document

http://immunol.nature.com • august 2000 • volume 1 no 2 • nature immunology

Nicola J. Rogers,Vincenzo Mirenda, Ian Jackson,Anthony Dorling and Robert I. Lechler

Xenogeneic tissues induce vigorous T cell immunity, reflecting the ability of costimulatory moleculesto function across species barriers. We describe a strategy to inhibit costimulation that exploitsspecies differences using the model of porcine pancreatic islet transplantation into mice. Mice wereimmunized with chimeric peptides that contained a known T cell epitope and selected sequences ofthe porcine costimulatory molecule CD86. This resulted in anti-peptide antibody responses thatrecognized intact porcine CD86, blocked costimulation by porcine CD86 but not murine CD86 invitro, and prolonged the survival of porcine islet grafts in vivo. This strategy of inducing endogenousdonor-specific costimulatory blockade has potential clinical applicability.

Department of Immunology, Imperial College of Science,Technology and Medicine, Hammersmith Campus, Du Cane Road, London W12 ONN, UK.Correspondence should be addressed to R.I.L.([email protected]).

Costimulatory blockade by the induction of an endogenous

xenospecific antibody response

163

Pig to human xenotransplantation provides a possible solution to theacute and worsening shortage of donor organs. Enormous progress hasbeen made in recent years due to the creation of pigs transgenic forhuman complement regulatory proteins. This single modificationappears able to prevent hyperacute rejection, and the survival of vascu-larized xenografts in nonhuman primates is now measured in weeksrather than hours1–3. However, there are several immunological barriersthat must be overcome before long-term survival of such grafts can beachieved. One obstacle is the strong T cell immune response evoked byporcine tissues.

The T cell response to xenogeneic tissues involves two distinct path-ways, direct and indirect4, which have been well documented for

allorecognition and allograft rejection. The indirect pathway refers toxenoantigens that are handled in exactly the same way as other proteinantigens. They are taken up, processed and presented by recipient anti-gen presenting cells (APCs) in the form of peptides bound to recipientmajor histocompatibility complex (MHC) molecules. This type of Tcell response does not involve any cross-species interactions in the gen-eration of costimulatory signals. The direct pathway results from CD4and CD8 T cells interacting with the xenogeneic MHC molecules inintact form on the surface of xenogeneic APC. This will only culminatein recipient T cell activation if the relevant interspecies molecular inter-actions occur with adequate efficiency to transduce the appropriate sig-nals. In vitro, both direct and indirect pathways of xenorecognition

induce strong primary proliferative responsesby human T cells against porcine stimulatorcells4–11. Indeed, the direct human anti-porcineT cell response is quantitatively comparable todirect alloresponses between HLA-mis-matched pairs, reflecting productive interac-tions between key accessory molecules acrossthe species barrier and the delivery of costimu-lation by porcine B7 molecules throughCD2812.

Although conventional immunosuppressivedrugs appear to be able to prevent cell-mediat-ed rejection in preclinical models, the doses ofdrugs that are likely required in the long termare unacceptable. Thus for the clinical applica-bility of xenotransplantation, graft-specificstrategies for tolerance or immunosuppressionwould be highly advantageous. Despite all theproblems of discordant xenotransplantation,the use of organs from a disparate species doescreate opportunities for donor-specific

ARTICLES

Figure 1. Sequence and structure of chimeric peptide 6. (a) Position of the B cell epitope of ovalbu-min–porcine CD86 (OVA-pCD86) peptide within the protein sequence of pCD86. The underlined region withbold residues (position 151–162) denotes the OVA-pCD86 peptide sequence derived from pCD86. The othereight underlined regions indicate other putative B cell epitopes tested but later excluded from the study.The ital-ic residues at the amino terminus correspond to the signal sequence, and the italic residues at positions 245–265denote the predicted transmembrane domain. (b) Full sequence of OVA-pCD86 peptide comprising the ovalbu-min T cell epitope, OVA(323–339), synthesized upstream of 12 amino acids derived from the protein sequence ofpCD86(151–162). (c) Comparison of the amino acid sequence of the B cell epitope of OVA-pCD86 peptide withthe murine homolog.

a b

c

© 2000 Nature America Inc. • http://immunol.nature.com©

200

0 N

atu

re A

mer

ica

Inc.

• h

ttp

://im

mu

no

l.nat

ure

.co

m

nature immunology • volume 1 no 2 • august 2000 • http://immunol.nature.com

ARTICLES

164

immunotherapy that allotransplantation does not allow. This arises dueto species-specific differences in key immunostimulatory molecules.

