‚Journal of Neurochemistryl.ippincott—Raven Publishers, l‘hiladelphia© 1997 International Society for Neurochemistry

a2,6-Sialyltransferase Gene Transfection intoa Human Glioma Cell Line (U373 MG)

Results in Decreased Invasivity

Hirotaka Yamamoto, Yoichi Kaneko, Abdeihadi Rebbaa, Eric G. Bremer,and Joseph R. Moskal

Chicago Institute for Neurosurgery and Neuroresearch, Chicago, Illinois, U.S.A.

Abstract: Glycosyltransferase gene transfection into celllines has been an approach used successfully to eluci-date the functional role of cell surface glycoconjugates.We have transfected the rat CMP-NeuAc:Gal/31 ‚4GIcNAccn2,6-sialyltransferase (EC 2.4.99.1) gene into a human,tumorigenic, glioma cell line, U373 MG. This transfectionled to a marked inhibition of invasivity, alterations in ad-hesivity to fibronectin and collagen matrices, and inap-propriately sialylated cr3ßl integrin. Adhesion-mediatedprotein tyrosine phosphorylation was reduced in thetransfectants despite increased expression of focal adhe-sion kinase, pl2

5fak Furthermore, the transfectantsshowed a distinct cell morphology, an increased numberof focal adhesion sites, and different sensitivity to cyto-chalasin D treatment than control U373 MG cells. Theseresults suggest that inappropriate sialylation of cell sur-face glycoconjugates, such as integrins, can change focaladhesion as well as adhesion-mediated signal transduc-tion and block glioma cell invasivity in vitro. Key Words:Sialyltransferase—Glioma— Integrin— Invasivity— Focaladhesion kinase.J. Neurochem. 68, 2566—2576 (1997).

Glycosyltransferase gene transfection into cell lineshas been an approach used successfully to elucidatethe functional role of cell surface glycoconjugates.Shifting ganglioside biosynthesis from the “a“ to the“b“ pathway by transfection of GD3 synthase (EC2.4.99.8) results in the differentiation of Neuro2A cellsto cholinergic-type neurons (Kojima et al., 1994).UDP-GlcNAc, cr-mannoside ~3-l‚6-N-acetylglucosam-inyltransferase V (GnT-V) (EC 2.4.1.155), a glyco-syltransferase that determines the branching structureof complex-type N-linked oligosaccharides, has beencorrelated with metastatic potential in colon carcino-mas. Transfection of this enzyme into fibroblast orepithelial cell lines resulted in increased metastatic po-tential of these cells (Demetriou et al., 1995). Morerecently, transfection of UDP-GlcNAc, /3-mannoside/3-1,4-N-acetylgl ucosaminyltransferase III (GnT-ITl)(EC 2.4.1.144), into melanoma cells also produced

a marked decrease in metastasis (Yoshimura et al.,1995).

There are at least two sialyltransferases that transfersialic acid to the nonreducing termini of sugar chainsof N-linked glycoproteins. One is CMP-NeuAc:Galßl,4GIcNAc ct2,6-sialyltransferase (cr2,6-ST; EC2.4.99.1), and the other is CMP-NeuAc:Galßl,3(4)-G1cNAc a2,3-sialyltransferase (cr2,3-ST; EC 2.4.99.6).These transferases have been shown to be cell-typespecific and appear to modulate various important cel-lular processes. a2,6-ST has been reported to play akey role in oncogenic transformation (Le Marer et al.,1992), metastatic potential (Bresalier et al., 1990; LeMarer and Stehelin, 1995), and differentiation of coloncarcinomas (Vertino-Bell et al., 1994; Dall‘Olio et al.,1995). On the other hand, a2,3-ST is expressed pri-marily in skeletal muscle, brain, and most fetal tissues(Kitagawa and Paulson, 1994), but the biologicalfunction of cr2,3-ST in carcinogenesis is not clear. Wehave previously reported on the expression of both N-linked cr2,6-ST mRNA and ti2,3-ST mRNA in humanbrain tumor specimens and brain tumor cell lines (Ya-mamoto et al., 1995; Kaneko et al., 1996). No a2,6-ST mRNA or a2,6-linked sialoglycoconjugates wereobserved in any gliomas, metastases to the brain, ornormal glia (Kaneko et al., 1995). The a2,3-ST ishighly expressed in malignant gliomas and fetal astro-cytes but could not be detected in normal adult astro-

Received October 25, 1996; revised manuscript received January2, 1997; accepted February 4, 1997.

Address correspondence and reprint requests to Dr. J. R. Moskalat Chicago Institute for Neurosurgery and Neuroresearch. 2515North Clark Street, Suite 800, Chicago, IL 60614, U.S.A.

The present address of Dr. Y. Kaneko is Department of Neurosur-gery, Yamaguchi Red Cross Hospital, Yahatababa 53-l, Yamaguchi.753, Japan.

Abbreviations used: DMEM. Dulbecco‘s modified Eagle‘s nie-dium; FTTC, fluorescein isothiocyanate; PBS, phosphate-bufferedsaline; PHA-E, Phaseolus vulgoris erythroagglutinin; PVDF, polyvi-nylidene difluoride; SNA, Sambucus nigra agglutinin: a2,3-ST,CMP-NeuAc:Galßl ‚3 (4)GIcNAc ct2,3-sialyltransferase; ce2,6-ST,CMP-NeuAc:Galß 1 ‚4GIcNAc cu2,6-sialyltransferase.

2566

cs2,6-SIALYLTRANSFERASE GENE REDUCES INVASIVITY 2567

cytes or metastases to the brain (Yamamoto et al.,1995; Kaneko et al., 1996).

In this communication we describe the transfectionolcs2,6-ST into a human glioma cell line (U373 MG).This cell line was chosen as a model for several rea-sons. First, similar to surgical glioma specimens, it istumorigenic anddoes not express a2,6-linked sialogly-coconjugates or a2,6-ST (Yamamoto et al., 1995).Second, adhesion of this glioma cell line to fibronectinor collagen matrices appears to be mediated by thet3/3 I integrïn receptor because no other /3 1 integrins

could be detected (Paulus and Tomm, 1994). The ex-pression of this integrin is increased in glioblastomaswhen compared with normal brain tissue and may playa role in theability of this tumor to infiltrate and invadenormal brain tissue (Juliano, 1993; Giancotti andMainero, 1994). Therefore, we thought that it wouldhe possible to alter the sialylation pattern of cell surfaceglycoconjugates by transfection with a2,6-ST andthereby create a model system to evaluate the roleol cell surface glycosylation on glioma invasivity andadhesivity.

Here we report that ct2,6-ST gene transfectioncaused a marked inhibition of glioma cell invasivityand a significant reduction in adhesivity to theextracel-lular matrix molecules fibronectin and collagen. Thea3ßl integrin was found to contain a2,6-linked sialicacids, and tyrosine phosphorylation of pl

25fak wasblocked in the transfectants despite increased expres-sion of p125tuk message. These data suggest that it is

possible to alter cellular glycosyltransferase expres-sion, in this case by transfection of the a2,6-ST gene,and have a marked effect on glioma invasivity in vitro.

