 Single base pair extension

G ____ A _~ __ A

____ G ____ A

ClAP treatment to remove unincorporated ddNTPs

Fragments separated on 3130xl DNA sequencer with Liz size - standard 120

J. A

Fig. 2.4: Schematic representation of SNaPShot chemistry (ABI).

50

with ClAP (calf intestinal alkaline phosphatase) to remove unincorporated ddNTPs

and primers. 3 III of the ClAP reaction (0.8 III of the 10 X reaction buffer, 1 U of

ClAP) was added to each completed PCR reaction and the samples were incubated

for 40 min at 3TC followed by inactivation of enzyme at 75'C for 10 min. The DNA

was resuspended in 9.7 III of Hi-Di Formamide and 0.3 III of Liz size standard-120.

Before electrophoresis, samples were denatured for 5 min at 95'C followed by snap

chilling on ice for few a seconds. The SNaPShot reactions were then loaded on the

3130xl automated DNA sequencer and the data was collected and analyzed with

Gene Mapper v3.5 software (ABI).

Table 2.4: List of primers used for genotyping SNPs with SNaPShot method. peR-primers used for the preparation of template amplicon for genotyping are also listed.

Gene Primer ID 1 ST peR primer pair SNaPShot primer

name (SNP ID) -308 FP:5'-caaacacaggcctcaggactc-3' 5'-tggaggcaataggtttgaggggcatg-3'

(rs1800629) RP:5'-agggagcgtctgctggctg-3'

-238 FP:5 '-caaacacaggcctcaggactc-3' 5 '-acactccccatcctccctgctc-3'

rs361525 RP: 5 '-agggagcgtctgctggctg-3 ,

TNF -76 FP: 5' -caaacacaggcctcaggactc-3' 5' -agatgagctcatgggtttctccaccaagg-(rs41297589) RP: 5' -agggagcgtctgctggctg -3' 3'

INT1_1 FP: 5'-tctttccccgccctcctctcg -3 ' 5' -acccaaggggaaatggagac-3' (rs3093661) RP: 5'-tcttccccatctcttgccacatctc-3'

INT1_2 FP: 5'-tctttccccgccctcctctcg -3 ' 5' -tagggagggatgagagagaaaaaaac-3' (rs1800610) RP:5' -tcttccccatctcttgccacatctc-3'

Ex2_Kilifi FP: 5'-gtcgcctcttccctcgtttcttcta -3 ' 5' -gcacctcctgtgaccagccca -3 ' (rs5491) RP:5' -agcccctccttgaccctacgagc-3'

[CAMl Ex6 FP:5' -agtaagaaggggcaggggcggagtg-3' 5'-tcacagagcacattcacggtcacct -3 ' (r85498) FP: 5' -acaggcggtgaggattgcattaggt -3'

IC_utr FP:5'-ccaggagcactcaaggggaggtca-3' 5' -ccacgcctccctgaacctatccc-3' (r82071440) RP: 5' -ggccccaaatgctgttgtatctgact -3 '

Ex3_LV FP: 5' -aagagaaaaccactgcagagtaccag -3' (rs28933978) 5' -aatatctgcataggatgggataagaccaca -3 '

RP:

5'-ggcctattgggaatatgtctagtgcttacg -3 '

51

PECAM1 Ex8_SN FP: 5' -accactgcactccagcctgggtgataa -3 ' 5'-tgcagtaatactctccctcctgttccttg -3'

(r817343222) RP:

5' -agccttcagtcacataagctagactccc-3'

Ex12_RG FP: 5' -tttcaactaggtcacaatgacgatgtc-3'

(r81131012) 5' -gctggttgtcactacactgaataaatcagg -3 '

RP: 5' -atttagtccaatccctcagtgcttcag -3'

PR01_TC FP: 5'-tgttgttatgtggttcctag -3' 5' -ggactgactgatgtacagcagtgat -3 ' (r81334512) RP:5' -caaaagtcagatcaaagtag-3'

CD36 PR02_GT FP: 5- 'accccctcccccccc-3' (r82151916) 5' -ctgtgatcatgaaatttttgcaaaactaa -3 '

