1

MDCK SIAT-1 cells show improved isolation rates for recent human influenza 1

viruses compared to conventional MDCK cells 2

3

Running title: Isolating influenza virus in MDCK-SIAT1 and MDCK cells. 4

5

Ding Yuan Oh1,2

, Ian G. Barr1,2

, Jenny A. Mosse2 , Karen L. Laurie

1* 6

7

1WHO Collaborating Centre for Reference and Research on Influenza, 45 Poplar Road, 8

Parkville, Melbourne, Australia, 3052. 9

2School of Applied Sciences and Engineering, Monash University Gippsland Campus, 10

Churchill, Victoria, Australia, 3842. 11

12

*Corresponding author: mailing address: WHO Collaborating Centre for Reference and 13

Research on Influenza, 45 Poplar Road, Parkville, Melbourne, Australia, 3052. 14

Phone:+61-3-9389-1340. Fax:+61-3-9389-1881. Email: karen.laurie@influenzacentre.org 15

16

17

ACCEPTED

Copyright © 2008, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.J. Clin. Microbiol. doi:10.1128/JCM.00398-08 JCM Accepts, published online ahead of print on 14 May 2008

on April 9, 2020 by guest

http://jcm.asm

.org/D

ownloaded from

2

ABSTRACT 18

The ability to isolate and propagate influenza virus is an essential tool for yearly 19

surveillance of circulating virus strains, and to ensure an accurate clinical diagnosis for 20

appropriate treatment. The suitability of MDCK-SIAT1 cells, engineered to express 21

increased levels of α-2,6-linked sialic acid receptors, as an alternative to conventional 22

MDCK cells for isolation of circulating influenza virus was assessed. A higher number of 23

influenza A (H1N1 and H3N2) and B viruses from stored human clinical specimens 24

collected between 2005 and 2007 was isolated following inoculation in MDCK-SIAT1 25

cells compared to MDCK cells. In addition, a higher titre of virus was recovered 26

following culture in MDCK-SIAT1 cells. All A(H1N1) viruses recovered from MDCK-27

SIAT1 cells were able to agglutinate both turkey and guinea pig RBC, whilst half of the 28

A(H3N2) viruses recovered after passage in MDCK-SIAT1 cells lost the ability to 29

agglutinate turkey RBC. Importantly, the HA-1 domain of the haemagglutinin gene was 30

genetically stable after passaging in MDCK-SIAT1 cells, a feature not always seen 31

following MDCK cell- or embryonated chicken egg-passage of human influenza virus. 32

These data indicate that the MDCK-SIAT1 cell line is superior to conventional MDCK 33

cells for isolation of human influenza from clinical specimens and may be used routinely 34

for the isolation and propagation of current human influenza viruses, for surveillance, 35

diagnostic and research purposes. 36

ACCEPTED

on April 9, 2020 by guest

http://jcm.asm

.org/D

ownloaded from

3

INTRODUCTION 37

38

The ability to isolate and propagate influenza virus is essential for the yearly surveillance 39

of circulating virus strains and for further studies, such as antigenic and antiviral 40

sensitivity analyses. Historically, embryonated chicken eggs have been used to propagate 41

influenza viruses and are still used by most manufacturers to produce influenza vaccine 42

today (2,3,4). Infection of immortalised mammalian cell lines in vitro with influenza 43

virus has provided an alternative to egg inoculation (10, 13). Following the threat of an 44

avian-derived H5N1 influenza pandemic, vaccine production via cell culture is currently 45

being expanded, allowing more rapid production of influenza vaccine (8, 21, 29, 44). 46

47

Cell culture has been the preferred method for laboratory-based influenza virus isolation 48

since the 1960s, as it is relatively simple, sensitive and cost-effective. Many cell lines 49

have been used, including BHK-21 (14), LLC-MK2 (38), SPJL (40) and Vero cells (11, 50

12). Madin-Darby canine kidney cells (MDCK), however, have proved to be the easiest 51

to handle, most sensitive and most reliable cell line (10, 13, 27, 38) and remain the 52

standard cell line for influenza virus propagation. Both human and avian influenza 53

viruses can be isolated from MDCK culture with high viral titres (27, 42, 43), which may 54

be attributed to the fact that both α−2,6- and α−2,3-linked sialic acid receptors are 55

expressed on the cell surface of MDCK cells and these are the primary receptors for 56

human and avian influenza viruses, respectively (18, 35). However, unlike human 57

respiratory cells, the level of α−2,6-linked sialic acid receptors on MDCK cells is 58

relatively low, thus MDCK are not an ideal in vitro representation of the human 59

