JOURNAL OF VIROLOGY, Nov. 1993, p. 6716-67250022-538X/93/1 16716-10$02.00/0Copyright ©) 1993, American Society for Microbiology

Cell Type-Specific Proteins Which Interact with the5' Nontranslated Region of Hepatitis A Virus RNA

KI HA CHANG, EDWIN A. BROWN, AND STANLEY M. LEMON*

Department of Medicine, The University of North Carolina at Chapel Hill, Chapel Hill, North Carolina 27599-7030

Received 22 February 1993/Accepted 30 July 1993

The 5' nontranslated region (5'NTR) of hepatitis A virus (HAV) RNA contains structural elements whichfacilitate 5' cap-independent initiation of virus translation and are likely to interact with cellular proteinsfunctioning as translation initiation factors. To define these interactions, we characterized the binding ofribosome-associated proteins from several cell types to synthetic RNAs representing segments of the 5'NTR byusing a UV cross-linking/label transfer assay. Four major proteins (p30, p39, p57, and p11O) were identified.p30 and p39 were present in ribosomal salt washes prepared only from HAV-permissive BS-C-1 and FRhK-4cells, while p57 was found only in HeLa cells and rabbit reticulocyte lysates. pllO was present in all cell types.Both p30 and p39 bound to multiple sites within the 5'NTR. Efficient transfer of label to p30 occurred withminimal RNA probes representing nucleotides (nt) 96 to 155, 151 to 354, and, to a much lesser extent, 634 to744, while label transfer to p39 occurred with probes representing nt 96 to 155 and 634 to 744. All of theseprobes represent regions of the 5'NTR which are rich in pyrimidines. Competitive inhibition studies indicatedthat both p30 and p39 bound with greater affinity to sites in the 5' half of the NTR (a probe representing nt1 to 354) than to the more 3' site (nt 634 to 744). Binding of p39 to the probe representing nt 96 to 155 wasinhibited in the presence of an equal amount of proteins derived from HeLa cells, suggesting that p39 sharesbinding site specificity with one or more HeLa cell proteins. A 57-kDa protein in HeLa cell protein extractsreacted with antibody to polypyrimidine tract-binding protein in immunoblots, but no immunoreactive proteinwas identified in a similar BS-C-1 protein fraction. These results demonstrate that ribosome-associatedproteins which bind to the 5'NTR of HAV vary substantially among different mammalian cell types, possiblyaccounting for differences in the extent to which individual cell types support growth of the virus. Mutationsin the 5'NTR which enhance the growth of HAV in certain cell types may reflect specific adaptive responses tothese or other proteins.

Hepatitis A virus (HAV) is a positive-strand RNA virus witha genome length of approximately 7,480 nucleotides (nt) (9, 10,30). Although it has several features in common with otherpicornaviruses, including the general organization of its ge-nome (9, 26, 30, 31), HAV differs from other members of thisvirus family in several important respects. These include,among others, a unique tropism for liver cells, the absence ofboth 2A protease activity and shutdown of host cell macromo-lecular synthesis, and a slow, generally noncytolytic replicationcycle in cell culture (for a review, see reference 25). Inaddition, HAV has little primary nucleotide sequence related-ness to any other picornavirus genus. These and other consid-erations have led to the recent classification of HAV within a

new genus, hepatovirus, of the family Picornaviridae.Picornavirus RNAs, including that of HAV, contain a

lengthy 5' nontranslated region (5'NTR), the 5' end of whichis uncapped and within which there is extensive secondarystructure (1, 7). In addition, numerous AUG triplets precedethe authentic AUG initiator codon located at the start of thelarge open reading frame which encodes the polyprotein (inthe HAV genome, there are at least 10 upstream AUGtriplets). These unusual features reflect the fact that picorna-viruses utilize a novel mechanism for initiation of translationwhich putatively involves direct binding of the 40S ribosomalsubunit to an internal region of the 5'NTR rather than thescanning of ribosomes from the 5' end. The initiation oftranslation by internal entry has been suggested for severalpicornaviruses by a combination of genetic and biochemical

* Corresponding author.

data (2, 19, 20, 23, 32, 33). Similar approaches have beenapplied to the 735-nt-long 5'NTR of HAV. In vitro translationof HAV transcripts having large 5'-terminal deletions revealedthe presence of an element located between nt 352 and 634which was strongly inhibitory to translation, while the intact5'NTR was moderately active in directing translation (7). Suchevidence indirectly suggests the existence of an internal ribo-somal entry site (IRES) within the 5'NTR of HAV. Morerecently, translation studies in rabbit reticulocyte lysates pro-

grammed with dicistronic constructs demonstrated that the5'NTR sequence located between bases 151 and 735 of HAVis capable of directing internal entry and initiating translationof a downstream reporter gene (8).

Efficient translation of poliovirus RNA in rabbit reticulocytelysates requires cellular factors which are present in HeLa cells(6, 14), suggesting that cellular proteins are involved in trans-lation of picornavirus RNAs. Multiple cellular proteins, includ-ing the eukaryotic translation initiation factor eIF-2A, bindspecifically to the 5'NTRs of poliovirus (an enterovirus),encephalomyocarditis virus (EMCV; a cardiovirus), and foot-and-mouth disease virus (FMDV; an aphthovirus) (3, 4, 13, 16,21, 27, 28). A 52-kDa protein present in HeLa cells has beenshown to bind with specificity to nt 559 to 624 of poliovirusRNA (28). Similarly, a 57-kDa protein (p57) present in rabbitreticulocyte lysate was shown to interact with a stem-loopstructure 400 nt upstream of the initiation codon of EMCVRNA (21). This same protein appears to bind to two separatedomains within the IRES of FMDV (27). The binding of p57to poliovirus RNA has also been demonstrated, but its bindingsite has not been precisely mapped (34).

Indirect evidence has suggested that p57 may play an

6716

Vol. 67, No. 11

PROTEINS INTERACTING WITH HAV RNA 5'NTR 6717

important role in the translation of EMCV and FMDV RNAs(21, 27). Recently, Hellen et al. (17) demonstrated that p57protein binding to the IRES of EMCV is identical to that of anuclear polypyrimidine tract-binding protein (PTB), which hasbeen suggested to play a role in the splicing of nuclearpre-mRNAs (15). The addition of anti-PTB antibody to aHeLa cell-free lysate resulted in the inhibition of EMCV andpoliovirus (but not 3-globin) translation, suggesting that PTBmay play an essential role in IRES-directed translation (17).Similarly, Meerovitch et al. (29) have shown that the HeLa p52protein which binds to poliovirus RNA is identical to the Lanuclear autoantigen. The addition of La protein to a rabbitreticulocyte lysate which contains PTB corrected the normallyaberrant translation of poliovirus RNA in this system (29).These data provide strong support for an emerging hypothesisthat the translation of picornavirus RNAs is dependent uponinteractions between a cis-acting element within the 5'NTRand trans-acting cell type-specific factors.These recent findings with other picornaviruses are relevant

to the study of HAV. Wild-type HAV replicates very poorly incell cultures but becomes adapted to growth in a variety of celltypes after serial passage (reviewed in reference 37). These cellculture-adapted variants of HAV are often found to be atten-uated when inoculated into susceptible primates. We haveidentified specific mutations within the 5'NTR of HAV (at nt687 and 152 and/or 203 to 207) which enhance the replicationof the virus in cell culture in a very cell type-specific fashion(11, 12). These observations have prompted us to examine theinteraction of cellular proteins with the 5'NTR of HAV.

