World Journal of Gastroenterology

World Journal of G

astroenterology ww

w.w

jgnet.com Volum

e 17 Num

ber 04 Jan 28 2011

Volume 17 Number 4January 28, 2011

ISSN 1007-9327 CN 14-1219/R Local Post Offices Code No. 82-261

Published by Baishideng Publishing Group Co., Limited,Room 1701, 17/F, Henan Building,

No. 90 Jaffe Road, Wanchai, Hong Kong, ChinaFax: +852-3115-8812

Telephone: +852-5804-2046E-mail: baishideng@wjgnet.com

http://www.wjgnet.com

World Journal of GastroenterologyWorld J Gastroenterol 2011 January 28; 17(4): 409-544

ISSN 1007-9327 (print)ISSN 2219-2840 (online)

www.wjgnet.com

I S S N 1 0 0 7 - 9 3 2 7

9 7 7 1 0 07 9 3 2 0 45

0 4

The World Journal of Gastroenterology Editorial Board consists of 1144 members, representing a team of worldwide experts in gastroenterology and hepatology. They are from 60 countries, including Albania (1), Argentina (8), Australia (29), Austria (14), Belgium (12), Brazil (10), Brunei Darussalam (1), Bulgaria (2), Canada (20), Chile (3), China (69), Colombia (1), Croatia (2), Cuba (1), Czech (4), Denmark (8), Ecuador (1), Egypt (2), Estonia (2), Finland (8), France (24), Germany (75), Greece (14), Hungary (10), India (26), Iran (6), Ireland (7), Israel (12), Italy (101), Japan (112), Jordan (1), Kuwait (1), Lebanon (3), Lithuania (2), Malaysia (1), Mexico (10), Moldova (1), Netherlands (29), New Zealand (2), Norway (11), Pakistan (2), Poland (11), Portugal (4), Romania (3), Russia (1), Saudi Arabia (3), Serbia (3), Singapore (10), South Africa (2), South Korea (32), Spain (38), Sweden (18), Switzerland (11), Thailand (1), Trinidad and Tobago (1), Turkey (24), United Arab Emirates (2), United Kingdom (82), United States (249), and Uruguay (1).

Editorial Board2010-2013

HONORARY EDITORS-IN-CHIEFJames L Boyer, New HavenKe-Ji Chen, BeijingMartin H Floch, New HavenEmmet B Keeffe, Palo AltoGeng-Tao Liu, BeijingLein-Ray Mo, TainanEamonn M Quigley, CorkRafiq A Sheikh, SacramentoNicholas J Talley, RochesterMing-Lung Yu, Kaohsiung

PRESIDENT AND EDITOR-IN-CHIEFLian-Sheng Ma, Beijing

ACADEMIC EDITOR-IN-CHIEFTauseef Ali, Oklahoma CityMauro Bortolotti, BolognaTarkan Karakan, AnkaraWeekitt Kittisupamongkol, BangkokAnastasios Koulaouzidis, EdinburghBo-Rong Pan, Xi’anSylvia LF Pender, SouthamptonMax S Petrov, AucklandGeorge Y Wu, Farmington

STRATEGY ASSOCIATE EDITORS-IN-CHIEFPeter Draganov, FloridaHugh J Freeman, VancouverMaria C Gutiérrez-Ruiz, MexicoKazuhiro Hanazaki, KochiAkio Inui, KagoshimaKalpesh Jani, BarodaJavier S Martin, Punta del Este

Natalia A Osna, OmahaWei Tang, TokyoAlan BR Thomson, EdmontonHarry HX Xia, HanoverJesus K Yamamoto-Furusho, MexicoYoshio Yamaoka, Houston

ASSOCIATE EDITORS-IN-CHIEFYou-Yong Lu, BeijingJohn M Luk, SingaporeHiroshi Shimada, Yokohama

GUEST EDITORIAL BOARD MEMBERSChien-Jen Chen, TaipeiYang-Yuan Chen, ChanghuaJen-Hwey Chiu, TaipeiSeng-Kee Chuah, KaohsiungWan-Long Chuang, KaohsiunMing-Chih Hou, TaipeiKevin Cheng-Wen Hsiao, TaipeiPo-Shiuan Hsieh, TaipeiTsung-Hui Hu, KaohsiungWen-Hsin Huang, TaichungChao-Hung Hung, KaohsiungI-Rue Lai, TaipeiTeng-Yu Lee, TaichungChing Chung Lin, TaipeiHui-Kang Liu, TaipeiHon-Yi Shi, KaohsiungChih-Chi Wang, KaohsiungJin-Town Wang, TaipeiCheng-Shyong Wu, Chia-YiJaw-Ching Wu, TaipeiJiunn-Jong Wu, TainanMing-Shiang Wu, Taipei

Ta-Sen Yeh, TaoyuanHsu-Heng Yen, ChanghuaMing-Whei Yu, Taipei

MEMBERS OF THE EDITORIAL BOARD

Albania

Bashkim Resuli, Tirana

Argentina

Julio H Carri, CórdobaEduardo de Santibañes, Buenos AiresBernardo Frider, Buenos AiresCarlos J Pirola, Buenos AiresBernabe Matias Quesada, Buenos AiresSilvia Sookoian, Buenos AiresAdriana M Torres, RosarioMaria Ines Vaccaro, Buenos Aires

Australia

Leon Anton Adams, NedlandsRichard Anderson, VictoriaMinoti V Apte, New South WalesAndrew V Biankin, SydneyFilip Braet, SydneyChristopher Christophi, MelbournePhilip G Dinning, KoagarahGuy D Eslick, SydneyMichael A Fink, Melbourne

January 7, 2011IWJG|www.wjgnet.com

Robert JL Fraser, Daw ParkJacob George, WestmeadMark D Gorrell, SydneyAlexander G Heriot, MelbourneMichael Horowitz, AdelaideJohn E Kellow, SydneyWilliam Kemp, MelbourneFinlay A Macrae, VictoriaDaniel Markovich, BrisbaneVance Matthews, MelbournePhillip S Oates, PerthShan Rajendra, TasmaniaRajvinder Singh, Elizabeth ValeRoss C Smith, SydneyKevin J Spring, BrisbaneNathan Subramaniam, BrisbanePhil Sutton, MelbourneCuong D Tran, North AdelaideDebbie Trinder, FremantleDavid Ian Watson, Bedford Park

Austria

Herwig R Cerwenka, GrazAshraf Dahaba, GrazPeter Ferenci, ViennaValentin Fuhrmann, ViennaAlfred Gangl, ViennaAlexander M Hirschl, WienKurt Lenz, LinzDietmar Öfner, SalzburgMarkus Peck-Radosavljevic, ViennaMarkus Raderer, ViennaStefan Riss, ViennaGeorg Roth, ViennaMichael Trauner, GrazThomas Wild, Kapellerfeld

Belgium

Rudi Beyaert, GentBenedicte Y De Winter, AntwerpInge I Depoortere, LeuvenOlivier Detry, LiègePhilip Meuleman, GhentMarc Peeters, De PintelaanFreddy Penninckx, LeuvenJean-Yves L Reginster, LiègeMark De Ridder, BrusselsEtienne M Sokal, BrusselsKristin Verbeke, LeuvenEddie Wisse, Keerbergen

Brazil

José LF Caboclo, São José do Rio PretoRoberto J Carvalho-Filho, São PauloJaime Natan Eisig, São PauloAndre Castro Lyra, SalvadorMarcelo Lima Ribeiro, Braganca Paulista Joao Batista Teixeira Rocha, Santa MariaHeitor Rosa, GoianiaDamiao C Moraes Santos, Rio de JaneiroAna Cristina Simões e Silva, Belo HorizonteEduardo Garcia Vilela, Belo Horizonte

Brunei Darussalam

Vui Heng Chong, Bandar Seri Begawan

Bulgaria

Zahariy Krastev, SofiaMihaela Petrova, Sofia

Canada

Alain Bitton, MontrealMichael F Byrne, VancouverKris Chadee, CalgaryWangxue Chen, OttawaRam Prakash Galwa, OttawaPhilip H Gordon, MontrealWaliul Khan, OntarioQiang Liu, SaskatoonJohn K Marshall, OntarioAndrew L Mason, AlbertaKostas Pantopoulos, QuebecNathalie Perreault, SherbrookeBaljinder Singh Salh, VancouverEldon Shaffer, CalgaryMartin Storr, CalgaryPingchang Yang, HamiltonEric M Yoshida, VancouverClaudia Zwingmann, Montreal

Chile

Marcelo A Beltran, La SerenaXabier De Aretxabala, SantiagoSilvana Zanlungo, Santiago

China

Hui-Jie Bian, Xi’anSan-Jun Cai, ShanghaiGuang-Wen Cao, ShanghaiXiao-Ping Chen, WuhanChi-Hin Cho, Hong KongZong-Jie Cui, Beijing Jing-Yuan Fang, ShanghaiDe-Liang Fu, ShanghaiZe-Guang Han, ShanghaiChun-Yi Hao, BeijingMing-Liang He, Hong KongChing-Lung Lai, Hong KongSimon Law, Hong KongYuk-Tong Lee, Hong KongEn-Min Li, ShantouFei Li, BeijingYu-Yuan Li, GuangzhouZhao-Shen Li, ShanghaiXing-Hua Lu, BeijingYi-Min Mao, ShanghaiQin Su, BeijingPaul Kwong-Hang Tam, Hong KongYuk Him Tam, Hong KongRen-Xiang Tan, NanjingWei-Dong Tong, ChongqingEric WC Tse, Hong Kong

Fu-Sheng Wang, BeijingXiang-Dong Wang, ShanghaiNathalie Wong, Hong KongJustin CY Wu, Hong KongWen-Rong Xu, ZhenjiangAn-Gang Yang, Xi’an Wei-Cheng You, BeijingChun-Qing Zhang, JinanJian-Zhong Zhang, Beijing Xiao-Peng Zhang, BeijingXuan Zhang, Beijing

Colombia

Germán Campuzano-Maya, Medellín

Croatia

Tamara Cacev, ZagrebMarko Duvnjak, Zagreb

Cuba

Damian C Rodriguez, Havana

Czech

Jan Bures, Hradec KraloveMilan Jirsa, PrahaMarcela Kopacova, Hradec KralovePavel Trunečka, Prague

Denmark

Leif Percival Andersen, CopenhagenAsbjørn M Drewes, AalborgMorten Frisch, CopenhagenJan Mollenhauer, OdenseMorten Hylander Møller, HolteSøren Rafaelsen, VejleJorgen Rask-Madsen, SkodsborgPeer Wille-Jørgensen, Copenhagen

Ecuador

Fernando E Sempértegui, Quito

Egypt

Zeinab Nabil Ahmed, CairoHussein M Atta, El-Minia

Estonia

Riina Salupere, TartuTamara Vorobjova, Tartu

Finland

Saila Kauhanen, Turku

January 7, 2011IIWJG|www.wjgnet.com

Thomas Kietzmann, OuluKaija-Leena Kolho, HelsinkiJukka-Pekka Mecklin, JyvaskylaMinna Nyström, HelsinkiPauli Antero Puolakkainen, TurkuJuhani Sand, TampereLea Veijola, Helsinki

France

Claire Bonithon-Kopp, DijonLionel Bueno, ToulouseSabine Colnot, ParisCatherine Daniel, Lille CedexAlexis Desmoulière, LimogesThabut Dominique, ParisFrancoise L Fabiani, AngersJean-Luc Faucheron, GrenobleJean Paul Galmiche, Nantes cedexBoris Guiu, DijonPaul Hofman, NiceLaurent Huwart, ParisJuan Iovanna, MarseilleAbdel-Majid Khatib, ParisPhilippe Lehours, BordeauxFlavio Maina, MarseillePatrick Marcellin, ParisRene Gerolami Santandera, MarseilleAnnie Schmid-Alliana, Nice cedexAlain L Servin, Châtenay-MalabryStephane Supiot, NantesBaumert F Thomas, StrasbourgJean-Jacques Tuech, RouenFrank Zerbib, Bordeaux Cedex