ACCEPTED

on April 9, 2020 by guest

http://jcm.asm

.org/D

ownloaded from

4

respiratory system (1, 7, 19, 40). Matrosovich and colleagues established a MDCK cell 60

line, MDCK-SIAT1, that was stably transfected with human CMP-N-61

acetylneuraminate:β-galactoside α−2,6-sialyltransferase, an enzyme that catalyses the α-62

2,6-sialylation of galactose on glycoproteins or glycolipids. These MDCK-SIAT1 cells 63

over-expressed the α-2,6-linked sialic acid receptor compared to MDCK cells (25). 64

Enhanced α-2,6-linked receptor levels should increase the number of interactions 65

between human influenza virions and the cell surface, and hence the avidity of the 66

binding. This was indirectly demonstrated with MDCK-SIAT1 cells being more sensitive 67

for assaying human influenza virus susceptibility to neuraminidase inhibitors compared 68

to MDCK cells (25). Increased sensitivity to neuraminidase inhibitors was also seen in 69

viruses passaged through another MDCK cell line transfected with the β-galactosidase α-70

2,6 sialyltransferase I gene (ST6Gal I) (16). In addition, in a small study with 8 A(H3N2), 71

7 A(H1N1) and 5 B viruses collected from 1999 to 2004, ST6Gal I cells showed 72

increased isolation rates with A(H3N2) and B viruses, but not A(H1N1) viruses, as well 73

as enhanced virus growth with all 3 types/subtypes if the samples had previously been 74

grown in MDCK cells (16). However, neither of these studies addressed the potential for 75

in vitro modifications to the virus during culture in cells over-expressing surface α-2,6-76

linked sialic acid receptors, a common feature seen in egg-adaptation of viruses where 77

mutations of the haemagglutinin (HA) gene occur in response to the abundance of α-2,3-78

linked sialic acid moieties (18). 79

80

Possibly for this reason, or because of the lack of further reports on the usefulness of 81

these cell lines for influenza virus isolation, few laboratories have adopted MDCK-82

ACCEPTED

on April 9, 2020 by guest

http://jcm.asm

.org/D

ownloaded from

5

SIAT1 or ST6Gal I cells for routine virus isolation or growth. In this study, we further 83

assessed whether MDCK-SIAT1 cells were a viable alternative to conventional MDCK 84

cells for isolation and propagation of recent influenza viruses. We found that MDCK-85

SIAT1 cells gave higher isolation rates and higher growth of influenza virus from human 86

clinical specimens compared to MDCK cells. In addition, there was little change in the 87

sequence of the HA gene on passaging in these modified MDCK cell lines. 88

ACCEPTED

on April 9, 2020 by guest

http://jcm.asm

.org/D

ownloaded from

6

MATERIALS AND METHODS 89

90

Cells 91

MDCK cells (CCL-34, ATCC, USA) and MDCK-SIAT1 cells (kindly provided by 92

Professor Hans-Dieter Klenk, University of Marburg, Germany) were passaged in 93

DMEM/HAM’s F12 Coon’s media (SAFC Biosciences, USA), supplemented with 10% 94

(v/v) FCS, 2 mM L-glutamine, 1x non-essential amino acids, 0.075 % (v/v) sodium 95

bicarbonate, 10 mM HEPES, 50 U/ml penicillin, 50 ug/ml streptomycin (SAFC 96

Biosciences, USA) and 20 ug/ml Amphotericin B (FungizoneR, Bristol-Myers Squibb 97

Company, USA). Passage medium for MDCK-SIAT1 cells was further supplemented 98

with 1 mg/ml G418 sulphate (GeneticinR, GIBCO, USA). Viral infection studies were 99

performed in the absence of FCS and G418. Cells were maintained at 37oC prior to 100

infection and at 35oC following infection. 101

102

Clinical specimens and viruses 103

Influenza A(H1N1), A(H3N2) and B viruses were received from WHO National 104

Influenza Centres, WHO Influenza Collaborating Centres and other regional laboratories 105

and hospitals in Australia, New Zealand and the Asia/Pacific region. A full list of 106

recovered viruses is provided in the Supplementary Data. Viruses were received as 107

isolates passaged in cell culture, or as original clinical samples (in which influenza A or 108