RP: 5' -acagtagtgtcacctcccgtcatctgg -3 '

PR03_TA FP: 5'-tgttgttatgtggttcctag -3 ' 5'-ttaattccctggtcttcccaactagcattc-3

RP:5 '-caaaagtcagatcaaagtag-3'

IL4_590 FP: 5' -ggggctgaggtgggaggatcattgag -3 ' cttctcaaaacactaaacttgggagaacattgt

IL4 (r82070874) RP: 5' -agaggccacacgtgtccaaatttgttgtaa -3 '

IL4_33 FP: 5' -ggtgtcgatttgcagtgacaatgtgag-3' (r82243250) 5' -ctttccccaggaggactgcattacaacaaat -3'

RP: gtgccctggactgccaccaaccac-3'

IL13 IL13_1055 FP: 5' -gctgggctgggaagcttcgagtgtgga -3 ' 5 '-gccttttcctgctcttccctc-3' (r81800925) RP:5' -ggcccctgcagccatgtcgccttttc-3'

CR_QH FP: 5' -gctacatgcaggttgagaccttac-3' 5'-tgcatgtgatcacagacatcca-3'

RP:5'- agcaaggatacagattttcccc-3'

CR1 CR_HR FP: 5 '-gcctccagacctcctgcatggtgagc-3' (r82274567) 5' -agaaaatacctcatgccctgtagatttacaagt -3 '

RP:

5'-taagtggaaatagcacacggccatgag -3'

2.2.9.3 Amplification Refractory Mutation detection System (ARMS)-PCR

ARMS-PCR (Newton et ai., 1989) was performed to genotype the 5bp ins/del

polymorphism in the upstream regulatory region of the IL12 gene. In ARMS-PCR,

two separate reactions were set for one sample in which one common forward

primer was used along with allele specific reverse primers. The allele specific primer

amplifies the allele for which it is specific. The common forward primer used was:

5'-gTCAgCAgACCTTCCTCgCCCATAgggTAAg-3'

The allele specific reverse primers were:

For wild type allele: (with 5bp insertion)

52

c.t.1crpter :2

5 '-gggggCCACATTAgAgCCTCTCTCgg-3 ,

For mutant allele:

5' -gggggCCACAgCCTCTCTCgg-3'

15 pI PCR was set with 3 pmoles of each primer and 10-20 ng of template genomic

DNA and the reaction was carried for 30 cycles with denaturation at 94'C for 20 sec

followed by annealing at 64 'c for 10 sec and extension at 72'C for 30 sec. The

amplicons were separated on 1.5% agarose gel. The genotypes were determined by

the appearance of DNA bands in the respective PCR reactions (Fig. 2.5).

Sample 1 Sample 2 Sample 3 M

210bp+-

-+ lOObp

Fig. 2.5: Visualization of peR amplified DNA fragments performed by ARMS method.

2.2.9.4 Restriction Fragment Length Polymorphism (RFLP)

The RFLP method was used to genotype the CRl intron 27 SNP (Katyal et ai., 2003).

Initially, 25pl of the PCR reaction was set to amplify the polymorphic locus using

primers: forward primer:5'- CCTTCAATggAATggTgCAT-3' and reverse primer: 5'­

ggTCTgAACggAATgTTCCC-3'. The amplification was carried out for 35 cycles with

initial denaturation at 950C for 10min followed by cycling at 940C for 30s, 500C for

30s and 720C for 2min. After the PCR, 5 pI of the reaction was checked on 1%

agarose gel. Restriction digestion was set in a 20 pl reaction mix containing 1 X

reaction buffer, 10 pI of the PCR product and 3 U of the HindIII restriction

endonuclease. The reaction was incubated at 3TC for 6 h followed by deactivation

of enzyme at 65'C for 10 min after which, fragments were separated on 1% agarose

gel. The undigested PCR fragment (wild type) was of 1.8 kb in length while the

mutant genotype showed two fragments of 1.3 and 0.5 kb in length on 1% agarose

gel. Individuals heterozygous for the polymorphism revealed all the three fragments

of 1.8 kb, 1.3 kb and 0.5 kb (Fig. 2.6).

