2013 army baseball media guide

136

Upload: army-west-point-athletics

Post on 07-Mar-2016

313 views

Category:

Documents


0 download

DESCRIPTION

2013 Army Baseball Media Guide

TRANSCRIPT

  • KevinMcKague

    KyleScogin

    Joey Henshaw

    Zach Price

    Nick Hill

    Cole White

    Nate Stone

    Milan Dinga

    SchulyerWilliamson

    ClintMoore

    TylerAnderegg

    Fourteen different Army baseball players have earned a total of 44 All-America Fourteen different Army baseball players have earned a total of 44 All-America honors (preseason, postseason, academic, freshman) the past nine years:honors (preseason, postseason, academic, freshman) the past nine years:Name Citing YearName Citing YearTyler Anderegg, P CoSIDA Academic, Third Team 2009Tyler Anderegg, P CoSIDA Academic, Third Team 2009Milan Dinga, OF-RP Louisville Slugger Freshmen 2004Milan Dinga, OF-RP Louisville Slugger Freshmen 2004Milan Dinga, RP NCBWA, Third Team 2006Milan Dinga, RP NCBWA, Third Team 2006Milan Dinga, RP NCBWA Preseason, First Team 2007Milan Dinga, RP NCBWA Preseason, First Team 2007Harold Earls, INF Louisville Slugger Freshmen 2012Harold Earls, INF Louisville Slugger Freshmen 2012Joey Henshaw, DH ABCA Second Team 2009Joey Henshaw, DH ABCA Second Team 2009Nick Hill, SP Louisville Slugger Freshmen 2004Nick Hill, SP Louisville Slugger Freshmen 2004Nich Hill, SP Louisville Slugger, Third Team 2004Nich Hill, SP Louisville Slugger, Third Team 2004Nick Hill, SP Louisville Slugger Preseason, Third Team 2005Nick Hill, SP Louisville Slugger Preseason, Third Team 2005Nick Hill, SP ABCA Second Team 2005Nick Hill, SP ABCA Second Team 2005Nich Hill, SP Louisville Slugger, Second Team 2005Nich Hill, SP Louisville Slugger, Second Team 2005Nick Hill, SP Louisville Slugger Preseason, Second Team 2006Nick Hill, SP Louisville Slugger Preseason, Second Team 2006Nick Hill, SP NCBWA Preseason, First Team 2006Nick Hill, SP NCBWA Preseason, First Team 2006Nick Hill, SP CoSIDA Academic, Third Team 2007Nick Hill, SP CoSIDA Academic, Third Team 2007Ben Koenigsfeld, OF-SP CoSIDA Academic, Third Team 2010Ben Koenigsfeld, OF-SP CoSIDA Academic, Third Team 2010Ben Koenigsfeld, OF-RP CoSIDA Academic, Second Team 2011Ben Koenigsfeld, OF-RP CoSIDA Academic, Second Team 2011Kevin McKague, 1B Louisville Slugger Freshmen 2008Kevin McKague, 1B Louisville Slugger Freshmen 2008Kevin McKague, 1B Louisville Slugger Preseason, Third Team 2011Kevin McKague, 1B Louisville Slugger Preseason, Third Team 2011Kevin McKague, 1B NCBWA Preseason, Second Team 2011Kevin McKague, 1B NCBWA Preseason, Second Team 2011Kevin McKague, 1B Kevin McKague, 1B College Baseball Lineup Preseason, Third TeamCollege Baseball Lineup Preseason, Third Team 2011 2011Kevin McKague, 1B Louisville Slugger, Third Team 2012Kevin McKague, 1B Louisville Slugger, Third Team 2012Clint Moore, SS Louisville Slugger Freshmen 2008Clint Moore, SS Louisville Slugger Freshmen 2008Clint Moore, SS ABCA Third Team 2009Clint Moore, SS ABCA Third Team 2009Clint Moore, SS Ping! Baseball Honorable Mention 2009Clint Moore, SS Ping! Baseball Honorable Mention 2009Clint Moore, SS Ping! Baseball Preseason 2010Clint Moore, SS Ping! Baseball Preseason 2010Clint Moore, SS Clint Moore, SS College Baseball Lineup Preseason, Second TeamCollege Baseball Lineup Preseason, Second Team 2010 2010Zach Price, 2B Louisville Slugger Freshmen 2009Zach Price, 2B Louisville Slugger Freshmen 2009Zach Price, 2B Ping! Baseball Freshmen, Third Team 2009Zach Price, 2B Ping! Baseball Freshmen, Third Team 2009Zach Price, 2B CoSIDA Academic, First Team 2012Zach Price, 2B CoSIDA Academic, First Team 2012Zach Price, 2B Lowes Senior CLASS Award, Second Team 2012Zach Price, 2B Lowes Senior CLASS Award, Second Team 2012Chris Rowley, SP Louisville Slugger, Second Team 2012Chris Rowley, SP Louisville Slugger, Second Team 2012Chris Rowley, SP NCBWA, Second Team 2012Chris Rowley, SP NCBWA, Second Team 2012Chris Rowley, SP Chris Rowley, SP CollegeBaseballInsider.com, Honorable Mention CollegeBaseballInsider.com, Honorable Mention 20122012Chris Rowley, SP NCBWA Preseason, First Team 2013 Chris Rowley, SP NCBWA Preseason, First Team 2013 Chris Rowley, SP Louisville Slugger Preseason, Second Team 2013Chris Rowley, SP Louisville Slugger Preseason, Second Team 2013Chris Rowley, SP Chris Rowley, SP College Sports Madness Preseason, Second Team College Sports Madness Preseason, Second Team 20132013Kyle Scogin, SS ABCA Third Team 2005Kyle Scogin, SS ABCA Third Team 2005Kyle Scogin, SP Louisville Slugger, Third Team 2005Kyle Scogin, SP Louisville Slugger, Third Team 2005Nate Stone, 2B ABCA Third Team 2004Nate Stone, 2B ABCA Third Team 2004Cole White, OF-SP Louisville Slugger Freshmen 2005Cole White, OF-SP Louisville Slugger Freshmen 2005Cole White, UTY Louisville Slugger Preseason, Third Team 2008Cole White, UTY Louisville Slugger Preseason, Third Team 2008Cole White, UTY NCBWA Preseason, Third Team 2008Cole White, UTY NCBWA Preseason, Third Team 2008Schuyler Williamson, C CoSIDA Academic, Third Team 2004Schuyler Williamson, C CoSIDA Academic, Third Team 2004Schuyler Williamson, C NCBWA Preseason, Third Team 2005Schuyler Williamson, C NCBWA Preseason, Third Team 2005

    BenKoenigsfeld

    Chris Rowley

    HaroldEarls

  • WWW.GOARMYSPORTS.COMWWW.GOARMYSPORTS.COMWWW.GOARMYSPORTS.COM

    FEBRUARYFEBRUARYFri. 15 at UNC Greensboro 4 p.m.Fri. 15 at UNC Greensboro 4 p.m.Sat. 16 at Sat. 16 at UNC GreensboroUNC Greensboro 2 p.m. 2 p.m.Sun. 17 Sun. 17 at at UNC GreensboroUNC Greensboro 12 p.m. 12 p.m.Fri. 22 vs. Eastern Kentucky ^ 12 p.m.Fri. 22 vs. Eastern Kentucky ^ 12 p.m.Sat. 23 at Winthrop ^ 4 p.m.Sat. 23 at Winthrop ^ 4 p.m.Sun. 26 vs. Delaware State ^ 11 a.m.Sun. 26 vs. Delaware State ^ 11 a.m.

    MARCHMARCHFri. 1 at Liberty # 3 p.m.Fri. 1 at Liberty # 3 p.m.Sat. 2 vs. Siena # 12 p.m.Sat. 2 vs. Siena # 12 p.m.Sun. 3 at Liberty # 3 p.m.Sun. 3 at Liberty # 3 p.m.Sat. 9 vs. Yale (2) + 12 p.m.Sat. 9 vs. Yale (2) + 12 p.m.Sun. 10 vs. Yale + 3:30 p.m.Sun. 10 vs. Yale + 3:30 p.m.Tue. 12 vs. Indiana + 6 p.m.Tue. 12 vs. Indiana + 6 p.m.Thu. 14 vs. Miami (Ohio) + 12 p.m.Thu. 14 vs. Miami (Ohio) + 12 p.m.Sat. 16 vs. North Dakota State + 2 p.m.Sat. 16 vs. North Dakota State + 2 p.m.Sat. 16 vs. Dartmouth + 6 p.m.Sat. 16 vs. Dartmouth + 6 p.m.Wed. 20 QUINNIPIAC 3 p.m.Wed. 20 QUINNIPIAC 3 p.m.Sat. 23Sat. 23 NEW YORK TECH NEW YORK TECH 11 a.m. 11 a.m.Sat. 23 COLUMBIA 2 p.m.Sat. 23 COLUMBIA 2 p.m.Sun. 24 NEW YORK TECH 1 p.m.Sun. 24 NEW YORK TECH 1 p.m.Tue. 26 SIENA 3:30 p.m.Tue. 26 SIENA 3:30 p.m.Sat. 30 NEW YORK YANKEES (Exh.) 2 p.m.Sat. 30 NEW YORK YANKEES (Exh.) 2 p.m.Sun. 31 NAVY * (2) 12 p.m.Sun. 31 NAVY * (2) 12 p.m.

    APRILAPRILMon. 1 Mon. 1 NAVY NAVY * (2) 12 p.m.* (2) 12 p.m.Wed. 3 at Fairleigh Dickinson 3 p.m.Wed. 3 at Fairleigh Dickinson 3 p.m.Sat. 6 at Lehigh * (2) 12 p.m.Sat. 6 at Lehigh * (2) 12 p.m.Sun. 7 at Lehigh * (2) 12 p.m.Sun. 7 at Lehigh * (2) 12 p.m.Wed. 10 FORDHAM 3:30 p.m.Wed. 10 FORDHAM 3:30 p.m.Sat. 13 at Lafayette * (2) 12 p.m.Sat. 13 at Lafayette * (2) 12 p.m.Sun. 14 at Lafayette * (2) 12 p.m.Sun. 14 at Lafayette * (2) 12 p.m.Wed. 17 MANHATTAN 3:30 p.m.Wed. 17 MANHATTAN 3:30 p.m.Sat. 20 at Bucknell * (2) 12 p.m.Sat. 20 at Bucknell * (2) 12 p.m.Sun. 21 at Bucknell * (2) 12 p.m.Sun. 21 at Bucknell * (2) 12 p.m.Wed. 24 vs. Marist % 7 p.m.Wed. 24 vs. Marist % 7 p.m.Sat. 27 Sat. 27 HOLY CROSS * (HOLY CROSS * (2) 12 p.m.2) 12 p.m.Sun. 28 Sun. 28 HOLY CROSS HOLY CROSS * (2) 1 p.m.* (2) 1 p.m.

    MAYMAYWed. 1 at New York Tech 3:30 p.m.Wed. 1 at New York Tech 3:30 p.m.Thu. 2 HARTFORD 3:30 p.m.Thu. 2 HARTFORD 3:30 p.m.Sat. 4 NYACK 1 p.m.Sat. 4 NYACK 1 p.m.Sun. 5 CHESTNUT HILL 1 p.m.Sun. 5 CHESTNUT HILL 1 p.m.Sat. 11-12 Patriot League Semifi nal Series TBASat. 11-12 Patriot League Semifi nal Series TBASat. 18-19 Patriot League Championship Series TBASat. 18-19 Patriot League Championship Series TBAFri. 31 NCAA Regionals TBAFri. 31 NCAA Regionals TBA

    Sat. 1-3 NCAA Regionals TBASat. 1-3 NCAA Regionals TBAFri. 7Fri. 7-10-10 NCAA Super Regionals TBA NCAA Super Regionals TBA

    HOME GAMES IN BOLD CAPSHOME GAMES IN BOLD CAPS* Patriot League Game* Patriot League Game% WPDH Hudson Valley Baseball Classic % WPDH Hudson Valley Baseball Classic (Fishkill, N.Y.)(Fishkill, N.Y.)+ Spring Break Trip to Florida+ Spring Break Trip to Florida^ Coca-Cola Classic (Rock Hill, S.C.)^ Coca-Cola Classic (Rock Hill, S.C.)# Liberty Invitational Tournament (Lynchburg, Va.)# Liberty Invitational Tournament (Lynchburg, Va.)