Germany

Erwin Biecker, SiegburgHubert Blum, Freiburg Thomas Bock, TuebingenDean Bogoevski, HamburgElfriede Bollschweiler, KölnJürgen Borlak, HannoverChrista Buechler, RegensburgJürgen Büning, LübeckElke Cario, EssenBruno Christ, Halle/SaaleChristoph F Dietrich, Bad Mergentheim Ulrich R Fölsch, Kiel Nikolaus Gassler, AachenMarkus Gerhard, MunichDieter Glebe, GiessenRalph Graeser, FreiburgAxel M Gressner, AachenNils Habbe, MarburgThilo Hackert, HeidelbergWolfgang Hagmann, HeidelbergDirk Haller, FreisingPhilip D Hard, GiessenClaus Hellerbrand, RegensburgKlaus R Herrlinger, StuttgartEberhard Hildt, BerlinAndrea Hille, GoettingenJoerg C Hoffmann, BerlinPhilipe N Khalil, MunichAndrej Khandoga, MunichJorg Kleeff, MunichIngmar Königsrainer, TübingenPeter Konturek, Erlangen

Stefan Kubicka, HannoverJoachim Labenz, SiegenMichael Linnebacher, RostockJutta Elisabeth Lüttges, RiegelsbergPeter Malfertheiner, MagdeburgOliver Mann, HamburgPeter N Meier, HannoverSabine Mihm, GöttingenKlaus Mönkemüller, BottropJonas Mudter, ErlangenSebastian Mueller, HeidelbergRobert Obermaier, FreiburgMatthias Ocker, ErlangenStephan Johannes Ott, KielGustav Paumgartner, MunichChristoph Reichel, Bad Brückenau Markus Reiser, BochumSteffen Rickes, MagdeburgElke Roeb, GiessenChristian Rust, MunichHans Scherubl, BerlinMartin K Schilling, HomburgJoerg F Schlaak, EssenRene Schmidt, FreiburgAndreas G Schreyer, RegensburgKarsten Schulmann, BochumHenning Schulze-Bergkamen, MainzManfred V Singer, MannheimJens Standop, BonnJurgen M Stein, Frankfurt Ulrike S Stein, BerlinWolfgang R Stremmel, Heidelberg Harald F Teutsch, Ulm Hans L Tillmann, LeipzigChristian Trautwein, AachenJoerg Trojan, FrankfurtArndt Vogel, HannoverSiegfried Wagner, DeggendorfFrank Ulrich Weiss, GreifswaldFritz von Weizsäcker, BerlinThomas Wex, MagdeburgStefan Wirth, WuppertalMarty Zdichavsky, Tübingen

Greece

Helen Christopoulou-Aletra, ThessalonikiT Choli-Papadopoulou, ThessalonikiTsianos Epameinondas, IoanninaIoannis Kanellos, ThessalonikiElias A Kouroumalis, Heraklion Ioannis E Koutroubakis, HeraklionMichael Koutsilieris, AthensAndreas Larentzakis, AthensEmanuel K Manesis, AthensSpilios Manolakopoulos, AthensKonstantinos Mimidis, AlexandroupolisGeorge Papatheodoridis, AthensSpiros Sgouros, Athens Evangelos Tsiambas, Ag Paraskevi Attiki

Hungary

György M Buzás, BudapestLászló Czakó, SzegedGyula Farkas, SzegedPeter Hegyi, SzegedPeter L Lakatos, Budapest

Yvette Mándi, SzegedZoltan Rakonczay, SzegedFerenc Sipos, BudapestZsuzsa Szondy, DebrecenGabor Veres, Budapest

India

Philip Abraham, MumbaiVineet Ahuja, New DelhiGiriraj Ratan Chandak, HyderabadDevinder Kumar Dhawan, ChandigarhRadha K Dhiman, Chandigarh Pankaj Garg, PanchkulaPramod Kumar Garg, New DelhiDebidas Ghosh, MidnporeUday C Ghoshal, LucknowBhupendra Kumar Jain, DelhiAshok Kumar, LucknowBikash Medhi, ChandigarhSri P Misra, Allahabad Gopal Nath, VaranasiSamiran Nundy, New DelhiJagannath Palepu, MumbaiVandana Panda, MumbaiBenjamin Perakath, Tamil NaduRamesh Roop Rai, JaipurNageshwar D Reddy, HyderabadBarjesh Chander Sharma, New DelhiVirendra Singh, ChandigarhRupjyoti Talukdar, GuwahatiRakesh Kumar Tandon, New DelhiJai Dev Wig, Chandigarh

Iran

Mohammad Abdollahi, TehranPeyman Adibi, IsfahanSeyed-Moayed Alavian, TehranSeyed Mohsen Dehghani, ShirazReza Malekzadeh, TehranAlireza Mani, Tehran

Ireland

Billy Bourke, DublinTed Dinan, CorkCatherine Greene, DublinRoss McManus, DublinAnthony P Moran, GalwayMarion Rowland, Dublin

Israel

Simon Bar-Meir, HashomerAlexander Becker, AfulaAbraham R Eliakim, Haifa Sigal Fishman, Tel AvivBoris Kirshtein, Beer ShevaEli Magen, AshdodMenachem Moshkowitz, Tel-AvivAssy Nimer, SafedShmuel Odes, Beer ShevaMark Pines, Bet DaganRon Shaoul, HaifaAmi D Sperber, Beer-Sheva

January 7, 2011IIIWJG|www.wjgnet.com

Italy

Donato F Altomare, BariPiero Amodio, PadovaAngelo Andriulli, San Giovanni RotondoPaolo Angeli, PadovaBruno Annibale, RomePaolo Aurello, RomeSalvatore Auricchio, NaplesAntonio Basoli, RomeClaudio Bassi, VeronaGabrio Bassotti, Perugia Mauro Bernardi, BolognaAlberto Biondi, RomeLuigi Bonavina, Milano Guglielmo Borgia, NaplesRoberto Berni Canani, NaplesMaria Gabriella Caruso, BariFausto Catena, BolognaGiuseppe Chiarioni, ValeggioMichele Cicala, RomeDario Conte, Milano Francesco Costa, PisaAntonio Craxì, PalermoSalvatore Cucchiara, RomeGiuseppe Currò, MessinaMario M D’Elios, FlorenceMirko D’Onofrio, VeronaSilvio Danese, MilanoRoberto de Franchis, MilanoPaola De Nardi, MilanGiovanni D De Palma, NaplesGiuliana Decorti, TriesteGianlorenzo Dionigi, VareseMassimo Falconi, VeronaSilvia Fargion, MilanGiammarco Fava, AnconaFrancesco Feo, SassariAlessandra Ferlini, FerraraAlessandro Ferrero, TorinoMirella Fraquelli, MilanLuca Frulloni, VeronaGiovanni B Gaeta, NapoliAntonio Gasbarrini, RomeEdoardo G Giannini, Genoa Alessandro Granito, BolognaFabio Grizzi, MilanSalvatore Gruttadauria, PalermoPietro Invernizzi, MilanAchille Iolascon, NaplesAngelo A Izzo, NaplesEzio Laconi, CagliariGiovanni Latella, L’AquilaMassimo Levrero, RomeFrancesco Luzza, CatanzaroLucia Malaguarnera, CataniaFrancesco Manguso, NapoliPier Mannuccio Mannucci, MilanGiancarlo Mansueto, VeronaGiulio Marchesini, Bologna Mara Massimi, CoppitoGiovanni Milito, RomeGiuseppe Montalto, Palermo Giovanni Monteleone, RomeLuca Morelli, TrentoGiovanni Musso, TorinoMario Nano, TorinoGerardo Nardone, NapoliRiccardo Nascimbeni, BresciaValerio Nobili, RomeFabio Pace, MilanNadia Peparini, Rome

Marcello Persico, NaplesMario Pescatori, RomeRaffaele Pezzilli, Bologna Alberto Piperno, MonzaAnna C Piscaglia, RomePiero Portincasa, Bari Michele Reni, MilanVittorio Ricci, PaviaOliviero Riggio, RomeMario Rizzetto, TorinoBallarin Roberto, ModenaGerardo Rosati, PotenzaFranco Roviello, SienaCesare Ruffolo, TrevisoMassimo Rugge, PadovaMarco Scarpa, PadovaC armelo Scarpignato, ParmaGiuseppe Sica, RomeMarco Silano, RomePierpaolo Sileri, RomeVincenzo Stanghellini, BolognaFiorucci Stefano, PerugiaGiovanni Tarantino, NaplesAlberto Tommasini, TriesteGuido Torzilli, Rozzano MilanCesare Tosetti, Porretta TermeAntonello Trecca, RomeVincenzo Villanacci, BresciaLucia Ricci Vitiani, RomeMarco Vivarelli, Bologna

Japan

Kyoichi Adachi, Izumo Yasushi Adachi, SapporoTakafumi Ando, Nagoya Akira Andoh, OtsuMasahiro Arai, Tokyo Hitoshi Asakura, TokyoKazuo Chijiiwa, MiyazakiYuichiro Eguchi, SagaItaru Endo, YokohamaMunechika Enjoji, FukuokaYasuhiro Fujino, AkashiMitsuhiro Fujishiro, TokyoKouhei Fukushima, SendaiMasanori Hatakeyama, TokyoKeiji Hirata, KitakyushuToru Hiyama, HigashihiroshimaMasahiro Iizuka, Akita Susumu Ikehara, OsakaKenichi Ikejima, Bunkyo-kuYutaka Inagaki, KanagawaHiromi Ishibashi, Nagasaki Shunji Ishihara, Izumo Toru Ishikawa, Niigata Toshiyuki Ishiwata, Tokyo Hajime Isomoto, NagasakiYoshiaki Iwasaki, OkayamaSatoru Kakizaki, GunmaTerumi Kamisawa, TokyoMototsugu Kato, Sapporo Naoya Kato, TokyoTakumi Kawaguchi, KurumeYohei Kida, KainanShogo Kikuchi, AichiTsuneo Kitamura, Chiba Takashi Kobayashi, TokyoYasuhiro Koga, IseharaTakashi Kojima, SapporoNorihiro Kokudo, TokyoMasatoshi Kudo, OsakaShin Maeda, Tokyo

Satoshi Mamori, HyogoAtsushi Masamune, SendaiYasushi Matsuzaki, Tsukuba Kenji Miki, TokyoToshihiro Mitaka, SapporoHiroto Miwa, Hyogo Kotaro Miyake, TokushimaManabu Morimoto, YokohamaYoshiharu Motoo, Kanazawa Yoshiaki Murakami, HiroshimaYoshiki Murakami, KyotoKunihiko Murase, Tusima Akihito Nagahara, TokyoYuji Naito, Kyoto Atsushi Nakajima, YokohamaHisato Nakajima, Tokyo Hiroki Nakamura, Yamaguchi Shotaro Nakamura, FukuokaAkimasa Nakao, NagogyaShuhei Nishiguchi, HyogoMikio Nishioka, Niihama Keiji Ogura, TokyoSusumu Ohmada, Maebashi Hirohide Ohnishi, AkitaKenji Okajima, NagoyaKazuichi Okazaki, OsakaMorikazu Onji, EhimeSatoshi Osawa, Hamamatsu Hidetsugu Saito, TokyoYutaka Saito, TokyoNaoaki Sakata, SendaiYasushi Sano, ChibaTokihiko Sawada, TochigiTomohiko Shimatan, HiroshimaYukihiro Shimizu, KyotoShinji Shimoda, FukuokaYoshio Shirai, Niigata Masayuki Sho, NaraShoichiro Sumi, KyotoHidekazu Suzuki, TokyoMasahiro Tajika, NagoyaYoshihisa Takahashi, TokyoToshinari Takamura, KanazawaHiroaki Takeuchi, KochiYoshitaka Takuma, OkayamaAkihiro Tamori, OsakaAtsushi Tanaka, TokyoShinji Tanaka, Hiroshima Satoshi Tanno, HokkaidoShinji Togo, YokohamaHitoshi Tsuda, TokyoHiroyuki Uehara, OsakaMasahito Uemura, KashiharaYoshiyuki Ueno, SendaiMitsuyoshi Urashima, TokyoTakuya Watanabe, NiigataSatoshi Yamagiwa, NiigataTaketo Yamaguchi, ChibaMitsunori Yamakawa, YamagataTakayuki Yamamoto, Yokkaichi Yutaka Yata, MaebashiHiroshi Yoshida, Tokyo Norimasa Yoshida, Kyoto Yuichi Yoshida, OsakaKentaro Yoshika, ToyoakeHitoshi Yoshiji, NaraKatsutoshi Yoshizato, HigashihiroshimaTomoharu Yoshizumi, Fukuoka