One such molecule is CD86, a major costimulatory molecule in Tcell activation. The crucial role played by costimulatory molecules indetermining the result of T cell receptor (TCR)-CD3 receptor engage-ment with MHC and peptides has been demonstrated extensively bothin vitro and in vivo in the context of both allotransplantation and xeno-transplantation13–20. For example, the use of a B7-binding fusion pro-tein, CTLA4-Ig, to block signaling via CD28-B7 resulted in enhancedgraft survival and the prevention of chronic rejection in a rat cardiacallograft model and a murine aortic allograft model16–18. In these stud-ies, administration of CTLA4-Ig caused partial or complete tolerance tograft antigen. It has also been demonstrated that treatment of allogene-ic pancreatic islet transplant recipients with antibodies to CD80 andCD86 inhibits transplant rejection13.

In the realm of xenotransplantation, Lenschow et al. have demon-strated long-term donor-specific tolerance of human islets transplantedinto mice with concomitant treatment with CTLA4-Ig19. Graft-specifictolerance was demonstrated to be a direct consequence of inhibitingrecognition of B7-expressing APC. Thus, anticostimulatory moleculestrategies aimed at either the receptors or their ligands can be used astherapeutic strategies for altering the immune response.

Previously we and others have shown that pCD86 efficiently cos-timulates human T cells through human CD28, and is therefore anattractive target for immune intervention12. Constitutive expression ofpCD86 by porcine vascular endothelial cells is an additional factor con-tributing to the antigenicity of the graft12 and thus the direct antiporcineT cell response is unlikely to diminish with time, as appears to occurfollowing allotransplantation21,22. In contrast the graft itself will contin-ue to stimulate the direct pathway of T cell activation indefinitely.Conventional approaches to inhibiting the delivery of costimulationinvolve the injection of antibodies or fusion proteins designed to blockthe relevant interactions13,14,18–20.

The strategy we tested here is designed to capitalize on species

differences and to generate an endogenous, donor-specific, costimula-tion-blocking antibody response. If successful this approach wouldavoid the need for a series of post-transplant injections of biologicalreagents. We have employed a chimeric peptide strategy to generateantibodies to pCD86 without priming T cells against porcine antigens.

ResultsDesign of chimeric peptidesNine putative pCD86 B cell epitopes were designed on the basis of anti-genicity and hydrophilicity plots corresponding to sequences predictedto lie on the exposed surface of pCD86 (Fig. 1a). Each peptide incorpo-rated regions of nonidentity between porcine and murine proteinsequences. Mice were immunized with pools of peptides and the antis-era screened for reactivity with individual peptides by ELISA. One ofthe peptides, OVA-pCD86, was selected based on the strength of evoked

Figure 2. Induction of antibodies to peptide.Enzyme-linked immunosorbent assay (ELISA) analysis of anti-peptide in sera from C57BL/6 mice immunized with OVA-pCD86peptide (solid symbols) or control OVA peptide (open symbols).Tripling dilutions of the sera were analyzed by peptide ELISA. (a) Specific binding of antisera to plates coatedwith OVA-pCD86 peptide. (b) Specific binding of antisera to plates coated with pCD86 peptide. (c) Background binding levels to plates coated with OVA control peptide.

a b c

Figure 3. Species-specific recognition of native pCD86 by OVA-pCD86 pep-tide antisera. Chinese hamster ovary (CHO) cells transfected with pCD86 (a,b) ormCD86 (c,d), or the mock-transfected cells (e,f), were stained with sera collectedfrom OVA-pCD86 peptide–immunized mice (thick lines in a,c,e) or OVA controlpeptide–immunized mice (filled histograms in a,c,e).Antibody binding was determinedby two layer staining and assessed by flow cytometry. CTLA4-Ig staining confirmsexpression of CD86 by both transfectants (thick lines in b,d) compared to humanIgG1 control (filled histograms in b,d), but not on untransfected control cells (f).

a b

c d

e f


200

0 N

atu

re A

mer

ica

Inc.

• h

ttp

://im

mu

no

l.nat

ure

.co

m

ARTICLES

http://immunol.nature.com • august 2000 • volume 1 no 2 • nature immunology 165

antibody response. OVA-pCD86 peptide is a 29mer comprising a knownT cell epitope, ovalbumin residues 323–339 (OVA(323–339)) and 12amino acids from pCD86 (Fig. 1b). The OVA-pCD86 peptide sequenceis located in the membrane proximal domain of the CD86 predictedstructure. OVA(323–339) and the pCD86 sequence alone (referred to aspCD86 peptide) were used as control peptides for the separate analysisof T and B cell responses. The pCD86 component of OVA-pCD86 pep-tide shows 50% sequence identity with the murine homolog (Fig. 1c).Of the six amino acid substitutions between the two species, only twoare conservative; serine to threonine at position 152 and arginine tolysine at position 162. The sera from mice immunized with the peptidesthat failed to evoke a strong anti-peptide response served as internal neg-ative control sera.