MATERLALS AND METHODS

Preparation of cell extracts. Cytoplasmic cell extracts wereprepared from continuous African green monkey kidney (BS-C-1) cells by the procedure of Andino et al. (3). Briefly, cellswere removed from monolayers mechanically, washed withice-cold phosphate-buffered saline, and collected by centrifu-gation at 150 x g for 10 min. Cells were resuspended in 4packed-cell volumes of hypotonic lysis buffer containing 10mM HEPES (N-2-hydroxyethylpiperazine-N'-2-ethanesulfonicacid, pH 7.9), 10 mM KCI, 1.5 mM MgCl2, 0.5 mM dithio-threitol (DTT), and 0.1 mM phenylmethylsulfonyl fluoride(PMSF). The cells were homogenized by 50 strokes with aDounce homogenizer, and the suspension was centrifuged at4,300 x g for 10 min to remove nuclei. The supernatant wascentrifuged at 100,000 x g for 1 h, and the resulting superna-tant was adjusted to buffer A conditions (20 mM HEPES [pH7.9], 100 mM KCI, 1.1 mM MgCl2, 0.37 mM DTT, 0.2 mMEDTA, 0.2 mM PMSF, and 20% glycerol) and frozen inaliquots at -70°C. To isolate ribosome-associated proteins,the 100,000 x g pellet was resuspended in buffer containing0.25 M sucrose, 1 mM DTT, and 0.1 mM EDTA, pH 7.0. Tothis ribosome suspension, 4 M KCl was slowly added to give afinal concentration of 0.5 M. The suspension was held in an icebath for I h, and the ribosomes were removed by centrifuga-tion at 100,000 x g for 2 h (39). The supernatant was dialyzedovernight against buffer A, and aliquots were stored at - 700C(ribosome salt wash). Ribosomal salt washes were similarlyprepared from fetal rhesus kidney (FRhK-4) cells, HeLa S3cells, and a commercial rabbit reticulocyte lysate (Promega,Madison, Wis.).Recombinant glutathione-S-transferase (GST)-PTB fusion

protein and antibody to PTB were generously provided byM. A. Garcia-Blanco and antibody to La was provided by J.Keene, both of Duke University.

Construction of plasmids. Multiple-deletion mutants were

made from cDNA that contained the entire 5'NTR of HAV(HM175/p16 strain) (22). Constructs pA46 (containing the5'NTR sequence inclusive of nt 46 to 744), pA151 (nt 151 to744), pA355 (nt 355 to 744), pA451 (nt 451 to 744), pA533 (nt533 to 744), and pA634 (nt 634 to 744) have been describedpreviously (wild-type HM175 numbering is used throughout)(7). These constructs contain the indicated HAV 5'NTRsegment fused naturally to a truncated HAV P1 polyproteincoding region, within an SP6 transcription vector. An addi-tional deletion mutant, pA533(A543-663), was made by diges-tion of pA533 with BamHI and treatment with nuclease Bal 31.The resulting DNA was made blunt ended by incubation withthe Klenow fragment of Escherichia coli DNA polymerase Iand religated. The extent of the internal deletion (nt 543 to663) was determined by dideoxy nucleotide sequencing. Thesynthesis of an RNA probe terminating at nt 99 was madepossible by introduction of an NlaIV site at this position bypolymerase chain reaction-mediated site-directed mutagene-sis. This plasmid (pA-NlaIV) was kindly provided by David R.Shaffer. p96-155 was generated from pA46 by polymerasechain reaction with the genomic sense primer 5'-'Tl'GCCTAGGCTATAGGCTCCAT and anti-genomic sense primer5'-TCAACCTGCAGGAACCAATAThF`TA. The amplifiedDNA fragment was digested with NlaIV, electrophoresed on a1.5% agarose gel, and ligated into pGEM3Zf(-) that hadbeen cleaved with HindIII and BamHI and blunt ended. Itsinsertion in the correct orientation was determined by se-quencing. For synthesis of control EMCV RNA probes, acDNA fragment corresponding to nt 260 to 488 of the 5'NTRof EMCV RNA was excised from plasmid pCITE (Novagen,Madison, Wis.) at the EcoRI and HindIll sites and insertedinto pGEM3Zf(-) to create pEM.RNA transcription. To generate HAV 5'NTR RNA probes

by runoff transcription, purified plasmid DNAs were linearizedwith appropriate restriction enzymes: probes terminating at nt45 were synthesized from DNA digested with NcoI; nt 99,NlaIV; nt 155, SmaI; nt 268, EaeI; nt 354, HpaI; nt 532, NsiI;nt 633, BamHI; and nt 744, XbaI (Fig. IA). Transcriptionreactions were carried out with SP6 RNA polymerase (Pro-mega) and 32P-labeled UTP (3,000 Ci/mmol; DuPont) asdescribed by the supplier. For synthesis of EMCV RNA,plasmid pEM was linearized with HindIlI and transcribed withT7 polymerase (Promega). RNA transcripts were digested withRNase-free DNase I at 37°C for 15 min, and unincorporatednucleotides were removed by gel filtration with Sephadex G-50(Pharmacia, Piscataway, N.J.).UV cross-linking of RNA-protein complexes. Protein-RNA

binding reactions were carried out in a 60-,ul volume contain-ing 32P-labeled RNA (2.5 x 106 to 3.0 x 106 cpm) and 1 to 3jLg of protein in binding buffer (5 mM HEPES [pH 7.9], 25 mMKCl, 2 mM MgCl2, 1.75 mM ATP, 6 mM DYT, 0.05 mMPMSF, 0.05 mM EDTA, 30 jig of E. coli tRNA, 5% glycerol).Samples were transferred to ice and irradiated for 30 min witha UV light source (254 nm, 5.3 W; Phillips GIOT5-1/2L lamp)at a distance of 2 to 4 cm. After irradiation, RNA was digestedwith 20 ,ug of RNase A and 20 U of RNase T1 at 370C for 30min. The UV-cross-linked products were separated on adiscontinuous 10% polyacrylamide-sodium dodecyl sulfate(SDS) gel. The gel was fixed, dried, and exposed to X-ray filmat - 700C.

Mobility shift gel electrophoresis assay. Binding reactionswere carried out in a 15-,ul volume containing 2P-labeledRNA (5 x 104 cpm) and cytoplasmic extract (2 ,ug of protein)under the conditions described above. After incubation at 30°Cfor 10 min, the mixture was electrophoresed through a nonde-

VOL. 67, 1993

6718 CHANG ET AL.

(A)IVa

532-543

Va

-63

354- [soIIa

45 99 151 IhIc

- 2683IhIb

(B)100 200 300 400 500 600 700

1-354 I - -1-99-3-46-266 r-- U46-633 - -

96-155 -151-354-U----

355-532533-744-

533-744(A543-663).-........634-744-

FIG. 1. RNA probes synthesized for UV cross-linking(A) Schematic representation of the proposed secondarthe HAV 5'NTR (not to scale) (7). Major structuralindicated by roman numerals I to VI, and individual steneach domain are designated by lowercase letters (e.g., Ipotential initiation codons (AUG-il and AUG-12) aresboxes, and pyrimidine-rich tracts (defined as continuou:least eight pyrimidines and contiguous pyrimidines incluthan a single purine) are shown as thick lines. Stippled repotential Watson-Crick base pairs, which may respseudoknots (7). The positions of restriction sites useiplasmid constructs and RNA substrates are number,numbering). (B) Linear representation of RNA probc(nucleotide positions) are shown at the top. Probes arethe left according to their 5' and 3' limits, and the e.transfer to p30 and p39 in UV cross-linking studies is inright. + +, very strong to absent (-). The dotted lirdeletion, and the thick lines indicate the locations of p]tracts, defined as above.

naturing 6% polyacrylamide gel. The gel wascomplexes were visualized by autoradiography.Immunoblot analysis. Cell extracts (S100 fractii

somal salt wash) were separated on a 10% polySDS gel and transferred electrophorectically todene difluoride membrane. Immunoreactiveidentified after successive incubations with rabbitPTB and goat anti-rabbit immunoglobulin G (IgGconjugated with horseradish peroxidase (Bethes(Laboratories). Detection was done by enhancednescence (Amersham).