Jordan

Ismail Matalka, Irbid

January 7, 2011IVWJG|www.wjgnet.com

Kuwait

Islam Khan, Safat

Lebanon

Bassam N Abboud, BeirutAla I Sharara, BeirutRita Slim, Beirut

Lithuania

Giedrius Barauskas, KaunasLimas Kupcinskas, Kaunas

Malaysia

Andrew Seng Boon Chua, Ipoh

Mexico

Richard A Awad, MexicoAldo Torre Delgadillo, MexicoDiego Garcia-Compean, MonterreyPaulino M Hernández Magro, CelayaMiguel Angel Mercado, Distrito FederalArturo Panduro, JaliscoOmar Vergara-Fernandez, TlalpanSaúl Villa-Trevio, Mexico

Moldova

Igor Mishin, Kishinev

Netherlands

Ulrich Beuers, AmsterdamLee Bouwman, LeidenAlbert J Bredenoord, NieuwegeinLodewijk AA Brosens, UtrechtJ Bart A Crusius, AmsterdamWouter de Herder, RotterdamPieter JF de Jonge, RotterdamRobert J de Knegt, RotterdamWendy W Johanna de Leng, UtrechtAnnemarie de Vries, RotterdamJames CH Hardwick, LeidenFrank Hoentjen, HaarlemMisha Luyer, SittardJeroen Maljaars, MaastrichtGerrit A Meijer, AmsterdamServaas Morré, AmsterdamChris JJ Mulder, Amsterdam John Plukker, Groningen Albert Frederik Pull ter Gunne, TilburgPaul E Sijens, GroningenBW Marcel Spanier, ArnhemShiri Sverdlov, MaastrichtMaarten Tushuizen, AmsterdamJantine van Baal, HeidelberglaanAstrid van der Velde, The HagueKarel van Erpecum, Utrecht Loes van Keimpema, Nijmegen

Robert Christiaan Verdonk, GroningenErwin G Zoetendal, Wageningen

New Zealand

Andrew S Day, Christchurch

Norway

Olav Dalgard, OsloTrond Peder Flaten, TrondheimReidar Fossmark, TrondheimRasmus Goll, TromsoOle Høie, ArendalAsle W Medhus, OsloEspen Melum, OsloTrine Olsen, TromsoEyvind J Paulssen, TromsoJon Arne Søreide, StavangerKjetil Soreide, Stavanger

Pakistan

Shahab Abid, KarachiSyed MW Jafri, Karachi

Poland

Marek Bebenek, WroclawTomasz Brzozowski, Cracow Halina Cichoż-Lach, LublinAndrzej Dabrowski, BialystokHanna Gregorek, WarsawMarek Hartleb, KatowiceBeata Jolanta Jablońska, KatowiceStanislaw J Konturek, KrakowJan Kulig, KrakowDariusz M Lebensztejn, BialystokJulian Swierczynski, Gdansk

Portugal

Raquel Almeida, PortoAna Isabel Lopes, Lisboa CodexRicardo Marcos, PortoGuida Portela-Gomes, Estoril

Romania

Dan L Dumitrascu, ClujAdrian Saftoiu, CraiovaAndrada Seicean, Cluj-Napoca

Russia

Vasiliy I Reshetnyak, Moscow

Saudi Arabia

Ibrahim A Al Mofleh, RiyadhAbdul-Wahed Meshikhes, QatifFaisal Sanai, Riyadh

Serbia

Tamara M Alempijevic, BelgradeDusan M Jovanovic, Sremska KamenicaZoran Krivokapic, Belgrade

Singapore

Madhav Bhatia, SingaporeKong Weng Eu, SingaporeBrian Kim Poh Goh, SingaporeKhek-Yu Ho, Singapore Kok Sun Ho, SingaporeFock Kwong Ming, SingaporeLondon Lucien Ooi, SingaporeNagarajan Perumal, SingaporeFrancis Seow-Choen, Singapore

South Africa

Rosemary Joyce Burnett, PretoriaMichael Kew, Cape Town

South Korea

Sang Hoon Ahn, SeoulSung-Gil Chi, SeoulMyung-Gyu Choi, SeoulHoon Jai Chun, SeoulYeun-Jun Chung, SeoulYoung-Hwa Chung, SeoulKim Donghee, SeoulKi-Baik Hahm, IncheonSun Pyo Hong, Geonggi-doSeong Gyu Hwang, SeongnamHong Joo Kim, SeoulJae J Kim, SeoulJin-Hong Kim, Suwon Nayoung Kim, Seongnam-siSang Geon Kim, SeoulSeon Hahn Kim, SeoulSung Kim, SeoulWon Ho Kim, SeoulJeong Min Lee, SeoulKyu Taek Lee, Seoul Sang Kil Lee, SeoulSang Yeoup Lee, Gyeongsangnam-doYong Chan Lee, SeoulEun-Yi Moon, SeoulHyoung-Chul Oh, SeoulSeung Woon Paik, SeoulJoong-Won Park, GoyangJi Kon Ryu, SeoulSi Young Song, SeoulMarie Yeo, Suwon Byung Chul Yoo, SeoulDae-Yeul Yu, Daejeon

Spain

Maria-Angeles Aller, MadridRaul J Andrade, MálagaLuis Aparisi, ValenciaGloria González Aseguinolaza, NavarraMatias A Avila, Pamplona

January 7, 2011VWJG|www.wjgnet.com

Fernando Azpiroz, Barcelona Ramon Bataller, BarcelonaBelén Beltrán, ValenciaAdolfo Benages, ValenciaJosep M Bordas, Barcelona Lisardo Boscá, MadridLuis Bujanda, San SebastiánJuli Busquets, BarcelonaMatilde Bustos, PamplonaJosé Julián calvo Andrés, SalamancaAndres Cardenas, BarcelonaAntoni Castells, Barcelona Fernando J Corrales, PamplonaJ E Domínguez-Muñoz, Santiago de CompostelaJuan Carlos Laguna Egea, BarcelonaIsabel Fabregat, BarcelonaAntoni Farré, BarcelonaVicente Felipo, ValenciaLaureano Fernández-Cruz, BarcelonaLuis Grande, BarcelonaAngel Lanas, Zaragoza Juan-Ramón Larrubia, GuadalajaraMaría IT López, JaénJuan Macías, SevilleJavier Martin, GranadaJosé Manuel Martin-Villa, MadridJulio Mayol, MadridMireia Miquel, SabadellAlbert Parés, BarcelonaJesús M Prieto, Pamplona Pedro L Majano Rodriguez, MadridJoan Roselló-Catafau, BarcelonaEva Vaquero, Barcelona

Sweden

Lars Erik Agréus, StockholmMats Andersson, StockholmRoland Andersson, LundMauro D’Amato, HuddingeEvangelos Kalaitzakis, GothenburgGreger Lindberg, Stockholm Annika Lindblom, StockholmSara Lindén, GöteborgHanns-Ulrich Marschall, StockholmPär Erik Myrelid, LinköpingÅke Nilsson, LundHelena Nordenstedt, StockholmKjell Öberg, UppsalaLars A Pahlman, UppsalaStefan G Pierzynowski, LundSara Regnér, MalmöBobby Tingstedt, LundZongli Zheng, Stockholm

Switzerland

Pascal Bucher, GenevaMichelangelo Foti, GenevaJean L Frossard, GenevaAndreas Geier, ZürichPascal Gervaz, GenevaGerd A Kullak-Ublick, ZürichFabrizio Montecucco, GenevaPaul M Schneider, ZürichFelix Stickel, BerneBruno Stieger, ZürichInti Zlobec, Basel

Trinidad and Tobago

Shivananda Nayak, Mount Hope

Turkey

Sinan Akay, TekirdagMetin Basaranoglu, IstanbulYusuf Bayraktar, AnkaraA Mithat Bozdayi, AnkaraHayrullah Derici, BalıkesirEren Ersoy, AnkaraMukaddes Esrefoglu, MalatyaCan Goen, KutahyaSelin Kapan, IstanbulAydin Karabacakoglu, KonyaCuneyt Kayaalp, MalatyaKemal Kismet, AnkaraSeyfettin Köklü, AnkaraMehmet Refik Mas, Etlik-AnkaraOsman C Ozdogan, IstanbulBülent Salman, AnkaraOrhan Sezgin, MersinIlker Tasci, AnkaraMüge Tecder-Ünal, AnkaraAhmet Tekin, MersinMesut Tez, AnkaraEkmel Tezel, AnkaraÖzlem Yilmaz, Izmir

United Arab Emirates

Fikri M Abu-Zidan, Al-AinSherif M Karam, Al-Ain

United Kingdom

Simon Afford, BirminghamNavneet K Ahluwalia, StockportMohamed H Ahmed, SouthamptonBasil Ammori, SalfordLesley A Anderson, BelfastChin Wee Ang, LiverpoolYeng S Ang, WiganAnthony TR Axon, Leeds Kathleen B Bamford, LondonJim D Bell, LondonJohn Beynon, SwanseaChris Briggs, SheffieldGeoffrey Burnstock, LondonAlastair D Burt, NewcastleJeff Butterworth, ShrewsburyJeremy FL Cobbold, LondonJean E Crabtree, LeedsTatjana Crnogorac-Jurcevic, LondonWilliam Dickey, LondonderrySunil Dolwani, Cardiff Emad M El-Omar, AberdeenA M El-Tawil, BirminghamCharles B Ferguson, BelfastAndrew Fowell, SouthamptonPiers Gatenby, LondonDaniel R Gaya, EdinburghAnil George, LondonRob Glynne-Jones, NorthwoodJason CB Goh, BirminghamGianpiero Gravante, Leicester

Brian Green, BelfastWilliam Greenhalf, Liverpool Indra N Guha, NottinghamStefan G Hübscher, BirminghamRobin Hughes, LondonPali Hungin, StocktonNawfal Hussein, NottinghamClement W Imrie, GlasgowJanusz AZ Jankowski, Oxford Sharad Karandikar, BirminghamPeter Karayiannis, LondonShahid A Khan, LondonPatricia F Lalor, BirminghamJohn S Leeds, SheffieldIan Lindsey, OxfordHong-Xiang Liu, Cambridge Dileep N Lobo, NottinghamGraham MacKay, GlasgowMark Edward McAlindon, SheffieldAnne McCune, BristolDonald Campbell McMillan, GlasgowGiorgina Mieli-Vergani, London Jamie Murphy, LondonGuy Fairbairn Nash, PooleJames Neuberger, Birmingham Patrick O’Dwyer, GlasgowChristos Paraskeva, BristolRichard Parker, North StaffordshireThamara Perera, BirminghamKondragunta Rajendra Prasad, LeedsD Mark Pritchard, LiverpoolAlberto Quaglia, LondonAkhilesh B Reddy, CambridgeKevin Robertson, GlasgowSanchoy Sarkar, LiverpoolJohn B Schofield, KentMarco Senzolo, PadovaVenkatesh Shanmugam, DerbyPaul Sharp, LondonChew Thean Soon, ManchesterAravind Suppiah, East YorkshireNoriko Suzuki, MiddlesexSimon D Taylor-Robinson, London Frank I Tovey, LondonA McCulloch Veitch, WolverhamptonVamsi R Velchuru, LowestoftSumita Verma, BrightonCatherine Walter, CheltenhamJulian RF Walters, LondonRoger Williams, London