    JUNEJUNE

    2013 SCHEDULE2013 SCHEDULE2013 SCHEDULE

    PATRIOT LEAGUEREGULAR SEASON CHAMPIONSHIPS

    1997

    2004 2005

    2008 2009

    2010 2012PATRIOT LEAGUE

    TOURNAMENT CHAMPIONSHIPS

    1997 2000

    2004 2005

    2009 2012

  • 2013 ARMY

    BASEBALL

    2013 ARMY

    BASEBALL

    2013 ARMY2013 ARMYR0 A2013 ARMY

    BASEBALLBASEBALLBB AABASEBALL

    JJJJJJJJJJuuuuuuuuunnnnnnnnnnnnnniiiiiiiiiiiiooooooooooooorrrrrrrrrrrrrrrrrrrrrrrrrrr RRRRRRRRRRRRRRRRRHHHHHHHHHHHHHHHHHHHHPPPPPPPPPPPPPPPPPPPPPP GGGGGGGGGGGGGGGGGGGGGGGGuuuuuuuuuuuuuuuuunnnnnnnnnnnnnnnnnnnnnnnnnnnnnnaaaaaaaaaaarr Carrrroolll TTTTTTTTTeeeeeeaaaaaaaaaaaaaaaammmmmmmmmmmmmmm CCCCCCCCCCaaapppppptttttttaaaaaaaaaiiiiinnnnnnnnnSSennnnnnnniiiiiiioooorr C AAnndddddddrrrrrrrreewwwww JJooooohhhhhhnnnnnnnsssssssssssssssssooooooooooooooooooooooooooonnnnnnnnnnnnnnnnnnnnnnn TTTTTTTTTTTeeeeaaaaaaaaaaaammmmmmmmmmmmmmm Caapttaain

  • ERIC TIPTON

    NCAA REGIONALS2000, 2004, 2005, 2009, 2012

    PATRIOT LEAGUE CHAMPIONS1997, 2000, 2004, 2005, 2009, 2012

    ERIC TIPTONERIC TIPTOARMY TRADITION

    ERIC TIPTON STEVE REICH

    ARMY SPORTS HALL OF FAME INDUCTEESName ..................... Induction YearBob Neyland* ...................... 2004Eric Tipton ........................... 2005Steve Reich ......................... 2006Barry DeBolt ........................ 2007Arnold Galiffa ...................... 2007John Boretti ......................... 2008Mike Silliman ...................... 2008Mike Scioletti ...................... 2011*Charter Class Member

  • ARMY TRADITION SIX PATRIOT LEAGUE TITLES FIVE NCAA REGIONAL BERTHS FIVE 30-WIN SEASONS SINCE 2004

  • ROAD TO REGIONALS

  • ROAD TO REGIONALS

  • IIIIIIIIIII ccccccchhoosssseeeeeeee ttoo ccoommeee ttooooo WWWWWWWWeeeeeeesstt PPPooiinntt bbeecccaaauuuuuuuuuuuuuuuuuuussssssssseeeeeeeeee IIIIIIIII hhhhhhhhhhaaaaddddd tttthhhhheeeee oooopppppppppppoooooooorrrrrr--tttttttuuuuuuunnnnnnnnnnnnnnnniiittttttttttttttttttttttyyyyyyyyyyyyyyyyyyy ttttttttttttttttttoooooooooooooooo fffffffffffffffffuuuuuuuuuuuuuuurrrrrrrrrrrrrrrrtttttttttttthhhhhhhhhhhhheeeeeeeeeeeeeerrrrrrrrrrrrrrr mmmmmmmmmmmmmmmmmmmmyyyyyyyyyyyyyyyyyyy bbbbbbbbbbbbbbbbbbbbbbbbbbbaaaaaaaaaaaaaaaaaaaaaassssssssssssssseeeeeebbbbbbbaaaaaallllllllllll ccccccaaaaaaareeeeerr aaaaaannnddddddddd mmmmmmmmyyyyyyyyyy ppprrrooooooffffeeessssioonnnaallll

    ttttttttttttttttttaaaaaaaaaaaattttttttteeeeeeeesssssssssss AAAAAAAAAAAAAArrrrrrrrrrrmmmmmmmmmmmmmyyyyyyyyyyyyyyyyyyyyyyyyyyyy.. BBBBBBBBBBBBBeeeeeeeeeeeeeiiiiiiiiiiiiiiiiiiinnnnnnnnnnnnnnnnngggggggggggggggggggggg aaaaaaaaaaaaaaaaaaatttttt WWWWWWWWWWWWWWWWWWWWeeeeeeeeeeeeeeesssssssssssstttttttttttttttttt PPPPPPPPPPPPPooooooooooooiiiiiiiiiiinnnnnnnnnnnnntttttttttt aaaaaaaaallllllllllllll-fffffffeeeeee oooooooffffff hhhhhhhhhaaaaaaaaaappppppppppppppiiinnnnnneeeeeeeeessssssssssssssss aaaaaaaaaannnnnnnnnnddddddddddddd ssssssssssssseeeeeeeeeeeeeeecccccccccccccuuuuuuuuuuuuuurrrrriiiiitttyyyyyyyyyyyyyyyyyyy fffffffffffffffooooooooooorrrrrrrrrrr mmmmmmmmmmmmmyyyyyyy

    uuuuuuutttttttttttttteeeeeeeeeeeeeee ttttttttttoooooooo tttttttttttthhhhhhhheeeeeee hhhhhhhhhhaaaaaappppppppppiiiiinnnnnneeeeessssssssssssss aaaaaaaaaaannnnnnnnnnnnnddddddddddddddd sssssssssssseeeeeeeeeeeeeeeeccccccccccccccuuuuuuuuuurrrrrrrriiiiiiiiiiiitttttttttttttttyyyyyyyyyyyyyyy ooooooooooooooofffffffffffftthhee Unniteddd SSStttaaatteesss aas a wwhhoollee.

    CCHHRRIISS RROOWWWLLEEYY 1133

    PLAYERS PERSPECTIVES

    e e toootooooooo WW W WWesesesesesesttt t t PoPoPoinint,t, fifi rrstst aandndd ffforrroremmost,,,, tto o plplppp ayayyyyy DDDDDDDDivivivivivviiisisisssioioioionn I babab seebab llll i n n oro deder r too ddevvvvelelelelopopopopop nn n notottttotot a a plpplayya erere ,, bubub t t asas aa pperee soson. AAAdddd itioi naallly,y,, ttheeh

    ngngggininininininggggg g edddedededededucucucucucucattatatatatatioioioioioioionnnnnn n drddrdrrrdrddrd ewwewewewewwewe mmmmmmm m mmeeeeeeee e tootototottototoo UUUUU UUU USMSMSMSMSMSMSMSMA.A.A.A II hhavavave eoonanatete l lovove e fofor r GoGod d anand d mymy country andnd II

    aat t WeWestst P Poiointnt i is s a a plplacace e ththatat i is s cocondnducucive ofofvavavavaalululululuesesesese ...KK D DIGIGNANACCCCO O 1144

    ccaammee ttoo WWeesstt PPooiinntt ffoorr tthhee ooppppoorrttuunnii--eess wwhhiilee II aamm hheerree aanndd wwwhheenn II ggrraadduuaattee.. ee vvaalluueess tthhaatt WWeesstt PPooiinntt iinnssttiillllss iinn iittss ddeettss aare thinnggss wwhhiicchh II ttrryy ttoo lliivvee mmyy lliiffee eevveerryy ddaayy, eevveenn bbeeffoorree II ccaammee hheerree. The

    mmoosspphheerree fifi ttss mmyy ppeerrsonnaalliittyy aanndd ggiivveessee mmoorree ooppppoorrttuunniittiiieess ffoorr ssucceessss tthhaannyyy ootthheerr ooption.

    EERRIIKK WWAASSHHBBUURRNN 1144

    IIIIIII a aa aalwlwlwwwlwayayayayyayayyys s sss thtththththththttthououo ghghgghgghghghght tttt abababababaabououououoo ttt ttt bebebeeeeininnngg gg g ininininnnnnin tt tt tttheheheheheee m m m mililili ititi araraaryy,y,y,yyy h hhhhowowowowowweveveveeveverererererr, , , thththththththtt attatatat w wwwwwwasasasasasasassssss oooveversrshahhadoddododoweweweeeeeeweew dd d ddd bybybyb mmmmm mmmmmy y y y yyy yy dededededeed sissssisiiisisississ rerererereeereerererereree tt tttttt t to ooooooobbebebbebebbebebebebebebebebeb cocococococococococoococcococcomemememememeemememeeeeeemeeme a aaaaaaaaaaa p p p p ppphhyhhyhyhyhyyyhyyhyhyhyyh sissisisisisissisisisisississicicicicicicicicicc anaanananananananananaaann aaaa aaaaaaaa andnddndnddndndnddndnddd m m m mmmyyy y y y lololooloololoveveveveveeve f f fffff ffffffffororororrororoooooooo b b b bbbbbasasassa ebebebebeee alalalalalallalllll..l.l.lll S S SSo o oooo whwhwhwhwhww enenenen I III w wwwwwasas ii intntrororor dududud cececececed dd dd tototo W W WWWWeseseseeseeeeseeeeeesese tt tt PoPoPoPoinininnt ttt tt tt II I rereeeeereeeealalalaaaaaaaa izizzedededdededeededed ththththtthththtthththththt tttatatatatataatatatatat ttttt tt t t t t tthihhihihihihihhihihihihihiss ssssss iinininiinnininininnnnnnnnstsststssstststststststs ititittitititititititutututututututututututuuu ioioiioioioioion nnnnnn n wowowowowowoowowow ullullulululululdd dddddddd bebebebebebbebebebbebe ttttttt t ttheheheheehehehehe iiiiiiii i iidedededededdededd alalalalalalalal ppppp pp plalalallalaalalaacecececececece fff fforoororooorr m mme.e. BBBBBBBBB B B ttttututut iiii i ittt t wawass nononoonn t t ununtitititilllll l IIIII I hahahahahaddddd ddddddd dddd d ththththththtthththhthheee e eeeeee opopopopoopoooppppopopopoppopppppp rttrtrtrtrtrtununununuunuunuununuu ititittititittyy y y yyy totoototo vivivisisisit t tt WeWeWeW ststs P PPoiointnntnttttt aaaandndddn eexpxxpxperereerieeiencnncncee e e ititiits s s mamamaajejejeststticicicc n nnnatatururuu e e e thththhhhhhatataa I II m m madaddade e mymmmmymymy dececcisisioion n toto c commmmome e hehehehehehhehehhhehhererererereerererereerere....... PAPPAAPAPAPAPAATRTRTRTRTRRRTTRTTRICICCICIICICCCICICICKKK KKKKKK MEMEMEEMEEMEMEMMMEMEMESCSCSCSCSCSCSCSCSSSCHEHEHHHHEHEHEHEHHHEHERRRRRRRRRR 1111111111111444444444444

    TTTTTooo hhhhhaaaavvvveee ttthhheee ooopppppppooorrrtttuuunniiittttyyyy ttttooo bbbbeeeee aaaaa ppppaaaarrrttt oooooffff tttttthhhhheeeee LLLoooooonnnnggggggg GGGGGrrrraaaaaayyy LLLiiiiinnneeeeee hhhheeerrrrreeeee aaaaaattttttt WWWWWWeeeeeesssssttt PPPPooooooiiiinnnnnttt hhhhhhhaaaaassss bbbbbbeeeeeeeeeeennnnn aaaaaa gggggrrrreeeeeaaaattttt eeeeexxxxpppppppeeeeeeerrrrrrriiiiieeeeennnnnnccceee ssssssoooo ffffaaaarrrrr. III aaaaammmm vvvvveeeeerrrryyyyyy hhhhhhuuuuummmmmbbbbbblllleeeeedddd bbbbbyyyy iiiiitttt,,,,,,, aaaaaannnnnnnddddddddd tttttttooooo bbbbbbbbbbeeeeee sssssssuuuuuuurrrrrrrrrrrroooooouuuuuunnnnnndddddddeeeeeeeeddddddd bbbbbbbbbyyyyyyyy sssssssuuuuccccchhhhhhhhhh oooooooouuuuuuutttttttssssssstttttttaaaaaaannnnnnnddddddiiiiiinnnnnnngggggggggg iiiinnnnnndddddddiiiiiivvvvvviiiiiiidddddduuuuuuaaaaaaalllllllssssss iiiiiisssssss aaaaaaannnnnnn hhhhhhhooooooonnnnnnnooooooorrrrr... IIIIIIIII ccccccccoooooooooonnnnnsssssssssssssiiiiiiiiiiddddddddddddddddeeeeeeeeeeerrrrrrr mmmmmmmyyyyyyyyyssssssseeeellllfffff lllluuucccccckkkkkkyyyyyyy tttttttooooooo bbbbbbbbbbeeeeeeee pppppppaaaaarrrrrrrrtttttt oooooffffffff tttttthhhhhheeeeeeeee AAAAAAAArrrrrmmmmmmmmmyyyyyyy BBBBBBBBBaaaaasssseeebbbbbbbaaaaaallllllllllll FFFFFFFaaaaaammmmmmmiiiiillllllyyyyyyy aaaaaaasssssss iiiiiiitttttttttt ttttttrrrrrrrrruuuuulllllyyyyyyy iiiiisssssss aaaaaaa fffffaaaaaaaammmmmmmiiiiiiiilllllllyyyyyy oooooofffffff gggggggguuuuuuuyyyyyyysss ttttthhhhhhaaaaaaaattttttttt llllooooovvvvvvveeeeeeee ttttttooooooo ppllaayy tttttthhhhhheeee gggggaaaaammmmmmeeeeee.... AAAAAAAAALLLLEEEEXXXX JJJJJJEEEENNNNNNSSSSSEEEEEENNNNN 11111111115555555555

    ccccaaaaaaarrrrreeeeeeeeeeeeeeeeeeeeeeeeeeeer iinn ttthhhhhhheeeeeee UUUUUUUUUnnnnnnniiiiiiiiiittttttteeeeeeeedddddd SSSSSSSSStlllllllloooooooooowwwwwwwwwwwwwsssssss mmmmmmmmmmmmmmmmmmmeeeeeeeeeeeeeeeeeee ttttttttttttttttoooooooooooooooo ccrreeaaattteee aa llliiffffffffffffffaaaaaaaaaaaaaaaaaammmmmiiiiiiilllllyyyyyyyyyyyyyy aaaaaaaaaaaaaaaaaaannnnnnnnnnnnnnnnnnnnnndddddddddddddddddddddddd tttttttttttttoooooooooooooooo cccccccccccccccooooooooooooooonnnnnnnnnnnnnnttttttttttttrrrrrrrrrrrrrriiiiiiiiiibbbbbbbbbbbbuuuuuuuuu

    II c ccamamameeNCNCAAAAAAAAAAAAAAAAAAA DDDDDDDD D DDoooononoonnnnlylylylylyyy aaass schchalallelenna a papassssiifefeelel t thahathththththososososeeee e vvvvv NINICKCK

