23 4 blackett family dna paternity study. use of short tandem repeats non-coding sections (do not...

18
2 3 4 ACGCAC TTCAGAACGCGTACTGACTGAA TGCGTGAAGTCTTG CGCATGACTGACTT Blackett Family DNA Paternity Study

Upload: jessica-matthews

Post on 17-Dec-2015

332 views

Category:

Documents


2 download

TRANSCRIPT

Page 1: 23 4 Blackett Family DNA Paternity Study. Use of Short Tandem Repeats Non-coding sections (do not code from proteins) Inherited from parents –Individuals

2 3 4

ACGCACT

TCAGAACG

CGTACTGA

CTGAA

TGCGTGAA

GTCTTGCG

CATGACTG

ACTT

Blackett Family DNA Paternity Study

Page 2: 23 4 Blackett Family DNA Paternity Study. Use of Short Tandem Repeats Non-coding sections (do not code from proteins) Inherited from parents –Individuals

Use of Short Tandem Repeats

• Non-coding sections (do not code from proteins)

• Inherited from parents – Individuals have 2

copies (alleles)

Page 3: 23 4 Blackett Family DNA Paternity Study. Use of Short Tandem Repeats Non-coding sections (do not code from proteins) Inherited from parents –Individuals

13 CODIS Core STR Loci with Chromosomal Positions

CSF1PO

D5S818

D21S11

TH01

TPOX

D13S317

D7S820

D16S539 D18S51

D8S1179

D3S1358

FGA

VWA

AMEL

AMEL

Page 4: 23 4 Blackett Family DNA Paternity Study. Use of Short Tandem Repeats Non-coding sections (do not code from proteins) Inherited from parents –Individuals

Short Tandem Repeats• Short repeats of bases in non-coding DNASTRs are short sequences of DNA, normally of length 2-5 base pairs, that are repeated numerous times Example: the 16 bp sequence of "gatagatagatagata" would represent 4 copies of the tetramer "gata".

• Number of STR repeats vary with individualsThe polymorphisms (variations in DNA sequence between individuals) in STRs are due to the different number of copies of the repeat element that can occur in a population of individuals.

Page 5: 23 4 Blackett Family DNA Paternity Study. Use of Short Tandem Repeats Non-coding sections (do not code from proteins) Inherited from parents –Individuals

STR genotyping is performed by comparison of sample data to allelic ladders

Microvariant allele

Page 6: 23 4 Blackett Family DNA Paternity Study. Use of Short Tandem Repeats Non-coding sections (do not code from proteins) Inherited from parents –Individuals

Short Tandem Repeats (STRs)

7 repeats

8 repeats

AATG

Homozygote = both alleles are the same length

Heterozygote = alleles differ and can be resolved from one another

A person inherits a copy (allele) of the STR from each parent.

Page 7: 23 4 Blackett Family DNA Paternity Study. Use of Short Tandem Repeats Non-coding sections (do not code from proteins) Inherited from parents –Individuals

STR-D7S280 1 aatttttgta ttttttttag agacggggtt tcaccatgtt ggtcaggctg actatggagt

61 tattttaagg ttaatatata taaagggtat gatagaacac ttgtcatagt ttagaacgaa121 ctaacgatag atagatagat agatagatag atagatagat agatagatag atagacagat181 tgatagtttt tttttatctc actaaatagt ctatagtaaa catttaatta ccaatatttg241 gtgcaattct gtcaatgagg ataaatgtgg aatcgttata attcttaaga atatatattc301 cctctgagtt tttgatacct cagattttaa ggcc

D7S280 is one of the 13 core CODIS STR genetic loci. This DNA is found on human chromosome 7.The tetrameric repeat sequence of D7S280 is "gata". Different alleles of this locus have from 6 to 15 tandem repeats of the "gata" sequence.

How many tetrameric repeats are present in the DNA sequence shown above? Notice that one of the tetrameric sequences is "gaca", rather than "gata".