M GlterLGl Ls. Gl vcd MeHlOds.

abc M d e

1.8kb +-- ----+ 1.3 kb

----. 0.5 kb

Fig. 2.6: peR fragments after HindIII digestion. Sample 'a' was wild type for the intron 27

mutation which remained undigested (1.8 kb), samples 'b', 'c' and 'd' were heterozygous and

gave three bands of 1.8, 1.3 and 0.5 kb. Sample 'e' was homozygous mutant for the

mutation and gave 1.3 and 0.5 kb bands after digestion.

2.2.10 Flow cytometry for estimation of CRllevels on RBCs

Twenty pI of the packed RBCs (after removing the plasma) were aliquoted in a fresh

microcentrifuge tube and flxed as described (Cockburn et ai., 2002). Briefly, cells

were washed twice with 200 pI of incomplete RPMI-1640 media (for 1 L, 16.4 g

RPMI, 10 ml of antimicrobial/antimycotic mix was taken and pH was adjusted to

7.2-7.4). After washing, cells were suspended in complete RPMI media (incomplete

RPMI media supplemented with 10% FBS/FCS) so as to make 4% haematocrit.

Cells were flxed by addition of 480 pI of flxative solution (4% D-glucose and 10%

formaldehyde was dissolved in tris-saline pH 7.3, containing 10 mM tris-Cl, 150

mM NaCl, 10 mM sodium azide). Samples flxed in this way can be stored for about

four to six weeks at 4'C without loss in CRI levels. 30 pI of the flxed samples were

taken and washed twice with 200 pI of RPMI-PBS-FCS buffer (4% v /v of incomplete

RPMI, 1% heat inactivated FCS dissolved in 1 X PBS). After the last wash, buffer

was removed completely and resuspended in 25 pI of the RPMI-PBS-FCS buffer.

Cells were incubated overnight (16-18 h) with primary anti-CRI rnAb (1:200

dilution) at 4'C after which cells were washed three times with 200 pI of RPMI-PBS­

FCS buffer. Cells were resuspended in 25 pI of the RPMI-PBS-FCS buffer and

incubated with Oregon Green-tagged goat anti mouse IgG antibody (10 pg/ml) for 2

54

h at 4'C after which cells were washed twice with 200 pI of RPMI-PBS-FCS buffer.

Cells were finally suspended in 500 pI of fixing solution (0.37% formaldehyde in

RPMI-PBS-FCS buffer). Every time the experiment was set, one sample containing

only secondary antibody was included which served as a negative control. RBCs

were gated on the SSC and FSC scatter plot after examining the fluorescence at the

FL1 height (absorption at 488 nm). Mean fluorescence of the subsequent samples

were recorded in the RBC gate after exciting 10000 events (cells)/ sample. All the

readings were taken on FACSCalibur (BD Biosciences). For estimation of the

number of CR1 sites/RBC a calibration curve was constructed using samples with

pre-determined CR1 sites (kindly provided by Prof. JHM Cohen; INCERM, France).

2.2.11 Cell culture 2.2.11.1 In vitro cell culture of human macrophage and T-cell line

The human macrophage cell line (THP1) and human T-cell leukemia cell line

(Jurkat) were maintained in vitro in RPMI-1640 medium (for 1 L, 16.4 g of HEPES

modified RPMI medium was dissolved in water and supplemented with 10%

FCS/FBS, 1% antibiotic/antimycotic mix and 2 g of NaHC03 and the pH was

adjusted to 7.2-7.4). Cells were grown at 3TC in a 5% C02 incubator.

2.2.11.2 Cryopreservation of cell cultures

Frozen stock of the cell cultures was prepared at a cell count of approximately 5

million cells/ml of the culture. The freezing solution contained 10% DMSO, 20%

FCS and 70% RPMI medium. Cultures were pelleted and were resuspended in

freezing solution (for -40 million cells, 2 ml of freezing solution was used) after

which 1.5 ml of suspension was aliquoted in cryovials. The vials were kept at -20'C

for 4-5 h after which they were transferred to -70'C overnight and finally stored in

liquid nitrogen until use.