B had been detected by immunofluorescence or by RT-PCR). Original clinical samples 109

were collected as throat swabs, nasopharyngeal swabs and throat washes. All clinical 110

ACCEPTED

on April 9, 2020 by guest

http://jcm.asm

.org/D

ownloaded from

7

specimens and virus isolates were stored at -80oC prior to use and clinical samples had 111

been thawed at least once previously. 112

113

Virus infection and analyses 114

MDCK and MDCK-SIAT1 cells (5 x 105 per well) were seeded into 12-well plates 115

(Cellstar, Greiner Bio-one) and allowed to grow to confluence overnight at 37 oC, 5 116

%CO2. Monolayers were washed twice with Ca2+

/Mg2+

-free PBS before incubation with 117

50 µl virus sample (clinical isolate inoculated neat, cell- or egg-passaged virus inoculated 118

at 1/100 dilution) at 35oC, 5% CO2 for 30 min. After inoculation, 3 ml medium (without 119

FCS and G418) supplemented with 4 ug/ml trypsin was added to each well and cells were 120

incubated at 35oC, 5% CO2. Wells were monitored daily for virus growth by cytopathic 121

effects (CPE) and after 4 days, supernatant was collected and the presence of virus was 122

assessed by haemagglutination using 1% turkey or guinea pig red blood cells. For serial 123

passaging, cell supernatants were passaged a further 5 times in the same cell line as used 124

for isolation before RNA extraction and sequencing. Viral titres in the supernatant were 125

quantified as 50% tissue culture infectious dose (TCID50 assay) (41), with ten-fold 126

dilutions of supernatant inoculated onto confluent monolayers in 96-well plates and 127

allowed to grow for 4 days before staining with 0.036% (w/v) neutral red. Virus was 128

titred using MDCK cells for viruses that had been grown in MDCK cells and MDCK-129

SIAT1 cells for viruses that had been grown in MDCK-SIAT1 cells. All TCID50 assays 130

were performed in triplicate. 131

132

HA gene sequencing 133

ACCEPTED

on April 9, 2020 by guest

http://jcm.asm

.org/D

ownloaded from

8

For RT–PCR, viral RNA was extracted from 140 µl of infected cell culture supernatant or 134

clinical sample using the QIAamp Viral RNA Mini kit (Qiagen). A 5 µl aliquot of RNA 135

was used to amplify the HA-1 domain of influenza HA using gene-specific primers and 136

SuperScriptTM

III One-Step RT-PCR with Platinum Taq (Invitrogen). Fragments 137

amplified (from nucleotide position) were: H3 HA 34–1101, H1 HA 1–1317, B HA 20–138

1119 using primers: H3; forward 5’-GACTATCATTGCTTTGAGCTAC and reverse 5’-139

CTATCATTCCCTCCCAACCAT: H1; forward 5’-AGCAAAAGCAGGGGAWAA and 140

reverse 5’-ACAGCTGTGAATTGAGTGTT or reverse 5’- CCTCATAGTCGGCGAAAT 141

A: B; forward 5’- CTAATATCCACAAAATGAAGGC and reverse 5’- ACCAGCAATA 142

GCTCCGAAGAAA. The RT-PCR consisted of 1 cycle 50°C for 30 min, 94°C for 143

2 min, 35 cycles of 94°C for 30 s, 55°C for 30 s, 68°C for 1 min, followed by a final 144

elongation step of 68°C for 7 min. Amplicons were visualised on a 2% (w/v) agarose gel. 145

PCR products were purified for use in sequencing reactions using Exonuclease I:Shrimp 146

Alkaline Phosphatase (ExoSAP-ITR,USB Corporation, USA). DNA sequencing was 147

carried out using the above primers in a 96-well plate format using ABI Prism Dye 148

Terminator III cycle sequencing kit (Applied Biosystems, USA) followed by the removal 149

of excess dye terminators with BigDyeR XTerminator

TM Purification kit (Applied 150

Biosystems, USA). The sequence was determined using an automated capillary DNA 151

sequencer (ABI Prism 3700 at the Institute of Medical and Veterinary Science, Adelaide, 152