Page 8: 23 4 Blackett Family DNA Paternity Study. Use of Short Tandem Repeats Non-coding sections (do not code from proteins) Inherited from parents –Individuals

Blackett Family DNA Study

In this activity, you will learn the concepts and techniques behind DNA profiling of the 13 core CODIS "Short Tandem Repeat" loci used for the national DNA databank. You will then have the opportunity to collect and interpret actual STR data, and to answer one or more of the following questions:1. How is STR data used in a DNA Paternity Test? 2. How can STR data from close relatives be used to create a genetic profile of a missing person? 3. How much genetic diversity exists among siblings? 4. How does one calculate the probability for a specific DNA profile?

Page 9: 23 4 Blackett Family DNA Paternity Study. Use of Short Tandem Repeats Non-coding sections (do not code from proteins) Inherited from parents –Individuals

Blackett Family

Person Family Relationship

Bob Husband – Starting of genealogical chart

Anne Wife

David Son

Katie Daughter

Fred Father

Norma Mother

Karen Sister

Steve Husband of Karen

Tiffany Daughter of Karen and Steve

Melissa Daughter of Karen and Steve

Amanda Daughter of Karen and Steve

Louise Sister of Fred; Bob's Aunt

Bud Husband of Louise

Buddy Son of Bud and Louise

Dick Son of Bud and Louise

Marilyn Daughter of Bud and Louise

Janet Daughter of Bud and Louise

Step 1: Build a family tree

Page 10: 23 4 Blackett Family DNA Paternity Study. Use of Short Tandem Repeats Non-coding sections (do not code from proteins) Inherited from parents –Individuals

Allele. The different forms of a gene. Different STR repeat lengths represent different alleles at a genetic locus, i.e. 8 and 9 are different alleles of the THO1 locus. Locus. The position on a specific chromosome where the different alleles of a genetic marker are located. The plural is loci.

Genotype. The genetic composition of the alleles at a locus. Since we are diploid, we each have two alleles at each locus.

Key Terms

Page 11: 23 4 Blackett Family DNA Paternity Study. Use of Short Tandem Repeats Non-coding sections (do not code from proteins) Inherited from parents –Individuals

Key TermsHomozygous. Both alleles at a locus are the same, i.e. Fred has a genotype of 29, 29 at the D21S11 locus.

Heterozygous. Alleles at a locus are not the same, i.e. Normal has a genotype of 29, 31 at the D21S11 locus. Multiple Allelic Series. Many different alleles at a locus, i.e. the known alleles at the vWA locus are 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, and 21.

Punnett Square. A diagram used to determine all possible genotypes that can occur in a genetic cross.

Page 12: 23 4 Blackett Family DNA Paternity Study. Use of Short Tandem Repeats Non-coding sections (do not code from proteins) Inherited from parents –Individuals

Punnett Square

If the genotypes of both parents are known, we use a Punnett Square to predict the possible phenotypes of their offspring. Each child inherits one allele of a given locus from each parent. Panel (a) - At the D21S11 locus, the children of Bob Blackett and wife Anne can have four different genotypes. Son David is 28, 31. Daughter Katie is 29, 30. Panel (b) - Bob Blackett inherited the 31 allele from his mother, Norma. Therefore the 29 allele is paternal. If Bob's paternal was not 29, what would be your conclusion?

Page 13: 23 4 Blackett Family DNA Paternity Study. Use of Short Tandem Repeats Non-coding sections (do not code from proteins) Inherited from parents –Individuals

Step 2: Analysis of

STR data for the Blackett

family

Examine the chart and table provided to you.

How are the alleles represented? How are the alleles reported?

