Supplementary Information for

New natural products isolated from Metarhizium robertsii ARSEF 23 by

chemical screening and identification of the gene cluster through

engineered biosynthesis in Aspergillus nidulans A1145

Hiroki Kato, Yuta Tsunematsu, Tsuyoshi Yamamoto, Takuya Namiki, Shinji Kishimoto,

Hiroshi Noguchi and Kenji Watanabe

Department of Pharmaceutical Sciences, University of Shizuoka, Shizuoka 422-8526, Japan

*Correspondence e-mail: kenji55@u-shizuoka-ken.ac.jp

S1

Table of Contents

1. Supplementary Methods ................................................................................................. S3–S51.1 Metabolic profile of Metarhizium robertsii ARSEF 23..............................................S31.2 Construction of pKW16020, pKW16025 and pKW16026 for de novo

production of 5 and 6 in Aspergillus nidulans A1145. ....................................... S4–S5

2. Supplementary Results ................................................................................................. S6–S22Supplementary Table 1. Oligonucleotide primer sequences. ............................................... S6

2.1 Chemical characterization of 3. ................................................................................ S72.2 Chemical characterization of 1. ........................................................................ S8–S122.3 Chemical characterization of 2. ...................................................................... S13–S172.4 Chemical characterization of 6........................................................................ S18–S21

3. Supplementary References ................................................................................................. S22

S2

1. Supplementary Methods

1.1 Metabolic profile of Metarhizium robertsii ARSEF 23.

Supplementary Figure 1. UHPLC trace of metabolic extracts from Metarhizium robertsii

ARSEF 23 cultured in (a) YPD or (b) MYG liquid media, and (c) UV–Vis spectra of 1–3. All

UHPLC traces were monitored at 280 nm.

S3

1.2 Construction of pKW16020, pKW16025 and pKW16026 for de novo production of

5 and 6 in Aspergillus nidulans A1145

For de novo production of 5 and 6 in Aspergillus nidulans A1145, we constructed five vectors

for expressing subA, subC and subD. The construction of those vectors was accomplished in

situ using the endogenous homologous recombination activity of Saccharomyces cerevisiae.

pKW200931 was linearized by restriction digestion with Swa I (10 units). subA with its

original terminator was amplified from M. robertsii ARSEF 23 genomic DNA using the

pKW16020_MAA_07496_F1/pKW16020_MAA_07496_R1 primer set (Supplementary

Table 1). These DNA fragments were simultaneously introduced into S. cerevisiae BY4741

to combine them into an intact plasmid in situ by homologous recombination. The resulting

plasmid was amplified in E. coli for restriction digestion analysis and later sequenced to

confirm its identity. This plasmid was named pKW16020 (Supplementary Figure 2).

pKW100292 was linearized by restriction digestion with Swa I (10 units). subC with

its original terminator was amplified from M. robertsii ARSEF 23 genomic DNA using the

pKW16025_F/pKW16025_R primer set (Supplementary Table 1). These DNA fragments

were simultaneously introduced into S. cerevisiae BY4741 to combine them into an intact

plasmid in situ by homologous recombination. The resulting plasmid was amplified in E. coli

for restriction digestion analysis and later sequenced to confirm its identity. This plasmid was

named pKW16025 (Supplementary Figure 2).

pKW100352 was linearized by restriction digestion with Swa I (10 units). subD with

its original terminator was amplified from M. robertsii ARSEF 23 genomic DNA using the

pKW16026_F/pKW16026_R primer set (Supplementary Table 1). These DNA fragments

were simultaneously introduced into S. cerevisiae BY4741 to combine them into an intact

plasmid in situ by homologous recombination. The resulting plasmid was amplified in E. coli

for restriction digestion analysis and later sequenced to confirm its identity. This plasmid was

named pKW16026 (Supplementary Figure 2).

S4

Supplementary Figure 2. Maps of plasmids pKW16020, pKW16025 and pKW16026.

S5

2. Supplementary Results

Supplementary Table 1. Oligonucleotide primer sequences. DNA primers were designed

based on the sequence information obtained from the M. robertsii ARSEF 23 genome

sequence database.

Primer name Sequence, 5'-3'

pKW16020_MAA_07496_F1 TCCCCAGCATCATTACACCTCAGCATTAATTAAATGCGTGTAAATACACCATCTCTATTGATATGC

pKW16020_MAA_07496_R1TGTCCTCCCTCGGACATACACAGAATAC

pKW16025_F ACAATAAACCCCACAGAAGGCATTTATGGCGAAGGAAGCAAAAATGAAGGCC

pKW16025_R AGACCCAACAACCATGATACCAGGGGATTTAAATATACGACAGGCGGCTCATTTAGGTC

pKW16026_F ATTACCCCGCCACATAGACACATCTAAACAATGTCCCCAAGCGCGCCAAACAC

pKW16026_R TCGAAAGGGAGTCATCCAATTTAAATTGGACAATCGTTGTGTGCTCTGTGG

S6

2.1 Chemical characterization of 3.

Supplementary Table 2. NMR data of compound 3 in CD3OD. The molecular formula of 3 was established by mass data [ESI-MS: m/z 427 (M+H)+; HRESIMS: m/z 427.2841 (M+H)+, calcd. for C27H39O4

+, 427.2843, = 0.2 mmu].