    II ccttiieeTThhccaabbyy aattmmmmeeaann CHRIS ROWLEY

  • IIIIIIIIII c c chohoooohossesesesesesese WW W W WW W WWeseseseseseseesessest t ttttt PPoPoPPPoPPPP inint t bebebebeeeecaacaususssssussseeeee ee plplplplppplplplplayayayayayinininining g g g thththththe ee e e spspspsspororororttt t t I I II lolololol veveveve w wwwww witititithh h h h ofofofofofofof g ggggggguyuyuyuyuuu s s s ssss thththththththhatatatatatataattata s s ss ssshahahahahahhhaharere tthehe ssamme reeeeereespsspspspspspspspspspspspspspsspppececeecececececececececececceccecceccecececttttt tttt ttttttt ttt tt ananaaaanannnnana d d ddd lolovev ffor thehe gggg ggggggggggamameeIII hahahahahahahahahhhavevevevvvvvvvve h h hhhhhhhasasasasasasaasasaa a a a a aa aaaalwlwlwlwlwlwlwwwayayayayayyayayyyyyyyyyyyys ss ss s bebebebeebebebebebebeeneneeneneneenenneneeeeene aaaa aaaa a aaaaa a aaaaa d d ddd ddd dd ddd dd d drerererererererrerrreamammmaaaa o of fff mimiim neneneee... . IIII alalalalalalaalsosossossososososososo c ccccccccccc c c cchohohohohohohohosesesseseeseseeeseeeseeseseese tt t t tttt t tt ttttt ttt toooooooo o ooo oo o cccccccccccccchhhehehhhhehehhehhhh rere bbbb b bbbbbbbbbbbbbbececececececececececececececeeececee auauauauauuuauaaaauauaa ssesesesesese I I I II w w w wwwwananananananteetetetetet ddddd dd d dd totootototottotoootoo e eee eeeeeeeeararararaaraaarnnnnn n n aaa aa a aaa aa aaaaa a dedededdddddddd grgrgrgrggreeeeeeeeeeeee fff ff fffffrooorororor mmm m m aaa a prpprprprpprememememieieieieieeeieeeeeeerrrrrrrrrrr r uunuuuuuuunuuuunununussity.. . ... . .. NNNoNNoNNNN ooooooooththththththththererereerererer p p pp ppppppppplalalalalalalallal cececececececeeececc c c cc cc couoououuouuuuouuuldlddddddddldd hhhh h aveee e e e ee giiiveeeeeeeeeeen nn n nn memememememe t t t tttthehehehehehh seseseseseeses o o o o opppppppppppppppp ororororororroroorororrtututututuuututututuuuuuuninininiiniininininininininiitttttttttttttt ANANANANANANANANANAAANAANAAANNNDRDRRDRDRDRDRDRDRDRDRDRDRDRRDRRDRDREWEWEWEWEWEWEWEEEWEWEWEWEWWWWEWEWEWEWEEW J J J JJ JJJJJ JJJJJ JJ JJJOHOHOHOHOHOHOHOHOHOHHOHOHOHOHOHOHHOHOHO NSNSNSNSNSNSNSSNSNSNNSNSNSNSNSNNSNSNSNSNSNSONONONONONONONONONONONONONONOONONONN 131313131313131311313133313

    ON WEST POINTIII cccchohohohohosesesee WW WW WW eesesest tt PoPoPoPooinininnnnt t ttt bebebebbebeb cacacaususususe ee ee III wawawawawawwawawaawawantntntntntedededededd t t t t to o oo ooo plplplplplplayayayayayayay o o o ooonn n nn a aa a a cocoocococ mpmpmpmppetetetetetete ititititititivivivivivee e e DiDiDiDiDiDiD vviviv sisisisiss ononononoo II III t t t t ttteaeaeaeaeeaam m m mm m wiwiwiwiwiw thththththh t t tttheheheheehe abababababa ilillilitititititty y yyyy totototottt mmmmakakakakake eee ee ititittittit t t t t t t too o o ooo a a a aa a SuSuSuSuSuSupepepepeerr r rrr ReReReReReRegigigiiigiig ononononoo alalalalalal. .. II I II alalalalalla sosossososo w w w wwanananntetetetetetetet d ddd d d tototototototo l ll l leeaeaeaeaeaae rnrnrrn ii in a a a ststststtimimimimimimululululu atataatata ininininnggg ggg acacacacacaccadadadadadaddemememememicicicic enenenenenee vviviviviirorororororonmnmnmnmnmnmnmmmmenenenenenenentt tt t ananananananand dd d ddd eaeaeaeaeae rnrnrnrnrnr a a aaa rrrepepepepepppeppppppppututututututtabababbabbabblelelelell d d d ddddegegegegegegegrererereree.e.e.e.e.ee COCOCOCOCOCOOOOOONNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNOOOROROROROOOOOOOOR L LLOVOVOVOVOVO E E E E EEE 111111444444

    aa a a grgrgrgrgg ououououp p p p pppee thhthhththatat ooooooooooooooomememememememememememememe nnnnnnnnnnnnnnivivivivvivivivivivivivivvivivivivivivviviviiiveererereereeeeeeeeeeeeeeee ---titiiiiiesesesesesseseeseseseess.........

    HAROLD EARLS

    GGGGGGoooooiiiiinnnnnnnggggggggg ttttttoooooooooo WWWWWWWWWWWWWWWWWWeeeeeeeeeeeeessssssttttttt PPooooooiiiiiinnnnnnnttttttt iiisssss ttttttthhhhheeeeeeeeeeee ooooooooooooppppppppppppppppppppppppppoooooorrrrrrrttttttttuuuuuuuuuunnnnnnnniiiiittttttyyyyy oooooffffff aaaaaaaa lllllliiiiiffffffeeeeettttiiiimmmmmmeeeee... AAAAAAAAssssssss IIII pppppppprrrrrrrreeeeeeepppppppaaaaaaaaarrrrrreeeeeeeeeeeee mmmmmmmyyyyyyyysssssssseeeeellllffffff ttttooooo bbbbbbbbeeeeeeeeeee aaaaaaa ffffffffffffffffuuuuuuuuuuuuuuuuuuttttttttttttuuuuuuurrrrrrrrrreeeeeeeeeee ooooooooooffffffffffffifififififififififi cccccccccccceeeeeeeeeeeerrrrraaaannnddddd lllllleeeeeeaaaaaaaadddddd sssssssssooooollllllllllllldddddddiiiiiieeeeeerrrrsss,,,,, IIIIII ggggeeeeetttttt ttttooooo ppppppppppllllllaaaaaaaaayyyyyyyyyyyyyy ttttttthhhhhheeeeeeeee ggggggggggggaaaaaaaaammmmmmmmmeeeeee IIIII llllllllooooooooooovvvvvvvvvvveeeeeeeeeeeeee aaaaannnnnnndddddddd rrrreeeeeeeeccccccceeeeeeeeiiiiiiiivvvvvvvveeeeeeee oooooonnnnnnnneeeeeee oooooooffffffffffff ttttthhhheeee bbbbbbeeeeeeeessssssssttttttttttt eeeeeeeeeddddddddduuuuuccccccccaaaaaaaaaaaattttttttttiiiiiiiiiiooooooooooooonnnnnnnnnssssssss iiiiiiiiinnnnnnnnnnn ttttttthhhhhheeee wwwwoooorrlllddddd... IIII ttttttttttrrrrrruuuuullllllyyyyyyyyyyyyyy lllloooooooookkkkkkk aaaaaaaattttt ttthhhhheeee AAAAAAAAAAAArrrrrrrmmmmmmyyyyyyyyyyy BBBBBBaaaaaaaassssssseeeeeeebbbbbbaaaaaaalllllllllll FFFFFFFaaaaammmmmmiiiiillllyyyyy aaaaaaassss mmmyyy sssssssseeeeeeeccccccooooonnnnnnnndddddd fffffffaaaaaaammmmmmmmmmmmiiilllyyyyyy aaannnnndddddd mmmmyyyyyy ttttteeeeeeeaaaaaammmmmmmmmmmmmmmmmmmmmaaaaaatttttttttttttttteeeeeeeessss aaaaaaaaasssss bbbbrrrrrooooooootttttthhhhh---eeeeeeeerrsss wwhhoooo hhhhhhhhhheeeeeeelllllppppppppppppppppppppp mmmmmeeee cccaaarrrrrrrrrryyyyyyyyy ooooooooooooooonnnnnnnnnn eeeeeeeeeeevvvvvvvvveeeeeeennnnnnnnnnnnnnnnnnn tttthhhhhhhhrrrrrrrrooooouuuggggggghhhhhhhh tttttttttthhhhhhhheeeeeeeeeeeee mmmmmmmmmooooooooosssssssttttttt ssssttttttrrrrreeeeeennnnnnuuuuuuuoooooouuuussssss ddddddaaaayyyyyyysssssss........ IIIIIII cccccccccaaaaaaaaaannnnnnnnnttttttt hhhhhhhhhheeeeeeeeellllllllppppppppppppppppppppp bbbbbbbbbbbbbbbbbbbuuuuuuuuuuuuuuuuuttttttttttttttttt bbbbbbbbeeeee iiiiiinnnnnnnnnnssssssssssssspppppppppppppppppiiiiiiiiiiiiiirrrrrrrrrrrrreeeeeeeddddd bbbbbyyyyyy ttttttttttthhhhhhhhhhhhheeeeeeeeee ggggggggggrrrrrrreeeeeeeeeeaaaaaaaaaatttttttttt llllllllleeeeeeeeeeeeeaaaaaaaaaaaaaaaaadddddddddddddeeeeeeeeeeeerrrrrrrrsssssssssssssssss wwwwwwwwwwwhhhhhhhhhhhhhhooooooooooo hhhhhhhhhhaaaaaaaaaaaavvvvvvvvvvvveeeeeeeee cccccccccooooooooooooooooommmmmmmmmmmmeeeeeeeeeeeee bbbbbbbbbbbbbbbeeeeeeeeffffffffffffffoooooooooorrrrrrrrrrreeeeeeeeeeeeee mmmmmmmmmmmmmmeeeeeeeeeeeeee,,,,,,,, aaaaaaaaaaaannnnnnnnnndddddddddddd IIIIIIIIII aaaaaaammmmmmmmmmmm ffffffffffffffffffoooooooooooooooooooorrrrrrrrrrrrrrrrrrrrrreeeeeeeeeeeeeeeeeeeeeeeevvvvvvvvvvveeeeeeeeeeeeerrrrrrr ggggggggrrrrrraaaaaaaaaaaaaatttttttttttttttteeeeeeeeeeeeeffffffffffffffffuuuuuuuuuuuulllllllllllllll fffffffffffffffffoooooooooooooooooorrrrrrrrrrr ttttttttttttttthhhhhhhhhhhhhhheeeeeeeeeeeee oooooooooooppppppppppppppppppppppppooooooooooooorrrrrrrrrrrrtttttttttttttttttuuuuuuuuuuunnnnnnnnnnnnniiiiiiiiiiittttttttttttttttyyyyyyyyyyyyyyy ttttttttttttoooooooooooo ppppppppppppllllllllllllaaaaaaaaaaayyyyyyyyyyyyyyy bbbbbbbbbbbbbbbbbbbbbbbbbaaaaaaaaaaaaaaaaaasseeeebbbbbaaallllllll wwwwwwwwwwwwwhhhhhhhhhhhhhhiiiiilllllllllleeeeeeee ppppppppppppprrrrreeeeeeeppppppppppppaaaaaaaaaaaaarrrrrrrrrrrrriiiiiiinnnngggggg mmmmmyyyyyyyssssssseeeeeeeeeeeeelllllfffff ttttttoooooo fifififififi ggggggghhhhhhtttttt fffffffoooooorrrrr ttttthhhhhiiiiiissssss gggggggrrrrrreeeeeeaaaaaaaaaaatttttt ccccccccccooooooooooouuuuunnnnttttttrrrryyyy... DDDDDDDDDDDDAAAAAAANNNNIIIIEEEELLLL CCCCCCCCCCCCCCOOOORRRRTTTTEEEESSSS 111115555

    TThee tthhingg thhatt brougghhtt mmeeee tttttooooo WWWWWWeeeeesssssstttttt PPPPPoooiinntt wwwwaaaaass tthhhee oopp--pppppooooorrrrrrtttttuuuuunnnnniiiiitttttyyy tttttoo bbbbbee aa ppaarrtt ooff ssoommeetthhiinngg bbiiggggeerr tthhaann mmyysseelllff.. II ddiiddnnntt wwaannttt ttoo ppllaayy bbaasseebaalll aatt aannootthheerr uunniivveerrssssiittyy aanndd bbeekknnoowwnn ssimmppllyy aass aann aatthhlleettee. HHeerreee II aamm mmoorree.. YYYYoouurree hheelldd ttoo tthhee hhiigghheesstt ssttaannddaarrddss aanndd eexxppeeecctteedd ttoo bbee aaaatt yyoouurr bbeesstt aatt aallll ttiimmeess. II ccoouullddnntt fifi nndd tthhiiss aannyywwhhheerree eellssee.. HHAARROOLLDD EEAARRLLSS 1155

    II d dece idideded t to o atattetendnd W Wesestt PoPoinintt not ononlyly b bececauausese o of f ththe e egrgreaeat t ededucucatatioion,n, b ut also o toto b bececomome e a a memembmberer o of f ththe exexcccecel-l-lelent basebbalall l prprogograram.m. I I c chohosese W Wesest Poinnt t bebecacaususe e itit aallllowoweded meme t too cocontntininueue p plalayiyingng t thehe g gamame e I I loloveve wwhihilel aalslso o gegettttiningg a a grgreaeat t educcattioon n anand d bebeining g aba le tto o seservrve e mymy c couountntryry.. BRBROCOCK K DAAVIDSDSONON 1616

    IIII mm m madadadaadeee ee thththeee dededeciiiciicici isiisiisis ononon ttttttt tooo o coocococomememememe t ttttttooo WWeWWWeWWWestttsttsts PPPPP PPoiioioio ttnttntnt bbbb bbececcececauauauuauseseseesese oooo oofffffffff hhththththththheee alalaalalalalalallllllll l ofofofofofofofof t tttt t t thehehehehehhehee hhh hh hhisissisissisisistottottototototoryryryryryyyy tt t ttthehhehee AAAA AAAcaccacacacadeddedededemymyyyyyyy hhasas. The miilitaaryr hhas aalwwayays sbebebeenn aaaan n ininini teteeet rerrr ststst of mimiim neneeene aaaa aandndndndndddd t the opppportutunin ty tto jojoin t thehe m lililiiii-itataryy, , rerececeeivve e a a grgreaeatt tt ededuccatatatatatattataatatioion and play Divisioion I basebaallwawas s totoo o o mumuchchc tto oo papassss uuuuuuuuuppppp.p.pppp JUJJUSTSTINN FFREER NCNN H H 11111116666666666

  • MATT REID

    I am proud to be a member of the West Point family. The unique qualities of life education received at the United States Military Academy, both in the classroom and on the baseball fi eld, are remarkable. Every day I am at West Point, I understand the incredible closeness here, and I see the vibrant, active alumni network, and how they help each other. The support within the baseball family is awesome as well, and Im excited to be a part of it. Its an honor to work with the outstanding cadets on the baseball team, and we will all work hard to make the United States Military Academy proud. MATT REID, ASSOCIATE HEAD COACH

    The opportunity to be a part of the best leadership development institution in the world, and to coach on the grounds that many of our nations very best leaders once walked is truly a humbling experience. I am extremely proud to be working alongside many of the very best young men that America has to offer. In addition, the support that the Army baseball program receives is remarkable, both from an alumni and an administrative standpoint. The combination of these two aspects makes this an extraordinary opportunity. ANTHONY DeCICCO, ASSISTANT COACH

    Winners are always striving for something more. They have a competitive edge that separates them from everyone else. They never seem to weigh the odds before accepting a challenge. They push themselves to the limits to maximize their ability in all aspects of life. To be at West Point is to be a winner. You attend college in hopes of setting yourself up for success in the future. Your goal is to open as many doors as possible. No place in the world accomplishes that better than West Point. West Pointers have been an integral part of our past and will be an integral part of our future. There is no place Id rather be. JOE SOTTOLANO, HEAD COACH

    JOE SOTTOLANO

    ANTHONY DeCICCO

    COACHES PERSPECTIVES

  • SHANE KIMBROUGH 892008 SPACE SHUTTLE MISSION

    BASEBALL LETTERWINNER, 1987-89

    BUZZ ALDRIN

    DWIGHT EISENHOWERNORMAN SCHWARZKOPF JOHN PERSHING

    NOTABLE ALUMNI

    AT WEST POINT, IT IS OFTEN SAID MUCH OF THE HISTORY WE TEACH WAS

    MADE BY PEOPLE WE TAUGHT.