pCD86 recognized in a species-specific mannerTwo of the three mice injected with OVA-pCD86 peptide gener-ated high titers of specific antibodies to OVA-pCD86 peptide.Although one mouse responded with a very low titer of OVA-pCD86 peptide antibody, all three mice generated OVA-pCD86peptide antibody titers greater than those from OVA-immunizedmice (Fig. 2a,b). Thus mice injected with OVA-pCD86 peptideare capable of generating a specific antibody response to this

peptide, but antibody titers differ between the individual animals.These data are representative of many experiments demonstrating spe-cific antibody responses to OVA-pCD86 peptide. To confirm whichportion of the chimeric peptide was providing the antibody epitope,sera were screened against pCD86 peptide alone. Sera from the OVA-pCD86 peptide mice recognized the pCD86 peptide at a similar titer tothe OVA-pCD86 peptide containing both the T and B cell epitope (Fig.2c). This confirmed that the antibody epitope lay within the pCD86sequence and did not involve the chimeric peptide junction.

To determine whether the antipeptide would recognize the nativemolecule from which the peptide sequence was derived, sera fromimmunized mice were screened against pCD86-expressing transfectantsor the parent cell line. OVA-pCD86 peptide sera (1:25 dilution) clearly

Figure 4. Specific recognition of OVA(323–339) epitope by T cellsfrom OVA-pCD86 peptide–sensitized mice. Purified CD4+ T cells col-lected from four groups of peptide-sensitized mice were tested in vitro fortheir ability to proliferate to (a) whole ovalbumin (b) OVA peptide (c) OVA-pCD86 peptide or (d) pCD86 peptide, in the presence of purified APC.Theantigens were titrated from 1–50 µg/ml. The four groups (three mice pergroup) all received whole OVA (50 µg) emulsified 1:1 in complete Freud’sadjuvant on day 1, and were subsequently injected on days 14, 21 and 28with either nothing (inverted triangles), OVA peptide (triangles), OVA-pCD86 peptide (squares) or pCD86 peptide (diamonds). pCD86 peptide isthe pCD86 sequence alone corresponding to OVA-pCD86 peptide withoutthe T cell epitope. Mice were killed on day 35, 7 days after the last injection.Proliferation was determined after 3 days by incorporation of [3H]thymidineover a 16 h period and scintillation counting. Data points and error bars rep-resent means ± s.e.m for triplicate wells.

a b

c d

Figure 5. Effect of anti-pep-tide on the delivery of cos-timulation by pCD86 andmCD86 as determined by Tcell proliferation. CHO I-Ad

cells were transfected with eitherpCD86 (a–c) or mCD86 (d–f)and tested for their ability to pro-vide costimulation for CD4+ Tcells purified from DO.11.10 Tcell receptor transgenic mice(restricted for OVA(323–339) inthe context of H-2Ad), in thepresence of anti–H-2Ad (a,d),CTLA4-Ig (b,e) or OVA-pCD86peptide antisera (c,f). The pres-ence of antibodies against H-2Ad

(open inverted triangles) andCD86 (open diamonds) clearlyinhibited T cell proliferation whencostimulation was provided byeither stimulator population, ascompared to medium alone (filledsquares) or isotype controls (filledinverted triangles) and (filled dia-monds), respectively.The presenceof sera from immunized mice(open circles) clearly inhibited T cell proliferation compared to OVA peptide control (filled circles) when costimulation was provided by pCD86 (c), but not mCD86 (f).Proliferation was determined after 2 days by incorporation of [3H]thymidine over a 16 h period and scintillation counting. Errors bars represent s.e.m. for triplicate wells.

a b c

d e f


200

0 N

atu

re A

mer

ica

Inc.

• h

ttp

://im

mu

no

l.nat

ure

.co

m


ARTICLES

166

detected pCD86 on the cell surface (Fig. 3a) at a level comparable tothat detected by 1 µg/ml of murine CTLA4-Ig (Fig. 3b). Sera failed tobind to the untransfected parent cell line (Fig. 3e). To further test thespecies-specificity of the sera, murine CD86 (mCD86) transfectantswere screened using the same protocol. Although surface expression ofmCD86 was detected by murine CTLA4-Ig (Fig. 3d), OVA-pCD86 pep-tide antisera did not recognize native mCD86 (Fig. 1c), clearly demon-strating the species specificity of the sera. In all circumstances, controlOVA peptide antisera or human IgG1 gave negative results.

T cell response is OVA(323–339)-specificOVA-pCD86 peptide is a chimeric peptide containing a known T cellepitope and a predicted B cell epitope derived from pCD86. For the suc-cess of our immunization strategy it was imperative that mouse T cellresponses were generated against the ovalbumin sequence alone and nottowards the native pCD86 molecule. T cell responses directed againstpCD86 would have been detrimental, accelerating graft rejection.