United States

Kareem M Abu-Elmagd, PittsburghSami R Achem, FloridaGolo Ahlenstiel, BethesdaBhupinder S Anand, HoustonM Ananthanarayanan, New YorkBalamurugan N Appakalal, MinneapolisDimitrios V Avgerinos, New YorkShashi Bala, WorcesterAnthony J Bauer, PittsburghKevin E Behrns, GainesvilleRoberto Bergamaschi, New York Henry J Binder, New HavenEdmund J Bini, New YorkWojciech Blonski, PhiladelphiaMark Bloomston, ColumbusEdward L Bradley III, SarasotaCarla W Brady, Durham

January 7, 2011VIWJG|www.wjgnet.com

David A Brenner, San DiegoAdeel A Butt, PittsburghShi-Ying Cai, New HavenJustin MM Cates, NashvilleEugene P Ceppa, DurhamJianyuan Chai, Long BeachRonald S Chamberlain, LivingstonFei Chen, MorgantownXian-Ming Chen, Omaha Ramsey Chi-man Cheung, Palo AltoDenesh Chitkara, East BrunswickClifford S Cho, MadisonParimal Chowdhury, ArkansasJohn David Christein, BirminghamThomas Clancy, BostonAna J Coito, Los AngelesRicardo Alberto Cruciani, New YorkJoseph J Cullen, Iowa CityMark J Czaja, New YorkMariana D Dabeva, BronxJessica A Davila, HoustonConor P Delaney, ClevelandLaurie DeLeve, Los AngelesAnthony J Demetris, PittsburghSharon DeMorrow, TempleBijan Eghtesad, ClevelandYoram Elitsur, HuntingtonMohamad A Eloubeidi, AlabamaWael El-Rifai, NashvilleSukru H Emre, New HavenGiamila Fantuzzi, ChicagoAshkan Farhadi, Irvine Ronnie Fass, TucsonMartín E Fernández-Zapico, RochesterAlessandro Fichera, ChicagoJosef E Fischer, BostonPiero Marco Fisichella, Maywood Fritz Francois, New YorkGlenn T Furuta, AuroraT Clark Gamblin, Pittsburgh Henning Gerke, Iowa CityJean-Francois Geschwind, BaltimoreR Mark Ghobrial, TexasJohn F Gibbs, BuffaloShannon S Glaser, TempleAjay Goel, DallasJon C Gould, MadisonEileen F Grady, San FranciscoJames H Grendell, New YorkJohn R Grider, RichmondAnna S Gukovskaya, Los Angeles Chakshu Gupta, St. JosephGrigoriy E Gurvits, New YorkHai-Yong Han, PhoenixYuan-Ping Han, Los AngelesImran Hassan, SpringfieldCharles P Heise, MadisonLisa J Herrinton, OaklandOscar Joe Hines, Los AngelesSamuel B Ho, San DiegoSteven Hochwald, GainesvilleRichard Hu, Los AngelesEric S Hungness, ChicagoJamal A Ibdah, ColumbiaAtif Iqbal, Omaha Hartmut Jaeschke, TucsonDonald M Jensen, ChicagoRobert Jensen, BethesdaLeonard R Johnson, MemphisAndreas M Kaiser, Los AngelesJingXuan Kang, CharlestownJohn Y Kao, MichiganRandeep Singh Kashyap, New YorkRashmi Kaul, Tulsa

Jonathan D Kaunitz, Los AngelesStephen M Kavic, BaltimoreAli Keshavarzian, ChicagoAmir Maqbul Khan, MarshallKusum K Kharbanda, OmahaChang Kim, West LafayetteDean Y Kim, DetroitMiran Kim, ProvidenceBurton I Korelitz, New York Josh Korzenik, BostonRichard A Kozarek, Seattle Alyssa M Krasinskas, PittsburghShiu-Ming Kuo, Buffalo Michelle Lai, BostonMichael Leitman, New YorkDong-Hui Li, HoustonMing Li, New Orleans Zhiping Li, BaltimoreGary R Lichtenstein, Philadelphia Chen Liu, GainesvilleZhang-Xu Liu, Los AngelesCraig D Logsdon, HoustonKaye M Reid Lombardo, RochesterMichael R Lucey, MadisonKirk Ludwig, WisconsinJames D Luketich, Pittsburgh Patrick M Lynch, HoustonJohn S Macdonald, New YorkWillis C Maddrey, DallasMercedes Susan Mandell, AuroraChristopher Mantyh, DurhamWendy M Mars, PittsburghJohn Marshall, ColumbiaRobert CG Martin, LouisvilleLaura E Matarese, PittsburghCraig J McClain, LouisvilleLynne V McFarland, WashingtonDavid J McGee, ShreveportValentina Medici, SacramentoStephan Menne, New YorkDidier Merlin, AtlantaGeorge Michalopoulos, PittsburghJames M Millis, ChicagoPramod K Mistry, New HavenEmiko Mizoguchi, BostonHuanbiao Mo, DentonRobert C Moesinger, OgdenSmruti R Mohanty, ChicagoJohn Morton, StanfordPeter L Moses, BurlingtonSandeep Mukherjee, OmahaMillion Mulugeta, Los AngelesMichel M Murr, TampaPete Muscarella, ColumbusEce A Mutlu, ChicagoMasaki Nagaya, BostonLaura E Nagy, ClevelandAejaz Nasir, TampaUdayakumar Navaneethan, CincinnatiStephen JD O’Keefe, PittsburghRobert D Odze, BostonGiuseppe Orlando, Winston SalemPal Pacher, RockvilleGeorgios Papachristou, PittsburghJong Park, TampaWilliam R Parker, DurhamMansour A Parsi, ClevelandMarco Giuseppe Patti, ChicagoZhiheng Pei, New York CS Pitchumoni, New Brunswiuc Parviz M Pour, OmahaXiaofa Qin, NewarkFlorencia Georgina Que, RochesterMassimo Raimondo, Jacksonville

Raymund R Razonable, MinnesotaKevin Michael Reavis, OrangeRobert V Rege, DallasDouglas K Rex, IndianapolisVictor E Reyes, Galveston Basil Rigas, New YorkRichard A Rippe, Chapel HillAlexander S Rosemurgy, TampaPhilip Rosenthal, San FranciscoRaul J Rosenthal, WestonJoel H Rubenstein, Ann ArborShawn D Safford, NorfolkRabih M Salloum, RochesterBruce E Sands, BostonTor C Savidge, GalvestonMichael L Schilsky, New HavenBeat Schnüriger, CaliforniaRobert E Schoen, PittsburghMatthew James Schuchert, PittsburghEkihiro Seki, La JollaLe Shen, ChicagoPerry Shen, Winston-SalemStuart Sherman, Indianapolis Mitchell L Shiffman, RichmondShivendra Shukla, ColumbiaBronislaw L Slomiany, NewarkScott Steele, Fort LewisBranko Stefanovic, TallahasseeLygia Stewart, San FranciscoLuca Stocchi, ClevelandDaniel S Straus, RiversideRobert Todd Striker, MadisonJonathan Strosberg, TampaChristina Surawicz, SeattlePatricia Sylla, BostonWing-Kin Syn, DurhamYvette Taché, Los AngelesKazuaki Takabe, RichmondKam-Meng Tchou-Wong, New York Klaus Thaler, ColumbiaCharles Thomas, OregonNatalie J Torok, SacramentoGeorge Triadafilopoulos, Stanford Chung-Jyi Tsai, LexingtonThérèse Tuohy, Salt Lake CityAndrew Ukleja, FloridaSanthi Swaroop Vege, RochesterAaron Vinik, NorfolkDinesh Vyas, WashingtonArnold Wald, WisconsinScott A Waldman, PhiladelphiaJack R Wands, ProvidenceJiping Wang, BostonIrving Waxman, ChicagoWilfred M Weinstein, Los AngelesSteven D Wexner, Weston John W Wiley, Ann ArborJackie Wood, OhioJian Wu, SacramentoWen Xie, PittsburghGuang-Yin Xu, GalvestonFang Yan, NashvilleRadha Krishna Yellapu, New YorkAnthony T Yeung, PhiladelphiaZobair M Younossi, VirginiaLiqing Yu, Winston-SalemRun Yu, Los AngelesRuben Zamora, Pittsburgh Michael E Zenilman, New YorkMark A Zern, SacramentoLin Zhang, PittsburghMartin D Zielinski, RochesterMichael A Zimmerman, Colorado

January 7, 2011VIIWJG|www.wjgnet.com

S

409 Nestiningastrointestinalandothercancers:Effectsoncellsandtumor

angiogenesis

Ishiwata T, Matsuda Y, Naito Z

419 PeginterferonandribavirintreatmentforhepatitisCvirusinfection

Tsubota A, Fujise K, Namiki Y, Tada N

433 DifferentiationofCrohn’sdiseasefromintestinaltuberculosisinIndiain2010

Pulimood AB, Amarapurkar DN, Ghoshal U, Phillip M, Pai CG, Reddy DN, Nagi B,

Ramakrishna BS

444 Isdiabetesacausalagentforcolorectalcancer?Pathophysiologicaland

molecularmechanisms

Giouleme O, Diamantidis MD, Katsaros MG

449 Ghrelinandgastrininadvancedgastriccancerbeforeandaftergastrectomy

Zub-Pokrowiecka A, Rembiasz K, Konturek PC, Budzyński A, Konturek SJ, Winiarski M,

Bielański W

459 Bifidobacterium lactis attenuates onset of inflammation in a murine model of

colitis

Philippe D, Favre L, Foata F, Adolfsson O, Perruisseau-Carrier G, Vidal K, Reuteler G,

Dayer-Schneider J, Mueller C, Blum S

470 ApotentialoncogenicroleofthecommonlyobservedE2F5overexpressionin

hepatocellularcarcinoma

Jiang Y, Yim SH, Xu HD, Jung SH, Yang SY, Hu HJ, Jung CK, Chung YJ

478 BlockingNF-kBnucleartranslocationleadstop53-relatedautophagy

activationandcellapoptosis

Zhu BS, Xing CG, Lin F, Fan XQ, Zhao K, Qin ZH

488 AssociationbetweenEGF +61A/Gpolymorphismandgastriccancerin

Caucasians

Araújo AP, Costa BM, Pinto-Correia AL, Fragoso M, Ferreira P, Dinis-Ribeiro M, Costa S,