MATERIALS AND METHODS

Cell cultureThe human glioma cell line U373 MG (American Type

Culture Collection, Rockville, MD, U.S.A.) and all transfec-(ants were maintained using Dulbecco‘s modified Eagle‘smedium (DMEM; containing 4.5 g/L glucose) supple-mented with 10% heat-inactivated fetal bovine serum (Whit-taker BioProducts, Walkersville, MD, U.S.A.) at 37°Cin ahumidified 10% CO2 incubator.

TransfectionsHuman glioma U373 MG cells were transfected with the

1.45-kb rat a2,6-ST eDNA (Weinstein et al., 1987). Forthe stable transfections, it was inserted into the pcDNA3expression vector (Invitrogen, San Diego, CA, U.S.A.) atthe EcoRI site. The orientation of the insert was confirmedby ApaI restriction digestion. The pcDNA3/a2,6-ST con-struct was then transfected into U373 MG cells using a cat-ionic liposome system, DOTAP (Boehringer Mannheim, In-dianapolis, IN, U.S.A.). Putative transfectants were then se-lected by antibiotic resistance in cell culture mediumcontaining 800 ~ig/ml G418. After 6 weeks of culture in the

presence of G4l8, the remaining cells were tested for thepresence of a2,6-linked sialoglycoproteins and a2,6-STmRNA expression.

Detection of a2,6-ST mRNA and enzyme activityin transfectants

Northern analysis was performed to detect the expressionof a2,6-ST mRNA in the transfectants. Total RNA was iso-lated from parental U373 MG cells and transfectants usingguanidium isothiocyanate (Chomczynski and Sacchi, 1993)followed by CsCI centrifugation (Chirgwin et al., 1979).Twenty micrograms of total RNA per lane was electropho-resed in a formaldehyde-agarose gel and transferred to Du-ralon nylon membranes (Stratagene, La Jolla, CA, U.S.A.).After UV cross-linking, blots were hybridized with aradiolabeled rat a2,6-ST eDNA probe synthesized by usinga random priming kit (Stratagene) and QuikHyb solution(Stratagene). After washing at 60°C,the blot was exposedto X-OMAT film (Kodak, Rochester, NY, U.S.A.) for 16 h,and the film was then developed (see Fig. 3A). Under thesestringent conditions, the rat cs2,6-ST eDNA probe onlyweakly cross-hybridized with thehuman transcript (data notshown).

The a2,6-ST enzyme activity of the transfectants wasmeasured as described previously (Paulson et al., 1989) us-ing the sugar nucleotide donor CMP-[‘

4C]NeuAc (6,200dpmlnmol; NEN/DuPont, Wilmington, DE, U.S.A.) and asi-alo-~

1-acidicglycoprotein (50 /ig/reaction mixture; Sigma,St. Louis, MO, U.S.A.) as the acceptor. A whole cell extractwas used as the enzyme source, and the enzyme reactionswere done for 30 min at 37°C and terminated by dilutioninto 1 ml of ice-cold 5 mM sodium phosphate buffer, pH6.8. ‘

4C-labeled protein products were immediately separatedfrom unincorporated CMP-[‘4C]NeuAc by Sephadex G-50column chromatography and quantified using a Beckmanmodel LS 6000SE liquid scintillation spectrometer.

Detection of cell surface a2,6-linkedsialoglycoproteins

Expression of cell surface a2,6-linked sialoglycocon-jugates in transfected U373 MG cells was confirmed bystaining with fluorescein isothiocyanate (FITC)-conjugatedSambucus nigra agglutinin (SNA) (Vector Laboratories,Burlingame, CA, U.S.A.) to recognize the terminalNeu5Aca2,6Gal sequenceusing amodification of previouslypublished methods (Lee et al., 1989). In brief, subconfluentcells, grown on 12-mm glass coverslips, were fixed with10% buffered formalin for 20 min at 25°Cfollowed by wash-ing once with phosphate-buffered saline (PBS). The fixedcells were incubated for 15 min at room temperature withPBS containing 10 ‚m.eg/ml FITC-SNA (Vector) and 1% bo-vine serum albumin. After incubation, excess FITC-SNAwas removed by washing the coverslips with PBS threetimes. The cells were mounted in 70% glycerin. Fluores-cence microscopy was performed using a Nikon model 401fluorescence microscope. The pcDNA-transfected cells wereused as controls. FITC- Pha,ceolu.c vulgaris erythroagglutinin(PHA-E) lectin (Vector) was also used as a control to con-firm that the branching of complex-type oligosaccharidestructures in the transfectantremained unchangedafter o2,6-ST transfection. This lectin has been reported to stain “bi-secting-type,“ complex oligosaccharides (Cummings andKornfeld, 1982).

Expression of a~2,6-STprotein in the stabletransfectant

The transfected cells were plated onto 12-mm glass coy-erslips at 70% confluency, washed with PBS twice, and fixedwith 10% buffered formalin for 20 min at room temperature.

J. Neurochein., Vol. 68, No. 6, /997

2568 H. YAMAMOTO ET AL.

The fixed cells were washed with PBS once for 3 min andincubated with 1% Nonidet P-40 (Sigma) in PBS for 10 minfollowed by washing twice with PBS for 3 mm, all at roomtemperature. The cells were then incubated with affinity-purified anti-rat ~2,6-ST antibody (1:200 dilution) in 10%normal goat serum for 15 min at room temperature. Afterwashing with PBS three times, the cells were incubated withFITC-labeled, anti-rabbit IgG (1:160 dilution; Sigma) inPBS for I h. The cells were washed with PBS three timesto remove unbound secondary antibody and were mountedwith 70% glycerin. Fluorescence microscopy wasperformedusing a Nikon model 401 fluorescence microscope. ThepcDNA3-transfected cells were used as controls.

Subcloning of a2,6-ST-transfected glioma cellsSterile bacterial plates were coated aseptically with SNA

(5 ~sg/ml) in 50 mM Tris-HC1 (pH 9.5), incubated for 2 hat 20°C,and washed three times with 10 ml of 0.15 MNaC1.The plates were then incubated with I mg/ml bovine serumalbumin in PBS at 4°Covernight to block nonspecific bind-ing of the cells. Well-dissociated transfected cells were incu-bated on the SNA-coated plates for 10 min at 20°C.Unboundcells were removed by washing the plate 10 times with PBS.Cells that remained bound to the plate were then allowed togrow by addition of normal culture medium, and cloningrings (Belco Glass) were used to isolate individual clones.