To confirm T cell sensitization against the OVA peptide, and toexclude sensitization against the pCD86 sequence, proliferation assayswere done with T cells from mice primed with ovalbumin and boostedwith OVA-pCD86 peptide or a variety of controls: OVA(323–339),pCD86 or ovalbumin alone. T cells were rechallenged in vitro with thedifferent antigens. Maximal T cell proliferation was detected in miceboosted with either the OVA peptide or OVA-pCD86 peptide whenrechallenged with either ovalbumin, OVA peptide or OVA-pCD86 pep-tide (Fig. 4a–c). In addition, mice primed with ovalbumin and boostedwith pCD86 alone, failed to mount an antibody response in the absenceof T cell help (data not shown). Proliferative responses by T cells frompCD86 peptide-boosted mice were no different from those of mice thatreceived no boosting after the initial priming with ovalbumin. Mostimportantly no proliferation was seen from any of the mice in responseto the pCD86 peptide. These data clearly demonstrate that T cellresponses in the immunized mice are directed towards the OVA epitope(Fig. 4a–c).

Antisera specifically inhibit pCD86 costimulationT cell proliferation assays were performed to determine whether OVA-pCD86 peptide antiserum was able to block CD86-mediated costimu-lation in vitro. Purified CD4 T cells from DO.11.10 TCR transgenic

mice were used as responder cells. DO.11.10 T cells are spe-cific for OVA(323–339) peptide in the context of H-2Ad.CHO H-2Ad transfectants, supertransfected with cDNAsencoding either pCD86 or mCD86, were used as the stimu-lator population. Comparable levels of CD86 and H-2Ad

were expressed on the two transfected cell lines, as determined by flowcytometric analysis (data not shown).

As illustrated in Fig. 5a, pCD86 appeared to costimulate primaryresponses by D0.11.10 T cells with comparable efficiency to its murinecounterpart. The proliferative responses to both stimulator populationswere inhibited to comparable extents by the presence of either anti-MHC class II or murine CTLA4-Ig (Fig. 5a–d), further suggesting func-tional similarity between the two species of CD86. However, the OVA-pCD86 peptide antisera had markedly different effects when costimula-tion was provided by mCD86 or pCD86. At a 1:50 dilution the anti-serum was as efficient as CTLA4-Ig in inhibiting T cell proliferationsupported by pCD86. In contrast, the antiserum caused no inhibitionwhen the APC expressed mCD86, indicating precise species specificity.

Antibody to pCD86 prolongs pancreatic islet survivalTransplantation of porcine islets into C57BL/6 mice is a well estab-lished model for studying T cell mediated xenograft rejection. Theimmunogenicity of the porcine islets is enhanced by contamination ofthe islet clusters with passenger leucocytes and endothelial cells thatare CD86 positive23,24,25.

To determine whether antibodies generated by immunization withOVA-pCD86 peptide were capable of inhibiting costimulatory interac-tions in vivo, a porcine islet transplant model was used. Mice that hadpreviously undergone the peptide immunization protocol were rendereddiabetic by streptozotocin induction on day 35. Four days later, 1000pancreatic islets were transplanted under the kidney capsule of all micewith a blood glucose reading of 20 mM/l or above.

Our previous analysis of the antibody titers in OVA-pCD86 pep-tide–immunized mice revealed mouse-to-mouse variation (Fig. 2a). Wetherefore measured the antibody levels in the sera of the transplantedmice at the time of death. A range of antibody titers was detected (Fig.6a) which correlated directly with graft survival time (Fig. 6b).

Having demonstrated a clear correlation between antibody titer andgraft survival time, the islet-grafted mice were divided into two groups,according to the strength of their antibody response. High responders(OD >0.5 at sera dilution 1:150, Fig. 6a, n = 4) and low responders (OD< 0.5 at sera dilution 1:150, Fig. 6a, n = 4). Survival curves for the highresponders (Fig. 6c) compared to OVA peptide controls illustrate sig-nificant (P = 0.0121 as determined by Mann Whitney nonparametric

Figure 6. OVA-pCD86 peptide immunization prolongs the sur-vival of transplanted porcine pancreatic islets. (a) ELISA analysisof OVA-pCD86 peptide antibodies in the sera of the eight individualislet-transplanted mice.Tripling dilutions of sera were analyzed by pep-tide ELISA for binding to OVA-pCD86 peptide. Data points are meansof duplicate wells and have been corrected for background binding toOVA peptide.Antibody titers are represented in relation to graft survivaltime.A broad range of antibody titers are demonstrated. (b) Correlationbetween antibody titer (sera dilution 1:150) and graft survival time (P = 0.003). (c, d) Survival of porcine islet xenografts in streptozotocin-induced diabetic mice. (c) Mice demonstrating a high titer of antipeptidein their sera (n = 4, OD >0.5) (d) mice demonstrating a low titer of anti-peptide in their sera (n = 4, OD <0.5) or control OVA peptide–injectedmice (n = 7). Both groups of mice were rendered diabetic on day −4 and1000 islets were transplanted per mouse on day 1. The two groups ofmice are as follows: OVA peptide–immunized mice (squares), OVA-pCD86 peptide–immunized mice (triangles).

a b

c d


200

0 N

atu

re A

mer

ica

Inc.