Page 14: 23 4 Blackett Family DNA Paternity Study. Use of Short Tandem Repeats Non-coding sections (do not code from proteins) Inherited from parents –Individuals

Buddy Dick Marilyn Janet

D3S1358 18, 18 18, 18 15, 16 15, 16

vWA 16, 18 16, 18 16, 17 16, 18

FGA 19, 19 19, 21 19, 21 19, 19

AMEL X Y X Y X X X X

D8S1179 13, 15 13, 15 13, 15 12, 13

D21S11 29, 30 28, 29 29, 30 29, 30

D18S51 12, 18 17, 18 12, 13 17, 18

D5S818 11, 13 10, 12 10, 13 11, 13

D13S317 11, 12 11, 12 11, 12 11, 12

D7S820 10, 10 10, 10 7, 11 10, 10

D16S539 11, 12 9, 11 9, 11 9, 11

THO1 9.3, 10 9.3, 10 6, 9.3 6, 9.3

TPOX 10, 11 10, 11 10, 11 10, 11

CSF1PO 12, 12 11, 12 12, 12 11, 12

• STR Data for Buddy, Dick, Marilyn and Janet

Suggestion: Compare the chart and the table.

How are alleles reported?

Page 15: 23 4 Blackett Family DNA Paternity Study. Use of Short Tandem Repeats Non-coding sections (do not code from proteins) Inherited from parents –Individuals

Step 2 - STR Data for the Blackett Family

• These data are from the actual DNA analysis of the Blackett family members by Bob Blackett. The tracings show the genotypes for three of the 13 CODIS STR loci. In this activity, you will record the data for use in the ensuing genetic analysis of the Blackett family.

1. Collect the data for Bob, Anne, David, Katie, Fred and Norma for the "Paternity Testing with STR" Activity.

2. Collect the data for Karen, Tiffany, Melissa, and Amanda for the "DNA Profile of a Missing Person" Activity.

Page 16: 23 4 Blackett Family DNA Paternity Study. Use of Short Tandem Repeats Non-coding sections (do not code from proteins) Inherited from parents –Individuals

Locus D3S1358 vWA FGA D8S1179 D21S11 D18S51 D5S818

Genotype 15, 18 16, 16 19, 24 12, 13 29, 31 12, 13 11, 13

Frequency 8.2% 4.4% 1.7% 9.9% 2.3% 4.3% 13%

Locus D13S317 D7S820 D16S539 THO1 TPOX CSF1PO AMEL

Genotype 11, 11 10, 10 11, 11 9, 9.3 8, 8 11, 11 X Y

Frequency 1.2% 6.3% 9.5% 9.6% 3.52% 7.2% (Male)

A DNA Profile: The 13 CODIS STR loci As part of his training and proficiency testing for DNA Profile analysis of STR Polymorphisms, Forensic Scientist and DNA Analyst Bob Blackett created a DNA Profile on his own DNA. Here is Bob's DNA Profile for the 13 core Genetic Loci of the United States national database, CODIS (Combined DNA Index System):

Page 17: 23 4 Blackett Family DNA Paternity Study. Use of Short Tandem Repeats Non-coding sections (do not code from proteins) Inherited from parents –Individuals

Step 3: Paternity Testing with STR Data

1. Who are the biological parents of David and Katie? • Do all of the data you have collected on the

genotypes of Bob, Anne, Katie, and David support the conclusion that Bob and Anne are the biological parents of David and Katie? You should justify your answer by reference to the specific genotypes for the STR loci.

Page 18: 23 4 Blackett Family DNA Paternity Study. Use of Short Tandem Repeats Non-coding sections (do not code from proteins) Inherited from parents –Individuals

Step 3: Paternity Testing with STR Data

2. What is the genetic legacy of Fred and Norma? The alleles that Bob passes on to his children have in turn been inherited from Bob's parents, Fred and Norma. Identify the alleles among the 13 CODIS STR loci in the genotypes of Katie and David that have been un-ambigously inherited from each of their paternal grandparents. Now identify any additional alleles that might have been inherited from their paternal grandparents.