  • WHY WEST POINT?

    PETE DAWKINS

    ALEXANDER HAIG

    AAAAAnynynyn o o of f ff usuuusss w ww wwhohoohoh ww wwwweneenenenee t t tt ththththhhrororouguguggggh h h hhhh ththththtt e e e prprprprprocococccesesesesesess;s;s;s; a aa a nynynynyn onononno e e e whwhwhwhwhww o o o ooooo fefefeffffeffef ltltlttttt tttt thehehehe fl flfl a a aamememememem ofoffofoffof t tt thahahaah t t tt fufufuuurnrnrnrnrnnnacacacaace,e,e,e,e c cccamamamameee awawawawawayayayayyyy a aaaaltltltlttererrerere edededededd iiiiiin nn n ththththtththe eeee wawawawawawwaway y y y wewweew g g gggggggggggo o oo oooo ababababbououoououuo t t ttt rurururuurunnnnnnnnnnnn inininiii g g g gouououououououo rrr rrrr lillliililivevvevev s.s.s.ssss SS S SSSSomomomomomoomeee e e e papapapapapap rtrtrtrtrtrtrt o oooooof f ff f f ititititititt i i i i i s sss ss thththththtt ee e e e ee bebebeebebeelililiill efefefefefefef t t ttt thahahaahaah tttt ttt yoyoyoyoyooyoy uu uuuuu aararararararrree ee e eee nonnnnonoononnnononnon tttt t t ononononononlllylylylylyy ddd dd dddoioioioioiooooioioingngngngngngngnngnngnnnnnn ii i iittt t tt fofofofoforrrr r pepepepepepersrsrrsrsrsrssonononononono alaalalalla g g ggg g gloloolololoolloryryryryryry, , , bubububbb t t t yoyoyoou uuuu dodododoodododo ii itt tt bbebebebebebeecacacacacacausususususususe e e e eee e ititititititttttit i i i i iisss s sss yoyoyoyoy ururur r r resesesespopopopppppoopoop nsnsnsnsibibibbililililillitititittititty.y.y.y. II I ttttttttt sss s papapapapppap rtrtrtrtrtt ofofofofofofoff b bbbbbeieie ngng aaaaa mm m m mmmmemememeememmee bebebebeebb r rr rr ofofoffoff T T T T TTTheheheehhhe CCCC CCororoorororo pspspspspspsp aa a a a aaandndndndndndnnn e e e e eeeacacacacacacacch h h hhhhh ofofofofofofo u uu us s sssss ththththhhatataaaatataata h hh hh havavavavavve e e ee e fefefefefeltltltlt t tttt t ttt ttthahahahhaat t t ttmamamammammamm gigiggg c c fefeelel e eespspsspss ececececciaiaiaaaaallllllllllllllyyy y yy prprprprpp ivivvivivivililililegegegegegege edededdededed t t t tt t to o o o o oo hahahahahahahaveveveveveveveev d d d ddononoononoo e e ee e sssososososo.... - - H HEIEISMSMMANANA T TROROOOOPHPHPHPHPHPHP Y YY Y YY WIWIWIWIWIW NNNNNNNNNNNNNNNN ERERERERERERERRRR P P PPP PPPPPETETETETETTETE E E EEE EE DADADADADADDAWKWKWKWKKKKKININININININSSSSSSSSSSS

    AAAs s ss I III lolololoooookokokoookokkookoooo b b bbacacacaca k k k kkkk ovovovovvererererrr mmyy yyyyyyy cacacarererer ererere i iiinnnn n gogogogogogggg vevevevernrnrnrnnnnnnnnnnnrrrnnmememementntntnt, ,, ,,,, iinininiiini b bbbususuusuuusususuuuuuuusininnesesessesesessss,s,sss,s,sss,ss,s,s,, ofoffoofofofofof cc cc couoououououo rsrsrsrsrse e e iiininin ttttt t tthhhhhehhe m mmiliililititttarary,y, I I t thihihhhhh nknkn WWWWWesesesesesese ttttt PPPoPoPPoPoPoPoPooPoPooooooPoiniininininininnininnninnnt t tt ttttt tttt wawawawawawawawawawasss ssssssss a aaaa veveveveveeeeeeveveeerryryryyyryrrryy ininiinfl fl ueueueuentntnttiaiaiaal ll exxexxexee pepepepp riririrrrrieneeene cececec . . ItItt h haraaaraara dedededeneeed d a a sesensnse e ofooofoooo d diiiiiiisisciiiciiciciiiciciciplplplplplplplplpplplp ininininininnininnninnne,e,e,e,e,e,e,e,eeeeee,e, a a sesensnse e ofof r resespopoppponsnsibibilillititti y,y, d dutuuuutu y y anand d ininnntetetegrgrgrititity y y anananananananananaananna d d also verrryy y yyy yyhahahahahaahahappppppppppppppppililililillili y y yyyyyy cococococoococombmbmbmbmbmbmbm inininininnnnededededededeed aaa aaaa annnn n nnn alalalalalalala ererrererererertntnntnntntnttnt eesesesesesesssss s s fofoffoffofofofo m miiininiiindddd dddd anand d bobobobb dydyddy.. -- F FORORRRRMEMEEEER R RR R SESESSSS CRCRETETTARARY Y OFOFFF S STATAATETETEEE A AAAAAAA LLELELELELELELELEL XAAXAXAXAXAXXAXX NDNDDEERERE H HHAIA GGG

    FFFFFFFFFFFFForororororroror here e wewewwwewewwwewweee ttttt ttttrarararararararr ininninininn t tttttheheheheheehe menn aaaaaaaa ddndndndndndndnd ww w wwww wwwomomomomomomomomoo eneneneeeeeee wwwwwwwwwwhohohohohohohohohoohoseseseseseseseseesee ddddddd d dddd ddutututuututuuututuututuutututuuutyyyyy yyyyy y y y yy itititititititttiititit iii ii ii i iissss sssssss s sss totototooototototootoootttttot dedededededededededeededed fefefefefefefefefefefefendndndndndndnddddddddnddnnnnnn ttttt ttt ttt tttt thehehehhehehehehhehehhhhhhehehh RRRRRR RRRRR RRepepubublilic,c, t thehe m mmmmmmmmmenennenenee a aaaaandndnddndnd w w wwwwomoomooomenenene ww w whohohoohooosesesesee pppp p p prororororor fefefefefefffeessssssssssssssssssssssssssssiiiiiooooiooiii nn isisisisisssissisiisissisisisisissii wwaaawaaaaaaatctctcctctctctctctctct hfhfhfhfhfhfhfhfhhfhhfulullllllululululululululnnenenenenennennenenenenesssssssssssssssssssssssss, , whhwhhhhwhwhwhwhwhwhwwwwhw ososososoose ee skkskskskskksks iliililililillll l l l ll isiss v vigigililancee, whose calling g is tto guardddddd d thhthhththe pepeacace,e, b butut iiff neneededededededededededdd b b b bbb b bbbe,e,e,ee,e,e,e,eeee tttttttttoo ooooooo oo fi fi fifififififighght anand d wiw n. -- PPRERESISIDEDENTNT R RRONONONONNALALLALLDDDD D D REREEREREERREREAAAGAAAGAGAGAANAN

    RONALD REAGAN

    WEST POINT IS THE RING.ITS THE FOUNDATION OF EVERYTHING I HAVE DONE. - MIKE KRZYZEWSKI 69

  • WHY WEST POINT?

    DDDDDDDDDDODODODODODDOOOOOOOODDOODDOODODODOOOODDDDDOUGUGUGUGUGUGGGGUGUGUUUUUU LALALALALALAALALALAAS S SSS SS S S SSS MaMaMaMaMaMaMaMaMaMaMaMaMMMaaaaMMaMaMMaMaMaaMacAcAcAcAcAcAcAcAcAcAAAcAcAAcARTRTRTRTRTRTRTRTRTRTRTRTTTRTRTTTTRTRTTTTTTHUHUHUHUHUHUHHHHHHHHHHUHUHUHUUUHUHHHUHUHUHUUHHUUHHHHHHHHHUHHH RRRRRRRRRRRRRRRRRRRRRRRRR

    DICK CHENEY

    AAAAAAAAAAAAAsssssss ssss s IIIII I I loloololololooloololoolookkokokokkokokokokokokokokok bbb bbbb b b bb b b bbbacacacacacacacccccacacacacccckk k k k kkk kkk ononoononoononnonn mm mmmmmmmy yyyyyy y y y y yy y y liilililililililill fefefefefefefefefeeeefefe, , , IIIIIIIIIIII llllllllllllllllllllllllll aaaaaaaaaaaaaaa alwlwlwlwlwwlwlwlwwlwwlwwwwlwlwlwayayaayayayyyayaayayayayayayaaayays sssssssssssss s rrerererererereerererereeveveveveveveveveveveeerreerereerereeeerererererererere tttttttttt t t t t t tthhehehehehhehehehehehehehehee opoopopopopopooppopopopoopopopooppppppopopopopopoportrtrttttrtrtrtrtunununnunnununununititititiitiiitititieieeeeeieieieieieieessss s s sssss sss thththththtthththtththatattatattataatatatatat ccccccccc ccamamamamammmamaamamamameeeee e eeeeee lllalllalononnong g gg g ththhthththhhhtthhatat b brorougugugggghththt a a aboboboututut thththththththe ee eeeee eee chchchchcccchccchc oioioioicececece IIII m mmmmmmmmmm mmmmadadadade e ee totototo g g g ggo oo o o totototo W WWWesesesesttt tt PoPoPoPoinininint.t.t.t. I I II j j jjusususust tt t fefefefeelelelel thththhthththttththt atatatatatattatat i iiii t ttt wawawawawawaassssssss s s fufufufufuuufufuuffufufuundndndndama enenenentatatatal l l l inninin mm mmololololdidididddiiid ngngngng tt t thehehehe ffffababababababbriririric c cc ofofofof mymmmmmymyymmm life. TTTTTT TTTTTTTTTTTTTThhhehehehhehehehhhehehe ee e e expxpxppxpxpxpxpxxxx ererere ieieieieieeeeeeencncncncncncncn eseseses t t t thahahahat t t t III I hahahaaaahahad dd d atatatat W W W Wesesesest t t t PoPoPoPoinininint,t,t,t, thththththththhhhheyeyeey w wwwwweerererererere e ee eee ee iririririririri rerererereereerereplplplplplplpllpllaaacaaacaa eaeablblble.eee.eee ---- AAAAAAAASTSSTSTSTSTSTROROROROORORORROROOONANANANANANANANANN UUUUTUTUTTUUTUU E E DWWDWINN BUUUUB ZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZ ALALALALALLALALALALALALALALAALALALALALLALLALALLDRDRDRDRDDRDRDRDRDRDRDRDRDRDDRDRDDRDRRDD INININININININININIIIN

    WWesest t PoPoinintts s grgradaduauatetes s hahaveve sere vevedd AmAmerericica a inin m mana y,y, m mananyy wawaysys. .NoNot t ononlyly b by y leleada ing troooopsps i intnto o cocombmbatat, , bubut t alalsos b byy exexplplororiningg frfronontitierers,s, ffoundingng u uniniveversrsititieies,s, layayining g ouout t tht e raaili roroadads,s, bbuiuildldiningg ththe e e PaPananamma CaCananal,l runnniningng c cororporaatiionons,s, s serervivingng iin n ththe e CoCongngreressss a andnd T Thehe W WhihiteteHoHouse, andnd w walalkikingng oon ththe momoonon. . ThThrorougugh h ouour r hihiststorory,y, w wheh never r dudutyty cacalllleded, ththe memen n anand d wowomemen n ofof W Wesest t PoPoinint t hah ve neveverer f faiaileled d usus, anand d I Ispspeaeak k fofor ala l AmAmerericicanans s whw en I sayy, , I I knknowow y youou nneveverer w wilill.l. - - PRPRESIDDENT BIBILLLL C CLILINTNTONON

    YYou havve ahead d off you the bbest t ofofof aa a allllllll pppp p prororororofefefefefesssssioionssns. .BeBeBeBeBeininininningggg g aaaaa leleleleleadadadadadererererer iii i issss s thththththe e bbebestst tthihingng yyouou c canana p posossisiblbly ybebe a andnd y youourre e atat a a s schchooool l ththatataa w wililll mamakeke y youou t thehe bebestst p posossisiblble e leeadadere . WeWestst P Poiointnt i is s the e riringng.. ItItss tthehefofounundadatit onon o of f evevere ytythihingng I I hhavave e dodonene.. - - H HEAEAD D COCOACACH H MIMIKEKE K KRZRZYZYZEWEWSKSKII