Invasion assayInvasivity of the U373 MG/a2,6-ST-transfected sub-

clones (clones 18, 24, and 35) was examined using a com-mnercial membrane invasion culture system (Hendrix et al.,1989; Paulus and Tomm, 1994). Biocoat Matrigel InvasionChambers (Collaborative Research, Bedford, MA, U.S.A.)consist of two compartments separated by a filter precoatedwith Matrigel (which contains laminin, type IV collagen,entactin, and heparan sulfate). Cell invasion is measured bycounting the number of cells passing to the opposite side ofthe filter (pore size, 8 /sm). Cells (4 X l0~)were platedinto the upper chamber and incubated for 24 h. One-halfmilliliter of U373 MG cell conditioned medium was placedin the lower compartment to facilitate chemoattraction (Hen-drix et al., 1989). lmniunostaining using various integrinantibodies suggested a3ß1 integrin as the predominant inte-grin in U373 MG cells (Paulus and Tomm, 1994). To evalu-ate directly the involvement of a3ßl integrin in invasion,in vitro, an anti-cr3 integrin antibody (Novocastra; cloneVM-2) was used to block glioma invasivity.

Cells that migrated through the Matrigel and through thefilter were fixed in 10% formalin andstained with hematoxy-lin. The membranes were mounted on glass slides, and thecells were counted (Paulus and Tomm, 1994).

Cell adhesion assayCell adhesion to defined matrix components was accom-

plished as previously described (Mosmann, 1983). In brief,flat-bottomed, polystyrene, 24-well plates were incubatedovernight at 4°Cwith 40 ~eg of an extracellular matrix sub-strate in 250 gl of PBS per well. Human fibronectin, humancollagen type I, human laminin, or human vitronectin (Col-laborative Research) were used as substrates. Plates werewashed with 500 fA of 1.0% bovine serum albumin in PBStwice to remove unbound extracellular matrix proteins andalso to block any remaining reactive surfaces. Nonspecificcellular binding was determined using wellscoated only with1 .0% bovine serum albumin. After the plates were washed

with PBS, 5 X l0~cells per well in 250 pI of DMEM wasplated, and the cells were incubated at 37°Cfor 30 min forattachment to the fibronectin substrate. After nonadherentcells were washed off, 25 pI of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (5 mg/mI) was addedto the culture and incubated for 3 h, and then 250 pl ofacidic isopropanol (0.1 M HCI in isopropanol) was addedand mixed completely. Optical density (absorbance at 570nm minus that at 630 nm) was measured to evaluate cellsattached to the substrate. The number of cells without thewashing procedure was defined as 100%.

RESULTS

Stable transfection of the a2,6-ST gene into ahuman glioma cell line, U373 MG

U373 MG was chosen as a suitable cell line fortransfections because it does not express a2,6-STmRNA or cell surface a2,6-linked sialic acid-con-taining glycoproteins (Yamamoto et al., 1995; Kanekoet al., 1996). Thirty percent of the initial transfectantsexpressed a2,6-ST and rt2,6-linked sialoglycoconju-gates (Fig. IC and E) using an anti-a2,6-ST antibodyor SNA lectin, respectively. The transfected cells alsoreacted with PHA-E lectin, which stains bisecting-typecomplex oligosaccharides (Cummings and Kornfeld,1982). There was no difference in the PHA-E stainingbetween transfected and nontransfected cells (Fig. lAand B), These data indicate that there is little or nochange in the branching pattern of the complex N-linked oligosaccharides after a2,6-ST transfection.

To obtain homogeneous populations of cells, thetransfected cells were cloned by panning with SNAlectin. Thirty-six clones were isolated. Three of theseclones were chosen for further analysis. Greater than95% of the cells in each of these three clones dis-played positive, cell surface staining with SNA lectinas well as with affinity-purified anti-a2,6-ST anti-body. The intensity of reactivity, however, differedfor each clone. The data for the most intensely reac-tive clone (no. 35) are shown in Fig. 2A and B.Whereas SNA staining of clone 35 was predominantlyon the cell surface, some cytoplasniic staining wasalso observed (Fig. 2B). Anti-a2,6-ST staining waslocalized to a perinuclear intracellular organelle, con-sistent with Golgi staining (Fig. 2A). The morphol-ogy of this clone appeared to be rounder and lessdendritic than the initial transfectants or controls (Fig.2B and D).

The expression of rat ~2,6-ST mRNA in thetransfectants was confirmed by northern analysis asshown in Fig. 3A. A 2.1-kb transcript was detectedin cells transfected with pcDNA3/a2,6-ST but not inparental cells or pcDNA3-transfected controls. In addi-tion to message expression, a2,6-ST enzyme activitywas determined in each of the isolated clones (Fig.3C). Clone 35 expressed the highest amount of a2,6-ST mRNA and also had the highest relative enzymeactivity. Clone 24 had the lowest relative enzyme activ-ity. Because of the very high expression of a2,6-ST

J. Neurochens., Vol. 68, No. 6, /997

a2, 6-SIALYLTRANSFERASE GENE RED UCES JNVASIVJTY 2569

FIG. 1. Expression of m2,6-ST protein and a2,6-linked sialoglycoconjugates in transfected U373 MG cells. Transfected cells, beforeclonai selection, were grown on glass coverslips, and immunofluorescence microscopy was performed as described in Materials andMethods. The pcDNA3/cn2,6-ST-transfected cells (A, C, and E) and pcDNA3-transfected cells (B, D, and F) were stained with FITC-PHA-E (A and B) to detect bisecting type N-linked structures or anti-ce2,6-ST antibody (C and D) or FITC-SNA (E and F) to detects2,6-linked sialoglycoconjugates.

mRNA in clones 18 and 35, no ~2,6-ST mRNA ap-pears in the lane containing mRNA from clone 24.However, in northern blots that were exposed for 24h, a2,6-ST mRNA can be seen (data not shown).

These data suggest a direct relationship among theamount of mRNA expressed, the level of enzyme activ-ity, and the quantity of cell surface-expressed glyco-protein(s) containing a2,6-linked sialic acids.

FIG. 2. Expression of a2,6-ST protein and a2,6-linked sialoglycoconjugates after subcloning. Fluorescence microscopy of clone 35is shown. Clone 35 cells were stained with anti-ct2,6-ST antibody (A) or FITC-SNA (B). C and D: The corresponding phase-contrastphotomicrographs.

J. Neurochen,., Vol. 68, No. 6, / 997

2570 H. YAMAMOTO ET AL.

FIG. 3. Expression of a2,6-ST mRNA and enzyme activity inU373 MG/a2,6-ST clones. A and B: Total RNA was isolatedfrom parental glioma U373 MG cells, pcDNA3-transfected cells,and three pcDNA3/a2,6-ST-transfected clones (18, 24, and 35)as described in Materials and Methods. Twenty micrograms oftotal RNA per lane was electrophoresed. The 1.45-kb rat a2,6ST cDNA was used for northern analyses (A). To assessa2,6-STexpression caused by transfection artifacts, we used pcDNA3-transfected U373 MG cells as a control. Lane 1, parental U373MG cells; lane 2, U373 MG cells transfected with pcDNA3; lane3, pcDNA3/ct2,6-ST-transfected clone 18; lane 4, clone 24; andlane 5, clone 35. Total RNAstaining was done by ethidium bro-mide (B). C: Relative a2,6-ST enzyme activity expressed by thethree transfected clones. Enzyme activity was determined asdescribed previously (Paulson et al., 1989) and in Materials andMethods. The data were normalized to values in the highestexpressing clone, 35. No cr26-ST enzyme activity was detectedin the parental or in the pcDNA3-transfected cells.