2.2.11.3 Pretreatment of cells prior to harvesting

Cells were stimulated to transcribe TNF prior to harvesting. The THP1 cells were

incubated with 100 ng/ml of LPS for 4 h and the Jurkat cells were treated with 1

11M of Ionomycin for 30 min at 3TC before harvesting.

55

cl-lcrpter :2

2.2.12 Electrophoretic mobility shift assay (EMSA)

2.2.12.1 Preparation of nuclear extract

60 X 106 million THP1 or Jurkat cells were pelleted and washed twice with 1XPBS

at 4'C. Cells were resuspended in 1 XPBS and ice-cold lysis buffer (0.03 M Tris-Cl

pM 7.5, 0.01 M Mg-Acetate.4H20, 1% NP-40) was added (500 pI lysis buffer/3

million cells). Cells were incubated in ice for 5 min with brief vortexing for 15 sec

after every min. Nuclei were pelleted after centrifugation at 2000 rpm for 3 min at

4'C. The supernatant was discarded and nuclei were washed in ice-cold 1 X PBS.

PBS was removed carefully and completely and nuclei were suspended in 100 pI of

protein extraction buffer (20 mM HEPES pH 7.9, 25% glycerol, 0.42 NaCI, 1.5 mM

MgCh, 0.2 mM EDTA, 0.5 mM PMSF, and 0.5 mM DTT) and nuclear proteins were

extracted at 40C for 30min with constant stirring. After centrigugation at 11000 rpm

for 10 min at 4'C, the supernatant containing the nuclear proteins were carefully

transferred to a fresh microcentrifuge tube and dialyzed overnight against 250 ml of

dialysis buffer (20 mM HEPES pH 7.9, 20% glycerol, 0.2 mM EDTA, 0.1 M KCI, 0.5

mM PMSF, 0.5 mM DTT). After centrifugation at 11000 rpm for 20 min at 4'C, the

nuclear extract (supernatant) was stored at -70'C in aliquots for further use.

2.2.12.2 Preparation of radio-labeled oligo nucleotide probe

Double stranded oligos for the wild and mutated TNF enhancer sequence at the -76

position was designed (TNF _wild: 5'-CTCCACCAAGGAAGTITTCCGCTGGT-3',

TNF_mutant: 5'-CTCCACCAAGGAAGTATTCCGCTGGT-3'). The 30bp long TNF

enhancer oligo-nucleotides were end labeled with y32P-ATP. 100 ng of the double

stranded TNF probe was incubated at 3TC for one hour with 1 U polynucleotide

kinase, 1 X reaction buffer and 50 /lCi yP32_ATP. The probe was purified through

Sephadex G-50 column (single drop method) and counts were taken in a Beckman

scintillation counter.

2.2.12.3 Binding and electrophoresis

Binding reactions with THP1 nuclear proteins was carried out with 4 IJg of the

extract and end-labeled TNF 30bp DNA fragment (both wild and mutant with the

mutant oligo carrying 'A' at -76 position). 4 IJg of the extract was incubated with 2

ng of the DNA probe for 10 min at room temperature (24'C) in the binding buffer

56

containing 12 mM HEPES pH 7.5, 100 mM KCI, 1 mM EDTA, 12% glycerol and

0.51lg (250-fold excess) of poly(dI-dC). EMSA with Jurkat nuclear proteins were

carried out with 41lg of nuclear extract in the binding buffer containing 4 mM

HEPES pH 7.4, 90 mM NaCI, 20 mM KCI, 0.08 mM EDTA, 12% glycerol and 0.5 Ilg

of poly(dI-dC). The reactions were incubated on ice for 20 min. Binding reactions

was loaded on a 6% poly-acrylamide gel and electrophoresed at 150 V in 0.5 X TBE

buffer at 4°C. Gel was dried at 80'C for 2 h and subjected for phosphorimaging

(Cyclone, Hewlett Packard). In competition experiments, 20-fold and 200-fold molar

excess of unlabeled specific competitor and 200-fold molar excess of unlabeled non­

specific competitor DNA (30bp double stranded DNA sequence from M.tubercuiosis,

LRP promoter) was incubated with the nuclear extract prior to the addition of

labeled probe. For gel supershift experiments, nuclear extract was incubated for 20

min at 24'C with human anti-ETS-1 monoclonal antibody prior to the addition of

DNA probe.