    IIIn nn nnn ththhthhhe e eee evevevevevenenenenneninininininng gg ggg ofofofoffofo m m mmmmy y yyyy memememememomomooomooryryryryryry, ,, , alalaala wawawawaaysysysyssyss I II cc cccomomome e eee babababababackckckckkkckckckk t tt tt o oooo WeWeWeWeWeWeststststststst P P PPPPPoioioioioiointntntntnttnt. .. .AlAlAlAlAAlwawawawawaysysysyss t t tthehehehehherererere e ee eeechchchccc oeooeoeoeoesss sss anananana d d dd ddd rereerererre-e-e-eeechchchchc oeoeoeoeoeees sss s ......... DuDuDuDuDuDuutytytytytyyy -- ---- - HoHoHoHHHHooHoHHH nnononononn rr rrr r rr ------ C C CCCCououououoountntntntntntn ryryryryryrr . . ToToToTooToTodadadadadadaaayy y yy mamamamamamaaamamamamamaamaaarkrkrkrkrkrkrrrr ss sss mymymymymymmy fi fi fi fifififi n n nnnnnalaalalaalal rr r r rololololololll ll cacacacacacacallllllllllllllllll w w wwwwwitititttitthhhh h h h yoyoyyoyoyoyouuu.u.u.u.u. B B BBBBututututututt III I I I w ww www wwwwwwwwananananananaanaa tttt t yoyoyoyoyoyoyoy uuu u totototoooo k k k kknononononooow,w,w,w,w, whwwhww enennnnnnn II III I II c c ccccccccc c ccrrorroroooorrorooororr sssssssssssssssss t t t ttt t thehheheheheheh r r r rrivivivivvverererererrererererer,, , ,,, mymymymymyymyyyymmmmm l l l l l ll llasasaasasasasasaasasasaasasasassassst t tttttttttttttt cococooooonsnsnsnsnsnsciciciciciciciouououoouoo s ss s sss ththththththhththththhththhouououououuooughghghghghhghhhghghtststststtssttstststt w w w w w ililililll l lll bebebebebebeb o o o oof f f f ff ThThThThTThThThT eeee eeee CoCoCoCCoCoooorprprprprprprpr s s s s s ......... . . ananaananananaaa d dddd d d d d ThThThThThThThThThThThhhhe eeeeee eeeee CoCCoCoCoCoCoCoCCCC rprprprprprprps s ssss ..... . . ananananananaananaaananananannnddddd d d ddd TThThThThThThThThee ee e ee CoCoCoCoCoCooorprprrrprprpps ss ss ......... - --- G G GGGGGGGENENENENENENENENNEENEENE EEREREREEREREREEEERERERERRALAALALAAA D DDDDDDDDOUOUOOUOUOUOUOUO GLGLGLGLGLGLGLG ASASASASSSSASSSAS M MMMMMM MMaacacacacacacaa ARARARARRRARRTHTHTHTHTHTTTTTHURURURURURURUU

    TTTTTTTTTTTTTTTThihihihihhihhhihihihihihihis s s ss sss s ssssssss nananananannnananaananaanan tttttittttttttitt ononononnnnnnnonnnnonnnno i s grrrrrrrrraaaaataaaa effffffululululululuululululululu t t t t tttttttthahahahahaahaahaaahahhaaat tt t t tt tttt fofofofofofofofofofoourururururrurrrrururuu y y y yyyyyyy yeaeaeaeaeaeaeeaaeeaeaeaaarsrsrsrsrsrsrsrsrsrsrrrsrsrsrss a a a aaaaaaaagogogogogoooogogooogooogo e eeeeevevveveveveveveeveeeveeeeveeeryryryryryryryryyryryyy mamamam nnn anananddd d wowowooomamaman nnnnnnnn gr dddddadua ititititiitiiti ggngg tttt tt ddddddddddddoddaayay m mm ddaddddddddadaaadeeee aaaa aaa lliliiililiillilll ffefefefeffefefefeee-chchchhhchhchchchchcccchhaanaananananananaananaaanangigiiigiigigigigigiiiigg nngngngngngngngngngngnggng d d dd d dddd dd ddd d deececececececececeecececececececceecisisisisissisissisissssioiooioioioioooioioiioiiioion.nn.n.nn YYouo llefefeft the eeeeeeeee comffortst aaaannndnnn ffffffffffffamamamamamamammmaaamililiiar rsusususus rrrrrrouuouou dddnddndndnn iininiinininingsgsgsgsgs oo offfffff iiiciciiciviivvivililililianananan llll lififfiffee,e a aa ddndndndn dddddd ddeveevevevotototototo dedededededd yy yyououoououo rsrsrsrselelelelelveevevevevv ssss s tototttootononononononoone eeee e e offfofoffoffofofof tttt t thehhehehehehehe nnnn n nobbbbobobobobobobleleleleleelelestststststststst pppp p p p pprororororofeffefeeessssssssiooonsn in a frfreeee couountntry--thththe eprrrp ofoffo esssionn ooooooooooof f fffffff arms. - FFF FORORMMMEMEMEMEMMEMMM RR VICE PRESIDENT DDICI K CHC ENEYE

    BILL CLINTON

  • AtAtAtAt W W WWWesesesesssssssssst t t t ttt PoPoPoPooPoininininnnt,t,t,t,tt,, b b bbbbbbasasasassasa ebebebbalalall l plpllplplppppppp ayayayaayayyyyerereeee s,ss,ss,s,ss,, ll l l llikikikkikikeeeeee e eee e ee e aaaalalalalaaaalaalaa lllll otototototothehehehheheheeherrrr cacaacaaacaaaaaaaaacacacadededededeedetststststststststs,,,,, , ,, , mumummumumumumumuummumumumuststststststststeeexexexxexhihihihihiihihiibibibibibibiibibitttttt ttt prprp fififififiofiofifi c ciiieiencncnn y y yy inin t theheeeeee c cclalassrororororoooomommmmmommomommmmm a a a aaaaa aaa a aas s s ss sssssssss wewewwwewwewewewwweww lllllllllllllll aaaaaasss sssssssss inininnniniiiinn mmmmm mmm mmmmmmmmmmililiililililititiittititititararrararaaarararararryyyyy yy yy y yy yyyyyyyanaaand d dd cacacacacadedededdedet tt t trtrtrttrrt aiaaaininininnniin ngngng. . ArArA mymymy b bbbbbbasasassebebbalall l plplayayerers s hahaveve nnnnnnnotototototttototototottotot ooooooooooooo onlnlnlnllllnlnlnlnlnlnlnnnlnnn yyyyy yyy yy yy sususususususususs c-c--c-c-c-c-cceceedededed,, ththheyey hhhhhhhhhhavave e exexxxxxxxxxcecec lllledededeeddeeded..

    Zach Price (right) was selected to the Academic All-America First Team in 2012.

    Thee C Cenenene teteeteterrr r foffoffofoorrrr r EEEnEnEEnhahahh ncncededed PPPererrerfofoffof rmrmrrmaanana cecece (( (CECECEEEC P)PP)P)P))P)) iii i iisss ssss a a ststatattatateee-e-eeeeeeee ofof-t-thehe arararartt t t ffafafacicicicicilililillitytytytytyty c c comommmimim tttteded t to o dedevevelolopipingng t theehe ff f fffffulululullululuulu lllll ll popotetentntiaial l ofof eeacachhcacadedett ththrorougughh cocompmprereheheh nsnsivvvee mementntalalalalallallalaa tttttt tt ttououghghnenessss aandnd acacadedemimic c skskilillsls t traraininining.g. I It t ofoffeferss t thrhreeee p prorogrgramams s dede iiisisigngngngngnededededed ttt ttoooo o mamamamaxiximimizeze WeWestst PPoiointnt c cadadetet p pererfoformrmanancece, , asas wwelele l l asas e expxporort t ththesese e crcrititicicalal mementntalal s skik lls s toto t thehe U Uniniteted d StStatateses A Armrmy y atat l larargege. . TThehe PPererfoformrmanancecec E Enhnhanancecemementnt P Prorogrgramam ((PEPEP)P) i is s ththe e nanatitiononss moostst c comomprprehehenensisiveve t traraininining g prprogograramm fofor r leleararniningng, , prpracactiticicingng anand d mmasterining g ththe e inintatangngibiblele mmenentatal l skskilillsls t thahat t unundederlrlieie h humumanan peperfformancce;e; ccononfi fi dedencnce e deespspitite e sesetbtbacacksks, , coconcncenentrt ata ioionnamamididstst d disistrtracactitionons,s, a ndd c comompoposusurere uundnderer s strtresess.s. C Cadadetets s papartrticicipipatate e inin i indndivivididuaual l trt aininingng s sesessisionons s duduriringng f frereee pepeririodods s inini t theheiir acadedemimic c scschehedudulele, leleararniningng, anand d ththenen a apppplylyining g theeskskilillsls oof f imimagagerery,y, a ttennentitionon c conontrtrolol, enenere gygy m mananagagememenent,t, anand goalal ssetettitingng. . BiBiofofeee dbdbacack k trtraiaininingng aallllowows s cacadedetsts tto learncrcrucuciaial l ses lff-regegululatatioion n tetechchniniququeses, , anand d sosophisstiticacateted d auaudiio o ananddviv dedeo o sisimumulalatitiononss ofof ggamame anand d prpracactiticece s sitituauatitionons s arare e usedd tto fafacicilitatatete mmenentatal l rereheheararsasal l ofof s spepecicififi c physy icicalal, , acacadadememicic, oror mim lil tataryry s skikilllls.s. TTThehesee t traraininining g memeththodods s arare e dedeririveved frf om ttheheh fi fi e eldldd o of f apapplplieieddspps ororort tt pspsycychoholologygy, wwhw erre e thttheyey a arerer e empmpploloyeyed dd ininn t thehe t traraininning of prprrofofo esessisiononalal aandnd OOlylyympmmpicic aaaththleletetes,s, bbutu aapppply tto oo eveverery y ototheher arareaea off h humumumanan p pererfoformrmmananancec .

    ACACACAACA ADADADADADDDDDDEMEMEMEMEEMEEMEMEMEMEMEMMMMEEEME IICICICICICIC FF FFFF FFACAACACACACACACCCCT:T:TT:TTTT:TT:T:T:USUSUUSUSUSUSU MAMMAMAMAAMAMAAA a a a aaaveveveverararararr gegegegege c cc ccclalalallasssssss s ssssiziziziziiize ee ee isiisiiisssisiis 1111111112222222ststststs ududddduddudduddenenenenenene tststststss....

    ACADEMIC EXCELLENCE

  • ARMY GAME DAY

  • FACILITIES

    Some of the fi nest athletic facilities in the nation greet an Army baseball player upon his arrival at West Some of the fi nest athletic facilities in the nation greet an Army baseball player upon his arrival at West Point. In addition to Johnson Stadium at Doubleday Field one of the countrys most historic baseball Point. In addition to Johnson Stadium at Doubleday Field one of the countrys most historic baseball facilities Army players train regularly in Kimsey Athletic Center, Foley Athletic Center and the Black facilities Army players train regularly in Kimsey Athletic Center, Foley Athletic Center and the Black Knights Indoor Pitching and Hitting Facility. When not training, Army players can relax in the sparkling Knights Indoor Pitching and Hitting Facility. When not training, Army players can relax in the sparkling Team Room that was completed in 2006.Team Room that was completed in 2006.

  • Foley Athletic Center: 77,000-square-foot in-door turf fi eld training facility (2007)

    Team Room: Cutting-edge players lounge (2006)

    Indoor Pitching and Hitting Facility: 100-by-60-foot turf center with three batting cages and dirt mounds (2005)

    Kimsey Athletic Center: 20,000 square-foot strength development facility (2004)