• h

ttp

://im

mu

no

l.nat

ure

.co

m

ARTICLES

http://immunol.nature.com • august 2000 • volume 1 no 2 • nature immunology 167

statistical analysis) prolongation of islet graft survival in OVA-pCD86peptide–immunized mice, median survival time 29 days (range 20–47days) compared to OVA peptide controls median survival time 12 days(range 11–21 days). In contrast, survival curves for the low responders(Fig. 6d) compared to OVA controls show no significant difference.

Another experiment was performed to exclude the possibility that thehigher antibody titers in the mice were secondary to, rather thancausative of, the longer survival. A group of mice were immunized witha suboptimal concentration of OVA-pCD86 peptide (50 µg instead of100 µg). Sera were collected immediately before transplantation andagain after mice were killed following graft rejection. Suboptimal lev-els of OVA-pCD86 peptide failed to prolong graft survival and anti-body titers were of comparable levels pre- and post-transplantation(data not shown). Peptide ELISA analysis of sera from transplantedmice previously immunized with OVA peptide alone failed to recognizepeptide 6 in vitro, thus, the islet graft itself did not induce or amplifyanti–OVA-pCD86 peptide responses (data not shown). Furthermoresera from post-transplant recipients screened by cell ELISA on pCD86-or mCD86-transfectants only stained the pCD86-expressing cells, con-firming the continued specificity of our sera post-transplantation (datanot shown).

DiscussionThe results presented here demonstrate that an endogenous costimu-lation-blocking antibody response can be induced by peptide immu-nization, that this antibody response was xenospecific, and that it ledto the prolongation of survival of porcine pancreatic islet xenograftsin immunized mice. Parallel in vitro studies demonstrated the abilityof the peptide-induced antisera to inhibit direct pathway mouse anti-pig T cell xenoresponses when costimulation was provided byporcine, but not murine, CD86.

The significant prolongation of porcine islet graft survival in theimmunized mice was surprising for two reasons. First, the antibodyresponse was only generated against a sequence in pCD86, therebyleaving other costimulatory molecules free to interact with murine lig-ands. No data exists concerning the interaction between porcine CD80and murine CD28 so it is possible that this interaction is inefficient ornonexistent. The other obvious limitation of this strategy is that it wasonly capable of inhibiting direct mouse anti-pig T cell responses, trig-gered by recognition of intact porcine MHC molecules on the surfaceof costimulation-positive porcine cells. Based on other species combi-nations, including human anti-pig, the indirect mouse anti-pig T cellxenoresponse is probably vigorous. Studies from our group havedemonstrated both direct and indirect responses of murine T cellsagainst porcine stimulators in vitro with comparable levels of respon-siveness (data not shown). It is likely therefore that islet graft failurein these experiments was mediated by an unfettered indirect T cellresponse. In this study we have not examined the fate of T cells withdirect anti-pig specificity. It is attractive to imagine that xenorecogni-tion in the presence of costimulatory blockade may have inducedxenospecific nonresponsiveness, as has been observed in other exper-imental settings.

Transplantation of nonvascularized tissues lends itself to theapproach described here, in that the parenchyma of the graft itself is nota target of the induced antibodies. Whether or not the same approachcould be used in recipients of vascularized porcine xenografts is a mat-ter of conjecture. It is well established that porcine vascular endothelialcells expressed B7 family molecules12. As a consequence, an inducedanti-pB7 response would add to the burden of preformed antibodies topig depositing on porcine vascular endothelium immediately following

transplantation. However, based on the impressive results obtainedwith high level expression of complement regulatory proteins, such asdecay accelerating factor (DAF)1–3, it may well be that the deleteriouseffects of antibodies to pB7 could be adequately regulated in organsfrom DAF-transgenic pigs.

It can be further predicted that the antibody response will be sus-tained by the graft for as long as the target antigen is expressed. Thisprediction was fulfilled in another study aimed at achieving contra-ception by vaccination in which mice were immunized with peptidesincorporating sequences of mouse GNRH (gonadotrophin-releasinghormone) and a T cell epitope. Peptide immunization succeeded inbreaking self-tolerance so that the mice made antibodies to GNRH.The antibody response was sustained indefinitely, presumably by thepresence of endogenous GNRH in the recipient mice26. This is ananticipated benefit of the use of this strategy in the context of xeno-transplantation.

The approach described and tested here shows how the species dif-ferences that are integral to xenotransplantation can be exploited forits benefit. Clearly this approach could be extended to include otherdonor-specific molecules that may contribute to recipient T cell acti-vation. Obvious candidates include CD80 and CD40. The potentialclinical utility of this strategy will require experiments to be carriedout in a preclinical model.