Reis RM, Medeiros R

Contents

EDITORIAL

Weekly Volume 17 Number 4 January 28, 2011

REVIEW

TOPIC HIGHLIGHT

� January 28, 2011|Volume 17|�ssue 4|WJG|www.wjgnet.com

ORIGINAL ARTICLE

BRIEF ARTICLE

ContentsWorld Journal of Gastroenterology

Volume 17 Number 4 January 28, 2011

493 Long-termoutcomeofchronichepatitisCpatientswithsustainedvirological

responsetopeginterferonplusribavirin

Trapero-Marugán M, Mendoza J, Chaparro M, González-Moreno L,

Moreno-Monteagudo JA, Borque MJ, Moreno-Otero R

499 EUS-guideddrainageismoresuccessfulinpancreaticpseudocystscompared

withabscesses

Sadik R, Kalaitzakis E, Thune A, Hansen J, Jönson C

506 EvaluationofCladribinetreatmentinrefractoryceliacdiseasetypeⅡ

Tack GJ, Verbeek WHM, Al-Toma A, Kuik DJ, Schreurs MWJ, Visser O, Mulder CJJ

514 Proximalanddistalesophagealsensitivityisdecreasedinpatientswith

Barrett’sesophagus

Krarup AL, Olesen SS, Funch-Jensen P, Gregersen H, Drewes AM

522 T2*magneticresonanceimagingoftheliverinthalassemicpatientsinIran

Zamani F, Razmjou S, Akhlaghpoor S, Eslami SM, Azarkeivan A, Amiri A

526 SilenceofHIN-1expressionthroughmethylationofitsgenepromoterin

gastriccancer

Gong Y, Guo MZ, Ye ZJ, Zhang XL, Zhao YL, Yang YS

534 Anorectalmalignantmelanomas:Retrospectiveexperiencewithsurgical

management

Che X, Zhao DB, Wu YK,Wang CF, Cai JQ, Shao YF, Zhao P

540 Isolatedpancreaticgranulocyticsarcoma:Acasereportandreviewofthe

literature

Li XP, Liu WF, Ji SR, Wu SH, Sun JJ, Fan YZ

543 Perniciousanemia:Whataretheactualdiagnosiscriteria?

Cattan D

�� January 28, 2011|Volume 17|�ssue 4|WJG|www.wjgnet.com

CASE REPORT

LETTERS TO THE EDITOR

ContentsWorld Journal of Gastroenterology

Volume 17 Number 4 January 28, 2011

FLYLEAF

APPENDIX

EDITORS FOR THIS ISSUE

Responsible Assistant Editor: Xiao-Fang Liu Responsible Science Editor: Zhong-Fang ShiResponsible Electronic Editor: Wen-Hua Ma Proofing Editorial Office Director: Jian-Xia ChengProofing Editor-in-Chief: Lian-Sheng Ma

NAMEOFJOURNALWorld Journal of Gastroenterology

LAUNCHDATEOctober 1, 1995

RESPONSIBLEINSTITUTIONDepartment of Science and Technology of Shanxi Province

SPONSORTaiyuan Research and Treatment Center for Digestive Diseases, 77 Shuangta Xijie, Taiyuan 030001, Shanxi Province, China

EDITINGEditorial Board of World Journal of Gastroenterology, Room 903, Building D, Ocean International Center, No. 62 Dongsihuan Zhonglu, Chaoyang District, Beijing 100025, ChinaTelephone: +86-10-5908-0039Fax: +86-10-8538-1893E-mail: wjg@wjgnet.comhttp://www.wjgnet.com

PUBLISHINGBaishideng Publishing Group Co., Limited,Room 1701, 17/F, Henan Building, No.90 Jaffe Road, Wanchai, Hong Kong, ChinaFax: +852-3115-8812Telephone: +852-5804-2046E-mail: baishideng@wjgnet.comhttp://www.wjgnet.com

SUBSCRIPTIONBeijing Baishideng BioMed Scientific Co., Ltd., Room 903, Building D, Ocean International Center, No. 62 Dongsihuan Zhonglu, Chaoyang District, Beijing 100025, ChinaTelephone: +86-10-8538-1892Fax: +86-10-8538-1893E-mail: baishideng@wjgnet.comhttp://www.wjgnet.com

PRINTSUBSCRIPTIONRMB 245 Yuan for each issue, RMB 11760 Yuan for one year.

ONLINESUBSCRIPTIONOne-Year Price 864.00 USD

PUBLICATIONDATEJanuary 28, 2011

CSSNISSN 1007-9327 (print)ISSN 2219-2840 (online)

HONORARYEDITORS-IN-CHIEFJames L Boyer, New HavenKe-Ji Chen, BeijingMartin H Floch, New Haven Geng-Tao Liu, BeijingEmmet B Keeffe, Palo AltoLein-Ray Mo, TainanEamonn M Quigley, CorkRafiq A Sheikh, SacramentoNicholas J Talley, RochesterMing-Lung Yu, Kaohsiung

PRESIDENTANDEDITOR-IN-CHIEFLian-Sheng Ma, Beijing

ACADEMICEDITOR-IN-CHIEFTauseef Ali, OklahomaMauro Bortolotti, BolognaTarkan Karakan, AnkaraWeekitt Kittisupamongkol, BangkokAnastasios Koulaouzidis, EdinburghGerd A Kullak-Ublick, ZürichBo-Rong Pan, Xi’anSylvia LF Pender, Southampton Max S Petrov, AucklandGeorge Y Wu, Farmington

STRATEGYASSOCIATEEDITORS-IN-CHIEFPeter Draganov, FloridaHugh J Freeman, VancouverMaria Concepción Gutiérrez-Ruiz, MéxicoKazuhiro Hanazaki, Kochi

Akio Inui, KagoshimaKalpesh Jani, BarodaJavier S Martin, Punta del EsteNatalia A Osna, OmahaWei Tang, TokyoAlan BR Thomson, EdmontonHarry HX Xia, Hanover

ASSOCIATEEDITORS-IN-CHIEFYou-Yong Lu, BeijingJohn M Luk, PokfulamHiroshi Shimada, Yokohama

EDITORIALOFFICEJian-Xia Cheng, DirectorWorld Journal of GastroenterologyRoom 903, Building D, Ocean International Center, No. 62 Dongsihuan Zhonglu, Chaoyang District, Beijing 100025, ChinaTelephone: +86-10-5908-0039Fax: +86-10-8538-1893E-mail: wjg@wjgnet.comhttp://www.wjgnet.com

COPYRIGHT© 2011 Baishideng. All rights reserved; no part of this publication may be reproduced, stored in a re-trieval system, or transmitted in any form or by any means, electronic, mechanical, photocopying, record-ing, or otherwise without the prior permission of Baishideng. Authors are required to grant World Journal of Gastroenterology an exclusive license to publish.

SPECIALSTATEMENTAll articles published in this journal represent the viewpoints of the authors except where indicated otherwise.

INSTRUCTIONSTOAUTHORSFull instructions are available online at http://www.wjgnet.com/1007-9327/g_info_20100315215714.htm. If you do not have web access please contact the editorial office.

ONLINESUBMISSIONhttp://www.wjgnet.com/1007-9327office

ABOUT COVER

ACKNOWLEDGMENTS I AcknowledgmentstoreviewersofWorldJournalofGastroenterology

I Meetings

I-VI Instructionstoauthors

Zub-Pokrowiecka A, Rembiasz K, Konturek PC, Budzyński A, Konturek SJ, Winiarski M, Bielański W. Ghrelin and gastrin in advanced gastric cancer before and after gastrectomy. WorldJGastroenterol 2011;17(4):449-458http://www.wjgnet.com/1007-9327/full/v17/i4/449.htm

World Journal of Gastroenterology (World J Gastroenterol, WJG, print ISSN 1007-9327, DOI: 10.3748) is a weekly, open-access, peer-reviewed journal supported by an editorial board of 1144 experts in gastroenterology and hepatology from 60 countries.

The major task of WJG is to report rapidly the most recent results in basic and clinical research on esophageal, gastrointestinal, liver, pancreas and biliary tract diseases, Helicobacter pylori, endoscopy and gastrointestinal surgery, including: gastroesophageal reflux disease, gastrointestinal bleeding, infection and tumors; gastric and duodenal disorders; intestinal inflammation, microflora and immunity; celiac disease, dyspepsia and nutrition; viral hepatitis, portal hypertension, liver fibrosis, liver cirrhosis, liver transplantation, and metabolic liver disease; molecular and cell biology; geriatric and pediatric gastroenterology; diagnosis and screening, imaging and advanced technology.

I-VII EditorialBoard

��� January 28, 2011|Volume 17|�ssue 4|WJG|www.wjgnet.com

AIM AND SCOPE

Silence of HIN-1 expression through methylation of its gene promoter in gastric cancer

Yan Gong, Ming-Zhou Guo, Zhi-Jia Ye, Xiu-Li Zhang, Yong-Liang Zhao, Yun-Sheng Yang

Yan Gong, Ming-Zhou Guo, Xiu-Li Zhang, Yun-Sheng Yang, Department of Gastroenterology and Hepatology, Chinese PLA General Hospital, Beijing 100853, ChinaZhi-Jia Ye, Department of Genetics, Yale Medical School TAC, S320 1 Gilbert Street, New Haven, CT 06520, United StatesYong-Liang Zhao, Department of General Surgery, Southwest Hospital, Third Military Medical University, Chongqing 400038, ChinaAuthor contributions: Gong Y and Yang YS performed the majority of experiments; Guo MZ and Ye ZJ provided vital re-agents and analytical tools and edited the manuscript; Zhao YL and Zhang XL collected all the specimens for this work; Gong Y and Guo MZ designed the study and wrote the manuscript.Supported by National Basic Research Program (973 Program No. 2010CB912802) and the Postdoctoral Fund of China, No. 20080441314Correspondence to: Yun-Sheng Yang, MD, PhD, Department of Gastroenterology and Hepatology, Chinese PLA General Hos-pital, No. 28 Fuxing Road, Beijing 100853, China. sunny888@medmail.com.cnTelephone: +86-10-68182255 Fax: +86-10-68212267Received: September 2, 2010 Revised: November 2, 2010Accepted: November 9, 2010Published online: January 28, 2011

AbstractAIM: To clarify the role of high in normal-1 (HIN-1 ) gene promoter methylation during gastric cancer de-velopment.

METHODS: Gastric cancer cell lines and tissue speci-mens were analyzed for expression of HIN-1 mRNA and protein using the semi-quantitative reverse transcription polymerase chain reaction and immunohistochemistry. The methylation of the HIN-1 gene promoter was de-tected in gastric carcinoma cells and tissues using meth-ylation-specific polymerase chain reaction. The 3-(4,5-di-methylthiazol-2yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium cell viability assay and flow cytometry were used to assess the changes in behaviors

of gastric cancer cells with or without 5-aza-2’-deoxycyt-idine treatment.

RESULTS: HIN-1 was not expressed in 4 of 5 gastric cancer cell lines. The demethylation reagent 5-aza-2’-deoxycytidine was able to induce or upregulate HIN-1 expression in gastric cancer cell lines, which is associ-ated with reduction of tumor cell viability. Furthermore, methylation of the HIN-1 gene promoter was shown in 57.8% (26/45) of the primary gastric cancer and 42.1% (17/38) of adjacent tissue samples, but was not shown in normal gastric mucosa (0/10). From the clini-copathological data of the patients, methylation of the HIN-1 gene promoter was found to be associated with tumor differentiation (P = 0.000).

CONCLUSION: High methylation of HIN-1 gene pro-moter results in silence of HIN-1 expression in gastric cancer. 5-aza-2’-deoxycytidine reverses HIN-1 methyla-tion and reduces viability of gastric cancer cells.

© 2011 Baishideng. All rights reserved.

Key words: High in normal-1; Gene methylation; 5-aza-2’-deoxycytidine; Tumor differentiation; Gastric cancer

Peer reviewer: Huanbiao Mo, PhD, Associate Professor, De-partment of Nutrition and Food Sciences, Texas Woman’s Uni-versity, PO Box 425888, Denton, TX 76204, United States

Gong Y, Guo MZ, Ye ZJ, Zhang XL, Zhao YL, Yang YS. Silence of HIN-1 expression through methylation of its gene promoter in gastric cancer. World J Gastroenterol 2011; 17(4): 526-533 Available from: URL: http://www.wjgnet.com/1007-9327/full/v17/i4/526.htm DOI: http://dx.doi.org/10.3748/wjg.v17.i4.526

INTRODUCTIONGastric cancer is the second most common cause of can­

BRIEF ARTICLE

World J Gastroenterol 2011 January 28; 17(4): 526-533ISSN 1007-9327 (print) ISSN 2219-2840 (online)

© 2011 Baishideng. All rights reserved.