2.2.13 Estimation of cytokine levels in plasma by Enzyme-Linked

Immunosorbent Assay (ELISA)

Sandwich ELISA was performed for the estimation of cytokines, TNF, IL-4, IL-6, IL-

10, IL-12, IL-13 and IFNy in the plasma of patients and controls. All the ELISAs

were performed according to the manufacturer's instructions. Briefly, the microtiter

plates were coated with 100 pI of coating monoclonal antibody suspended in

recommended buffers (Table 2.5) (recommended concentrations: 1.5 pg/ml for TNF

and IL-4, 6.5pg/ml for IL-13 and 1:250 dilution for IL-6, IL-10, IL-12 and IFNy) and

incubated overnight at room temperature for TNF, IL4 and IL13 ELISAs and at 4'C

overnight for IL-6, IL-12, IL-lO and IFNy ELISAs. Plates were washed four times

with wash buffer (Table 2.5) and blocked with 200 pI of assay buffer (Table 2.5) for 2

h at room temperature after which the plates were washed thoroughly four times.

50 pI of plasma was added in each well and incubation was carried out either

overnight at 4'C (for TNF and IL-4) or at room temperature for 2-4 h (for IL-6, IL-13,

IL-12, IL-10 and IFNy) after which plates were washed six times with the wash

buffer. Every time the ELISA was performed, cytokine standards were included in

each assay plate in duplicate. Incubation with biotin labeled detecting antibody

was done at room temperature for about 2 h at recommended dilutions (0.3 pg/ml

57

for TNF, 0.2 pg/ml for ILA, 0.15 pg/ml for IL-13, 1:250 dilution for IL-6, IL-12,

1:125 dilution for IFNy and 1:500 dilution for IL-I0). For IL-13 ELISA, samples and

detecting antibody were incubated together. After the detecting antibody incubation,

plates were washed six times and then incubated with HRP enzyme linked with

Streptavidin (1:20,000 dilution used for TNF, ILA and IL-13) and incubated for

30min at room temperature. For IL-6, IL-12, IL-I0 and IFNy ELISAs, HRP­

streptavidin (at 1 :250 dilution) and detecting antibody were incubated together.

Plates were washed thoroughly for eight times and 50 pI substrate solution, TMB

was added in each well. Reactions were allowed to develop for about 30 min.

Reactions were stopped with 7% H2S04. The optical density (00) was measured at

450 nm wavelength on BioTek Microplate reader. The minimum detection limit for

all the assays was mostly between 1-2 pg/ ml.

Table 2.5: List of various buffers used in cytokine ELISAs.

Coating, buffers

Phosphate buffer saline (PBS) TNF, IL-4, IL-13

Carbonate buffer IL-6, IL-12, IL-lO, IFNy

Assay' buffers

PBS with 4% BSA TNF, IL-4, IL-13

PBS with 5% FCS IL-6, IL-12, IL-IO, IFNy

Wash buffers

50mM Tris-Cl with 0.2% Tween-20 TNF, IL-4, IL-13

PBS with 0.05% Tween-20 IL-6, IL-lO, IL-12, IFNy

2.2.14 Hemoglobin electrophoresis

Cellulose acetate electrophoresis was performed to determine the presence of sickle

hemoglobin in patients and controls as described by Kohn, (1969) with brief

modifications. Hemoglobin, a negatively charged protein, migrates towards the

anode under an electric field when cellulose acetate membrane is used as matrix.

During electrophoresis, various hemoglobins separate due to charge differences

caused by structural variations and thus the presence of sickle hemoglobin can be

identified.

58

20 pI of packed RBCs were washed twice with 200 pI of normal saline (0.9% NaCl).