RESULTSBSoC-1 cell proteins which bind to the 5'Nfl

Interactions between proteins present in the

E E E E E E E E0 0 0 U0 0 0 0

N 0 U0 N Lfl0 U0

_r v r

QQiovckDa97.4 -

66.2 -

42.7 -b

33

31.0 -

Vc

V7 FIG. 2. Transfer of label to BS-C-1 cell ribosomal salt wash pro-744 teins after UV cross-linking to RNA probes representing nt 1 to 354

and 355 to 744 under conditions of increasing potassium chlorideconcentration.

ribosomal salt wash and the HAV 5'NTR were initially de-nts Tafe tected in a UV cross-linking/label transfer assay by using two

p3O p39 RNA probes which together span the 5'NTR. These RNA++ ++ probes, which represented nt 1 to 354 and 355 to 744 of the

- - 5'NTR, were uniformly labeled with [32P]UTP and incubated++ ++ with the ribosomal salt wash in binding buffer. The reaction++ (+ mixtures were subsequently exposed to a UV light source and

_- .(+) extensively digested with RNase prior to separation by SDS-_ polyacrylamide gel electrophoresis (PAGE). Label transfer, as--+ a measure of the binding of proteins to these RNA probes,

(+)(+) identified two putative protein species with apparent molecularg experiments. masses of approximately 30 kDa (p30) and 39 kDa (p39) (Fig.ry structure of 2). The p30 and p39 bands were completely eliminated bydomains are incubation with pronase (1 ,ug) prior to SDS-PAGE (data not

n-loops within shown), indicating that they did in fact represent proteins[IIa). The two identified by the transfer of label from the RNA probes. LabelIhown as open transfer to the p30 protein was much greater with the RNAiding no more probe representing nt 1 to 354 than with the probe represent-gions indicate ing nt 355 to 744. In contrast, although somewhat greater labelsult in RNA transfer to p39 was observed with the nt 1 to 354 probe, thisd to generate protein appeared to bind efficiently to both probes. A very lowed (wild-type level of label transfer from both probes to a third protein (110es. Map units kDa; p11O) was also noted (Fig. 2; also see below). In otherdesignated at experiments, we observed transfer of label to p30, p39, and

dicated at the p110 from RNA probes representing the entire 5'NTR (nt 1 toe indicates a 744) as well as the segment spanning nt 46 to 633 (data notyrimidine-rich shown). The binding of p30 to RNA representing nt 1 to 354

occurred over a wide range of potassium concentrations (25 to150 mM) (Fig. 2). In contrast, the binding of p39 was markedlydecreased at 50 mM potassium and was not detected at higher

dried, and potassium concentrations (100 and 150 mM), indicating thatlow ionic strength favors p39 binding to RNA.

on and ribo- These data thus suggest that several ribosome-associatedracrylamide- proteins from HAV-permissive cells bind to regions within thea polyvinyli- HAV 5'NTR. The most clearly identified proteins (p30 andPTB was p39) appeared to have different RNA-binding requirements. In

anti-murine addition, the fact that p39 bound to two RNA probes repre-r) antibodies senting contiguous but nonoverlapping halves of the 5'NTRda Research suggests that p39 may recognize multiple sites within the viralchemilumi- RNA.

RNA binding sites for p30 and p39. To localize the bindingsites of the p30 and p39 proteins more precisely, we carried outadditional cross-linking studies with a variety of RNA probesrepresenting different segments of the 5'NTR. The probes

rR of HAV. were designed to contain particular sequence motifs and/orBS-C-1 cell secondary-structure elements based on the proposed second-

J . VlIROL.

PROTEINS INTERACTING WITH HAV RNA 5'NTR 6719

CD

um co t et X teLOCD .X - LO N - N

(D {DC

e

CD Id' en en LX)t D

kDa97.4

66.2

42.7

3t.0

FIG. 3. Label transfer to BS-C-I cell ribosomal salt wash proteinsafter UV cross-linking to a variety of RNA probes representingdifferent segments of the 5'NTR.

ary structure of the 5'NTR (Fig. 1) (7). These experimentsconfirmed that binding and transfer of label to p30 was greatestwith probes derived from the 5' 354 nt of the NTR (Fig. 3).RNA probes corresponding to nt 46 to 268, 96 to 155, and 151to 354 transferred label to p30 as efficiently as the larger, nt 1

to 354 probe did, indicating that each of these smaller RNAsegments contains p30 binding activity. The RNA sequences

represented by two of these smaller probes (nt 96 to 155 and151 to 354) overlap each other minimally, suggesting that eachof these segments of the 5'NTR contains a distinct p30 bindingsite. Cross-linking reactions with RNA representing nt 1 to 99resulted in a strongly labeled molecule slightly larger than p30(30.5 kDa), making it difficult to determine the extent of labeltransfer from this probe to p30 (Fig. 3). However, preliminaryexperiments carried out with a HeLa cell ribosomal salt wash(see below) indicated that the 30.5-kDa band was at leastpartially resistant to pronase (data not shown), suggesting thatit may in fact represent RNA tertiary structure having a highlevel of RNase resistance. Interestingly, this region of the5'NTR may contain two RNA pseudoknots (7).As was the case with p30, efficient label transfer to p39

occurred with RNA probes representing nt 1 to 354, 96 to 155,and 46 to 268 (Fig. 3). However, RNA representing nt 151 to354 did not transfer label efficiently to p39, even though thisprobe did bind p30. There was no label transfer from RNArepresenting nt 1 to 99 to p39. These data support theconclusion that p30 and p39 either have different RNA-bindingrequirements or different efficiencies of label transfer andsuggest that high-affinity binding of p39 within the 5' half of theNTR is restricted to the sequence between nt 99 and 150. It is

of interest that this segment of the 5'NTR is very rich inpyrimidines and unlikely to form conventional Watson-Crickpairs with bases elsewhere in the 5'NTR (7). Label transfer top39 also occurred with a probe representing the 3' half of theNTR (Fig. 2). However, probes derived from the 3' half boundp39 relatively weakly, making it difficult to definitively identifya p39 binding site(s) within this region. Relatively weak andinconsistent transfer of label to p39 was noted with probesrepresenting nt 355 to 744, 533 to 744, 533 to 744(A543-663),and 634 to 744 (Fig. 2 and 3). These data suggest that, withinthe 3' half of the NTR, the RNA sequence between nt 664 and744 contains an element which binds p39. However, weaktransfer of label from the probe representing nt 355 to 532 wasalso noted in some experiments (data not shown). The resultsof label transfer experiments with a variety of probes are

summarized in Fig. lB.

Probe 1-354 634-744

Competing RNA 634-744 1-354

oX X

C

xC-x 00 C-x 00 0 0 0 0 0 0Z I* N Z CC-m

kDa97.4 --

66.2 -

42.7

31.0

FIG. 4. Competition between labeled RNA probes representingthe 5' (nt 1 to 354) and 3' (nt 634 to 744) protein-binding sites andincreasing quantities of unlabeled competing RNAs representing nt634 to 744 or 1 to 354 for binding and transfer of label to proteinspresent in the BS-C-1 cell ribosomal salt wash. The relativc molarexcess of unlabeled RNAs is indicated for each rcaction mix. Unla-beled RNA competitors were incubated with proteins for 1) min at30(C prior to the addition of labeled RNA.

Similar UV cross-linking studies were carried out withcytoplasmic cell extracts (rather than ribosomal salt wash)prepared from BS-C-1 cells (data not shown). These experi-ments demonstrated label transfer to the p30, p39, and p1 10proteins, indicating that these proteins were also present in thecell extract. However, these experiments also identified anadditional protein having an approximate mass of 43 kDa andbinding specificities similar to those of p39. This protein wasnot identified in UV cross-linking experiments with ribosomalsalt wash. It is curious that we failed to identify transfer of labelfrom any probe to a protein of 52 kDa, consistent with the sizeof La. La is present only in low concentrations, if present at all,in ribosomal salt wash preparations (29). However, we did notobserve transfer of label to La even with cross-linking of HAVRNA to BS-C-1 cytoplasmic proteins (S100 fraction). Ladegradation products similar in size to the 43-kDa protein havebeen noted by others (29), but immunoblot analysis did notreveal proteins that were immunoreactive with anti-La anti-bodies in the BS-C-I cytoplasmic extract (data not shown).