MethodsAntibodies and reagents. Unless otherwise stated, all reagents were purchased fromSigma. The following fusion proteins and monoclonal antibodies were used in T cell pro-liferation assays: murine CTLA4-Ig and human CTLA4-Ig (both from R&D Systems), andanti–H-2Ad (M5/114) were used at saturating concentrations of 10 µg/ml. Human IgG (TheBinding Site, Birmingham, England) and rat IgG (Serotec, Raleigh, NC) were used as con-trols. Biotinylated sheep anti-mouse IgG and streptavidin-HRP (both from Zymed, SanDiego) were used for peptide ELISA studies and fluorescein isothiocyanate (FITC)-strepta-vidin (DAKO, Carpinteria, CA) for flow cytometric analysis. Human CTLA4-Ig followedby anti-human IgG-biotin and FITC-streptavidin was used to detect surface fluorescence ofpCD86 and mCD86 on cell transfectants.

Chimeric peptides and OVA(323–339) were generated on a peptide synthesizer(Genosys, Cambridge, England) and purified by HPLC to greater than 70% purity.Lyophilized peptides were reconstituted in sterile water and used at 1 µg/ml diluted in PBSbuffer for immunizations, and 10 µg/ml for coating wells in the peptide ELISA. OVA (albu-min, chicken egg, Grade VII) was resuspended in sterile water and diluted 1:1 in CFA forimmunizations.

Generation of pCD86 cell transfectants. RNA was extracted from a transformed porcineendothelial cell line, A8, using TRI-reagent (Sigma). mRNA was then reverse transcribedand pCD86 amplified from the cDNA by 35 cycles of PCR at 56 °C with 1.5 mM magne-sium. The 5′ and 3′ primers GCATGGATCCATGGGACTGAGTAACATTCTCTTTG andGCATGTCGACTTAAAAATCTGTAGTACTGTTGTC, respectively, were designed on thebasis of the published pCD86 sequence12 to overlie the start and stop codons. A 956-bp frag-ment was generated and subcloned into the eukaryotic expression vector pci.neo(Invitrogen, Carlsbad, CA). Stable CHO H-2Ad transfectants were generated using the stan-dard calcium phosphate precipitation27. Clones were selected using dynabead purificationand limiting dilution.

Cell culture. The CHO cell transfectants (CHO H-2Ad (ref. 28), CHO H-2AdmCD86 (ref.28) and CHO H-2AdpCD86) were maintained at 37 °C, 5% CO2 in RPMI-1640 supple-mented with 10% fetal calf serum, 100 µg/ml penicillin, 100 U/ml streptomycin and 2 mML-glutamine. Medium was changed every third day. Once confluent, cells were detached forsubculture by treatment with 0.5% trypsin, 0.5% EDTA.

Peptide ELISA. This was carried out according to a method described previously29. 96-wellpolystyrene microtiter plates (Maxisorb, Nunc, Copenhagen) were coated with 50 µg/mlpoly-l-lysine diluted in PBS buffer for 45 min at 37 °C, followed by 0.5% (v/v) glutaralde-hyde for 15 min at 37 °C. Plates were washed with PBS buffer, then 10 µg/ml peptide wasadded for 1 h at 37 °C. Unreacted aldehyde groups were then blocked by the addition of 1M glycine (pH 7.2) for 30 min at 37 °C. Nonspecific binding sites were blocked with 2%bovine serum albumin (BSA) (w/v) in PBS buffer for 1 h at 37 °C. The plates were washedthree times with PBS buffer, serum was then added (dilution range 1:150–4050) in PBSbuffer containing 0.1% BSA for 1 h at 37 °C. Biotinylated sheep anti-mouse IgG (1:8000)was then allowed to bind for 1 h at 37 °C, followed by the addition of HRP-conjugatedstreptavidin (1:4000) . The plate was developed with TMB substrate (CambridgeBioscience) and the reaction stopped by the addition of 1 M H2SO4. The absorbance was


200

0 N

atu

re A

mer

ica

Inc.

• h

ttp

://im

mu

no

l.nat

ure

.co

m


ARTICLES

168

measured at 450 nm using a microtiter plate reader. The ELISA wells were washed exten-sively with PBS buffer containing 0.05% Tween-20 after each step.

Flow cytometric analysis. To examine the expression of surface antigens, CHO cells trans-fected with pCD86, mCD86 or mock-transfectants (2.5 × 105) were incubated with 1:50 dilu-tion of the appropriate sera for 30 min on ice. Bound sera was detected by incubation withsheep anti-mouse IgG-biotin (1:500), 30 min on ice, followed by FITC-streptavidin, 30 minon ice. Cells were washed twice with ice cold FACs buffer (PBS buffer, 1% fetal calf serum,0.05% sodium azide) after each step. Cells were fixed with 1 % paraformaldehyde in PBSbuffer and subsequently analyzed on a FACSCalibur flow cytometer (Becton Dickinson, SanJose). Dead cells and debris were excluded by forward and side scatter gating.