Australia). Sequences were assembled using Lasergene Seqman package IV 153

(DNAStar V7.2.1(1)). The sequences of the HA-1 domain of the HA gene of all original 154

clinical specimens analysed by multiple passaging in the cell lines is available on 155

GenBank/EMBL/DDBJ, with accession numbers provided in Supplementary Data. 156

ACCEPTED

on April 9, 2020 by guest

http://jcm.asm

.org/D

ownloaded from

9

157

Statistics 158

The data were analysed using the MINITAB statistical analysis program at a confidence 159

interval (CI) of 95%. Differences were considered statistically significant when p<0.05. 160

Median virus titres were compared using the nonparametric two-tailed Mann-Whitney U-161

test; the number of virus isolates recovered in each cell line was analysed using the chi-162

square test. 163

164

ACCEPTED

on April 9, 2020 by guest

http://jcm.asm

.org/D

ownloaded from

10

RESULTS 165

166

Rate of isolation and titre of influenza virus from human clinical specimens is 167

increased after growth in MDCK-SIAT1 cells compared to MDCK cells 168

To determine whether MDCK-SIAT1 cells had a higher isolation rate of recent influenza 169

viruses, MDCK-SIAT1 and MDCK cells were infected with a total of 125 stored clinical 170

specimens (previously confirmed to be influenza-positive) in duplicate, collected during 171

the period from 2003 to 2007 (39 A(H1N1), 53 A(H3N2), 33 B). Following 4 days in 172

culture, supernatants were analysed for influenza virus by TCID50 (performed in the same 173

cell line used for isolation). Viruses were considered to have successfully grown if log10 174

TCID50/ml >2. Of the stored clinical samples 74% of A(H1N1), 91% of A(H3N2) and 175

39% of B viruses were successfully recovered in at least one of the cell lines (Figure 1A). 176

No viruses were isolated exclusively in MDCK cells. Two thirds of the viruses grew in 177

both cell lines and the remaining viruses were recovered only in MDCK-SIAT1 cells 178

(Figure 1A). There was no correlation between year of isolation and cell line recovery, 179

nor any correlation between virus origin and recovery patterns for A(H1N1) and B 180

viruses (data not shown). For A(H3N2) viruses, yearly breakdown revealed that the 181

viruses appeared to be changing in their isolation pattern particularly between 2006 and 182

2007, with a significant reduction in the ability of MDCK cells to isolate 2007 viruses 183

compared to 2006 viruses (p<0.005), unlike MDCK-SIAT1 cells which were able to 184

grow A(H3N2) viruses from both years (Figure 1B). Median viral titres of clinical 185

specimens were significantly higher in MDCK-SIAT1-grown influenza A cultures 186

compared to MDCK-grown cultures for A(H1N1) viruses (p<0.001) and A(H3N2) 187

ACCEPTED

on April 9, 2020 by guest

http://jcm.asm

.org/D

ownloaded from

11

viruses (p<0.0005). No significant difference in the titre of B viruses was detected, 188

however this may be due to the small number of B viruses recovered (8 in MDCK cells 189

and 13 in MDCK-SIAT1 cells) (Figure 1C). 190

191

MDCK cell-passaged and egg-passaged influenza viruses propagate in MDCK-192

SIAT1 cells 193

To determine if MDCK-SIAT1 cells could support growth of viruses previously cultured 194

in MDCK cells or embryonated eggs, MDCK-SIAT1 cells (with MDCK cells as a 195

control) were infected in duplicate with 10 MDCK cell-passaged viruses (3 A(H1N1), 4 196

A(H3N2), 3 B/Malaysia/2506/2004-like) and 6 egg-passaged viruses (2 A(H1N1), 2 197

A(H3N2), 2 B/Shanghai/361/2002-like) isolated from 2003 to 2007. Supernatants were 198

collected after 4 days and analysed for virus by TCID50 assay. 9/10 cell-passaged viruses 199

were recovered in MDCK-SIAT1 cells and 10/10 in MDCK cells. One previously cell-200

passaged virus, B/Malaysia/174/2006, did not grow in MDCK-SIAT1 culture and grew in 201

only one of two infected MDCK wells, thus was eliminated from any further analyses. 202

All egg-isolated viruses grew in both cell lines. Median viral titres of cell- and egg-203

passaged viruses were significantly higher in MDCK-SIAT1-grown cultures compared to 204