Characterization of cellular behavior oftransfectants

In vitro invasion of transjècted subclones. The threeclones examined were chosen as representative of high,medium, and low c~2,6-STexpressors. Clones 18 and35, the medium and high a2,6-ST expressors, respec-tively, displayed <20% of the invasivity of controlcells (Fig. 4). On the other hand, clone 24, the lowa2,6-ST expressor was threefold more invasive thanclone 18 or 35 but still ‘-~~60%of the value for controlcells. From these results and preliminary studies usingseveral of the clones not presented here it is clearthat there is a correlation between a clone‘s a2,6-STexpression and a reduction in its invasive potential.That is, within the limits of quantitation used in thesestudies, the greater the a2,6-ST mRNA levels, thegreater the cr2,6-ST enzyme activity, the greater thequantity of cell-surface-expressed glycoprotein (s)containing a2,6-linked sialic acids, and the less theinvasivity of the transfectants using an in vitro invasionassay.

The U373 MG cells used in these studies expressprimarily a3ß1 integrin (Paulus and Tomm, 1994).Using this assay system, an anti-a3 integrin antibodywas able to abolish completely the invasion of bothcontrol pcDNA3-transfected cells (Fig. 4) and cr2,6-ST transfectants (data not shown).

In vitro adhesion of transfected cells. The a3ß 1

integrin has been reported to bind to type I collagen,fibronectin, and laminin (Ruoslahti et al., 1994). Theability of the transfected clones to adhere to these ex-tracellular matrix components was compared with thatof untransfected U373 MG cells and pcDNA3-trans-fected U373 MG cells. Adhesion to a vitronectin sub-strate was also examined as a non— a3ßl-mediatedadhesion control. Adhesion was examined after a 30-min incubation of the cells on the coated wells usinga colorimetric assay (Mosmann, 1983). After 30 minof incubation, ~‘-40—50% of the control cells adheredto fibronectin or laminin substrata. On the collagen-coated wells, only 10—20% of the cells adhered. Amarked reduction in adhesion to both fibronectin andtype Icollagen substrata was observed with those cr2,6-ST-transfected clones (Fig. 5) that expressed compara-tively high amounts of a2,6-ST message and enzymeactivity. However, the low a2,6-ST expressing clone(clone 24) showed no significant difference in adhesionto these substrata.

The transfected glioma cells contain Œ3ß1integrins with n2,6-linked sialic acids

Because of the direct involvement of a3ß1 integrinin the adhesion and invasivity of U373 MG cells, weperformed experiments to establish that this integrin,in the transfectants, contains a2,6-linked sialic acids.Abundant SNA staining of both cr3 and ~31 subunitswas detected in the transfected cells, but no SNA stain-ing was observed in control cells (Fig. 6).

The level of cr3/31 integrin protein was determinedto rule out the possibility of altered receptor expression

FIG. 4. In vitro invasion assayof the U373 MG/cr2,6ST transfec-tant. Biocoat Matrigel Invasion Chambers (Collaborative Re-search, Bedford, MA, U.S.A.) were used to evaluate the relativeinvasivity of the transfected subclones compared with pcDNA3‘mock“-transfected controls. When anti-cr3 monoclonal anti-body was added to the cells, >90% of cell invasion was abol-ished in control pcDNA3-transfected cells. The data are average±SEM (bars) values of two separate experiments done in tripli-cate. Values did not vary by >10%.

J. Neuroc‘hem., Vol. 68, No. 6, /997

cr2, 6-SIALYLTRANSFERASE GENE REDUCES INVASIVITY 2571

FIG. 5. In vitro adhesion assay of the U373 MG/a2,6STtransfectant. Human fibronectin- or collagen type I-coated 24-well plates were used to evaluate the relative adhesion of threetransfectants (clones 18, 24, and 35). Compared with a pcDNA3“mock‘ ‘-transfected control, the transfectants showed a reduc-tion in adhesion to both fibronectin substrate (A) and collagentype 1(B). Dataare average ±SEM (bars) values of three valuestaken from a representative experiment.

as an explanation for the changes in adhesion. Similaramounts of 35S-labeled cr3,81 integrin could be immu-noprecipitated from both the control and transfectedcells (Fig. 6). The anti-VLA3 antibody used for thisexperiment recognizes the 140-kDa cr3 subunit andcoimmunoprecipitates a I20-kDa protein, which isconsistent with /31 subunit.

To evaluate the cell surface expression of cr3,81 inte-grin, fluorescence-activated cell-sorting experimentswere performed. These studies showed that there wasno significant difference in its expression in the

FIG. 6. a2,6-Linked sialylation of cr3/Il integrin in the transfec-tant. Clone 18 cells and U373 MG/pcDNA3 cells were incubatedwith methionine-free DMEM and 2 pCi/mI [35S]methionine for16 h, and the cells were harvested. The membrane fraction wasisolated and solubilized with 1 % Nonidet P-40 in 50 mM Tris-HCI (pH 7.6) containing proteinase inhibitors. Three hundredmicrograms of solubilized proteins was used for immunoprecipi-tation with 20 pI of anti-VLA3 monoclonal antibody (Novocastra;clone VM-2) followed by rabbit anti-mouse lgG and protein A-agarose adsorption. Immunoprecipitated proteins were solubi-lized with 2% sodium dodecyl sulfate (SOS) and were loadedon a 6% SOS-polyacrylamide gel. After electrophoresis, the gelwas dried and exposed to x-ray film (lanes 1 and 2). The immu-noprecipitated proteins were also transferred to a PVDF mem-brane after electrophoresis and stained with SNA lectin to detect‚r2,6-linked sialic acids (lanes 3 and 4). Anti-VLA3 antibody rec-ognizes the 140-kDa cr3 integrin subunit and coimmunoprecipi-tates a 120-kDa protein, which is consistent with /31 subunit.cr26-Linked sialylation of cr3/Il integrin molecules was detectedin the transfectant but not in control cells.

transfectants compared with the pcDNA-transfectedcontrol cells (data not shown).

Adhesion-mediated protein tyrosinephosphorylation in the transfected clones

Because binding of integrin receptors to their ligandsstimulates tyrosine phosphorylation (Richardson andParsons, 1995) as well as adhesion to the extracellularmatrix, adhesion-mediated protein tyrosine phosphory-lation was examined in the transfected clones. Thequalitative pattern of phosphorylated proteins in eachof the clones was identical to those of parental U373MG or U373 MG/pcDNA3 cells (Fig. 7). The quantityof tyrosine phosphorylation in the transfected clones,however, was much less than in either of the controls(Fig. 7).