Online Submissions: http://www.wjgnet.com/1007-9327officewjg@wjgnet.comdoi:10.3748/wjg.v17.i4.526

526 January 28, 2011|Volume 17|Issue 4|WJG|www.wjgnet.com

Gong Y et al . HIN-1 methylation in gastric carcinoma

cer death worldwide after lung cancer[1,2]. Gastric carcino­genesis, like all other cancers, is a multistep process, in­volving numerous genetic and epigenetic alterations, such as abnormalities in growth factors/receptors, angiogenic factors, cell cycle regulators, and DNA mismatch repair genes. These abnormalities also define biological character­istics of gastric cancer cells, which can serve as therapeutic targets for gastric cancer[3,4]. Although genetic abnormali­ties including gene mutation and deletion are prominent in causing oncogene activation and tumor suppressor gene inactivation, epigenetic silence of tumor suppressor genes via aberrant promoter hypermethylation have also been shown to be frequent events in gastric carcinoma[5,6]. DNA high methylation of tumor suppressor genes frequently occurs in the early stage of human carcinogenesis, and investigating the methylation of these gene promoters may contribute to the diagnosis, prognosis and target therapy in gastric carcinoma[7,8].

High in normal­1 (HIN-1) gene was originally isolated through a serial analysis of gene expression from normal and ductal carcinoma in situ luminal mammary epithelial cells. The latter is believed to be the precursor of invasive ductal carcinoma[9]. HIN­1 is highly expressed in normal luminal mammary epithelial cells but lost in the majority of breast cancers. Restoration of HIN­1 expression sup­pressed growth of breast cancer cells[10]. HIN­1 can also regulate cell­cycle reentry, suppresses tumor cell migration and invasion, and induces apoptosis in breast cancer cell lines[10]. Although HIN­1 processes the putative tumor suppressor function, no somatically genetic changes of HIN-1 gene were found in breast cancer[9]. Previous stud­ies demonstrated frequent methylation of HIN-1 gene promoter in breast cancer, prostate cancer, malignant me­sotheliomas, non­small cell lung cancer, lymphoma, reti­noblastoma, Wilms’ tumor, and rhabdomyosarcoma[11­14].

However, expression of this putative tumor suppressor gene in gastric cancer has not been fully studied. Therefore, in this study, we first confirmed the methylation of HIN-1 gene promoter in human gastric cancer cell lines and de­termined the role of 5­aza­2’­deoxycytidine [5­aza­dc, a drug that inhibits the DNA methyltransferase (DNMT)­mediated hypermethylation of promoter region CpG is­lands] in regulation of HIN-1 expression in gastric cancer cells. We also detected the methylation of HIN-1 gene promoter in tissue specimens and found the association between HIN-1 gene promoter methylation and clinico­pathologic characteristics of gastric cancer.

MATERIALS AND METHODSCell lines and cultureGastric carcinoma cell lines KATOIII, AGS, PHM82, NUGC3, and BCG823 were obtained from American Type Culture Collection (Manassas, VA) and cultured in either RPMI 1640 medium or RPMI 1640/Ham’s F­12 medium (all from Invitrogen, Carlsbad, CA) supplemented with 10% fetal bovine serum in a humidified incubator with 5% CO2 and 95% air at 37℃. These cells were pas­

saged at a ratio of 1:3 with trypsin once they reached confluence (approximately 106 cells) into 75 cm2 culture flasks (Sarstedt, Newton, NC). For treatment with 5-aza-2’­deoxycytidine, these cell lines were split and cultured at a low density (30% confluence) overnight and then treated with 5­aza­2’­deoxycytidine (Sigma, St. Louis, MO) at a concentration of 1 μmol/L for up to 96 h. The growth medium was refreshed every 24 h, and at the end of the treatment, DNA and RNA from these cells were isolated as described below.

Human tissue samples In the current study, 45 surgically resected and pathologi­cally confirmed gastric tumors and 38 adjacent non-tumor tissues were obtained from the PLA General Hospital, Beijing, China between January 2009 and January 2010 and stored in liquid nitrogen until use. Ten cases of nor­mal gastric mucosa were also obtained from the gastric endoscopic biopsies of tumor­free patients. This study was approved by our hospital’s Institutional Review Board.

DNA extraction and methylation-specific polymerase chain reactionGenomic DNA from these cell lines and tissue specimens were extracted using a proteinase­K method described previously[15]. The extracted DNA was then dissolved in Tris­EDTA (TE) buffer and stored at ­20℃. To assess the methylation levels of the HIN-1 gene promoter, genomic DNA from gastric cancer cell lines and tissue specimens were first subjected to bisulfite treatment and then methyla­tion-specific polymerase chain reaction (MSP) as described previously[16]. The MSP primers for HIN­1 were designed and synthesized according to genomic sequences skirt­ing the presumed transcription start sites for HIN­1. The HIN­1 MSP primers spanned a region of 92 base pairs for unmethylation (location is from +128 to +41) and 88 base pairs for methylation (location is from +131 to +40). The primer sequences were: HIN-1­UN 5'­GAAGTTTT­GTGGTTTTGTTTGGGTAGTT­3', HIN-1­UN­AS 5'­CACACAAAACCCCAAAAAAACAACA­3', HIN-1­ME­S 5'­GTTTCGTGGTTTTGTTCGGGTAGTC­3' and HIN-1­ME­AS 5'­GCAAAACCCCAAAAAAACGACG­3'. Each MSP reaction incorporated approximately 100 ng of bisulfite-treated DNA, 25 picomoles of each primer, 100 pmoles dNTPs, 2.5 μL 10 × PCR buffer, and 1 unit of JumpStart Red Taq Polymerase (Sigma) in a final reaction volume of 25 μL. The PCR amplification conditions were an initial 95℃ for 5 min and then 35 cycles of 95℃ for 30 s, 60℃ for 30 s, and 72℃ for 30 s and a final extension at 72℃ for 5 min and then stored at 4℃. The MSP products were separated on 2% agarose gel electrophoresis and vi­sualized under the ultraviolet (UV) light.

RNA isolation and semi-quantitative reverse transcription PCRTotal cellular RNA from the cell lines was isolated using the TRIzol reagent (Invitrogen) according to the manu­

527 January 28, 2011|Volume 17|Issue 4|WJG|www.wjgnet.com

facturer’s instructions. RNA quality and quantity were assessed using agarose gel electrophoresis (1%) and spec­trophotometric analysis of 260/280 ratios. The RNA was stored at ­70℃ prior to use. The first strand cDNA was synthesized with oligo­(dT) primer using a reverse tran­scriptase kit from Invitrogen.

Two micrograms RNA was subjected to the first strand cDNA synthesis, and 1 μL cDNA from RT reac­tion was subjected to PCR amplification of gene expres­sion in a total 25 μL reaction volume. The PCR ampli­fication was carried out using primer sets derived from the published HIN-1 gene sequences: HIN-1 primers were 5'­TCTGCGTGGCCCTGTCCTG­3' (sense) and 5'­GCTCAGCCAAACACTGTCAG­3' (antisense)[14]. This primer set, designed to cross the intronic sequenc­es, can prevent from amplification of genomic DNA for control of genomic DNA contamination during RNA isolation. A total of 32 cycles of PCR amplifica­tion were performed based on our pre­experiment for semi­quantitative measurement of HIN-1 gene expres­sion levels. Glyceraldehyde­3­phosphate dehydrogenase (GAPDH) was amplified for 25 cycles as an internal control of equal loading and cDNA quality and quantity. The sequence of GAPDH primers: 5'­GACCACAGTC­CATGCCATCAC­3' (sense) and 5'­GTCCACCACCCT­GTTGCTGTA­3' (antisense). The PCR products were then electrophoresed in 1.5% agarose gels containing ethidium bromide and reviewed under the UV light.

Protein extraction and Western blotting The cells were grown and treated with or without 5­aza­2’­deoxycytidine for 6 d and total cellular protein was then extracted from these cells in 200 μL ice­cold mild lysis buffer containing 10 μL nonidet P­40, 0.15 mol/L NaCl, 0.01 mol/L sodium phosphate (pH 7.2), 2 mmol/L EDTA, 50 mmol/L sodium fluoride, 0.2 mmol/L sodium vanadate, and 1 μg/mL aprotinin. The cell mixture was centrifuged at 20 000 r/min for 15 min and supernatants were then collected. The concentration of protein was quantified by the BCA protein assay from Pierce (Rock­ford, IL, USA) and an equal amount of protein was separated by sodium dodecyl sulfate­polyacrylamide gel electrophoresis (SDS­PAGE) and then transferred onto PDVF membranes (Millipore, Billerica, USA). Western blotting analyses were then carried out using an anti­HIN­1 (Novus Biologicals, Littleton, USA) or an anti­β­actin antibody (Boster, Wuhan, China). The blots were de­veloped with chemiluminescence substrate solution from Pierce and exposed to X-ray film.

3-(4,5-dimethylthiazol-2yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium assay Gastric cancer cells were grown in 96­well plates and treat­ed with or without 5­aza­2’­deoxycytidine for up to 6 d, and then cell proliferation was determined using CCK­8 solution (Beyotime, China) according to the manufacturer’s instructions. The optical density was measured at 492 nm using an ELISA plate reader (TECAN, Switzerland). The

experiments were performed in triplicate and repeated three times.

Detection of apoptosis Gastric cancer cells were treated with or without 5­aza­2’-deoxycytidine for up to 6 d. Both attached and floating cells were harvested and fixed with 70% ethanol for at least 48 h. After resuspension in 50 μg/mL, the cells were treated with 100 μg/mL RNase for 30 min and stained with propidium iodide and then analyzed by flow cytom­etry (FACscalibur; Becton Dickinson, Franklin Lakes, NJ).

ImmunohistochemistrySections 5 μm thick were formalin­fixed and paraffin­embedded in xylene and rehydrated through an ethanol series. Antigen retrieval was carried out at this stage in a microwave oven. Sections were then blocked with 3% hydrogen peroxidase followed by incubation with a 50% protein blocking agent. Fetal bovine serum (10%), with or without HIN­1 antibody (1:60), was applied to each slide, and the slides were incubated for 30 min, and counter­stained with hematoxylin. Tissues without the specific an­tibody were used as negative controls. Anti­HIN­1 (Novus Biologicals, Littleton, USA) and PV­6000­G Kit (Beijing Zhongshan Jinqiao Biotechnology, Beijing, China) were used for the immunohistochemical (IHC) staining. HIN­1 expression was regarded as positive when 10% or more cancer cells exhibited HIN­1 expression.

Statistical analysisThe statistical analyses of the experimental data were carried out using SPSS 13.0 software for Windows (Chi­cago, IL). P values for dichotomous variables were two­tailed and based on the Pearson χ2 test or the Pearson χ2 test with continuity correction. Continuous variables were analyzed with Student’s t test. A value of P < 0.05 was considered statistically significant.

RESULTSSilence of HIN-1 expression through methylation of HIN-1 gene promoter and 5-aza-2’-deoxycytidine induction of HIN-1 gene expression in gastric cancer cell lines To find out whether the silence of HIN-1 gene expression is caused by methylation of the HIN-1 gene promoter, we first detected the methylation status of HIN-1 in 5 gastric cancer cell lines. The MSP analysis showed that HIN-1 gene promoter was highly methylated in AGS, PHM82, and BCG­823 cells, but not methylated or partially methyl­ated in NUGC 3 and KATOIII cell lines (Figure 1A). We detected HIN-1 expression in five gastric cancer cell lines and found that HIN­1 mRNA was not expressed in AGS, PHM82, and BCG 823 cells, but expressed in NUGC 3 and weakly expressed in KATOIII cells. HIN­1 expres­sion was induced or upregulated in these cell lines after we treated them with 5­aza­2’­deoxycytidine (Figure 1B).