5' and 3' binding sites compete for p39 binding. To deter-mine whether the p39 proteins interacting with the 5' (nt 99 to150) and 3' (nt 664 to 744) binding sites were idcntical,competition experiments were carried out with RNA probesrepresenting nt I to 354 and 634 to 744 (Fig. 4). Theseexperiments demonstrated that a 200-fold molar excess ofunlabeled RNA representing nt 634 to 744 was required toprevent transfer of label from the labeled nt 1 to 354 probe top39. In contrast, only a 10-fold molar excess of unlabeled RNArepresenting nt 1 to 354 was required for effective competitionwith the nt 634 to 744 probe. These data indicate that the39-kDa proteins binding to these two segments of the 5'NTRare identical. Furthermore, they confirm that the differences inefficiency of label transfer to p39 that were observed withprobes derived from the 5' and 3' halves of the 5'NTR (Fig. 3)are due to higher-affinity interactions of p39 with the 5' bindingsites and not to differences in the efficiency of UV cross-linkingor label transfer per se. Similar results were observed incompetition experiments with RNA transcripts representing nt46 to 268 and 533 to 744 (data not shown), indicating that theability of RNA transcripts to compete for p39 binding was notrelated to their length.

VOL. 67, 1993

6720 CHANG ET AL.

In contrast to these findings, the transfer of label from the nt1 to 354 probe to p30 was not reduced even in the presence ofa 500-fold molar excess of unlabeled RNA representing nt 634to 744 (Fig. 4). These data are consistent with the earliercross-linking studies, which indicated that probes derived fromthe 3' half of the NTR have only a very low affinity for thisprotein (Fig. 2 and 3). Similarly, the transfer of label from thent I to 354 probe to p110 was also not reduced in the presenceof a 500-fold excess of unlabeled nt 634 to 744 RNA, eventhough the nt 634 to 744 probe transferred label to this proteinafter UV cross-linking and RNase digestion (Fig. 4). However,transfer of label to pI10 from the nt 634 to 744 probe wasinhibited in the presence of only a 10-fold excess of unlabelednt 1 to 354 RNA. The data shown in Fig. 4 thus indicate thatall three proteins (p30, p39, and pl 10) have substantiallygreater affinity for RNA transcripts representing nt 1 to 354than for RNA transcripts representing nt 634 to 744. However,these competition experiments do not rule out the possibilitythat these proteins may bind to the 5' half of the NTR in acooperative fashion and that the binding of any of theseproteins might be dependent upon the presence of anotherprotein in the RNA-protein complex.

p30 and p39 also bind to the 5'NTR of a cardiovirus. Wehave suggested previously that the secondary structures of the5'NTRs of HAV, cardiovirus, and aphthovirus RNAs containseveral relatively well conserved elements that may havesimilar functions (7). We were somewhat surprised, therefore,that UV cross-linking experiments did not demonstrate thebinding of a 57-kDa protein (p57) to HAV RNA, as multipleinvestigators have demonstrated the binding of such a proteinto the 5'NTR of EMCV and FMDV by using protein extractsprepared from a variety of cells (4, 21, 27). To determinewhether the BS-C-l cell extract or ribosomal salt wash con-tained p57, we constructed a plasmid (pEM) containing nt 260to 488 of the EMCV 5'NTR downstream of the T7 promoter.This region of the EMCV 5'NTR is known to bind p57 presentin rabbit reticulocyte lysates and Krebs-2 cells (reported asp58) (4, 21). An RNA probe representing this region of theEMCV 5'NTR was cross-linked to proteins in the BS-C-1 cellribosomal salt wash preparation, and transfer of label tospecific proteins was identified as described above. A controlRNA probe representing HAV nt 634 to 744 was included inthese experiments (Fig. 5). The EMCV RNA probe efficientlytransferred label to both p30 and p39, generating a pattern oflabeled proteins similar to that found with the HAV probe.There was no transfer of label from EMCV RNA to a proteinwith a size consistent with that of p57. These results indicatethat both p30 and p39 bind to the EMCV 5'NTR and suggestthat the BS-C-I protein preparation contained little, if any,p57. Furthermore, a 500-fold excess of unlabeled EMCV RNAcompeted with the HAV probe for binding to p39 and p30, andunlabeled HAV RNA (nt 634 to 744) was similarly able tocompete with the EMCV probe for binding to these proteins(Fig. 5).Compared with the experiment depicted in Fig. 3, which

demonstrated only minimal transfer of label to p30 from theHAV probe representing nt 634 to 744, labeling of this proteinwas readily apparent in this experiment (Fig. 5).HAV RNA binds p57 present in rabbit reticulocyte lysates

and HeLa cells. The data presented in Fig. 5 suggest that theBS-C-1 cell ribosomal salt wash contained little, if any, p57, butthey do not indicate whether any of the HAV probes arecapable of binding this protein. To assess this, we carried outUV cross-linking studies with ribosomal salt wash preparationsmade from HeLa cells and a commercial rabbit reticulocytelysate (Fig. 6). These experiments confirmed that the dominant

Probe HAV EMCVPoe634-744 260-488

CompetingRNA

kDa97.4

66.2

42.7

31.0

0)>

0

=c

4

p3

FIG. 5. Competition between unlabeled competitor RNAs andlabeled probes representing HAV RNA (nt 644 to 744) or EMCVRNA (EMCV nt 260 to 488) for binding and label transfer to p30(arrow) and p39 present in a BS-C-1 cell ribosomal salt wash. Nopicornavirus RNA competitor was present in the first and third lanes,but all reaction mixes contained excess E. coli tRNA.

protein(s) identified by label transfer from the EMCV probewas an apparent doublet migrating with a mass approximating57 kDa (probably PTB) (4, 21). Label was also efficientlytransferred to this protein by several of the HAV probes,indicating that HAV RNA is capable of binding to p57. RNA

A

kDa97.4

66.2

HeLa RSW

U) L t ce '- >-It Cm N Co Nrl N-LO-

e

Dt.)4 - Lh Lbe n e

0 _? au X 0 wus

42 7

3130 *^

RRL RSW

Lfl CD r Ce ~t er

B 'T Taz Ln Ln4n U c en-0)_- C LOC (Dto

kDa97.4

66.2

42.7

31.0 ....

FIG. 6. Label transfer to ribosomal salt wash (RSW) proteinsprepared from HeLa cells (A) and rabbit reticulocyte lysate (RRL) (B)after UV cross-linking to RNA probes representing different segmentsof the HAV 5'NTR (labeled according to the nucleotides included ineach probe) and an RNA probe representing EMCV nt 260 to 488.

J. VIROL.

PROTEINS INTERACTING WITH HAV RNA 5'NTR 6721

probes representing nt I to 354, 96 to 155, and 151 to 354strongly bound HeLa cell p57, while much lesser transfer oflabel to p57 was found with the nt 355 to 744 and 634 to 744probes (Fig. 6A). The HeLa p57 protein thus resemblesBS-C-1 cell p30 with respect to its binding to various HAVprobes (compare Fig. 6A with Fig. 3). In addition to p57, labelwas transferred to a 41-kDa protein (p41) from probes repre-senting nt 96 to 155 and 1 to 354 (Fig. 6).