S7

2.2 Chemical characterization of 1.

Supplementary Table 3. NMR data of compound 1 in CD3OD. The molecular formula of 1 was established by mass data [ESI-MS: m/z 443 (M+H)+; HRESIMS: m/z 443.2791 (M+H)+, calcd. for C27H39O5

+, 443.2792, = 0.1 mmu]. [α]D22 –94.9 (c 1.2, CH3OH).

DQF–COSY: double-quantum filtered correlated spectroscopyHMBC: heteronuclear multiple bond correlationNOESY: nuclear Overhauser effect correlated spectroscopy

S8

position H [ppm], XH, multi., (J [Hz])a C [ppm]b DQF–COSYa HMBCa

1 a 1.44 1H dt (13.0, 4.6) 26.3 1b, 2a, 2b 　b 1.58 1H dd (4.6, 13.0) 1a, 2b 2

2 a 2.07 1H m 32.1 1a, 2b, 10 1, 3, 4, 10, 19b 2.50 1H m 1a, 1b, 2a, 10 1, 3, 19

3 149.9

4 2.21 1H dd (4.6, 11.4) 56.6 20a, 20b2, 3, 5, 10, 19, 20

5 39.66 a 1.40 1H dt (2.9, 12.6) 35.9 6b, 7 5, 7, 8

b 1.91 1H ddd (1.6, 9.9, 12.6) 6a, 7 5, 7, 87 1.78 2H m 23.3 6a, 6b, 8 5, 8, 98 3.20 1H dd (3.6, 11.5) 88.8 7 6, 7, 119 45.5

10 1.77 1H dd (3.5, 13.1) 46.4 2a, 2b 1, 5, 911 1.50 1H dd (3.5, 11.3) 49.2 11b, 12 8, 9

1.96 1H m 11a, 1212 4.80 1H m 75.6 11a, 11b, 13 13, 1413 5.64 1H dd (1.8, 8.2) 128.1 12, 15, 16 11, 14, 15, 1614 138.915 3.94 2H d (1.8) 67.9 13 13, 14, 1616 1.70 3H s 14.1 13 13, 14, 1517 0.87 3H s 17.5 8, 9, 10, 1118 0.98 3H s 25.1 4, 5, 6, 1019 a 4.25 1H bs 110.6 19b 2, 3, 4

b 4.49 1H bs 19a 2, 3, 420 a 2.60 1H dd (4.6, 13.6) 22.8 4, 20b 3, 21

b 2.77 1H dd (11.4, 13.6) 4, 20a 4, 21, 2221 103.422 169.423 109.524 156.625 168.526 2.19 3H s 17.3 22, 23, 2427 1.92 3H s 10.4 22, 23, 24

aRecorded at 500 MHz. bRecorded at 125 MHz.

S9

Supplementary Figure 3. 1H NMR (500 MHz) spectrum of 1 in CD3OD.

Supplementary Figure 4. 13C NMR (125 MHz) spectrum of 1 in CD3OD.

S10

Supplementary Figure 5. DQF–COSY (500 MHz) spectrum of 1 in CD3OD.

Supplementary Figure 6. HMQC (500 MHz) spectrum of 1 in CD3OD.

S11

Supplementary Figure 7. HMBC (500 MHz) spectrum of 1 in CD3OD.

Supplementary Figure 8. NOESY (500 MHz) spectrum of 1 in CD3OD.

S12

2.3　Chemical characterization of compound 2.Supplementary Table 4. NMR data of compound 2 in CD3OD. The molecular formula of 2 was established by mass data [ESI-MS: m/z 445 (M+H)+; HRESIMS: m/z 445.2948 (M+H)+, calcd. for C27H41O5

+, 445.2949, = 0.1 mmu]. [α]D23 +57.4 (c 0.75, CH3OH).