Cells were resuspended in 20 pI of saline and lysed with 3 pI of 1% saponin. The

hemolysate was applied on the cellulose acetate membrane (presoaked in running

buffer for at least 30 min) in the form of a fine line made with a wire loop and

subjected to electrophoresis at 4S0V in the TBE running buffer pH 8.5 (for 1 L, 10.2

g of tris-Cl, 0.6 g of EDTA, 3.2 g of boric acid). The cellulose acetate membrane was

stained with Ponceau stain (0.5 g of Ponceau and 5 ml of trichloroacetic acid for 100

ml stain) for 3 min after which the membrane was washed three times with 5%

acetic acid, fixed in absolute methanol for 3-5 min and dried between paper towels.

The mobility of normal and sickled hemoglobin are shown in the Fig. 2.7.

Carrier of sickle cell trait

Fig. 2.7: Relative mobility of normal and sickled hemoglobin on cellulose-acetate matrix.

Since the sickle cell trait is widely-studied classical red cell defect that otherwise

confers resistance to malaria, we recorded its prevalence in our study groups from

both the endemic and the non-endemic regions (Table 2.6).

Table 2.6: Distribution of sickle-cell trait (AS) and sickle-cell hemoglobin in controls and patients (non-severe + severe malaria) in P.falciparum malaria endemic and non-endemic region of India.

Endemic Non-endemic

Controls Patients Controls Patients

(n=102) (n=98) (n=84) (n=47)

AS (%) 1 (1.13) 3 (3.06) 0(0.00) 0(0.00)

SS (%) 0(0.00) 1 (1.02) 0(0.00) 0(0.00)

59

2.2.15 Glucose 6-phosphate dehydrogenase (G6PD) assay

G6PD enzyme activity in RBCs was assayed using the semi-quantative fluorescent

spot test (Beutler et aI., 1968). In this method, Glucose-6-phosphate (G6P) is

oxidized into 6-phosphogluconate by G6PD present in blood using NADP as a

cofactor. NADP is reduced to NADPH which fluoresces under long UV light.

However, to continue the reaction for a longer time with limited NADP, oxidized

glutathione (GSSG) is added to the reaction mixture. GSSG oxidises NADPH and

itself gets reduced (GSH) through the action of glutathione reductase (GR) present

in blood. For the assay, 10 pI of RBCs were lysed with 90 pI of sterile distilled water.

About 10 pI of lysed RBCs were added to 100 pI of the reaction buffer (0.1 M

glucose 6-phospahte, 0.75 M Tris-Cl pH 8.0, 1% saponin, 0.007 M NADP, 0.008 M

GSSG), the contents were mixed thoroughly and a zero time spot (lcm diameter) of

the blood-reagent mixture was applied on 3 MM Whatman filter paper. This spot

served as the background control. The reaction was incubated at 3TC and samples

were spotted after incubation for 10 and 30 min respectively next to the control spot

on the filter paper. The spots were allowed to dry at room temperature and

examined under long wave (366nm) UV light for fluorescence. Absence of

fluorescence till 30 min indicated deficiency of G6PD in the individual (Fig. 2.8). The

intensity of fluorescence at 10 and 30 min was also indicative of the level of G6PD

in an individual's RBCs.

o 10 min 30 min 60 min

2

3

4

5

Fig. 2.8: G6PD assay. Spots at different time points after start of the reaction (0, 10 min, 30

min and 60 min) as observed under UV light. Samples I, 2 and 3 fluoresce maximally (high

G6PD activity) while sample 4 fluoresced weakly starting at 30 min (weak G6PD activity)

and sample 5 did not fluoresce at any time point (G6PD deficient).

60

The prevalence of G6PD deficiency has been extensively studied in India but there is

no clear data available establishing the correlation of deficiency with P.falciparum malaria in the country (Sukumar et ai., 2004; Balgir et al., 2006). Since G6PD

deficiency is a known red cell defect that confers resistance to malaria, we analyzed

the prevalence of G6PD deficiency in our study populations from malaria endemic

regions of Orissa and non-endemic regions of Uttar Pradesh. We observed that the

percentage deficiency was higher in the endemic region (total deficiency=21.2%) as

compared in malaria non-endemic region (total deficiency=8.6%) (Table 2.6).