The reduction in adhesion-mediated protein tyrosinephosphorylation in the transfected clones may havebeen due to the reduced expression of integrin-depen-dent signaling molecules, such as focal adhesion ki-nase, p125°tm‘,which is a key tyrosine kinase involvedin integrin-mediated signal transduction (Schwartz,1993; Sankar et al., 1995). One of the proteins thatdisplayed reduced phosphorylation as shown in Fig. 7had a molecular mass of 125 kDa, consistent withpl25~k.Focal adhesion kinase p125°~mRNA was ex-

FIG. 7. Adhesion-mediated protein tyrosine phosphorylation inthe transfected clones. The three subclones and pcDNA3-trans-fected control cells were incubated in fibronectin-coated flasksfor 10 or 30 mm, and unattached cells were removed by washingthree times with cold PBS. The attached cells were then solubi-lized with 200 pI of lysis buffer. The lysate was centrifuged at12,000 g for 5 min to eliminate nonsoluble material. An equalamount of protein (50 fig) from each sample was loaded on a10% sodium dodecyl sulfate-polyacrylamide gel. After electro-phoresis, the proteins were transferred to a PVDF membrane,and the membrane was incubated with 3% nonfat milk at 21°Cfor 30 min. Anti-phosphotyrosine antibody (Upstate Biotechnol-ogy) was then added at a 1:1,000 dilution and incubated at 21°Cfor 1 h. The membrane was then washed three times with PBScontaining 0.05% Tween 20, and the antibody-bound proteinswere detected using an ECL kit (Amersham). Lane 1, parentalU373 MG cells; lane 2, U373 MG cells transfected with pcDNA3;lane 3, clone 18; lane 4, clone 24; and lane 5, clone 35.

J. Neuro,he,,,., Vol. 68, No. 6, /997

2572 H. YAMAMOTO ET AL.

amined by northern analysis (Fig. 8). All transfectedclones showed an increase (~«l0-fold) of p125~kmRNA expression. The content of pi25°~‘protein wasalso increased in these subclones (data not shown)compared with controls. Clearly pl25~~‘expressionwas increased, but it remains to be determined if the125-kDa phosphoprotein is pl2stai<. Nevertheless, theseresults show that, despite the increased expression ofpl25~kin the transfected cells, tyrosine phosphoryla-tion was inhibited in them.

Alteration of actin cytoskeletal assembly and focaladhesion sites in the transfected cells

Integrin-mediated signaling includes tyrosine phos-phorylation of cytoplasmic proteins, such as focal ad-hesion kinase pI ~ and reorganization of integrin—cytoskeletal assemblies (Rosales et al., 1995). Themorphological changes observed in the transfectantsshown in Figs. 1 and 2 may have been due, at least inpart, to alterations in integrin—cytoskeletal assemblies.To examine this possibility, cells were treated withcytochalasin D, to inhibit actin polymerization, andthen stained with an anti-actin antibody (Fig. 9). Underthese conditions. pcDNA3-transfected control cellsmaintained their original bipolar or triangular cell mor-phology and some actin filament structure, whereas thetransfected cells had a distinctively more rounded or

FIG. 8. Induction of focal adhesion kinase (FAK) pl25tm~kmRNAexpression in cc2,6ST-transfected U373 MG cells. A: Northernanalysis was performed with a human FAK cONA probe. HumanFAK cDNA was cloned by using reverse transcriptase-polymer-ase chain reaction and poly(A) RNA from U373 MG cells. Asense primer, ATGGCAGCTGCUACCUGACC (bp 233-254),and an antisense primer, TTCATATTTCCACTCCTCTGG (bp601—571), were used (Clarke and Brugge, 1995). A 369-bp poly-merase chain reaction product (bp 233—601) was cloned intopT7 Blue T vector (Novagen, Madison, WI, U.S.A.) and the DNAsequence of the insert was confirmed bythe dideoxy terminationmethod. The FAK cONA was isolated from the gel after Xbal andBamHl digestion of the vector and used as the template. Twentymicrograms of total RNA per lane was electrophoresed for theanalysis. Lane 1, U373 MG cells; lane 2, U373 MG cells trans-fected with pcDNA3; lane3, pcDNA3/cr2,6-ST-transfected clone18; lane 4, clone 24; and lane 5, clone 35. B: Total RNAstainingby ethidium bromide is shown.

“cobblestone-like“ morphology. On cytochalasin Dtreatment, transfectant cell bodies retracted towardtheir center, and many focal adhesion plaques wereobserved. No actin fibers were detected, and actinstaining was limited to the center of the cell body andthe focal adhesion plaques. These results are consistentwith the idea that the decrease in adhesion-mediatedphosphorylation or the increased expression of Pl

251d~,

both found in our transfectants, may have affected fo-cal adhesion plaque formation and actin cytoskeletalassembly.

DISCUSSION

We have successfully transfected the cr2,6-ST geneinto the human glioblastoma cell line U373 MG. Thesestably transfected cells exhibited several properties thatare different from those of the nontransfected parentalcells: Their invasive potential was reduced; their adher-ence to fibronectin and collagen matrices was reduced;their pattern of focal adhesions was altered; cr2,6-linked sialic acids were detected on their cell surfaces.particularly on the cr3,81 integrin, which is the onlyintegrin expressed in these cells; and integrin-depen-dent signal transduction was altered. These data sug-gested that the reduced invasivity and adhesion foundin the transfectants were caused, at least in part, bythe presence of cr2,6-linked sialic acid on the cr3,81integrin receptor expressed on these cells. Thus, thetransfectants appear to be a viable model system tostudy the effect of altered glycosylation on glioma in-vasivity and adhesion.

Integrins are a superfamily of transmembrane recep-tors that participate in cell—cell and cell—matrix inter-actions (Ruoslahti, 1991; Hynes, 1992; Yamada, 1992;Juliano, 1993; Schwartz, 1993), and the glycosylationof integrin receptors is important for their function.Most of the integrins that mediate adhesion to extracel-lular matrix components contain a common /31 compo-nent. Increased sialylation of the /31 integrin subunithas been correlated with decreased adhesiveness andmetastatic potential (Kawano et al., 1993). Further-more, the ability of cr5,81 receptors to form functionalheterodimers depends on the presence of N-linked oh-gosaccharides (Zheng et al., 1994). Human fibroblastscultured in the presence of 1-deoxymannojirimycin ex-pressed incompletely glycosylated fibronectin recep-tors, and fibronectin adhesion was greatly reduced(Akiyama et al., 1989). Adhesion to fibronectin andcollagen was reduced >50% by treatment of colon car-cinoma cells with 1-deoxymannojirimycin (von Lampeet al., 1993). The cr6/31-dependent binding of B16/Fl0melanoma cells to laminin was nearly abolished whencells were treated with tunicamycin (Chammas et al.,1993). Enzymatic deglycosylation of the cr5,81 integrinreceptor abolished its ability to bind to fibronectin(Zheng et al., 1994). In the experiments performed here,it was found that both subunits of the cr3,81 integrincontainedcr2,6-linked sialic acids after transfection with

J. !Veuroche,n., Vol. 68, No. 6. 1997

cr2, 6-SIALYLTRANSFERASE GENE REDUCES INVASIVITY 2573

FIG. 9. Alteration of actin cytoskeletal assembly and focal adhesion sites in the transfected cells. Human glioblastoma, U373 MG,cells transfected with either pcDNA3 (A and B) or pcDNA3/cr2,6ST (clone 18; C and D) were plated on fibronectin-coated coverslipsand incubated overnight with DMEM containing 10% fetal bovine serum. Cells were treated with 1.25 lU/mi cytochalasin D for 1 hand then fixed with cold methanol for 15 min. After blocking with 10% normaI goat serum, the cells were incubated with anti-actinpolyclonal antibody (Sigma, St. Louis, MO, U.S.A.) at a 1:100 dilution for 15 min at room temperature. After washing with PBS threetimes, the cells were incubated with FITC-labeled, anti-rabbit lgG (1:160 dilution; Sigma) in PBS for 1 h. The cells then were washedwith PBS three times to remove unbound secondary antibody and were mounted with 70% glycerin. Fluorescence microscopy wasperformed using a Nikon model 401 fluorescence microscope. A and C: Phase-contrast photomicrographs. B and D: Actin staining.