S13

positionH [ppm], XH, multi., (J

[Hz])a C [ppm]b DQF–COSYa HMBCa

1 a 1.47 1H m 26.2 2b 10b 1.59 1H m 2a, 2b 10

2 a 2.08 1H dd (3.5, 13.6) 32.1 1b, 2bb 2.50 1H dt (5.8, 13.6) 1a, 1b, 2a

3 149.84 2.19 1H m 56.6 20a, 20b5 39.66 a 1.39 1H dt (2.9, 13.3) 36.0 6b, 7 5, 10

b 1.91 1H m 6a, 7 5, 7, 107 1.80 2H m 23.4 6a, 6b, 8 6, 88 3.15 1H dd (4.3, 11.0) 88.7 7a, 7b 69 45.1

10 1.78 1H m 46.7 811 a 1.41 1H m 47.4 12

b 1.80 1H m 12 8, 12

12 4.08 1H m 78.011a, 11b, 13a, 13b

13 a 1.53 1H m 41.4 12 12, 15, 16b 1.68 1H m 12 12, 15, 16

14 1.72 1H m 34.6 15, 1615 3.41 2H m 67.9 14 13, 1616 0.95 3H d (6.8) 17.5 14 13, 14, 1517 0.87 3H s 18.2 8, 9, 10, 1118 0.96 3H s 25.2 4, 5, 6, 1019 a 4.23 1H br s 110.7 19b 2, 4

b 4.47 1H br s 19a 2, 420 a 2.59 1H dd (4.3, 13.2) 22.7 4

b 2.77 1H dd (11.9, 13.2) 4 3, 4, 21, 2221 103.822 168.123 108.924 156.825 168.226 2.18 3H s 17.3 23, 2427 1.85 3H s 10.4 22, 23, 24

aRecorded at 500 MHz. bRecorded at 125 MHz.

S14

Supplementary Figure 9. 1H NMR (500 MHz) spectrum of 2 in CD3OD.

Supplementary Figure 10. 13C NMR (125 MHz) spectrum of 2 in CD3OD.

S15

Supplementary Figure 11. DQF–COSY (500 MHz) spectrum of 2 in CD3OD.

Supplementary Figure 12. HMQC (500 MHz) spectrum of 2 in CD3OD.

S16

Supplementary Figure 13. HMBC (500 MHz) spectrum of 2 in CD3OD.

Supplementary Figure 14. NOESY (500 MHz) spectrum of 2 in CD3OD.

S17

2.4　Chemical characterization of 6.Supplementary Table 5. NMR data of compound 6 in CDCl3. The molecular formula of 6 was established by mass data [ESI-MS: m/z 413 (M+H)+; HRESIMS: m/z 413.3046 (M+H)+, calcd. for C27H41O3

+, 413.3050, = 0.4 mmu].

position H [ppm], XH, multi., (J [Hz])a C [ppm]b DQF–COSYa HMBCa

1 165.32 100.53 166.14 107.25 156.26 2.20 3H s 17.3 4, 57 1.88 3H s 9.7 3, 4, 51' 3.29 2H d (7.4) 23.4 2' 1, 2, 3, 2', 3'2' 5.32 m 120.5 1'3' 142.14' 2.13 m 39.8 5' 2', 3'5' 2.07 m 25.9 4', 6'6' 5.05 m 123.3 5'7' 136.38' 1.95 m 39.8 9'9' 2.04 m 25.8 8', 10'

10' 5.08 m 124.3 9'11' 135.112' 1.96 m 39.8 11', 13, 14', 20'13' 2.05 m 26.9 12', 14' 11', 12', 14'14' 5.09 m 124.5 13'15' 131.416' 1.68 3H s 25.8 14' 15' 17'17' 1.59 3H s 17.8 14', 15', 16'18' 1.80 3H s 16.5 2', 3', 4'19' 1.61 3H s 16.1 6', 7', 8'20' 1.61 3H s 16.1 10', 11', 12'

aRecorded at 500 MHz. bRecorded at 125 MHz.

S18

Supplementary Figure 15. 1H NMR (500 MHz) spectrum of 6 in CDCl3.

Supplementary Figure 16. 13C NMR (125 MHz) spectrum of 6 in CDCl3.

S19

Supplementary Figure 17. DQF–COSY (500 MHz) spectrum of 6 in CDCl3.

Supplementary Figure 18. HMQC (500 MHz) spectrum of 6 in CDCl3.

S20

Supplementary Figure 19. HMBC (500 MHz) spectrum of 6 in CDCl3.

S21

3. Supplementary References

1 Tsunematsu, Y. et al. Distinct mechanisms for spiro-carbon formation reveal biosynthetic pathway crosstalk. Nat. Chem. Biol. 9, 818–825 (2013).

2 Sato, M. et al. Involvement of lipocalin-like CghA in decalin-forming stereoselective intramolecular [4+2] cycloaddition. ChemBioChem, 16, 2294–2298 (2015).

3 Lee, J. C., Lobkivsky, N, P., Pliam, N. B., Strobel, G. & Clardy, J. Subglutinols A and B: Immunosuppressive compounds from the endophytic fungus Fusarium subglutinans. J. Org. Chem. 60, 7076–7077 (1995).

S22