    FACILITIES

  • AAbnbnbnbnbnbnerereee D DDouooublblblblbledededee ayay, , anann 1 1111184848484448 22 22 WeWeWeWeststststststt PPPPP P Pooiointnt g ggraraduatata e,e,, iis s sasaaidid to o hahaveve d devevvvvisisisisisississisededededededededede t t tthehehehee g ggggamaa e offo b bbasasebbalall l whwhw ilile onon leaeavvee ffrorom m thhe e UUUUU.U SSSS.S.. MM M Mililililitittitititi ararrrrararryyyyyy y AcAcA ada eme y in 1183839,9,, d ddraraaawwiwiwingngngng o o ooutututututtutut ttttttt thhhehe d ddiaiai mmondd a andnd t thehe r ruless o off ththee gagagaggg memememememeemememm . . HeHeeeHe c c ccalala leleed d thht e e gag memem BaBaB sse BBalall, bub t t itit w was patternede aftter a g gamaame ecacalllled RRounundededeersrsrss,,, wwww wwhihihihihihhihichhchchchchhh w wasas p plalayed byby b boyoyyys s aanand d giggirlrlss s ininin EE Enggngngngngnglalalalalallalandnd.. WWWWhihihihilelelele t t tthehehehe o ooo oririririgigigin nnn ofofof b basasa ebebe allall ll hahas s bebeenen disispuputetet d,d,d D DDDDDDouououououououoo bbbblbblededayay, , nononeneththelelesess,s, iis s ststilill l gigiveven n crcrededitit aandnd tthehe b basasebebalalll fifi eleldd atat tthehe UU U U SSSSS.SS. MiMiMiMiMiMiMiMiM lilililililitttttattaryryryryAAAcAcAcAcaadadadadeemememy y wawas s dededidicacacc teted d inin h hhisisi h hononor in n MaMay y 191939393939393939393 , , tttththt e e cecentntenenninialal y yeaear r ofof b basasebebalall.l. D Despitete t thehe c onontrtrovoverersysy, Doububbleledaday y didiststininininininniinnguguguguguisisisisheheh d d hihimsmselelf f ththrorougughohoutut hhisis m mililititarary y cacarereerer, , eaearnrnining g ththe e raranknk o of f mamajojor r gegeneneraal. H He servvedinin tthehe M Mexexicicanan a andnd C Civiviil warars.s. A Ass a a cacaptptaiain,n, h he e fi firered d ththe e fi firsrstt t gugugg nnnn n fofofoforrrr thththththeeee UnUnUnUnioioioi n n sisidede iin n ththe e CiCivivil l WaWar r atat F Forort t SuSumtmterer. OnOn NNovov. 2929, 18186262, , hehe wwasasmamade aa m majajoror g genenereralal o of f ththe e vovoluluntnteeeersrs. . HeHe retee irireded f frorom m ththe e U.U.S.S. A Armrmy y inin 1 187873 3 anand d didieded J Janan. . 262626, , 181818189393939393,, inininin NNN N Newewewew JJJ J Jererererseseseseseyyy y atatatatat tt tt thhehehehe aa a agegegegege ooo o offff f 7474747474.. ThThee HHome o of f ArArA mymy B Basasebebalalll s sinincece g gamameses w werere e fi fi rsrstt cocontntesesteted d onon iitsts p preresesentnt ssitite e inin 1 190909,9, D Dououblblededayay F Fieieldld u undndererwewentnt a a m majajoror $ $4.4.2 2 mimillllioion rerenonovavatitionon i in n n 19199696.. FoFollllowowining g ann a aggggreressssivive e fofourur m mononthth c cononststruructctioion n cycyclcle,e, the newew JJohohnsnsonon SStatadidiumum a at t DoDoububleledaday y FiFieleldd wawas s fofor-r-mallly y dededidicacateted d atat c cererememononieies s onon S Seppt.t. 1 13,3, 1 199996.6. T Thehe ggoal of tthee p prorojejectct w wasas tto o prprovovidide e ththe e U.U.S.S. M Mililititarary y AcAcadadememyy wiwithth aan n imimprpresessisiveve f facacililitity y susuititeded t to o ththe e ststororieied d heheriritatagege o of f bobothth W WesesttPoPoinintt ana d itts babasesebaballll p prorogrgramam. HHigighlhligighthts s ofof t thehe r renenovovattion prp ojojecect t ininclclududeded t thehe c cononststruructctioion n of ffulu l lolockckerer rroooomsms f for bbotth h hohomeme a andnd vvissititining g teteamamms,s, f fulullyly eequipippeped dtrtraiaininingng roooomsms, clclububhohoususe e faacicililititieses, , anand d ththe e adadditionon o of f 88880 0 fi fixexed d chchaiair-baackck s seaeatsts. . G Grereatat p paiainsns w werere e tatakekek n in its desesigign n toto d draraw w anan a apppproroprpriaiatete p paaralallelel l bebetwtweeeen n ththee neneww ffacilityy a andnd tthehe hhisistotoriric c sisigngnifiifi c canancece o of f its phphysysi-i-cacal l lolocationn o on n cacampmpusus. . FoFormrmal ggraaninitete f facacining g ememululatatining g mamanyny o of f WeW stt Pointntss o oldlderer a acacadedemimic c bubuilildidingngss waw s tastefefulullyly i incncororpoporarateted d tooadaddrdresess ththosose e memeanans.s. Internalllly,y, s spapaciciouous s loockcker roomsms a andnd c clulubhbhouousese f facacililititieies s prprovovide coachingng s stataffff a andnd t teaeam m memembmberers s wiwithth a spaparkrklilingng h homome.e. A A bbeaea tutififulullyly ccononceceiveded TeTeamam R Roooom,m, cocompmpleletete witth h twtwo o fl fl atat-s-sccreeen n tetelelevivisisionons,s, a a s statate-of-the arart t enentetetertrtaiainmnmenent t sysysttemem a andnd s spaparklinggnen w furnnititurure e wawas s cocompmpleleteted d inin 2200006,6, p prorovivididingng A Armrmyy s s plplayayerers s wiwithth a comfofortrtabablele p plalacece t to o rerelaax.x L Lanandsdscacapipingng a andnd sssitewworork k ararououndnd t thehe f facacililitity were intntenentitiononalallyly sububduueded w witith h ththe e hihiststoro ici parade grgrououndnd k knonownwn aass TThehe PPlalainin reremam in-ing dominanantnt. . InIn o ordrderer tto o ene sus re tthahat,t, o oveverarallll heighght ofof tthehe s strtrucuctuturere wwas minimmizizeded. D Dououblblededayay F Fieieldld i itself unded rwrwenent t a a mamajojor chchc angee dururiningg ththe e susummmmmerer o f 20200606 w whehen n a a coc mpletely nnewew n natatururalal pplalayiy ngng ssururfafacece w wasas iin-nstala led. In n adaddidititionon t to o inincocorprpororatattining g ststatate-e-ofof-t-thee-aarttrt ddrararainnagage e anand d wawateteriringng sysysttemss, ththe e prrojjece t ininclclududeded t thehe a addddititioionn of new bullppenen ppititchchininggmom ununu dsds, , a a hohostst o of f dudugogoututut aameem ninititieses aaandndd t thrhrh eee ffuluu lyly lligighth eded h hitittitingng t tununnenels. IIn thhee sus mmm erer of f 2020011111 , , tht e e e fi fi rsrst-t-eveverer p prreess bboxox was pprere-a-assssememblbleded a andnd d deleliviverereded tto o DoDoubu leday Field.d. T Thehe f facacililitity y prprovoviddese rooom m fofor r atatleasast t 10110 m medediaia m memembebbersrss, ana d a roroofoftotop p poporcrch alaallowsws aaccccesess s fofor r vividedeo o eqequipment.t A bbrarandnd n newew sscocorereboboarard d wawas s ininststalalleled d in theh fall l ofofo 2 201011,1,anand d d a a nenen w w papaddd edded w walall l wawas s ererecece teted d inin J Jananuauary 22012.2