(52,6-ST. Only a small amount of /31 subunit was coim-munoprecipitated with the cr3 subunit by an anti-cr3subunit antibody. However, when this same preparationwas stained with SNA hectin, which binds to cr2,6-linkedsialic acids, most of the staining appeared in the /31subunit. Because (a) adhesivity of the parental U373MG cells could be blocked with an antibody to the cr3integrin subunit and (b) the expression of cr2,6-Iinkedsialic acids on the cr3,81 integrin correlated with a de-crease in adhesion of the transfected cells to a fibronec-tin matrix, it is possible that the fibronectin bindingactivity of cr3,81, and possibly the entire /31 family ofintegrins, may be affected by cr2,6-sialylation. Clearly,however, we cannot rule out entirely the possibility thatother cell surface glycoconjugates have altered sialyla-ti()n patterns owing to the transfection and play a rolein the adhesivity of these cells.

The interaction of integrins with extracellular matrixcomponents not only provides a cell with a structurallink with the extracellular matrix but also gives rise tointracellular biochemical signals. Cellular adhesion toand spreading on extracellular matrices result in thetyrosine phosphorylation of several focal adhesionproteins, including paxillin, focal adhesion kinase(pl25~t),and tensin (Schuppan and Ruhi, 1994; Clarkand Brugge, 1995; Richardson and Parsons, 1995; Ro-

sales et al., 1995). Of these, the phosphorylation offocal adhesion kinase has been shown to be a keycomponent in the integrin-mediated adhesion and mi-gration of glioma cells (Sankar et al., 1995). Activationof both focal adhesion kinase and several distinct sig-naling pathways are required for the appearance ofstrong cell adhesion, the turnover of focal adhesionsites (Schwartz and lngber, 1994), and cell migration(Clark and Brugge, 1995; Sankar et al., 1995). North-ern analyses and western blots (data not shown) bothshowed an increase in the expression of focal adhesionkinase in the cr2,6-ST transfectants and a reduction inthe tyrosine phosphorylation of a band with a similarMr to that of pp125°“.This is consistent with inhibitionof focal adhesion kinase autophosphorylation (Rich-ardson and Parsons, 1995; Rosales et al., 1995), be-cause the decrease in phosphotyrosine content ap-peared to be due to decreased activation and not fromthe loss of focal adhesion kinase protein. Moreover,there appeared to be an increase in number of focaladhesion sites in the cr2,6-ST transfectants as revealedby cytochalasin D treatment, consistent with previousstudies that have shown that cells with many focaladhesion sites are also less invasive (Couchman et al.,1982; Rodriguez-Fernandez et al., 1992). Studies arein progress to verify this idea directly.

J. Ne,,roche,n.. Vol. 68, No. 6, /997

2574 H. YAMAMOTO ET AL.

Bissell et al. (1982) have proposed that extracellularmatrices can affect gene expression via chemical andphysical influences on transmembrane receptors,which, in turn, alter mRNA expression with the cy-toskeleton organization and the interaction of chroma-tin with the nuclear matrix. By altering the glycosyla-tion pattern of cr3,81 integrin with the addition of cr2,6-linked sialic acids, we hypothesize that we have alteredthe adhesivity of the integrin, i.e., one of the “trans-membrane receptors“ described above, to the extracel-lular matrix. lt has been reported that an increasedamount of surface sialic acid reduces metastatic tumorattachment to extracellular matrix components (Denniset al., 1982). Changing the glycosylation pattern ofthe integrin, leading to alterations in the structure andbinding properties of the cr3,81 integrin, could lead tothe kinds of conformational changes that would affectits normal signaling functions (Chammas et al., 1993;Kawano et al., 1993). For example, there are reportsthat integrin interactions with extracellular matrix, aswell as cross-linking extracellular matrix with specificanti-integrin antibodies, lead to increased phosphoryla-tion of focal adhesion kinase and focal adhesion kinaseactivity (Sankar et al., 1995). Focal adhesion kinaseis intimately associated with the formation of focaladhesions and the phosphorylation of several focal ad-hesion-associated proteins such as paxillin and tensin(Schuppan and RuhI, 1994; Clark and Brugge, 1995;Richardson and Parsons, 1995; Rosales et al., 1995).Thus, there is a plausible, direct link between alteredintegrin sialylation and the modulation of adhesion viafocal adhesion kinase or related kinases. Moreover,based on the model proposed by Bissell et al. (1982)described above and on a report by Chen et al., (1992),changes in integrin—extracellular matrix interactionscan lead to changes in gene expression. This couldexplain the changes in focal adhesion kinase expres-sion observed in our studies.

lt is surprising that the reduction in invasivity of theU373 MG cells transfected with the cr2,6-ST gene is inapparent contradiction to previously published reportsusing non—CNS-derived cell lines. For example, highcr2,6-sialylation of N-acetyllactosamine sequences inra.s-transformed fibroblasts has been reported to corre-late with high invasive potential (Le Marer and Stehe-lin, 1995), the expression of cr2,6-ST has been corre-lated with the oncogenic transformation of colon mu-cosa (Sata et al., 1991) and the metastatic potential ofcolon carcinomas (Bresahier et al., 1990), and increasedsialylation of metastatic lymphomas has been linkedwith reduced adhesion to extracellular matrix proteins(Dennis et al., 1982). Also, the pretreatment of meta-static colon carcinoma cells with a sialyltransferaseinhibitor resulted in a significant decrease in pulmo-nary metastasis (Kijima-Suda et al., 1986).

Perhaps the discrepancy between those reports andthe data presented here can be explained using recentlydeveloped theoretical models that show an invertedU-shaped relationship between cellular adhesivity and

migration (Lauffenburger, 1989; DiMilla et al., 1991).An increase or adecrease in cellular adhesivity broughtabout by, for example, an alteration in integrin glyco-sylation could enhance cell migration depending onthe initial strength of adhesion between a cell and itssubstratum. Experimental studies by several groupshave given strong support to this idea: An optimaladhesiveness for muscle cell migration on collagen hasbeen identified (DiMilla et al., 1993); concentration-dependent, inhibitory, and enhancing effects of an inte-grin-binding inhibitor on cell motility have been ob-served (Albelda, 1993; Wu et al., 1994); and cell motil-ity of mammary cells across collagen-coated filters wasincreased only in those clones with intermediate levelsof adhesion to collagen (Keely et al., 1995). Further-more, the composition of the extracellular matrix ofthe adult human brain is substantially different thananywhere else in the body (Rouslahti, 1996). Thus, onemight expect that altering the glycosylation patterns ofan inherently highly invasive glioma cell, progressingthrough a unique matrix, could lead to quite differenteffects on its invasive potential than a similar alterationin a nonneuronal cell.