T cell proliferation assays. T cells were purified from the lymph nodes and spleens ofDO.11.10 transgenic mice or C57BL/6 mice by 50% lymphosep density gradient centrifu-gation, 1250g for 20 min (Harlan, Sera-Lab, Leicestershire, England) and complementmediated lysis using anti–MHC class II (M5/114) antibody and rabbit complement(Cedarlane Laboratories, Hornby, Canada). To establish the specific recognition ofOVA(323–339) by T cells from peptide-sensitized mice, 2 × 105 T cells and 2 × 105 APCsfrom C57BL/6 mice were then cultured for 3 days in the presence of various antigens. Theantigens were titrated from 0–50 µg/ml. To assess the effects of the anti-peptide sera on thedelivery of costimulation, 2 × 104 DO.11.10 T cells were cultured for 48 h with CHO H-2Ad

stimulator cells transfected with either pCD86 or mCD86, in the presence of OVA(323-339)peptide over a 10–1000 ng/ml range. Anti-peptide serum was added at a final dilution of1:50. T cell proliferation was measured after 48 h by the incorporation of tritiated thymidineover a 16 h period. Data shown are representative of at least three independent experimentswith similar results.

In vivo immunization protocol. For peptide injections, 6- to 8-week-old C57BL/6 micewere injected subcutaneously with whole OVA (50 µg) emulsified 1:1 in CFA. Mice thenreceived 100 µg of OVA-pCD86 peptide or OVA(323–339) intravenously on days 14, 21and 28. On day 35 mice were either killed and their lymph nodes, spleen and blood col-lected, or they were rendered diabetic by intraperitoneal injection of 250 mg/kg streptozo-tocin before transplantation of 1000 islets on day 39.

Isolation and transplantation of porcine pancreatic islets. Pancreatic islets wereobtained from adult female large white pigs weighing 200–250 kg. Islets were isolated andpurified according to published protocols30. Islets were prepared by intraductal injection ofcollagenase solution (Type V, 2 mg/ml) and digestion at 37 °C. Islets were then purified bycentrifugation of the digested tissue over a discontinuous Euro-ficoll gradient. Purity of thefinal preparation was confirmed by dithisone staining and was always greater than 90%.Isolated islets were cultured overnight at 30 °C in 95% air and 5% CO2 in Medium199 sup-plemented as described. After overnight culture, 1000 handpicked islets were transplantedunder the kidney capsule of streptozotocin-treated C57BL/6 mice. Animals were considereddiabetic when their blood glucose was greater than 20 mM/l. The function of transplantedislets was assessed by biweekly measurements of blood glucose levels. Islets were consid-ered rejected following two consecutive blood glucose readings of 20 mM/l or above.

All in vivo experiments were performed in compliance with the relevant laws and insti-tutional guidelines.

Acknowledgements

We thank G.Taylor for assistance in the selection and design of the chimeric peptides,A.Chaudry for help with statistical analysis, H. Reiser for the donation of CHO transfectants,and H. Stauss and A. George for reading the manuscript. Supported by ML laboratories, St.Albans, Hertfordshire; additional funding was provided by PPL Laboratories, Scotland.

Received 12 April 2000; accepted 5 July 2000.

1. Waterworth, P.D. et al. Life-supporting pig-to-baboon heart xenotransplantation. J. Heart Lung Transpl.17, 1201–1207 (1998).

2. Zaidi,A. et al. Life-supporting pig-to-primate renal xenotransplantation using genetically modifieddonors. Transplantation 65, 1584–1590 (1998).

3. Schmoeckel, M. et al. Orthotopic heart transplantation in a transgenic pig-to-primate model.Transplantation 65, 1570–1577 (1998).

4. Dorling,A. & Lechler, R. I. in The passenger leucocyte, dendritic call and antigen-presenting cells (APC) (edsTilney, N. L., Strom,T.B. & Paul, L.C.) (Lippincott-Raven, Philadelphia, 1996).

5. Dorling,A., Lombardi, G., Binns, R. & Lechler, R. I. Detection of primary direct and indirect humananti-porcine T cell responses using a porcine dendritic cell population. Eur. J. Immunol. 26, 1378–1387(1996).

6. Dorling,A., Binns, R. & Lechler, R.I. Cellular Xenoresponses: Observation of significant primary indi-rect human T cell anti-pig xenoresponses using co-stimulator-deficient or SLA class II-negativeporcine stimulators. Xenotransplantation 3, 112–119 (1996).

7. Kumagai-Braesch, M., Johansson Borg,A., Satake, M. & Moller, E. Characteristics of direct and indirectactivation of human T cells against allogeneic and porcine xenogeneic cells/peptides.Xenotransplantation 4, 85–94 (1997).