528 January 28, 2011|Volume 17|Issue 4|WJG|www.wjgnet.com

Gong Y et al . HIN-1 methylation in gastric carcinoma

Suppression of gastric cancer cell viability with 5-aza-2’-deoxycytidine treatment We determined the ability of 5­aza­2’­deoxycytidine to reg­ulate gastric cancer cell viability using BCG­823 cells treat­ed with 5­aza­2’­deoxycytidine. The results showed that treatment with 1 μmol/L of 5­aza­2’­deoxycytidine for up to 6 d significantly upregulated expression of HIN-1 but reduced the number of the viable cells (Figure 2A) and induced them to undergo apoptosis compared with the untreated tumor cells (20.46% ± 1.24% vs 11.28% ± 1.01%, P = 0.001, Figure 2B). These data were associated with HIN-1 expression induced by 5­aza­2’­deoxycytidine (Figure 1B and Figure 2A).

Aberrant hypermethylation of HIN-1 gene promoter in primary gastric carcinomasTo translate this in vitro finding into ex vivo tissue speci­mens, MSP analysis of HIN-1 gene promoter methyla­tion was conducted in 45 patients with human gastric carcinoma (32 male and 13 female). The patients’ average age was 55 ± 13 years and other clinicopatho­logical data are listed in Table 1. MSP analysis showed that methylation of the HIN-1 gene promoter was fre­quently detected in gastric cancer (57.78%, 26/45) and adjacent non­tumor tissues (42.1%, 17/38), but not in normal gastric mucosa. Statistically, there was no dif­ference in methylation of the HIN-1 gene promoter between gastric cancer and adjacent non­tumor tissues. However, there were statistically significant differences between gastric cancer and normal gastric mucosa, and between adjacent non­tumor tissues and normal mucosa (Figure 3A and B, P = 0.002 and P = 0.005, respectively). To correlate HIN-1 gene promoter methylation with HIN­1 expression, 29 gastric cancer tissues (GCs) were subjected to immunohistochemistry analysis. Represen­tative immunostaining is shown in Figure 4A and B. GC cases with low HIN­1 immunostaining had more fre­quent DNA methylation than GCs with high immunos­

taining (53.33% vs 14.29%, P = 0.027, Figure 4C). These data demonstrate that DNA methylation contributes to the decreased expression of HIN­1 in GCs.

Association of HIN-1 gene promoter methylation with clinicopathological data in gastric cancer patients Methylation status of HIN-1 gene promoter was associat­ed with tumor differentiation. The methylation frequency in well­differentiated and moderately/poorly­differentiated tumors was 34.78% (8/23) and 80.95% (17/21), respec­tively, indicating that HIN-1 was more frequently methyl­ated in poorly­differentiated gastric cancer than that in well­differentiated gastric cancer (P = 0.000, Table 1). However, there was no correlation between HIN-1 meth­ylation and other parameters (such as age, tumor size, and lymph node metastasis) (Table 1).

DISCUSSIONIn the current study, we determined HIN­1 gene expres­sion and the methylation status of the HIN-1 gene pro­moter in gastric cancer cells. We found that the expression of HIN­1 mRNA was lost in gastric cancer cells. MSP analysis revealed high methylation of the HIN-1 gene pro­moter in these tumor cells. 5­aza­2’­deoxycytidine treat­ment induced HIN­1 expression, but reduced viability of gastric cancer cells. Furthermore, ex vivo data demonstrat­ed that the HIN-1 gene promoter is frequently methylated in gastric cancer and the adjacent non­tumor tissues, but not in normal gastric mucosae. HIN-1 gene promoter methylation was associated with differentiation of gastric cancer. This study demonstrated frequent methylation of the HIN-1 gene promoter in gastric cancer. Therefore, the

529 January 28, 2011|Volume 17|Issue 4|WJG|www.wjgnet.com

BCG823- +

KATOIII- +

AGS- +

PHM82- +

NUGC3- +

Mw5-aza

HIN-1

GAPDH

BCG823U M

KATOIIIU M

AGSU M

PHM82U M

NUGC3U M

IVDU M

NLU M

H2OU M

MwA

B

Figure 1 Silence of high in normal-1 gene expression due to methylation of high in normal-1 gene promoter in gastric carcinoma cell lines. A: Meth-ylation-specific polymerase chain reaction analysis of high in normal-1 (HIN-1) gene promoter methylation in five gastric carcinoma cell lines. U: Unmethylated alleles; M: Methylated alleles. In vitro methylated DNA (IVD) and DNA from normal human peripheral lymphocytes were used as methylated and unmethyl-ated controls; B: Gastric cancer cell lines were treated with or without 5-aza-CdR (-AZ) for up to 96 h. HIN-1 mRNA levels were measured by semi-quantitative reverse transcription polymerase chain reaction analysis, and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) served as control. The 1-kb marker in-dicated an appropriate size for the amplified products. HIN-1 expression varied among cell lines. The presence of methylation of HIN-1 corresponds directly to the loss of expression of the genes in each cell line.

Table 1 Association of high in normal-1 methylation with clinicopathologic characteristics in gastric cancer

Variable Patients HIN-1 methylation

P value

Sex 0.161 Male 32 17 Female 13 9Age (yr) 0.401 ≤ 50 14 9 > 50 31 17Tumor size (cm) 0.283 < 5 25 16 ≥ 5 19 10Tumor differentiation 0.000a

Moderate/poor 21 17 Well 23 8Stage 0.683 Ⅰ-Ⅱ 13 7 Ⅲ-Ⅳ 29 17Nodal status 0.903 - 9 5 + 35 20

aPearson’s χ2 test using SPSS 13.0 software for Windows. The methylation frequency of well-differentiated tumor vs moderately/poorly tumor. TNM was staged according to the guidelines of the International Union against Cancer. HIN-1: High in normal-1.

Gong Y et al . HIN-1 methylation in gastric carcinoma

HIN-1 gene promoter methylation may be further evalu­ated as a biomarker for early detection of gastric cancer.

Inactivation of tumor suppressor genes contributes to cancer development. Such inactivation may be caused by genetic or epigenetic alterations, including gene mutation, deletion, promoter methylation, abnormal splicing, de­regulation of imprinting and haploinsufficiency[4]. Among these abnormalities, loss of heterozygosity (LOH) was

shown to cause inactivation of most candidate tumor suppressor genes in the critical regions of chromosomes 3p, 5q, 8p and 9p[17­20]. However, changes in methylation status of these genes also frequently occur. The HIN-1 gene is located at 5q35 and plays a role in epithelial cell differentiation. HIN­1 can also regulate cell­cycle reentry, suppresses tumor cell migration and invasion, and induces apoptosis in breast cancer cell lines[10]. The HIN-1 gene is

530 January 28, 2011|Volume 17|Issue 4|WJG|www.wjgnet.com

1.8

1.6

1.4

1.2

1.0

0.8

0.6

0.4

0.2

0.0

Abso

rban

ce a

t 49

2 nm

Without 5aza treatmentWith 5aza treatment

BCG 823

HIN-1

β-actin

- +

1 2 3 4 5 6 t /d

A

25

20

15

10

5

0

% o

f ap

opto

tic c

ells

Without 5aza treatment

With 5aza treatment

a104

103

102

101

100

PI

100 101 102 103 104

Annexin Y FITC

With 5aza treatment104

103

102

101

100

PI

100 101 102 103 104

Annexin Y FITC

Without 5aza treatmentB

Figure 2 5-aza-2’-deoxycytidine inhibition of gastric cancer cell BCG823 viability through induction of high in normal-1 expression. A: Gastric can-cer BCG823 cells were treated with or without 5-Aza-CdR (AZ) for up to 6 d and then subjected to 3-(4,5-dimethylthiazol-2yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium analysis of cell viability before and after 5-Aza-CdR treatment. The high in normal-1 (HIN-1) protein levels were measured by immunoblot-ting. -: Without 5aza treatment; +: With 5aza treatment; B: BCG-823 cells were subjected to FACs for apoptosis analysis. 5-aza-2’-deoxycytidine treatment inhibits BCG-823 cell proliferation (A) and induces them to undergo apoptosis (B) vs the controls (aP < 0.05).

IVDU M

NLU M

NG1U M

NG2U M

NG3U M

NG4U M

NG5U M

Mw

N

70

60

50

40

30

20

10

0T

GC1U M

GC2U M

GC3U M

GC4U M

GC5U M

GC6U M

GC7U M

NT

GC1U M

GC2U M

GC3U M

GC4U M

GC5U M

GC6U M

GC7U M

Perc

ent

met

hyla

tion

a

b

N NT T

BA

Figure 3 Methylation-specific polymerase chain reaction analysis of high in normal-1 gene promoter methylation in gastric cancer, adjacent non-tumor tissues, and normal gastric mucosa. A: Representative data of MS-PCR analysis of high in normal-1 (HIN-1) genes in tumor tissues (T), paired adjacent non-tumor tissues (NT) and normal gastric mucosa(N). U: Unmethylated alleles; M: Methylated alleles. In vitro methylated DNA and DNA from normal human peripheral lympho-cytes were used as methylated and unmethylated controls; B: Comparison of HIN-1 gene methylation among gastric cancer (T) , adjacent non-tumor tissue (NT) and normal gastric mucosa (N). aStudent’s t test by SPSS 13.0 software, NT vs N, P = 0.005; bT vs N, P = 0.002.

Gong Y et al . HIN-1 methylation in gastric carcinoma

frequently methylated in different cancers, but not by mu­tation[11]. For example, HIN-1 gene promoter hypermeth­ylation was found in the majority (70%) of breast cancer and pre­invasive lesions. Hypermethylation of the HIN-1 promoter region also occurs in cancer and the adjacent tissues of the lung, prostate, pancreas, and esophagus, but not in normal tissues[21]. Methylation of the HIN-1 gene promoter was associated with esophageal squamous carci­noma progression[14]. Our current data demonstrated ab­errant methylation of HIN-1 gene promoter regions and subsequent loss of HIN­1 expression in gastric cancer cell lines and tumor tissue specimens. These results are con­sistent with previous studies on other cancers[9,12]. HIN-1 methylation existed in 57.78% (26/45) of gastric cancer and 42.1% (17/38) of adjacent non­tumor tissues, which indicated that it is a common feature of gastric cancer and may be the early stage accident in gastric carcinogenesis.

The pathogenesis of intestinal­type gastric cancer is usually initiated or caused by Helicobacter pylori (H. pylori) infection[22]. However, the underlying mechanism remains to be defined, and a better understanding of pathogenesis of gastric cancer could help develop molecular diagnostic and patient­tailored therapeutic targets[23]. In the previ­ous studies, we reported that field defect, an area of abnormal tissue that precedes and is predisposed to the development of cancer, could be predicted by detection of gene promoter methylation[24]. Such abnormal fields are of interest because they give insight into the early

stages of carcinogenesis and may provide biomarkers of cancer risk[25,26]. Aberrant promoter hypermethylation has been shown to be a common event in human cancer mainly due to the loss of function of tumor suppressor. This neoplasia­related event is thought to occur early in carcinogenesis, and hence, promoter hypermethylation is being widely studied as a biomarker for the diagnosis and detection of early lesions. In this context, HIN-1 was frequently methylated in gastric carcinoma adjacent tis­sues but not in normal gastric mucosa. It suggests that HIN-1 methylation may represent the field defect of gas­tric carcinoma. HIN-1 gene promoter methylation may be an early event in gastric cancer. However, further studies are required to determine whether H. pylori infection is responsible for this.