Table 2.6: Percent G6PD deficiency in individuals (controls + patients) from P.falciparnm malaria endemic and non -endemic region of India.

Endemic Non-endemic

Males Females Males Females

(n=12S) (n=88) (n=l1S) (n=39)

% Deficiency 19.2 23.9 9.5 7.7

2.2.16 Data analysis

The statistical methods and software tools used for the analysis of allele frequency

and case-control data were as follows:

2.2.16.1 Allele frequency estimations

The frequencies of major and minor alleles for each locus were computed by gene­

counting method. The chi-square test was performed for every locus to evaluate

whether the allele frequencies of the populations are in Hardy-Weinberg

equilibrium. All these estimations were performed using FSTAT version 2.9.3.2

program.

2.2.16.2 F-statisticsfor genetic differentiation

Pair-wise FST between populations were computed in FSTAT (version 2.9.3.2)

according to the Wright's F-statistics using Weir & Cockerham (1984) estimators

which weights the allele frequencies according to the sample size. Test for

significance of pair-wise FST values were done by bootstrapping in FSTAT. Locus

61

wise FST and Ho values were also computed in FSTAT and the significance was

estimated by jackknifing as implemented in the FSTAT program.

2.2.16.3 Haplotype analysis

The haplotypes with SNP genotype data were generated by using PHASE version 2.1

which implements Bayesian statistical method using the Markov-chain Monte Carlo

algorithm for reconstructing haplotypes (Stephens et ai., 2001). The linkage­

disequilibrium (LD) plots for the TNF, PECAMl and CD36 SNPs were generated

using Haploview version3.32 (Barret et aI., 2005) which also calculated the LD

measures: 0' and r2 for the SNP pairs. The haplotype diversity (h) was estimated by

the mathematical formula given by Nei and Tajima, (1981):

h = n(l- L,pi2} {n -I}

where, n= number of chromosomes sampled, LPi2 = sum of the squares of the

haplotypes.

2.2.16.4 Non-parametric tests/or correlations and comparison o/means

The values of cytokine levels in the various sample categories (patient/control

/ genotype) generally did not follow the normal Gaussian distribution of data and

hence do not fit in the assumptions of parametric tests for the comparison of

means. The comparison of cytokine levels among genotypes was carried out using

the non-parametric test of ANOVA, the 'Kruskal-Wallis test'. Pair-wise comparison

of means for cytokine levels between patient/control groups was done by using non­

parametric Mann-Whitney test. All these comparisons were done in VassarStats

online web-tool (http://faculty.Vassar.edu/lowry/VassarStats.html). The two-tailed

'rank-order correlations' were performed on log-transformed values of cytokine

levels and the Spearman 'r' values were calculated in GraphPad Prism version 3

software.

2.2.16.5 Odds Ratio estimation/or risk assessment

For the case-control data, the 'Odds Ratio' for risk assessment associated with

alleles (or genotypes) was determined using EpiInfoTM version 3.4 software. The

62

software computes the odds ratios at 95% confidence interval on 2X2 contingency

tables and provides the associated P-values calculated by Fisher Exact or Mantel­

Haenszel tests.

2.2.16.6 Multivariate hierarchical clustering

Two-way hierarchical clustering was performed on log transformed cytokine data

using Cluster3 program which clusters variables based on their similarities.

Clusters were assembled into a tree where variables are joined by very short

branches if they are very similar to each other, and by increasingly longer branches

as their similarity decreases. The distance measure used for clustering was

Euclidean distance. The output was visualized in Tree View program in the form of a

two-dimensional rectangular heat-map.

2.2.16.7 Step-wise discriminant analysis

Step-wise discriminant analysis was performed on log-transformed cytokine values

to determine which variables (cytokines) discriminate between two or more groups

(control and patient categories). To determine cytokines which can be determinants

of disease groups, backward step-wise elimination was performed by including all

variables in the model. At each step, the variable that contributes least to the

prediction of group membership is eliminated. All these calculations were performed

using XLstat program (limited version).

63