    JOHNSON STADIUM

  • I II It t t t ststststtarararaarartetetetettett dd d d asasasassssssasss aa a aaa v vv vvv iisisioioioooonnn.n IIIItt t tt eenenenenendededededdd d d d d asasassas a a a a d dd ddddrrererererereamamamamammamaaaaaa fi fifi fififi e ee eeeldldldldlddl o o o ooff f f drdrdrdrdreaeaeaaeaamsmsmsmsms, ,,, ,,, nenenenestststststssts leleleled d dd ddd smsmsmsmmmmacacaacacck kkkkk inininininni t t thehehe m mmmmmm mmmidididddididddddidddddlddldlddldldlddlddddldd ee ee e ofofofofofofof tt t tttthehehehehehhe U U UUUUU.S.S.SS.SS.S. ... MiMiMiMiMiMiliililililitatatatatataryryryryyryyyyy A A AAA AAAA Acacacacacacaaacacacacccaaccadededededededddd mymymmm , tutututtutt ckckckkckckededededed s s sssqququququaaaaaararrrara eleleleleleleeeeeee yyy y yyyyyy ininnnnniininininn t t thehehehehhee m m mmm mmididididd---dlddldldldldlleee e e e ofoofoffof h h hh hisi toryryryryryyyyy... BB BBBBB Bacacacaccacacckkkkk kkk k iininininininn t t t tttheheheheheheh lllll l llllatatatatttataaaatta eeeee e e 1919199191919119808080808080808 sss,ss,s,s,,s,,, ttttt tthehehhehehheheheh rererererereree wwwwww wwasasasssss mmmmm m mmmmmmmucucucuucucucucucucucucccuuuchhhhhhhhhhh hh tatatatatatalllklkklklkllk o oo offf ff ff f momomomomommoovivivivivivivinngngngnggggggngngngng v vvvenenenenene ererrrerrrrababababablelelelele DDDDDDoououououuuublblblblblblb e-e-e-e-e-e-edadadadaadayy y y y FiFiFiFiFiFielelelele d,d,dd,d,d t tt ttteaeaeaeaeaaeaaariririririiiiringngngggggggnggngngggg t ttttheheeehee q quauauauaauaiinininininntt t t t lililililitttttt leleleee p ppppararararrrrkk kkk frfrfrfrfrfrfrfrfrfrfrroomomomomoomoomm ii i iitstststststststts nnnn n nnnatatatatatatatturururuuruuralalalala rrrrresesesesestititittit ngngngngng ss ssssspopoppopop t ttt iniininninin tttttt ttheheheheheeeheehehee naanaann tititttitiionononnnalalalalal r rrregegegegegegge isisisisissisissssstetetetetetetetetet rrrrrr rrr ofofofofofofff h h hhhhisissisisisi totot ririiiiiic cc cc cc c c pppplplplp acacaccccaccesesesesss, jujujuujujujjujuuj ststststststt o oooooo oooofffffffffffff t t tttthehehehehehh ThThThThThThTTT e e e ee PlPlPlPlPPPlPPPlaaiaaiaiiiia nnnnn o o o o ooveveveveveveveveeveevveverlrrlrlrlrlrlrllr ooooooooooooo kikik ngngnnng t thhheheheeheheh mammmaajejestststicicciici H HHH HHududuududu sossososososss n nn nn n RiRiRiRiRiRRR vvvevevevev r.r.r. SSo o oo mamamaamanynynynynyyny h h h hh hhadadadadadadddddddadd rr rroaoaaaooooo mememeeememed d d d d d ththththttt e ee tititimememeeeeeeemee-hh-h-hh-hhonononononororororo edeeedeedededeeeede p pppppasasasaasa tutututuuturerrere, , , ,, chchchchchhhasasasassininininnnng g g gg g thththththeieieieeeirrr rr bobobobobooboboyyhyhyhy oooooodd d dddddrdrreaeae msmsmsmmss o on n n a a aa ddididididd amamamammmmammmammmononononond d dd wewewwelllll -s-sssuiuiuiuu teteteed dd d fofor r rrr susususussusus chchchchchchchch f ff ffffanananananaaaanaannanaa tatatataatatatatattaasisisississieseseseesses. . BrBrBrradadadadadadadada leleleleleleeeeyyy,yyy, EEEEEE EEEEisisisisiseneeeennene hohohoh weweewerr,r, M Macac-ArArArAAAAA thht urur, , FrFranannksksksksksskssssss,,,, ,,, ,,,,,,,, BlBlBlBlBlBllBllBllaaiaiaiaiaa kkk k ananna d d ReReReedededddderererer hhhhhhhhhhhhhhadadadaddadddaaaadaa a a a a aaallllllllllllllllll ff ffroroooooroooorooolililililililiilililllll ckckckccc eedddeddddeddd tttt thehheherererere;;;; ; sosoosoososo,,, tttototototototot ooo,o,o,o,o,oo,ooo hh h h haadadadadadddd MM M MMMMcGcGcGcGcGGrararararraw,w,ww,w,w, DuDuDuDuuDuDuDuDuDuDuD rorororororororrochchchhchchchchhhherererereerrrerererrerer, ,,, , , MMMaMMaMaMMaMaMaMaaMMaMaMaysysysysyysysyyssysy , ,, , ,, ,, MaMaMMMaMMMMaMaMaMaMMaaMaM ntntntnnntntnntntn leeleleleleele, ,, , BeBBeeBeBeBeBBeBerrrrrrrrrrrrrrrrrrrrr aaa aa a ananananananananannnnd dddddd d StSStSStStStStStStStStStStS eneeneneneneneeneneenenenenenee gegegegegegegegegegegegeggegg ll.ll.l.l..l.l.l.l. IIII I II IIIIIIt t t tttttttttt waawawwwawawawawawawawassss ss ss sss aaaa aaaaa a lplplplplplplplplplplaaccacacaacccacacacacacacaca eeeeeeeeeee e e e whwwwhwwhwwhwhwhwhwhwhwhwherrererererererererreeeeeeeeeee e e mmamamaamamamamamamamajjojojjojjojojojjojojojjojorrrrrrr gegegeggeggegeggg neneneneneneeeeer-r-r-r-r-rrrralalaa s s s memememememmeet ttt t ttt mamamamamam jojojojojojojojjjj rr rrr leleleleeleeleleleagagagagagagagggagaggaagaggaaggueueueueeuueeuueersrssrsrssrssrs, ,, ,,,, a a a aa wowowowowowwow ndndndndnndeeeeerererererererfufufufufuufufullllll l papapapapapapapaatctctctctcctcttch hhhhhhh ofofofofofoofofof llllll llanananaanananandddddd d ththththththththatatatatatatat tttt t traarararaannsnsnsnsn cececcececenddddndndndndndnd dddededdedededed ttttttttt ttiiiimimmimmimimeee e annaananananannndddddddd spspspspspspspspspspspsppspsppsppppspsppppaaacacaaaaaaaaaace.e.e. Y YYYYYYYYYeteteteteeeeeeee , ,, , asasasas pppparararartt tt ofofofooooooooofoo WW WWesesesesttt t PoPoPoPoinininintttts sss s mamamamaststststerererer ffffacacaccacciiiiilillititititieieieies s s s plplplplananannananan, , , DoDoDoDoububububleleleledadadaday y y y FiFiFiFieleleleld,d,d,d, s s s so o o o riririririr chchcchch inininn h h hh h hhhhisisisisstotototooooootot ryryryryryryryryry,, , sososossososososo w www asasssassasasaasashhehhhhehehehhh d ddd iniinin ttt trararadidididititititionononon, , , , wawawawas sss inininin ddddannnannnanannngegegeger r r ofofofof gg g goioioioingngngng tttthehehehe wwwwayayayay o o o offff sosososomemememe o o o of fff ththttththe ee egrgggrgrgrgrgrrgrrggggrgg eeaeaeaaeeaeaeattttt oonoonooononononononeseseseseses, ,,,,, gogogogogogogogoogogooiinininnninininiiinnnng g g g gggggggg ththththththt e e e ee wawawaay y y y ofofofof tt t thehehehe P P P PPololololo o o o o GrGrGrG ououuoundndndndnnnndnnn sss s anananand d d d EbEbEbEbbebebebetstststststss F F F Fieieieieeldldld; ; ;; gogogogoinininng g gg ththththe ee e wawawwwwaway y yy ofofofofofof C CConnie MMMaMMaMaMaMaMMackckckckkckck S S S S Stattatataaaaadiddididdiumummummum a aa aaa andndndndndndndndn S S S S popopoportrtrtrtsmsmsmsmananananssss PPPPP PP Parararark.k.k.k. TT T Thihihihis s s s mamamamagngngngnifiifiifiifi c c c cenenenent t t t olololold d d d babababasesesesebababbbbaballllllll didididididdiaamamamamaaa ono d,d,,,,,,, n nnnnnnamamamamamaamamedededededdeded i i i iiiiin n nnnnn hohohhhhhhh nor of AAAAAAbnbbbnbnb ereereererere DDDDD DDououououooooo blblblbledededdddddedddddddayayayayy, ,,,, ththththe ee e fofofofofoununununundededededer rr rr ofofofof b b b basasasasasebebebebalalalala l lll anananannd dd d anananann 18181818181818424422 U UUSMSMSMMSMSMA A A AAAAAA grgrgrggrgrgggg adadadadadaaddaduauauauauauauauaauatetetetetetttetee, , , wawas s totoo bbe rer lolocacacacaacacaacaaacacaaatetetttetetetetetteteteteteteeedddddd dddddd d d dddddddddd d totototototototott a a aa a a a m mmm orororore e e e ststststererererilililile e eee sesesesesesesetttttttttttttinininininnininng,g,g,g,g,g,g,g, aaaaaa a a hhhhhh h holololololololollollololololololoowwwwwwww plplplplplplp acacaaaaa e ee ee vovovovvv ididididididi o o o ooof ff f memememememeeeemomomommomomommoririririririeses andnd herititagage.e O O nln y y ththththththt eee e DoDoDoDoDoooDoubububububbubbbbleleeleleleledadadaday y SoSocicicietetteeee y,yy,yy, wwww wwwitititttitth h RoRRR d dd ViVVV ttyy (U(UUUUSMSMSSSMS A A 555)5)5) aaas ss ititits s drdrrrdrrdrrrrriivviiivi inininggg gg fofofoforcrcrcrcrcrccrcrcrcrcrcrcrcrcrcrccee,e,,,,, ananananaananaa d dddddd d dddddd thththththhthhthhthththhththt e ee ee e e eee eeeee fafaaafafaaafafafafafafaafafafaamimiiimiimimmim lylylylylylyylylylylylyyyylyyyy o ooo oooo oo oooooffffff fff RuRuRuRuRuRuRuRuRuRuRuRuRuRRRuRuRuRR pepepeeeeepepeeepepepepertrtrtttrtttrtrtrtr HHHHHH HHHHHHH. JoJoJoJoJoJoJoJoJoJooJooJJoJooooooJoohhnhnhnhnhnhnhnhnhnh sosososososssosoooson n nnnn n n (U(U(U(UU(U(UUU(U(U(U(U(U(UU(( SMSMSSMSSMSMSSMSMSMSMSMSMSSSS A A AA A AA A A AAA 22222222222)2)2)2)2)2)2))2)) wwwww wwwwwwwwouououououououuouooulddldldldlddldldldddldldd nnnnn nn nnnn nottototototottototot lllll ll ll tteteteteteteetetetett tttt t t ttttt t thhhahahahahahhahah ttttttt ttt hhahahahahahahahaahahapppppppppppppppppppppppppeneneneneneenenenenene . .. A A A A AA AAAAA marvrveeeeeeleleleee ououuuuuouououus s ssssss ssss ssss popopopopoppoowewwewewewer r r r rr pipipipppp tctctctctctt heheheheheheeer rr dududududuuririririringngngngngngnngngngggg h h h h isisisisisisssssss dddd ddddayayayayayayss s s s s sss ininininininiininiininn t tt t tttttheheheheh BBBBlalaaackckckckk, , ,, GoGoGoGooldldd a andndndnd GG Grararar y,y,yy V VV Vitititititititttititttttytttytyy hhah d spspspspspspspspppeeeeneeneee t aaa a aa aa gogogogogogogog ododododoodo pp p p porororororrortittititititiononononononnnnn o o o ooooooof f ff f hihihihihih sssss sssssss WeWeWeeeeWeeWeWessssssstststs Pointntntntntntntntt ssprpriiinnnnninnngsgsgsgsgsgs t t t ttoioioiooililililil ngngngngnggngg oo ooon n nnn ththththththe e eeee fi fi fi fi fi elelelelleld d dd ddd whwhwhwhwhhhherererrreeerrrrerre eeeeeeeeeeee legendndnndndnddndnnnddds weeeeeeeweeeeererererererererererereree bb bbbbb b bbbbb b borororrororororororororo n.n.n.n.n.n.nn.n..n F F F FFFFFFFF FFFFororororororoorororrorororo V VV V VVVVVVVVVVVitititittitititttttititttytytytytytyttytytytytytytyyy, , , ,,,,, ththththththhthtththththhthht e e thththththhhhhhhthhhhht ooouoooooooooo ght ofofofofofofoofofo movvvvvvvvvvvininnininnnnnnng g g g gg gggggg TTTTTTTTTThehehehehhehehheehehe HH H HHHHHHHHomomomomommomomomomoomommmmme e e ee eeeeee e ee ofofofofofofofofofoofo A A A A AAAAArmrmrmrmrmrmrmrrmrrmmyy yy y BaBaBaBaBaBBaB ssssesssssesssss -----bbbbbbabbballlllllllllllll ffffffffrfroooom ttttttt tthhehhhhhhhhhhee ssssss sititititittitiiite e e e ee e ee e hhwhhwhwhwhwwhwwwwhwwhwhw ererereerererreeeeee gagaggggagaagamememememememmememmmessssssss hahhahahahahahhahah ddddd ddddd fi fifififififififififirsrssrssrsrsrsst ttttttttttt bebebebebbebebbbbebeb eneneneneneneneneen cccccccccccc cononoonononoonnonnooonononteteteteteteteetetetettetteststststststsstststststededededededededeed iiiiiiii iinnnnnnnnnnn n 1919191919199191911990909090090990909090909909 bbbbbbbbbb bbbborororororoororororooordededededededddedededeererererereerreerreredddddddd d ononononononononononononnnoon treason.nn VVVVVVVVVV V VVV VVVVitittitititititittititi tytytttytytytytyty, ,, , ,,, llalalalalalononoonnonononnononnngg gg g wiwwwwiwiwiwiwiwiw hththththhhththh a a aa h hhhhhhhhhosososoooooooso ttt offofofoofofofoofofofofooo ooo ooooththththththhthhtthtthhthtthherererereeerererrrrereee f f fff fffffffffoooororo mememeeeememeerrrrrr rrrrr plplplp ayayerrs s anana d d frienddddddddds of the prorogrammmmmmmmm, ,bbbebebegagagannn aaa crcrcrc usususadaddddadadadeee ttttotottoo SaSaSSaSSaSaSaSaveveeveveeveve DDDDDDDDDDD DDouououoouuououblblblblblblblblbbblblbbb eddededededdddedede ayayayaayyayayyayay FFFFF F FFFFiieieieiiieieieeieldldlddddldldlldlddd.. T TTTTTTThhahahahhahahah kkkknkknknkknknksssss tttototototoo ttttttt thhhehehhhhheheheeiririiriiririirir eeeeeeee efffffffffffffffffffffororoorororororrttttstsstststststs aaaaaaaa a ddddndndndndndndndndd tttttttttt thhhhehehhehhehhehehhee trtt ememeneendousus genererososity y ofof tttheeh J JJohoohnssono fammilly,yy tthe dreeam wwassa rreaalizezez d dd with thehee ffffofofofoformrmrmmrmrmalalllallalala ddddddddededdddededede iciciiiciciici atattttatatatioioiioiooioionnnnnnn ofofofofofoffof RRRRRRRupupupupupupupuperererererererertttttttt t t HHHHH.H. JJJJJ Johohohohohohnsnsnsnsnssonnononononononn SSSSS S SSStatatatatatatatt dididididididiumuumumumumuumm aaaa atttttt t DoDoDoDooDoDoDoDooubbububububuubublellelellelel daddadadadadaddadayyyyy y y FiiFiFiF elelelelee d dd dd onono SSepepppppt. 1313313, 191999669696. T TTThehe g ggoaal ofo tthehe ppprorojejeej ctctc wwas tttttooo oo ooo o o o prprovide thhe U.S. Military y Academy with animmi prprressssivev ffaca illitity y suuititedeee tto o thhhe e e e sssststststs oro ied heritage of West Pointnt a andd itsts ggloriouo sbabaasesesss baballl pp rorogrgrg amam. Higigghllighth s s of tthee undndddndddddddeeeerertataking included the coonstructiono of full locker rrorororororoomomomomomsssss fooofofofoofoorrrrrrr r bobobobobobobooothhthththththh hhhhhhhh hoomomomomomee anandd ivisitingg teams, a training room, clubhouse facilities, alono g with thee addddittion ofoff 8 8888888888888808 fi xeded chah ir-back seats. GGreatat ppaia ns were takek n inn its dese iggn to draaw w an aapppppproroororoprprprpprp iaiaiaiaatetetete pp ppararalalleel l bebe-twt eeeen n tht e e new facility andd the histotoririiccc c sisisisisigngngngngnifiifiifiifiificcc c cananananancece o of f itits s phphysysy icicall loco atatioion n onon popopopop stststst.. FoFoFoFoFormrmrmrmrmalalalalal ggg g grararararanininininittetetete ffff facaciiiining g ememululatatining g mmanyy of WeWeestst PPoio ntntss o oldlder aacacadedemimicc bubuilildidingngs s wawas s tattaststefefulullyly i incncororpoporaateted d totot a addddreressss tthohosese m meaeansns.. IIntntterernanalllly,y, s spapacicic ouous s lolockc erer r rooom anand d clubbhohoususe e fafacicililititiese p prorovividede c coaoachch-ining g ststafaff f anand d teteamam mmemembeberss w witith h a a cocomfmforortatablb e hoomeme.. F Fininalallyly, lalandndscscapapinngg ararououndnd tthehe f facacililitity y wawas s inintetentntioiionanalllly y susubdbdueued d wiwithth ththe e hihiststororicic p pararadade e grgrououndnd k knonownwn a as s TThehe PPlalainin reremamaininining g dodomiminanantnt n neaearbrby.y. ToTodadayys s dededidicacatitionon oof this ststatate-e-ofof-t-thehe-a-artrt babasesebaballll ffacacililitity y bebecocomemes s a alolongng ooveverdrdue ddisistitincnct tt anand d pepermrmananenent t adaddidititionon t o the e AcAcadadememy y anand d itits s atathlhleteticic prprogogram,m, ViVitttty y ststreresssseded d dururining g ththe e fafacicillitytyss d dededicicatatioion n cecereremomoninieses.. TThihis s bebeaua titifuful l ststadadiuium m isis aann apapprpropopririatatee anand d prprououd d exexprpresessionon o of f WeWest PPoiointntss llovove efofor r ouour r nanatitiononalal p pasastit meme.. ThThe e DoDoububledaday y SoSocicietetyys s efeffofortrts s toto cononststruructct t thihis s fafacicililityty w wasas m made e popos-s-sis blble e byby t thehe e extxtrerememe ggennererosositity y ofof tthehe ffamilily y ofof RRupuperert t H.H J Johohnsnsonon. . ThThisis f famamilily y prprovovidideded t thehe l larargegests non-ttesestatamementntarary y gigiftft eevever r rerececeiviveded b by y WeW stst P Poiointnt. . ThThe eDoubleday y SoSocicietety y shsharareses t thehe ffammililyys s grgreaeat t pride inn ddededicicatatining g ththisis s statadidiumum ttto oo ththe e mememomoryry oof f RuRupepertrt H H. Johnson, ViVitttty y cocontntininueued.d. HiH s s prprououd d cocontntriribubutitionon t to o ththe fi nancial innduduststryry, , hihis s cocommmmununitity y seservrvicice e anand d philannththroropipic c acactitivivititieses wwerere ererefl fl ecectitivev of f ththe e ununcocompmproromim sing standdarardsds a andnd e endndururining g vavalulueses t thahat t weweree susuchch a an n inintetegral aandnd d dririvivingng f fororcece i n n hihis s lilifefe. . AlAll l ththatat wasas nurtured,d, IImm ssurure,e, byby h hisis WWest Point t exexpeperirienencece a andnd i imbm ede ded d byby tthohosese s sprprinng-g-titimeme d dayays s plplayayining g babasesebaballll o on n this vere y fi fi eleld.d. W We e cacallll i t our fi eld oof f drdreaeamsms.. T Thohosese same drd eamsms w wilill l bebe s shaharered d byby ffututurure e gegeneneraratitionons s of Army baseebaballll plp ayayererss fofor mamm nyn yeaars to o cocomeme. . ThThe e D Dououbledday Soccieietyty aandnd t thehe ffamilily y ofof RRu-u-peertrt H H. . JoJohnhnsoson sasaw w toto t thahat.t

    AAAAAARRRRRRMMMMMMYYYYYYSSSSSS FFFFFFFFIIIIIIEEEEEEEELLLLLLDDDDDDD OOOOOOOOFFFFFFF DDDDDRRRRRREEEEEEAAAAAAAAAAAMMMMMMMMMMMMMMMSSSSSSSSSSSSSS

    DOUBLEDAY FIELD

  • CENTER OF ATTENTION

  • One thing about these military-offi cers-in-training they wont be rattled. One thing about these military-offi cers-in-training they wont be rattled. Lets face it, theyre soldiers. Not only that, last years experience at LSU Lets face it, theyre soldiers. Not only that, last years experience at LSU will be a huge advantage for the (Black) Knights. Nick Hill and Justin will be a huge advantage for the (Black) Knights. Nick Hill and Justin Kashner have great resumes and with an inspired effort, could pull off a few Kashner have great resumes and with an inspired effort, could pull off a few shockers in the Tallahassee Regional. FSU better be aware of what theyre shockers in the Tallahassee Regional. FSU better be aware of what theyre getting into.getting into. ERIC SORENSON ERIC SORENSON, SEBaseball.com, , SEBaseball.com, predicting Army as the NCAA Tournaments No. 4 Seed to Watch prior predicting Army as the NCAA Tournaments No. 4 Seed to Watch prior to the 2005 NCAA Regionals to the 2005 NCAA Regionals

    Hardly daunted, Army played like a team determined to make school history. CHRIS MILTON, Times Herald-Record, following Florida States 3-2 defeat of Army at the Tallahassee Regional

    You have to give Army a lot of credit. We were really impressed with their ball club last night and equally impressed today. They scrap, they play hard and theyve got some pretty good talent. I dont think the general public really knows how good this Army team is. STEVE KITTRELL, Head Coach, South Alabama, following Armys 8-5 defeat of the Jaguars at the Tallahassee Regional

    The home runs and the pitches will long be forgotten, but the character of the Army baseball team will be long remembered from the NCAA regional tournament. Army coach Joe Sottolano was an impressive fi gure , whether passionately talking about his players effort, or their sacrifi ces or what may be in store for them in what he called these diffi cult times. He wasnt talking about trying to turn a double-play. He was talking about the world. Florida State offi cially won the regional. But Armys players stole the show. CHARLES GOLDBERG, Birmingham News

    I think the fi nish wouldnt have been nearly as exciting if it hadnt been for the tremendous, competitive play of Army. They set that up with outstanding effort. They hit the ball hard. They hit it far. They hit it often. They hit it off the ground. They hit it when it was in the air. They hit it off the fence. They hit it over the fence. They really did a great job this game. Were fortunate to win and it was a dramatic win. AUGIE GARRIDO, Head Coach, Texas, following Texas 14-10 win over Army at the 2009 Austin Regional Final

    Sottolano is a recruiting genius, bringing top-fl ight talent to a school that has demanding academic standards and a fi ve-year military commitment to boot. KEN McMILLAN, Times Herald-Record While other rising juniors at elite college programs wonder

    about next springs Major League draft, (Clint) Moore and (Ben) Koenigsfeld and the rest of Armys team are focused on in order duty, honor, country and baseball. JEFF MILLS, Greensboro News-Record

    2009 Regional GradeArmy: A

    The Black Knights will walk away from this regional with a bitter taste in their mouths, after going into the 9th inning with a four-run lead and losing the title game against Texas. But like BC, hard to fault the Cadets here. What a great effort they gave, nearly pushing this to a fourth day. This team set more than 60 records in their impressive 36-21 season. ERIC SORENSON, Eastons Collegebaseballtoday.com

    Three Bold Predictions:1- Army earns a No. 3 seed and makes another Regional title round. Yep, I didnt blink while typing that, either.