Remarkably similar proteins were identified by label transferfrom both the EMCV and HAV RNA probes in cross-linkingexperiments done with the HeLa cell and reticulocyte riboso-mal salt wash preparations (Fig. 6A and B). Equally strikingwere the substantial differences between these proteins andthose identified by cross-linkage to proteins present in theribosomal salt wash from HAV-permissive BS-C-1 cells (com-pare Fig. 6 with Fig. 3 and 5). Neither p30 and p39, thedominant proteins demonstrated in cross-linking studies withthe BS-C-1 preparation, was identified in experiments with theHeLa and reticulocyte ribosomal salt washes. However, a smallamount of label was transferred to HeLa and reticulocyteproteins resembling pl 10 with RNA probes corresponding toHAV nt 96 to 155 and 634 to 744 (Fig. 6A and B).BS-C-1 p30 and p39 are distinct proteins and not degrada-

tion products of p57 (PTB). Although extensive degradation ofPTB has not been noted after extraction of most types of cells,nuclear extracts of a murine plasmacytoma cell line were foundto contain a predominant 24-kDa proteolytic fragment of PTB(5). Because the p30 and p39 proteins identified in labeltransfer experiments with the BS-C-1 ribosomal salt washmight similarly reflect proteolytic degradation products of p57,we determined whether rabbit polyclonal antibody to murinePTB (97% amino acid identity with human PTB) (5) couldimmunoprecipitate cross-linked, RNase-digested proteins. Weobtained good precipitation of a recombinant GST-PTB fusionprotein, to which label was transferred after cross-linking toRNA representing nt I to 354, but no precipitation of BS-C-1p30 or p39 (data not shown). However, the results of theseexperiments were inconclusive because there was also noprecipitation of HeLa p57 after label transfer.As an alternative approach, BS-C-1 and HeLa S100 fractions

and ribosomal salt washes were probed in immunoblots withanti-PTB (Fig. 7A). Recombinant GST-PTB fusion proteinwas included in these experiments as a positive control and wasidentified as a band migrating with an expected molecular massof 86 kDa (Fig. 7A, lane 6). HeLa PTB was identified as a57-kDa protein present in an S100 fraction and, along withseveral apparent degradation products, also in a nuclearextract (Fig. 7A, lanes 3 and 5). PTB was not present insufficient quantities for detection in a HeLa ribosomal saltwash (Fig. 7A, lane 4). In contrast, no immunoreactive PTBwas identified in either the BS-C-1 S100 or ribosomal salt washfractions (Fig. 7A, lanes 1 and 2). Because the HeLa andBS-C-1 protein fractions contained similar total quantities ofprotein (12 to 14 pLg per lane in S100 fractions and 3.6 to 4.4 p.gper lane in the ribosomal salt washes), these data providestrong evidence that the BS-C-1 cytoplasmic extract was defi-cient in PTB and that p30 and p39 are not degradationproducts of PTB.

In order to further exclude the possibility that p30 and p39represent proteolytic products of PTB produced by an unusualprotease in BS-C-1 cells, we prepared a ribosomal salt washfrom a mixture of BS-C-1 and HeLa cells. Suspensions of cellsgrown in independent roller bottles were pooled before low-speed centrifugation and resuspension in hypotonic lysis buffer(see Materials and Methods). Similar ribosomal salt washfractions were simultaneously prepared from pure populations

A. B.

In Ir 0 l L

m m ZOakDa97.4

(u

a)

-j

m m

- GST-PTB66.2

- - PTB S.42.7

p39 --T

31.0p30 --

21.5 _1 2 3

1 2 3 4 5 6FIG. 7. (A) Immunoblots of protein fractions isolated from BS-C- 1

cells (lanes I and 2), HeLa cells (lanes 3 to 5), and a recombinantGST-PTB fusion protein (lane 6), probed with rabbit anti-murine PTBantibody and visualized by enhanced chemiluminescence. The ex-pected positions of PTB and GST-PTB are indicated to the right.RSW, ribosomal salt wash; NE, nuclear extract. (B) Label transfer toribosomal salt washes (RSW) after UV cross-linking to the HAV nt Ito 354 RNA probe. Lane 2 contains a ribosomal salt wash preparedfrom a mixture of BS-C-1 and HeLa cells, and lanes I and 3 containribosomal salt washes prepared from pure populations of BS-C-1 orHeLa cells, respectively.

of BS-C-1 and HeLa cells. The relative protein yields of theseribosomal salt wash preparations suggested that there was anapproximately 2:1 ratio of HeLa to BS-C-1 proteins in the saltwash prepared from the mixture of cells. Each of theseribosomal salt washes was used in label transfer experimentswith RNA representing HAV nt I to 354. As shown in Fig. 7B,while only p30 and p39 were identified in the BS-C- I ribosomalsalt wash (lane 1), there was no reduction in the quantity ofp57, and no p30 or p39 was identified in label transferexperiments with the mixed BS-C-1/HeLa ribosomal salt wash(Fig. 7B, compare lanes 2 and 3). These data argue stronglyagainst the possibility that the BS-C-1 cells express a uniqueprotease which is capable of degrading p57 (PTB) in thepresence of PMSF. Neither p30 nor p39 derived from theBS-C-1 cells was evident in Fig. 7B, lane 2. This suggests thatone or more of the HeLa proteins has a higher affinity for theRNA or is present at much higher concentration than p39 orp30 and can thus outcompete the BS-C-1 proteins (see below).FRhK-4 cell proteins which bind to the HAV 5'NTR. In

order to compare RNA-binding proteins from BS-C-1 cellswith proteins from a second HAV-permissive cell line (FRhK-4), we prepared a ribosomal salt wash from FRhK-4 cells foruse in similar UV cross-linking studies. FRhK-4 cells arederived from fetal rhesus kidney and are commonly used forcell culture propagation of the virus. BS-C-1 cells are derivedfrom African green monkey kidney cells. The results of theseexperiments (Fig. 8) demonstrated that FRhK-4 cells contain a

complement of ribosome-associated proteins similar to thosein BS-C-1 cells which bind to segments of the HAV 5'NTR.The HAV probe representing nt 1 to 354 bound to FRhK-4

VOL. 67, 1993

:*p39 J:4i

6722 CHANG ET AL.

FRhK-4 RSW

kDa

97.4

66.2

42.7

31.0 ~ *

FIG. 8. Label transfer to p130, p139, and p1 10 present in a ribosomal

salt wash (RSW) prepared from FRhK-4 cells after UV cross-linking

to RNA probes representing nt 1 to 354 and 634 to 744 of the HAV

5'NTR.

proteins identical in size to p130, p139, and pl110 (Fig. 8). As with

the BS-C-1 protein preparation (Fig. 3), the nt 634 to 744

probe transferred label to FRhK-4 p139 and p110 and, to a

lesser extent, p130. No p57 protein was identified in experi-

ments with the FRhK-4 ribosomal salt wash.

Binding of p139 to RNA representing nt 96 to 155 is inhibited

in the presence of HeLa cell proteins. The UV cross-linking

experiments described above suggested that proteins binding

to the 5'NTR of HAV vary among different cell types. To

confirm these observations and to determine whether different

proteins present in ribosomal salt washes prepared from

different cell types might recognize a common RNA binding

site, a competition experiment was designed in which we

assessed the ability of HeLa cell proteins to inhibit the binding

of p130 and p139 to HAV RNA (nt 96 to 155) (Fig. 9). In a series

of cross-linking reactions, the concentration of BS-C-1 proteins

was kept constant in the face of increasing amounts of HeLa

6

........

42l7

srotandaridcnentrcation ofze 1pce proteins (the0 indict

the fCeLprote sineachpreationrela3)t e t ive4 to

Bindng fp9 tp3N reresntn nt96. to15 i nhbie

exeImentd.Cmetiinsewenribedsomalesaltgesshd(RSW)proteinsbidnconfired these oBServ1atinsHeancell detrmbnine whehe different9prtoei55) preentprtins wribsoadde salwnrashes prneparedon fromastandaren conelltypeso mighBS--1cellnproein (thcomo RNvaueindicate

asesdthetotallmas of HeLa cell proteins tinhibhrecion rltivebinding

mass of BS-C-1 cell proteins). There were no HeLa proteins in the

reaction products loaded into the first (control) lane.