Because it is the highly invasive nature of highlymalignant ghioblastomas that makes them particularlydifficult to treat clinically, manipulation of cell surfaceglycosylation by glycosyltransferase gene transfer maybe a useful approach for the development of noveltherapeutic strategies for the treatment of these tumorsin vivo. The molecular machinery necessary for thebiosynthesis and expression of a functional glycosyl-transferase is undoubtedly very complex, involving ev-ery level of regulational control that is present in acell. It is this very complexity, and thus the numberof possible targets for regulational control, that makesthe manipulation of glycosyltransferases for therapeu-tic ends so attractive. The studies presented here arean early step toward the demonstration that the alter-ation of cell surface glycosylation of tumor cells bythe transfection of specific glycosyltransferase genescan modify their invasivity in a way that may eventu-ally be of clinical significance.

Acknowledgment: The authors would like to acknowl-edge Dr. Karen Colley for providing rat a2,6-ST eDNAand anti-a2,6-ST antibody and Dr. Ching-Ching Sung forfluorescence-activated cell-sorting analysis of the transfec-tants. Work was supported in part by grants from the IllinoisDivision of the American Cancer Society (to FI. Y.), theNational Institutes of Health (NS33383 to E. B.), the Bu-chanan Foundation (to J. M.), the Washington Square Foun-dation (to J. M.), the Brach Foundation (to J. M.), and theFalk Foundation (to J. M.).

REFERENCES

Akiyama S. K., Yamada S. S., and Yamada K. M. (1989) Analysisof the role of glycosylation of the human fibronectin receptor.J. Biol. CI,em. 264, 18011—18018.

Albelda S. M. (1993) Role of intcgrins and other cell adhesion

.1. N,‘uro,he,,,., Vol. 68, No. 6. /997

cr2, 6-SIALYLTRANSFERASE GENE REDUCES INVASIVITY 2575

molecules in tumor progression and metastasis. Lab. Invest. 68,4—17.

Bissell M. J., Hall H. G., and Parry G. (t982) How does theextracet-lular matrix direct gene expression? J. Theor. Biol. 99, 3 1—68.

Brcsalier R. S., Rockwell R. W., Dahiya R., Duh Q-Y., and KimY. 5. (1990) Cell surface sialoprotein alterations in metastaticmurine colon cancer cell tines selected in an animal model forcolon cancer metastasis. Cancer Res. 50, 1299—1307.

(‘hammas R., Veiga S. S., Travassos L. R., and Brentani R. R.(1993) Functionally distinct roles for glycosylation of alphaand beta integrin chains in cell—matrix interactions. Proc. Natl.Acad. Sci. USA 90, 1795—1799.

Chen D., Magnuson V., Hill S., Amaud C., Steffensen B., and KlebeR. J. (1992) Regulation of integrin gene expression by substrateadherence. J. Biol. Che,n. 267, 23502—23506.

(‘hirgwin J. M., Przbyla A. E., MacDonald R. J., and Rutter W. J.(1979) Isolation of biologically active ribonucleic acid fromsources enriched in ribonuclease. Biochemistry 18, 5294—5299.

Chomczynski P. and Sacchi N. (1987) Single-step method of RNAisolation by acid guanidinium thiocyanate-phenol-chloroformextraction. Anal. Biochem. 162, 156—t59.

Clark E. A. and BruggeJ. 5. (1995) Integrins and signal transductionpathways: the road taken. Science 268, 233—239.

Couchman J. R., Rees D. A., Green M. R., and Smith C. G. (1982)Fibronectin has a dual role in locomotion and anchorage ofprimary chick fibroblasts and can promote entry into the divi-sion cycle. J. Cell Biol. 93, 402—4 10.

Cummings R. D. and Kornfeld 5. (1982) Characterization of thestructural determinants required for the high affinity interactionof asparagine-linked oligosaccharides with immobilizedPhaseolus vulgaris leukoagglutinating and erythroagglutinatinglectins. J. Biol. Chem. 257, 11230—11234.

Dall‘Olio F., Chiricolo M., Lollini P., and Lau J. T. (1995) Humancolon cancer cell lines permanently expressing a2,6-siatylatedsugar chains by transfection with rat /3-galactoside cr2,6-sialyl-transferase eDNA. Biochem. Biophy.r. Res. Commun. 211, 554—561.

Demetriou M., Nabi I. R., Coppolino M., Dedhar S., and DennisJ. W. (1995) Reduced contact-inhibition and substratum adhe-sion in epithelial cells expressing GIcNAc-transferase V. J. CellBiol. 130, 383—392.

Dennis J., Wailer C., Timpl R., and Schirrmacher V. (1982) Surfacesialic acid reduces attachment of metastatic tumour cells tocollagen type IV and fibronectin. Nature 300, 274—276.

DiMilla P. A., Barbee K., and Lauffenburger D. A. (1991) Mathe-matical model for the effects of adhesion and mechanics on cellmigration speed. Biophys. J. 60, 15—37.

DiMilla P. A., Stone J. A., Quinn J. A., Albelda S. M., and Lauffen-burger D. A. (1993) An optimal adhesiveness exists for humansmooth muscle cell migration on type IV collagen and fibronec-tin. J. Cell Biol. 122, 729—737.

(iiancotti F. G. and Mainiero F. (t994) Integrin-mediated adhesionand signaling in tumorigenesis. Biochim. Biophy.s‘. Acta 1198,47—64.

Hendrix M. J. C., Seftor E. A., Seftor R. E. B., Misiorowski R. L.,Saba P. Z., Sundareshan P., and Welch D. R. (1989) Compari-son of tumor cell invasion assays: human amnion versus recon-stituted basement membrane barriers. Invasion Metastasis 82,278 —297.

Hynes R. 0. (1992) Integrins: versatility, modutation, and signalingin cell adhesion. Cell 69, lI—25.

Juliano R. L. (1993) The role of /31 integrins in tumors. Semin.Cancer Biol. 4, 277—283.

Kaneko Y., Yamamoto H., Colley K. J., and Moskal J. R. (1995)Expression of Gal /31 ‚4GIcNAc cr2,6-sialyltransferase and cr2,6-linked sialoglycoconjugates in normal human and rat tissues.J. Histochem. Cvtochem. 43, 945—954.

Kaneko Y., Yamamoto H., Kersey D., Coltey K. J., Leestma J. E.,and Moskal J. R. (1996) The expression of Galßl,4G1cNAccr2,6-sialyltransferase and a2,6-linked sialoglycoconjugates inhuman brain tumors. Acta Neuropathol. (Berlin) 9, 284—292.