    The Black Knights made headlines last year with their PL dominance and runner-up fi nish in the Austin Regional where they played Texas tough and eliminated Boston College and Texas State. The Black Knights are loaded for 2010, as the top fi ve pitchers and fi ve of the top six hitters are back, including one of the better two-way players in the Northeast in Ben Koenigsfeld. This looks like a bonzai year for the Black Knights. That NCAA tournament experience from last year will keep Army in the catbird seat, and confi dent it can stay there. ERIC SORENSON, Eastons Collegebaseballtoday.com

    WHAT THEYRE SAYING

  • ARMY AT THE NCAAS

  • For the 17th consecutive season, Army will travel to sunny Tampa, Fla., for its spring trip in March. Few teams For the 17th consecutive season, Army will travel to sunny Tampa, Fla., for its spring trip in March. Few teams nationally can boast of the accommodations offered to the Army baseball team during its annual venture south. nationally can boast of the accommodations offered to the Army baseball team during its annual venture south. Invited guests of the New York Yankees franchise, the Black Knights work out daily at the Yankees sprawling four-Invited guests of the New York Yankees franchise, the Black Knights work out daily at the Yankees sprawling four-fi eld minor league complex, located two blocks from George M. Steinbrenner Field, spring home to New Yorks fi eld minor league complex, located two blocks from George M. Steinbrenner Field, spring home to New Yorks Major League club. With access to the Yankees medical and training facilities, Army players are guaranteed Major League club. With access to the Yankees medical and training facilities, Army players are guaranteed some of the fi nest care and treatment afforded any college athlete. Additionally, the Black Knights are awash some of the fi nest care and treatment afforded any college athlete. Additionally, the Black Knights are awash in the heritage and tradition so synonymous with professional sports most storied franchise and its rich player in the heritage and tradition so synonymous with professional sports most storied franchise and its rich player development system. Current big-leaguers, top prospects and former stars routinely walk the complex as Yankee development system. Current big-leaguers, top prospects and former stars routinely walk the complex as Yankee workouts coincide with the Black Knights daily practice times. Army will once again square off against top teams workouts coincide with the Black Knights daily practice times. Army will once again square off against top teams from around the country during this years trip. In recent years, the Black Knights have defeated opponents such from around the country during this years trip. In recent years, the Black Knights have defeated opponents such as Central Florida, as Central Florida, Cornell, Cornell, Eastern Kentucky, Eastern Kentucky, Florida, South Florida, Florida, South Florida, Georgetown, Georgetown, Illinois, Indiana, Iowa, Illinois, Indiana, Iowa, Massa-Massa-chusetts, chusetts, Northern Iowa, Northern Iowa, Northwestern, Northwestern, Ohio State and Pennsylvania during their spring trip. This seasons spring Ohio State and Pennsylvania during their spring trip. This seasons spring slate includes games against Yale, Indiana, Miami (Ohio), North Dakota State and Dartmouth.slate includes games against Yale, Indiana, Miami (Ohio), North Dakota State and Dartmouth.

    SNAPSHOTS FROM FLORIDA

  • HUDSON VALLEY BASEBALL CLASSIC

  • 23232013 ARMY BASEBALL2013 ARMY BASEBALL

    MEDIA INFORMATIONMEDIA INFORMATION

    The 2013 Army baseball media guide has been prepared specifi cally to assist the media in its coverage of Black Knight baseball. Requests for additional information should be directed to Christian Anderson, assistant director for athletic communications, U.S. Military Academy, 639 Howard Road, West Point, NY 10996.

    PRESS CREDENTIALS Since there is no admission charge for baseball games at Johnson Stadium at Doubleday Field, there is no need to request credentials in advance. A press box is located behind home plate. Photographers are permitted in foul territory beyond either dugout, but are not allowed in the dugouts or in the area directly behind home plate. Photographers are asked to request fi eld access prior to game day. Please contact Christian Anderson in order to confi rm those arrange-ments.

    PARKING There is ample parking in the Clinton Field and Johnson Stadium at Doubleday Field lots, both of which are located directly adjacent to Doubleday Field. A special pass for both lots is required for weekday games prior to 3 p.m., but beyond that time there are no parking restrictions. Parking is open at all hours for weekend games. Media members are encouraged to park a safe distance from the fi eld to avoid foul balls.

    RADIO/TELEPHONES Armys Offi ce of Athletic Communications will provide a telephone line (845-938-6013) for one visiting radio station, with commercial groups granted preference over student stations. The line may be reserved through Christian Anderson. There is a $75 rental fee for all visiting radio stations, and all calls should be charged to the outlet or billed to a credit card. Checks must be pay-able to Army Athletic Association and received on the day of the game. There is no ISDN phone line availability at Johnson Stadium.

    INTERNET ACCESS While there is no wireless internet service availability at Johnson Stadium, media members will be provided with hard-line network access inside the press box.

    PLAYER/COACH INTERVIEWS Army players and coaches will be available to the media throughout the sea-son. All player and head coach interviews must be arranged through the Offi ce of Athletic Communications, but assistant coaches may be called directly in their offi ces. To ensure availability, please allow 24-hour notice prior to your need for a player interview. Please call Christian Anderson at (845) 938-3303 for all in-terviews. Please allow enough notice so that proper arrangements can be made that will not interfere with academics, work or practice times.

    ARMY ON THE INTERNET Information on the Army baseball program can be obtained throughout the year at www.goARMYsports.com. The comprehensive baseball site includes current and past press releases, game notes, up-to-date statistics, player and coach profi les, the 2013 season outlook, roster, schedule and results. Real-time statistics for all home games will be available throughout the year, while box scores and updated season statistics are posted immediately following every game, including road contests. In-game score updates for most contests will also be available on the Army Baseball Twitter page at www.twitter.com/Army_Baseball. For more information log on to the Army Athletics website at: www.goARMYsports.com.

    ARMY OFFICE OF ATHLETIC COMMUNICATIONS The Army Offi ce of Athletic Communications is located in Building 639 on Howard Road. Assistant Director Christian Anderson is the point of contact for baseball.

    Offi ce of Athletic Communications 845-938-3303Athletic Communications Fax 845-446-2556Andersons E-Mail [email protected] Cell Phone 845-554-6023Doubleday Field Press Box 845-938-8168

    MULTI-MEDIA COVERAGE Eighteen regular-season games and all postseason contests are scheduled to be broadcast by the Army Sports Network this spring. The audio broadcasts will be available online at www.goARMYsports.com via Knight Vision, Armys subscription-based multi-media offering. Fifteen of the 18 games will also be part of an aggressive video streaming package, which will be available on Knight Vision this spring. Most games will also be broadcast throughout the Hudson Valley on radio stations WALL (1340-AM) and WEOK (1390-AM). Army Assistant Athletic Director Rich DeMarco will handle play-by-play duties for the entire slate.

    2013 Army Broadcast ScheduleMarch 20 Quinnipiac (V)March 23 New York Tech (A)March 23 Columbia (A) March 24 New York Tech (V)March 26 Siena (V)March 30 New York Yankees (V)March 31 Navy (2) (V)April 1 Navy (2) (V)April 10 Fordham (V)April 17 Manhattan (V)April 24 Marist* (A)April 27 Holy Cross (2) (V) April 28 Holy Cross (2) (V)May 1 Hartford (V)May 11-12 Patriot League Tournament (TBA)May 18-19 Patriot League Tournament (TBA)

    *Hudson Valley Baseball Classic in Fishkill, N.Y.(A) Indicates Audio Stream(V) Indicates Video Stream

    TEAM LEADERS ARMY QUICK FACTSLocation ..................................................................................... West Point, N.Y.Founded .................................................................................... March 16, 1802Enrollment ................................................................................................. 4,400Nicknames .......................................................................Black Knights, CadetsColors .......................................................................................Black, Gold, GrayMascot ......................................................................................................... MuleHome Field ...................................Johnson Stadium at Doubleday Field (880)Dimensions ................................. LF-327, LCF-370, CF-400, RCF-375, RF-327Conference .................................................................................. Patriot LeagueAffi liation ..................................................................................... NCAA Division I2012 Overall Record ..................................................................................41-152012 Patriot League Record .......................................................................18-2

    BASEBALL STAFFHead Coach .................................................................................Joe SottolanoAssociate Head Coach ...................................................................... Matt ReidAssistant Coach ..................................................................... Anthony DeCiccoAssistant Coach .............................................................Lt. Col. Dave BorowiczHead Offi cer Representative .........................................Col. Raymond NelsonAthletic Trainer ................................................................................... Tim KellyAthletic Communications Contact .................................... Christian AndersonBaseball Offi ce Phone ............................................................ (845) 938-3712Athletic Communications Phone ...........................................(845) 938-3303Doubleday Field Press Box .................................................... (845) 938-8168

  • 2424 2013 ARMY BASEBALL2013 ARMY BASEBALL

    North Carolina (6): Jon Crucitti (Salisbury), Garrison Franklin (Granite Falls), Justin French (Charlotte), Alex Jensen (Charlotte), Jacob Page (Wilson), Justin Reece (Greensboro)

    Virginia (5): Stephen Brooks (Glen Allen), Gunnar Carroll (Louisa), Dakari Cooke (Hampton), Andrew Flaherty (Chesapeake), Patrick Gardner (Glen Allen)

    Georgia (4): Harold Earls (Cumming), John Malcolm (Marietta), Davis Marlar (Carrollton), Chris Rowley (Duluth)

    Texas (4): Blake Burrus (Wichita Falls), Brock Davidson (Houston), Mark McCants (Flower Mound), Jona-than Thiess (League City)

    New Jersey (3): Colin Briant (Manasquan), Brian Hapeman (Fair Haven), Grant Van Orden (Wyckoff)Connecticut (2): Nick Dignacco (Sharon), Erik Washburn (East Hartland)Oregon (2): Connor Love (Beaverton), Alex Robinett (Bend) California (1): Julian Larimer (Carmel)Florida (1): Daniel Cortes (Altamonte Springs)Illinois (1): Andrew Johnson (Elmhurst)Indiana (1): Ryan Levenhagen (Indianapolis) Louisiana (1): Michael Sands (Baton Rouge)Maine (1): Jack Verrill (South Berwick) Ohio (1): Patrick Mescher (Versailles) Tennessee (1): Ben Smith (Germantown) Washington (1): Taylor Goucher (Tacoma)

    TABLE OF CONTENTSTABLE OF CONTENTS

    EDITORIAL LINEUPTHE ACADEMY

    Army Baseball 2013 ...........................................1Army Tradition ......................................................2Road to the Regionals .........................................4Players Perspectives on West Point ..................6Coaches Perspectives on West Point ................8Notable Alumni ....................................................9Why West Point? ............................................... 10Academic Excellence ....................................... 12Army Game Day ................................................ 13Facilities ............................................................ 14Johnson Stadium ............................................. 16Doubleday Field .................................................17Center of Attention ........................................... 18What Theyre Saying ......................................... 19Army at the NCAAs ........................................... 20Snapshots from Florida ................................... 21Hudson Valley Baseball Classic ...................... 22Media Information ............................................ 23Squad Breakdown .............................................24U.S. Military Academy ...................................... 25Director of Athletics Boo Corrigan ................... 29

    THE COACHESHead Coach Joe Sottolano .............................. 30Assistant Coaches ............................................ 33

    THE TEAM2013 Season Outlook ...................................... 35Meet the Black Knights ....................................41Army Rosters .................................................... 79Career Highs ......................................................81

    THE GAMES2012 Final Statistics ........................................ 842012 Season Results ...................................... 852012 Patriot League Standings ...................... 862012 Patriot League Statistics ........................87The Last Time ................................................... 88

    THE HISTORYMore Than a Century of Tradition ................... 90Great Moments ................................................ 92Through the Years ............................................ 95Team Records ....................................................97Team Top 10 Lists ............................................ 98Individual Records .......................................... 100All-Time Batting Leaders ................................ 102All-Time Pitching Leaders .............................. 103Yearly Statistical Leaders .............................. 1042012 Honors .................................................. 107Army Accolades .............................................. 109League Championships ................................. 111Patriot League Honors ................................... 112All-Time Patriot League Standings ......