cell proteins (from 0.3- to 1.5-fold mass excess of HeLa-derived proteins). In the absence of HeLa proteins, there wasefficient transfer of label to both p30 and p39, as shown inprevious experiments. Addition of HeLa proteins up to 0.5times the mass of BS-C-1 cell proteins in the cross-linkingreaction did not inhibit the cross-linking of either p30 or p39(Fig. 9). However, the addition of an equal or greater mass ofHeLa proteins to the cross-linking reaction mix effectivelyeliminated label transfer to p39 and resulted in strong labeltransfer only to HeLa p57 and p41. This experiment did notallow an assessment of the ability of HeLa proteins to competewith BS-C-1 p30, because the RNA probe representing nt 96 to155 resulted in label transfer to proteins of similar or lessermolecular mass in the HeLa ribosomal salt wash (see Fig. 6A).These data thus indicate that p39 shares a binding site on HAVRNA with one or more HeLa cell proteins, possibly p57 or p41.Furthermore, the results suggest that the competing HeLaprotein either has greater affinity for the RNA than p39 or ispresent at a higher concentration in the HeLa ribosomal saltwash.Complex formation between stem-loop V and BS-C-1 cell

cytoplasmic proteins. The label transfer experiments describedabove did not provide evidence that two RNA pseudoknotslocated near the 5' end of the 5'NTR (Fig. 1) (7) play animportant role in the binding and transfer of label to cellproteins. The same may be said for a third potentialpseudoknot which is located between bases 633 and 663 (7).Probes derived from the region spanning nt 355 to 744, whileable to bind and transfer label to p39 and, to a lesser extent,p30, did so much less efficiently than probes from the 5' half ofthe NTR (Fig. 3 and 4). This was somewhat surprising, as thisregion appears to constitute the core of the IRES of HAVidentified in studies examining the translation of bicistronicconstructs in vitro (8).To investigate the potential binding of this region of the

5'NTR to cellular proteins, we carried out gel mobility shiftexperiments. A uniformly labeled RNA transcript correspond-ing to a 390-nt fragment of the 5'NTR (nt 355 to 744) was usedas a probe (Fig. 10). In the presence of binding buffer (seeMaterials and Methods), the interaction of this RNA probewith BS-C-1 proteins present in a cytoplasmic extract resultedin a significant mobility shift. Addition of unlabeled RNAcorresponding to nt 1 to 354 failed to block the formation of acomplex (data not shown). However, the mobility shift wassubstantially inhibited by competition with a 100-fold excess ofunlabeled, homologous RNA representing nt 355 to 744 or asmaller segment representing nt 533 to 744. These data suggestthat there was a specific interaction between BS-C-1 cellproteins and HAV RNA spanning nt 533 to 744. There was nocompetition with equivalent amounts of unlabeled RNA rep-resenting nt 451 to 633, 533 to 633, or 634 to 744. In contrastto the RNA segments which successfully inhibited complexformation with the probe, these noncompeting segments donot have the potential to form a complex stem-loop structurenormally present between nt 596 and 708 (domain Va; Fig. 1Aand lower panel of Fig. 10). Together, these data suggest thatthe RNA-protein complex formation detected in this assay mayinvolve protein recognition of specific structural featurespresent within domain V of the 5'NTR. Since the RNAsegment from nt 634 to 744 was able to bind and transfer labelto p30 as well as p39 (Fig. 5) but not capable of competing forcomplex formation in the mobility shift assay, there may be anadditional cellular protein(s) which contributes to this com-plex. Label transfer experiments (Fig. 3) did not suggest thatRNA representing nt 533 to 744 had greater affinity for theseproteins than the smaller probe representing nt 634 to 744,

J. VIROL.

PROTEINS INTERACTING WITH HAV RNA 5'NTR 6723

, CompetingRNA

rl)r S qcl) eslz etAD _

M t Co C -lt 11n n

1- ° U) nm MCOX. Z Z Kr o ur uzw

1u1Z1t1.

587

A

G GUGus 633UAAUGC

GCUC CAGCU UAU GACAG

CUUGUCAGAUAU -- ..AUUG 663UGCGCGGC

uGCUUU uAUGUAUCGUG

UUU GGUGCCUCUGA A

ACGGGGACUCA

AU

735

GCUUAGGGC - AGqUUUUUCCUCAUUCU UAUAAUMUGAACAUG

VIFIG. 10. Gel mobility shift assay demonstrating HAV RNA-pro-

tein interactions near stem-loop Va. 32P-labeled RNA representing

HAV nt 355 to 744 and a cytoplasmic BS-C-1 cell extract were

incubated with and without a 100-fold molar excess of competingRNAs representing various segments of the 5'NTR. Controls (first twolanes) included a lane loaded with the probe alone and the probemixed with the BS-C-1 extract in the absence of binding buffer. Detailsof the RNA secondary structure predicted at the 3' end of the HAV5'NTR (domains V and VI) are shown below (7). The initiator AUGcodons are underlined, and the box A motif of Pilipenko et al. (35) isindicated by the open box.

which would be an alternative explanation for the mobility shiftdata presented in Fig. 10.

DISCUSSION

Multiple lines of evidence suggest that translation of picor-navirus RNAs is initiated by a mechanism involving entry ofthe 40S ribosomal subunit at an internal site located hundredsof nucleotides from the 5' end of the genome. This mechanismis likely to be mediated by the specific interaction of atrans-acting cellular protein(s) with a cis-acting RNA elementwithin the 5'NTR (1, 4, 21). Studies examining the translationof HAV proteins in rabbit reticulocyte lysates programmedwith both monocistronic and dicistronic constructs suggest thatthe translation of HAV RNA is initiated by a similar process(7, 8). In vitro studies with dicistronic constructs indicate thatthe HAV IRES is located within the region spanning nt 151 to735, because this segment of the 5'NTR, when placed withinthe intercistronic space, efficiently initiates translation of adownstream reporter gene. Smaller segments of the 5'NTR do

not have this ability (8). However, recent in vivo studiesexamining 5'NTR-initiated translation within HAV-permissivecells suggest that the 5'NTR of HAV is manyfold less activethan that of EMCV in directing the translation of a reporterprotein (38). These observations have led us to consider thepossibility that the slow and usually noncytopathic replicationcycle of HAV may be related, at least in part, to the presenceof an inefficient IRES, leading to low-level translation of virusproteins. Partial support for this hypothesis comes from thefact that certain mutations accumulating within the 5'NTR ofHM175/p16 virus during its adapation to growth in cell cultureact to enhance virus replication in a very cell type-specificfashion (11, 12). These mutations, which are located at nt 687,152, and/or 203 to 207, are either within the IRES of HAV orvery close to its 5' limit.

Multiple models have been proposed to explain the mecha-nism by which translation is internally initiated on picornavirusRNAs (18, 21, 27, 33, 35). However, it remains uncertainwhether the initial interactions between the 40S ribosomalsubunit and the 5'NTR RNA are dependent upon priorinteractions of the RNA with host cell proteins, direct inter-actions between ribosomal and viral RNAs, or both. In thiscommunication, we describe UV cross-linking experimentswhich were designed to examine interactions between theHAV 5'NTR and ribosome-associated cellular proteins. Weidentified several proteins, present in a ribosomal salt washprepared from HAV-permissive BS-C-1 cells (p30, p39, andpl 10), which appear to interact in a specific fashion with RNAprobes representing segments of the 5'NTR. The p30 and p39proteins were found only in BS-C-1 cells and FRhK-4 cells,which are among the most HAV-permissive continuous celllines available. In contrast, we did not find either proteinpresent in ribosomal salt washes prepared from HeLa cells orrabbit reticulocytes. The HeLa and reticulocyte preparationscontained an alternative RNA-binding protein, p57, which hasa molecular mass similar to that of a protein(s) reported tobind to the 5'NTRs of multiple picornaviruses (4, 21, 27, 34).The results of immunoblotting studies (Fig. 7A) were consis-tent with the recent claim (17) that this protein is identical toPTB (5, 15). Label transfer experiments with EMCV and HAVRNA probes (Fig. 3 and 5), as well as the immunoblot analysisof BS-C-1 cell extracts with anti-PTB antibody, suggested thatBS-C-1 cells (and probably HAV-permissive FRhK-4 cells aswell) contain very little or no cytoplasmic PTB.