8. Kirk,A.D., Hall, B.L., Finn, O.J. & Bollinger, R.R. In vitro analysis of the human antiporcine T-cell reper-toire. Transpl. Proc. 24, 602–603 (1992).

9. Yamada, K., Sach, D.H. & DerSimonian, H. Human anti-porcine xenogeneic T cell response. Evidencefor allelic specificity of mixed leukocyte reaction and for both direct and indirect pathways of recog-nition. J. Immunol. 155, 5249–5256 (1995).

10. Satake, M., Kawagishii, N. & Moller, E. Direct activation of human responder T cells by porcine stimu-lator cells leads to T cell proliferation and cytotoxic T cell development. Xenotransplantation 3,198–206 (1996).

11. Kirk,A.D. et al. The human antiporcine cellular repertoire. In vitro studies of acquired and innate cel-lular responsiveness. Transplantation 55, 924–931 (1993).

12. Maher, S.E. et al. Porcine endothelial CD86 is a major costimulator of xenogeneic human T cells:cloning, sequencing, and functional expression in human endothelial cells. J. Immunol. 157, 3838–3844(1996).

13. Lenschow, D.J. et al. Inhibition of transplant rejection following treatment with anti-B7-2 and anti-B7-1 antibodies. Transplantation 60, 1171–1178 (1995).

14. Sun, H. et al. Prevention of chronic rejection in mouse aortic allografts by combined treatment withCTLA4-Ig and anti-CD40 ligand monoclonal antibody. Transplantation 64, 1838–1843 (1997).

15. Larsen, C.P. et al. Long-term acceptance of skin and cardiac allografts after blocking CD40 andCD28 pathways. Nature 381, 434–438 (1996).

16. Baliga, P. et al. CTLA4Ig prolongs allograft survival while suppressing cell-mediated immunity.Transplantation 58, 1082–1090 (1994).

17. Turka, L.A. et al. T-cell activation by the CD28 ligand B7 is required for cardiac allograft rejection invivo. Proc. Natl Acad. Sci. USA 89, 11102–11105 (1992).

18. Lin, H. et al. Long-term acceptance of major histocompatibility complex mismatched cardiac allo-grafts induced by CTLA4Ig plus donor-specific transfusion. J. Exp. Med. 178, 1801–1806 (1993).

19. Lenschow, D.J. et al. Long-term survival of xenogeneic pancreatic islet grafts induced by CTLA4lg.Science 257, 789–792 (1992).

20. Lu, L. et al. Blockade of the CD40-CD40 ligand pathway potentiates the capacity of donor-deriveddendritic cell progenitors to induce long-term cardiac allograft survival. Transplantation 64,1808–1815 (1997).

21. Hornick, P.I. et al. Assessment of the contribution that direct allorecognition makes to the progres-sion of chronic cardiac transplant rejection in humans. Circulation 97, 1257–1263 (1998).

22. Mason, P.D., Robinson, C.M. & Lechler, R.I. Detection of donor-specific hyporesponsiveness followinglate failure of human renal allografts. Kidney Int. 50, 1019–1025 (1996).

23. Mirenda,V. et al. Intact pancreatic islet function despite humoral xenorecognition in the pig to mon-key combination. Transplantation 66, 1485–1495 (1998).

24. Simeonovic, C.J., Bowen, K.M., Kotlarski, I. & Lafferty, K.J. Modulation of tissue immunogenicity byorgan culture. Transplantation 30, 175–179 (1980).

25. Faustman, D.L. et al. Prevention of rejection of murine islet allografts by pre-treatment with anti-dendritic cell antibody. Proc. Natl Acad. Sci. USA 81, 3864–3868 (1984).

26. Sad, S.,Talwar, G.P. & Raghupathy, R. Influence of the genetic background and carrier protein on theantibody response to GnRH. J. Rep. Immunol. 19, 197 (1991).

27. Graham, F.L. & Van der Eb,A.J.A new technique for the assay of infectivity of human adenovirus 5DNA. Virology 52, 456 (1973).

28. Galvin, F. et al. Murine B7 antigen provides a sufficient costimulatory signal for antigen-specific andMHC-restricted T cell activation. J. Immunol. 149, 3802–3808 (1992).

29. Ball, J.M., Henry, N.L., Montelaro, R.C. and Newman, M.J.A versatile synthetic peptide-based ELISAfor identifying antibody epitopes. J. Immunol. Meth. 171, 37–44 (1994).

30. Ricordi, C., Socci, C. & Davalli,A.M. Isolation of elusive pig islets. Surgery 107, 688–694 (1990).


200

0 N

atu

re A

mer

ica

Inc.

• h

ttp

://im

mu

no

l.nat

ure

.co

m

document

Documents