Our current data showed a statistical difference be­tween methylation of the HIN-1 gene promoter and gastric cancer differentiation, HIN-1 was more frequently methylated in poorly­differentiated gastric carcinomas than in well­differentiated ones, which may suggest the role of HIN-1 in regulation of cell differentiation.

We also found that methylation of HIN-1 gene pro­moter only occurred in gastric cancer but not in normal gastric mucosa. 5­aza­2’­deoxycytidine induced expres­sion of HIN­1, which is associated with reduced viability of gastric cells, indicating that HIN­1 plays an important role in suppressing gastric carcinogenesis. However, we cannot rule out whether other tumor suppressor genes

531 January 28, 2011|Volume 17|Issue 4|WJG|www.wjgnet.com

14

12

10

8

6

4

2

0

No.

of

case

s 87

2

12

Low expression High expression

aP = 0.027MethylatedUnmethylated

BA

C

Figure 4 Immunohistochemical analysis of high in normal-1 protein expression in gastric cancer tissue samples. A: Tumor cells with methylated alleles of high in normal-1 (HIN-1) gene promoter exhibited negative staining; B: Cancer cells without HIN-1 gene promoter methylation exhibited positive staining. HIN-1 expression in gastric cancer (membrane staining, arrow); C: The association of HIN-1 methylation with HIN-1 expression level was analyzed in 29 gastric cancers. High expression: +-+++ staining intensity with 10% or more cancer cells positively stained, otherwise it is considered as low expression. The staining intensity and percentage of staining were compared with a non-cancerous area of the same section. aPearson χ2 test or Pearson χ2 test with continuity correction by SPSS 13.0 software. A, B: IHC, × 200.

Gong Y et al . HIN-1 methylation in gastric carcinoma

532 January 28, 2011|Volume 17|Issue 4|WJG|www.wjgnet.com

are also induced and restored by 5­aza­2’­deoxycytidine, which plays a role in regulation of tumor cell viability. The latter warrants further studies because some other stud­ies showed that epigenetic modification of pro-apoptotic genes is one of the mechanisms by which the tumor cells are resistant to chemotherapy[27,28]. Therefore, treatment with a demethylating agent like 5­aza­2’­deoxycytidine prior to chemotherapy may help improve the therapeutic efficacy for gastric cancer.

In summary, silence of HIN­1 expression is achieved through the gene methylation in gastric cancer. Methyla­tion of HIN-1 is correlated with tumor differentiation. Future studies will evaluate whether HIN-1 gene promot­er methylation can be used as a biomarker for the early detection of gastric cancer.

COMMENTSBackgroundGastric cancer is the second most common cause of cancer death worldwide. However, the cause of gastric cancer development remains to be determined. Lost expression of tumor suppressor genes, such as high in normal-1 (HIN-1), may contribute to the development of gastric cancer. This study determined the cause of HIN-1 gene inactivation: epigenetic silence through methylation of the gene promoter. Research frontiersSilence of HIN-1 gene through hypermethylation of the gene promoter is a com-mon event in different cancers including breast, prostate, and non-small cell lung cancers and malignant mesotheliomas, lymphoma, retinoblastoma, Wilms’ tumor, and rhabdomyosarcoma. This study investigated the role of HIN-1 in gastric cancer and showed for the first time that the hypermethylation of HIN-1 gene promoter was the mechanism for HIN-1 gene silence in gastric cancer.Innovations and breakthroughsThe authors confirmed the methylation of HIN-1 gene promoter in human gastric cancer cell lines and determined the role of 5-aza-2’-deoxycytidine in regulation of HIN-1 expression in gastric cancer cells. ApplicationsThe HIN-1 gene promoter methylation may be further evaluated as a biomarker for early detection of gastric cancer.TerminologyHIN-1 gene was originally isolated through a serial analysis of gene expression from normal and ductal carcinoma in situ luminal mammary epithelial cells. HIN-1 gene promoter is frequently methylated in gastric cancer and the adja-cent non-tumor tissues, but not in normal gastric mucosa. Peer reviewThis manuscript demonstrated promising data illustrating the methylation status of H1N-1 gene promoter and its potential role in suppression of gastric carci-noma development.

REFERENCES1 Herszényi L, Tulassay Z. Epidemiology of gastrointestinal

and liver tumors. Eur Rev Med Pharmacol Sci 2010; 14: 249-2582 Brenner H, Rothenbacher D, Arndt V. Epidemiology of

stomach cancer. Methods Mol Biol 2009; 472: 467-4773 Arkenau HT. Gastric cancer in the era of molecularly tar-

geted agents: current drug development strategies. J Cancer Res Clin Oncol 2009; 135: 855-866

4 Yasui W, Sentani K, Motoshita J, Nakayama H. Molecular pathobiology of gastric cancer. Scand J Surg 2006; 95: 225-231

5 Herman JG, Baylin SB. Gene silencing in cancer in associa-tion with promoter hypermethylation. N Engl J Med 2003; 349: 2042-2054

6 Wang JF, Dai DQ. Metastatic suppressor genes inactivated

by aberrant methylation in gastric cancer. World J Gastroen-terol 2007; 13: 5692-5698

7 Tokugawa T, Sugihara H, Tani T, Hattori T. Modes of si-lencing of p16 in development of esophageal squamous cell carcinoma. Cancer Res 2002; 62: 4938-4944

8 Huang KH, Huang SF, Chen IH, Liao CT, Wang HM, Hsieh LL. Methylation of RASSF1A, RASSF2A, and HIN-1 is as-sociated with poor outcome after radiotherapy, but not sur-gery, in oral squamous cell carcinoma. Clin Cancer Res 2009; 15: 4174-4180

9 Krop IE, Sgroi D, Porter DA, Lunetta KL, LeVangie R, Seth P, Kaelin CM, Rhei E, Bosenberg M, Schnitt S, Marks JR, Pagon Z, Belina D, Razumovic J, Polyak K. HIN-1, a puta-tive cytokine highly expressed in normal but not cancerous mammary epithelial cells. Proc Natl Acad Sci USA 2001; 98: 9796-9801

10 Krop I, Parker MT, Bloushtain-Qimron N, Porter D, Gel-man R, Sasaki H, Maurer M, Terry MB, Parsons R, Polyak K. HIN-1, an inhibitor of cell growth, invasion, and AKT activa-tion. Cancer Res 2005; 65: 9659-9669

11 Krop I, Player A, Tablante A, Taylor-Parker M, Lahti-Domenici J, Fukuoka J, Batra SK, Papadopoulos N, Richards WG, Sugarbaker DJ, Wright RL, Shim J, Stamey TA, Sellers WR, Loda M, Meyerson M, Hruban R, Jen J, Polyak K. Fre-quent HIN-1 promoter methylation and lack of expression in multiple human tumor types. Mol Cancer Res 2004; 2: 489-494

12 Wong TS, Kwong DL, Sham JS, Tsao SW, Wei WI, Kwong YL, Yuen AP. Promoter hypermethylation of high-in-normal 1 gene in primary nasopharyngeal carcinoma. Clin Cancer Res 2003; 9: 3042-3046

13 Lehmann U, Berg-Ribbe I, Wingen LU, Brakensiek K, Becker T, Klempnauer J, Schlegelberger B, Kreipe H, Flemming P. Distinct methylation patterns of benign and malignant liver tumors revealed by quantitative methylation profiling. Clin Cancer Res 2005; 11: 3654-3660

14 Guo M, Ren J, Brock MV, Herman JG, Carraway HE. Pro-moter methylation of HIN-1 in the progression to esophageal squamous cancer. Epigenetics 2008; 3: 336-341

15 Blin N, Stafford DW. A general method for isolation of high molecular weight DNA from eukaryotes. Nucleic Acids Res 1976; 3: 2303-2308

16 Herman JG, Graff JR, Myöhänen S, Nelkin BD, Baylin SB. Methylation-specific PCR: a novel PCR assay for methyla-tion status of CpG islands. Proc Natl Acad Sci USA 1996; 93: 9821-9826

17 Gorringe KL, Ramakrishna M, Williams LH, Sridhar A, Boyle SE, Bearfoot JL, Li J, Anglesio MS, Campbell IG. Are there any more ovarian tumor suppressor genes? A new per-spective using ultra high-resolution copy number and loss of heterozygosity analysis. Genes Chromosomes Cancer 2009; 48: 931-942

18 Franko J, Krasinskas AM, Nikiforova MN, Zarnescu NO, Lee KK, Hughes SJ, Bartlett DL, Zeh HJ 3rd, Moser AJ. Loss of heterozygosity predicts poor survival after resection of pancreatic adenocarcinoma. J Gastrointest Surg 2008; 12: 1664-1672; discussion 1672-1673

19 Chang YC, Yeh KT, Liu TC, Chang JG. Molecular cyto-genetic characterization of esophageal cancer detected by comparative genomic hybridization. J Clin Lab Anal 2010; 24: 167-174

20 Ye Y, McDevitt MA, Guo M, Zhang W, Galm O, Gore SD, Karp JE, Maciejewski JP, Kowalski J, Tsai HL, Gondek LP, Tsai HC, Wang X, Hooker C, Smith BD, Carraway HE, Her-man JG. Progressive chromatin repression and promoter methylation of CTNNA1 associated with advanced myeloid malignancies. Cancer Res 2009; 69: 8482-8490

21 Shigematsu H, Suzuki M, Takahashi T, Miyajima K, Toyoo-ka S, Shivapurkar N, Tomlinson GE, Mastrangelo D, Pass HI, Brambilla E, Sathyanarayana UG, Czerniak B, Fujisawa T, Shimizu N, Gazdar AF. Aberrant methylation of HIN-1 (high

COMMENTS

Gong Y et al . HIN-1 methylation in gastric carcinoma

533 January 28, 2011|Volume 17|Issue 4|WJG|www.wjgnet.com

in normal-1) is a frequent event in many human malignan-cies. Int J Cancer 2005; 113: 600-604

22 Hamilton JP, Meltzer SJ. A review of the genomics of gastric cancer. Clin Gastroenterol Hepatol 2006; 4: 416-425

23 Chen J, Röcken C, Malfertheiner P, Ebert MP. Recent ad-vances in molecular diagnosis and therapy of gastric cancer. Dig Dis 2004; 22: 380-385

24 Guo M, House MG, Hooker C, Han Y, Heath E, Gabrielson E, Yang SC, Baylin SB, Herman JG, Brock MV. Promoter hyper-methylation of resected bronchial margins: a field defect of changes? Clin Cancer Res 2004; 10: 5131-5136

25 Bernstein C, Bernstein H, Payne CM, Dvorak K, Garewal H. Field defects in progression to gastrointestinal tract cancers.

Cancer Lett 2008; 260: 1-1026 Belshaw NJ, Pal N, Tapp HS, Dainty JR, Lewis MP, Williams

MR, Lund EK, Johnson IT. Patterns of DNA methylation in individual colonic crypts reveal aging and cancer-related field defects in the morphologically normal mucosa. Carcino-genesis 2010; 31: 1158-1163

27 Nyce J, Leonard S, Canupp D, Schulz S, Wong S. Epigenetic mechanisms of drug resistance: drug-induced DNA hyper-methylation and drug resistance. Proc Natl Acad Sci USA 1993; 90: 2960-2964

28 Tian K, Jurukovski V, Wang XP, Kaplan MH, Xu H. Epi-genetic regulation of WTH3 in primary and cultured drug-resistant breast cancer cells. Cancer Res 2005; 65: 10024-10031

S- Editor Sun H L- Editor Ma JY E- Editor Zheng XM

Gong Y et al . HIN-1 methylation in gastric carcinoma