Several groups have suggested that p57 (PTB) might play animportant role in cap-independent picornavirus translation(21, 27, 34). Recent studies demonstrating that anti-PTBantibodies inhibit the translation of picornavirus RNAs inHeLa cells and reticulocyte lysates provide further support forthis hypothesis (17). Because p30 and p39 are also present inribosomal salt washes and interact with segments of the 5'NTRwhich are located either within or near the apparent 5' limitsof the IRES of HAV (Fig. 3) (8), it is not unreasonable toconsider the possibility that these proteins may have similar orrelated functions. UV cross-linking studies carried out withmultiple HAV RNA probes suggested that the RNA-bindingspecificities of p30, p39, and p57 are similar but not identical(compare Fig. 3 with Fig. 6). Furthermore, a direct competi-tion experiment demonstrated that the binding of the BS-C-1p39 protein to RNA representing nt 96 to 155 was blocked inthe presence of equal or greater concentrations of HeLaribosome-associated proteins (Fig. 9).The apparent absence of PTB in the BS-C-1 cells suggests

that these cells might not support the internal initiation oftranslation on poliovirus or EMCV RNAs if this processrequires the presence of PTB, as suggested by Hellen et al.

VOL. 67? 1993

6724 CHANG ET AL.

(17). However, this is not the case. We recently examined thetranslational activity of the EMCV IRES in a transformedBS-C-1 cell subline which stably expresses bacteriophage T7RNA polymerase (BT7-H cells) (38). RNA transcripts contain-ing the EMCV IRES were very active in initiating cap-independent translation in these cells and much more activethan transcripts containing the HAV IRES (38). While wehave not yet directly assessed PTB levels in this BS-C-1 subline,these observations suggest that detectable levels of PTB maynot be essential for EMCV translation. If PTB plays a func-tional role in picornavirus translation, it is likely that this rolemay be assumed by some other BS-C-1 protein, possibly p39 or

p30. However, additional studies will be required to determineany role that these proteins play in picornavirus translation.

It is tempting to speculate that the cell type-specific differ-ences that we found in 5'NTR RNA-binding proteins might berelated in some way to differences in the level of permissive-ness of these cells for HAV replication. However, no clearrelationship is yet apparent. Cell culture-adapted HAV doesreplicate, albeit rather poorly, in HeLa cells, which do notcontain detectable quantities of p30 or p39. Furthermore, the5'NTR mutations in HM175/p16 virus enhance growth inBS-C-1 cells but not in FRhK-4 cells (12), even though both ofthese cell types contain p30 and p39 and otherwise appear tohave similar RNA-binding proteins. Nonetheless, it is interest-ing that the mutations which enhance viral replication inBS-C-1 cells (nt 152, 203 to 207, and 687) are located inproximity to the minimal RNA segments shown to be capableof binding p30 and p39 (see Fig. 3). Mutations within the5'NTR of attenuated polioviruses have also been shown toaffect virus replication in a cell type-specific fashion and to leadto cell type-specific differences in viral translation (24).The UV cross-linking studies indicated that the HAV

5'NTR contains multiple binding sites for p30 and p39 (Fig. 3and 6). These observations are reminiscent of the findings ofLuz and Beck (27), who reported that p57 interacts with twodistinct domains located at opposite ends of the IRES ofFMDV. Multiple RNA probes bound and transferred label toboth p30 and p39. However, our results suggest that theseproteins have different optimal ionic conditions for binding toRNA (Fig. 2) and at least subtly different RNA-bindingspecificities as well (Fig. 3). For example, efficient transfer oflabel to p30 occurred with probes representing nt 96 to 155 and151 to 354, while relatively efficient transfer of label to p39occurred with probes representing nt 96 to 155 and 634 to 744.There are substantial differences in the predicted secondarystructures of the two probes which bind p30, and the same istrue for p39 (Fig. 1). This suggests that the binding of theseproteins to RNA may depend primarily on primary, ratherthan secondary, RNA structure. While three RNA probes (nt96 to 155, 151 to 354, and 634 to 744) which bind p30 and/orp39 have little nucleotide sequence identity, each containssignificant pyrimidine-rich tracts (7) (Fig. 1). In some experi-ments, the nt 634 to 744 probe also transferred label to p30(Fig. 5 and 7), and a very small amount of label was occasion-ally transferred from the nt 151 to 354 probe to p39 (data notshown). These observations indicate less than very stringentbinding requirements for either protein and suggest thatpyrimidine-rich tracts may play a role in the binding of both.Such a hypothesis is consistent with the similarities in thebinding profiles of p30, p39, and p57 and with the recent notionthat p57 is identical to PTB (17).The smallest probe capable of binding and efficiently trans-

ferring label to both p30 and p39 was that representing nt 96 to155, which is predicted to be single stranded (7) and containsthe nucleotide sequence AAAIUUUUCCCCUUUCCCUJUU

UCCCUULUCCUAUUCCCUUUGUUUUGCUUGUAAAUAUUAAUU. This segment of the HAV 5'NTR is uniqueamong the 5'NTRs of all picornaviruses. While it is locatedwithin the NTR at a position analogous to the poly(C) tract ofEMCV (7), the 5'NTRs of cardioviruses, aphthoviruses, andenteroviruses do not contain similar, lengthy, mixed pyrimi-dine-rich tracts. This HAV sequence contains multiple reiter-ations of the oligonucleotide sequence (U)UUUCC (under-lined above), which is also present just upstream of theinitiator AUG of HAV, where it represents the box A motif ofPilipenko et al. (35) (Fig. 10). Although the box A nucleotidesappear to be important for translation (at least in the entero-viruses), the RNA segment spanning nt 96 to 155 does notappear to be required for internal initiation of HAV transla-tion in vitro (8), and its function remains unknown. Signifi-cantly, the sequence UUUC has been proposed as a potentialrecognition signal involved in the binding of p57 to otherpicornavirus 5'NTRs (21, 27), and UUUUCC has recentlybeen shown to represent a strong site for binding of PTB (36).

ACKNOWLEDGMENTS

We gratefully acknowledge the assistance of R. W. Jansen in theearly stages of these studies, as well as helpful comments and the giftof PTB and La reagents from M. A. Garcia-Blanco, A. Crow, and J.Keene.

This work was supported in part by grants from the Public HealthService (RO1-AI32599), the U.S. Army Medical Research and Devel-opment Command (DAMD 17-89-Z-9022), and the World HealthOrganization.

REFERENCES1. Agol, V. I. 1991. The 5' untranslated region of picornaviral

genomes. Adv. Virus Res. 40:103-163.2. AlSaadi, S., S. Hassard, and G. Stanway. 1989. Sequences in the 5'

noncoding region of human rhinovirus type 14 RNA that affect invitro translation. J. Gen. Virol. 70:2799-2804.

3. Andino, R., G. E. Rieckhof, D. Trono, and D. Baltimore. 1990. Afunctional ribonucleoprotein complex forms around the 5' end ofpoliovirus RNA. Cell 63:369-380.

4. Borovjagin, A. V., M. V. Ezrokhi, V. M. Rostapshov, T. Y. Ugarova,T. F. Bystrova, and I. N. Shatsky. 1991. RNA-protein interactionswithin the internal translation initiation region of encephalomyo-carditis virus RNA. Nucleic Acids Res. 19:4999-5005.

5. Bothwell, A. L. M., D. W. Ballard, W. M. Philbrick, G. Lindwall,S. E. Maher, M. M. Bridgett, S. F. Jamison, and M. A. Garcia-Blanco. 1991. Murine polypyrimidine tract binding protein: puri-fication, cloning and mapping of the RNA binding domain. J. Biol.Chem. 266:24657-24663.

6. Brown, B. A., and E. Ehrenfeld. 1979. Translation of poliovirusRNA in vitro: changes in cleavage pattern and initiation sites byribosomal salt wash. Virology 97:396-405.

7. Brown, E. A., S. P. Day, R. W. Jansen, and S. M. Lemon. 1991. The5' nontranslated region of hepatitis A virus: secondary structureand elements required for translation in vitro. J. Virol. 65:5828-5838.

8. Brown, E. A., A. J. Zajac, and S. M. Lemon. In vitro characteriza-tion of an internal ribosomal entry site (IRES) present within the5' nontranslated region of hepatitis A virus RNA: comparison withthe IRES of encephalomyocarditis virus. Submitted for publica-tion.