Kawano T., Takasaki S., Tao T. W., and Kobata A. (t993) Altered

glycosylation of /3 1 integrins associated with reduced adhesive-ness to fibronectin and laminin. Int. J. Cancer 53, 91—96.

Keely P. J., Fong A. M., Zutter M. M., and Santoro S. A. (1995)Alteration of collagen-dependent adhesion, motility, and mor-phogenesis by the expression of antisense 02 integrin mRNAin mammary cells. J. Cell Sei. 108 (Pt. 2), 595—607.

Kijima-Suda I., Miyamoto Y., Toyoshima S., Itoh M., and OsawaT. (1986) Inhibition of experimental pulmonary metastasis ofmouse colon adenocarcinoma 26 sublines by a sialic acid: nude-oside conjugate having siatyltransferase inhibiting activity.Cancer Res. 46, 858—862.

Kitagawa H. and Paulson J. C. (1994) Differential expression offive sialyltransferase genes in human tissues. J. Biol. Chem.269, 17872—17878.

Kojima N., Kurosawa N., Nishi T., Hanai N., and Tsuji S. (1994)Induction of cholinergic differentiation with neunte sproutingby de novo biosynthesis and expression of GD3 and b-seriesgangliosides in Neuro2a cells. J. Biol. Chem. 269, 30451—30456.

Lauffenburger D. A. (1989) A simple model for effects of receptor-mediated cell-substratum adhesion on cell migration. Chem.Eng. Sei. 44, 1903—1914.

Lee E. U., Roth J., and Paulson J. C. (1989) Alteration of terminalglycosylation sequences on N-linked oligosaccharides of Chi-nese hamster ovary cells by expression of ß-galactoside cr2,6-sialyltransferase. J. Biol. Chem. 264, 13848—13855.

Le Marer N. and Stehelin D. (1995) High cs2,6-sialylation of N-acetytlactosamine sequences in ras-transformed rat fibroblastscorrelates with high invasive potential. Glycobiology 5, 219—226.

Le Marer N., Laudet V., Svensson E. C., Cazlaris H., Van Hille B.,Lagrou C., Stehelin D., Montreuil J., Verbert A., and DelannoyP. (1992) The c-Ha-ras oncogene induces increased expressionof /3-galactoside cs2,6-sialyltransferase in rat fibroblast (FR3T3)cells. Glycobiology 2, 49—56.

Mosmann T. (1983) Rapid colorimetric assay for cellular growth andsurvival: application to proliferation and cytotoxicity assays. J.Immunol. Methods 65, 55—63.

Paulson J. C., Weinstein L., and Schauser A. (1989)Tissue-specificexpression of sialyltransferases. J. Biol. Chem. 264, 10931—10934.

Paulus W. and Tomm J. C. (1994) Basement membrane invasionof glioma cells mediated by integrin receptors. J. Neurosurg.80, 515—519.

Richardson A. and Parsons J. T. (1995) Signal transduction throughintegrins: a central role for focal adhesion kinase? Bioessays17, 229—236.

Rodriguez-Fernandez R., Geiger B., Salomon D., and Ben-Ze‘ev A.(1992) Overexpression of vinculin suppresses cell motility inBALB/c3T3 cells. Cell Motif. Cytoskel. 22, 127—134.

Rosales C., O‘Brien V., Komberg L., and Juliano R. (1995) Signaltransduction by cell adhesion receptors. Biochim. Biophys. Acta1242, 7—98.

Ruoslahti E. (1991) Integrins. J. Clin. Invest. 87, 1—5.Ruoslahti E. (1996) Brain extracellular matrix. Glycobiology 6,

489—492.Ruoslaliti E., Noble N. A., Kagami S., and Border W. A. (1994)

Integrins. Kidney mt. Suppl. 44, S l7—S22.Sankar S., Mahooti-Brooks N., HuG., and Madri J. A. (1995) Mod-

ulation of cell spreading and migration by pp125FAK phosphor-ylation. Am. J. Pathol. 147, 601—608.

SataT., Roth J., Zuber C., Stamm B., and Heitz P. U. (1991) Expres-sion of cr2,6-linked sialic acid residues in neoplastic but not innormal human colonie mucosa. Am. J. Pathol. 139, 1435—1448.

Schuppan D. and RuhI M. (1994) Matrix in signal transduction andgrowth factor modulation. Braz. J. Med. Biol. Re,r. 27, 2125—2141.

Schwartz M. A. (1993) Signaling by integrins: implications for tu-morigenesis. Cancer Res. 53, 1503—1506.

Schwartz M. A. and lngber D. E. (1994) Integrating with integrins.Mol. Biol. Cell 5, 389—393.

Vertino-Bell A., Ren J., Black J. D., and Lau J. T. (1994) Develop-

J. Neurochem., Vol. 68, No. 6. 1997

2576 H. YAMAMOTO ET AL.

mental regulation of /3-galactosidase cr2,6-sialyltransferase insmall intestine epithelium. Dcv. Bio!. 165, 126—136.

von Lampe B., Stallmach A., and Riecken E. O. (1993) Alteredglycosylation of integnin adhesion molecules in colorectal can-cer cells and decreased adhesion to the extracellular matrix. Gut34, 829—836.

Weinstein J., Lee E. U., McEntee K., Lai P., and Paulson J. C.(1987) Primary structureof/3-galactosidase cs2,6-sialyltransfer-ase. J. Bio!. Chem. 262, 17735—17743.

Wu P., Hoying J. B., Williams S. K., Kozikowski B. A., and Lauf-fenburger D. A. (1994) Integrin-binding peptide in solution in-hibits or enhances endothelial cell migration, predictably fromcell adhesion. Ann. Biomed. Eng. 22, 142—152.

Yamada K. M. (1992) Functions of integnins in cell adhesion andmigration. AIDS Re,c. Hum. Retroviru,ce,c 8, 786—793.

Yamamoto H., Kancko Y., VanderMeulcn D., Kersey D.,Mkrdichian E., Cerullo L., Leestma J., and Moskal J. R.(1995) The expression of CMP-NeuAc:Gal/31,4G1cNAccr2,6 sialyltransfenase and glycoproteins bearing a2,6-linkedsialic acids in human brain tumors. Glycoconjugate J. 12,848— 856.

Yoshimura M., Nishikawa A., Ihara Y., Taniguchi S., and TaniguchiN. (1995) Suppression of lung metastasis of B 16 melanomaby N-acetylglucosaminyltransferase Ill gene transfection. Proc.Nat!. Acad. Sei. USA 92, 8754—8758.

Zheng M., Fang H., and Hakomori S. (1994) Functional role ofN-glycosylation in cr5ß1 integnin receptor. De-N-glycosylationinduces dissociation oraltered association of cr5 and /31 subunitsand concomitant loss of tlbronectin binding activity. J. Bio!.C/scm. 269, 12325—12331.

.1. Neijiochen,., Vol. 68, No. 6, 1997