9. Cohen, J. I., J. R. Ticehurst, R. H. Purcell, A. Buckler-White, andB. M. Baroudy. 1987. Complete nucleotide sequence of wild-typehepatitis A virus: comparison with different strains of hepatitis Avirus and other picornaviruses. J. Virol. 61:50-59.

10. Coulepis, A. G., G. A. Tannock, S. A. Locarnini, and I. D. Gust.1981. Evidence that the genome of hepatitis A virus consists ofsingle-stranded RNA. J. Virol. 37:473-477.

11. Day, S. P., and S. M. Lemon. 1990. A single base mutation in the5' noncoding region of HAV enhances replication of virus in vitro,p. 175-178. In F. Brown, R. M. Chanock, H. S. Ginsberg, and R. A.

J VlIROL.

PROTEINS INTERACTING WITH HAV RNA 5'NTR 6725

Lerner (ed.), Vaccines 90: modern approaches to new vaccinesincluding prevention of AIDS. Cold Spring Harbor LaboratoryPress, Cold Spring Harbor, N.Y.

12. Day, S. P., P. Murphy, E. A. Brown, and S. M. Lemon. 1992.Mutations within the 5' nontranslated region of hepatitis A virusRNA which enhance replication in BS-C-1 cells. J. Virol. 66:6533-654(0.

13. del Angel, R. M., A. G. Papavassilliou, C. Fernandez-Tomas, S. J.Silverstein, and V. R. Racaniello. 1989. Cell proteins that bind tomultiple sites within the 5'-untranslated region of poliovirus RNA.Proc. Natl. Acad. Sci. USA 86:8299-8303.

14. Dorner, A. J., B. L. Semler, R. J. Jackson, R. Hanecak, E. Duprey,and E. Wimmer. 1984. In vitro translation of poliovirus RNA:utilization of internal initiation sites in reticulocyte lysate. J. Virol.50:507-514.

15. Garcia-Blanco, M. A., S. F. Jamison, and P. A. Sharp. 1989.Identification and purification of a 62,000-dalton protein thatbinds specifically to the polypyrimidine tract of introns. GenesDev. 3:1874-1886.

16. Gebhard, J. R., and E. Ehrenfeld. 1992. Specific interactions ofHeLa cell proteins with proposed translation domains of thepoliovirus 5' noncoding region. J. Virol. 66:3101-3109.

17. Hellen, C. U. T., G. W. Witherell, M. Schmid, S. H. Sun, T. V.Pestova, A. Gil, and E. Wimmer. 1993. A cytoplasmic 57-kDaprotein that is required for translation of picornavirus RNA byinternal ribosomal entry is identical to the nuclear pyrimidinetract-binding protein. Proc. Natl. Acad. Sci. USA 90:7642-7646.

18. Jackson, R. J., M. T. Howell, and A. Kaminski. 1990. The novelmechanism of initiation of picornavirus RNA translation. TrendsBiochem. Sci. 15:477-483.

19. Jang, S. K., M. V. Davis, R. J. Kaufman, and E. Wimmer. 1989.Initiation of protein synthesis by internal entry of ribosomes intothe 5' nontranslated region of encephalomyocarditis virus RNA invivo. J. Virol. 63:1651-1660.

20. Jang, S. K., H.-G. Krausslich, M. J. H. Nicklin, G. M. Duke, A. C.Palmenberg, and E. Wimmer. 1988. A segment of the 5' nontrans-lated region of encephlomyocarditis virus RNA directs internalentry of ribosomes during in vitro translation. J. Virol. 62:2636-2643.

21. Jang, S. K., and E. Wimmer. 1990. Cap-independent translation ofencephalomyocarditis virus RNA: structural elements of the inter-nal ribosomal entry site and involvement of a cellular 57 kDRNA-binding protein. Genes Dev. 4:1560-1572.

22. Jansen, R. W., J. E. Newbold, and S. M. Lemon. 1988. Completenucleotide sequence of a cell culture-adapted variant of hepatitisA virus: comparison with wild-type virus with restricted capacityfor in vitro replication. Virology 163:299-307.

23. Kuhn, R., N. Luz, and E. Beck. 1990. Functional analysis of theinternal translation initiation site of foot-and-mouth disease virus.J. Virol. 64:4625-4631.

24. La Monica, N., and V. R. Racaniello. 1989. Differences in replica-tion of attenuated and neurovirulent polioviruses in human neu-roblastoma cell line SH-SYSY. J. Virol. 63:2357-2360.

25. Lemon, S. M., and B. H. Robertson. Current perspectives in thevirology and molecular biology of hepatitis A virus. Semin. Virol.,in press.

26. Linemeyer, D. L., J. G. Menke, A. Martin-Gallardo, J. V. Hughes,A. Young, and S. W. Mitra. 1985. Molecular clonong and partialsequencing of hepatitis A viral cDNA. J. Virol. 54:247-255.

27. Luz, N., and E. Beck. 1991. Interaction of a cellular 57-kilodaltonprotein with the internal translation initiation site of foot-and-mouth disease virus. J. Virol. 65:6486-6494.

28. Meerovitch, K., J. Pelletier, and N. Sonenberg. 1989. A cellularprotein that binds to the 5'-noncoding region of poliovirus RNA:implications for internal translation initiation. Genes Dev. 3:1026-1034.

29. Meerovitch, K., Y. V. Svitkin, H. S. Lee, F. Lejbkowicz, D. J.Kenan, E. K. L. Chan, V. I. Agol, J. D. Keene, and N. Sonenberg.1993. La autoantigen enhances and corrects aberrant translationof poliovirus RNA in reticulocyte lysate. J. Virol. 67:3798-3807.

30. Najarian, R., D. Caput, W. Gee, S. J. Potter, A. Renard, J.Merryweather, G. Van Nest, and D. Dina. 1985. Primary structureand gene organization of human hepatitis A virus. Proc. Natl.Acad. Sci. USA 82:267-2631.

31. Paul, A. V., H. Tada, K. von der Helm, T. Wissel, R. Kiehn, E.Wimmer, and F. Deinhardt. 1987. The entire nucleotide sequenceof the genome of human hepatitis A virus isolate MBB. Virus Res.8:153-171.

32. Pelletier, J., M. E. Flynn, G. Kaplan, V. R. Racaniello, and N.Sonenberg. 1988. Mutational analysis of upstream AUG codons ofpoliovirus RNA. J. Virol. 62:4483-4492.

33. Pelletier, J., and N. Sonenberg. 1988. Internal initiation of trans-lation of eukaryotic mRNA directed by a sequence derived frompoliovirus RNA. Nature (London) 334:320-325.

34. Pestova, T. V., C. U. T. Hellen, and E. Wimmer. 1991. Translationof poliovirus RNA: role of an essential cis-acting oligopyrimidineelement within the 5' nontranslated region and involvement of acellular 57-kilodalton protein. J. Virol. 65:6194-6204.

35. Pilipenko, E. V., A. P. Gmyl, S. V. Maslova, Y. V. Svitkin, A. N.Sinykov, and V. I. Agol. 1992. Prokaryotic-like cis elements in thecap-independent internal initiation of translation on picornavirusRNA. Cell 68:119-131.

36. Roscigno, R. F., M. Weiner, and M. A. Garcia-Blanco. 1993. Amutational analysis of the polypyrimidine tract of introns: effectsof sequence differences in pyrimidine tracts on splicing. J. Biol.Chem. 268:11222-11229.

37. Siegl, G., and S. M. Lemon. 1990. Recent advances in hepatitis Avaccine development. Virus Res. 17:75-92.

38. Whetter, L. E., S. P. Day, 0. Elroy-Stein, E. A. Brown, and S. M.Lemon. Low efficiency of the 5' nontranslated region of hepatitisA virus RNA in promoting cap-independent translation in permis-sive monkey kidney cells. Submitted for publication.

39. Woodley, C. L., Y. C. Chen, and K. Gupta. 1973. Purification andproperties of peptide initiation factors from rabbit reticulocytes.Methods Enzymol. 30:141-153.

V()L. 67, 1993