MDCK-grown cultures for A(H3N2) viruses (p<0.005), but no significant difference in 205

growth of A(H1N1) or B viruses was detected (Figure 1D). 206

207

RBC binding changes after passaging in cell lines 208

RBC agglutination is the method most commonly used to detect influenza virus particles 209

in cell culture supernatants. To investigate changes to HA binding following cell culture 210

ACCEPTED

on April 9, 2020 by guest

http://jcm.asm

.org/D

ownloaded from

12

of clinical specimens, randomly selected MDCK-SIAT1- and MDCK-passaged A(H1N1) 211

(n=9) and A(H3N2) (n=25) viruses from 2005 to 2007, that grew in both cells lines, were 212

analysed for their ability to agglutinate turkey and guinea pig RBC. Turkey (and chicken) 213

RBC express high levels of α-2,3-linked sialic acid receptors and lower levels of α-2,6-214

linked sialic acid receptors than human and guinea pig RBC (19, 26). Following passage 215

of A(H1N1) viruses in MDCK cells, the majority of viruses were able to agglutinate both 216

turkey and guinea pig RBC (Figure 2). One virus, A/Singapore/32/2006, was unable to 217

agglutinate either RBC, possibly as the virus titre was very low (data not shown). 218

Following passage of A(H1N1) viruses in MDCK-SIAT1 cells, the majority of samples 219

agglutinated both turkey and guinea pig RBC (Figure 2). One virus, A/Singapore/68/ 220

2005, was able to agglutinate only guinea pig RBC. 221

222

Agglutination patterns were different for A(H3N2) viruses after passage in the two cell 223

lines. The majority of A(H3N2) virus samples passaged in MDCK cells were able to 224

agglutinate both turkey and guinea pig RBC, whilst almost one quarter of viruses could 225

agglutinate only guinea pig RBC (Figure 2). Following passage in MDCK-SIAT1 cells, 226

all A(H3N2) viruses agglutinated guinea pig RBC. Interestingly, agglutination of turkey 227

RBC by A(H3N2) viruses passaged in MDCK-SIAT1 cells was variable. Almost half of 228

the viruses also agglutinated turkey RBC and the remaining viruses had only partial 229

agglutination with turkey red blood cells (Figure 2). This incomplete agglutination was 230

characterised by a difficulty in determining the titre of the virus. Re-passage of 231

‘incomplete’ samples isolated in MDCK-SIAT1 cells into MDCK cells restored the 232

viruses’ ability to agglutinate turkey RBC, whilst re-passage of samples isolated in 233

ACCEPTED

on April 9, 2020 by guest

http://jcm.asm

.org/D

ownloaded from

13

MDCK cells into MDCK-SIAT1 cells generally led to loss of the ability to agglutinate 234

turkey RBC (data not shown). These data indicates that the incomplete agglutination 235

patterns observed were a result of the cell passaging and not a property of the individual 236

viruses. 237

238

HA gene remains unchanged following viral passage in MDCK-SIAT1 cells 239

To determine if the passaging of influenza virus in MDCK-SIAT1 cells (or conventional 240

MDCK cells) resulted in virus-cell adaptations, 6 A(H1N1), 5 A(H3N2) and 6 B 241

influenza viruses that grew in both cell lines were passaged five times in each cell line. 242

After each passage, CPE was observed and RBC agglutination measured to confirm virus 243

growth. A(H3N2) samples cultured in MDCK cells agglutinated both turkey and guinea 244

pig RBC after five passages, whilst A(H3N2) samples cultured in MDCK-SIAT1 cells 245

were only able to agglutinate guinea pig RBC after one passage. Comparison of the HA-1 246

domain of the HA gene sequences of isolated viruses at passage 1 and passage 5 to those 247

of viruses from original clinical specimens showed that the HA gene of A(H1N1) viruses 248

did not mutate following a single passage in either cell line. However, two base pair (bp) 249

changes were seen in A(H1N1) viruses following 5 passages in MDCK cells (Table 1). 250

Substitution of G with A at 606 bp, leading to an amino acid change, D190N (H3 251

numbering system), was detected in 4/6 A(H1N1) MDCK-passaged viruses. A mixed 252

population was detected in another sample, with substitution of C with G at 426 bp, 253

producing a N129K mutation. No changes were seen in A(H1N1) viruses cultured 254

multiple times in MDCK-SIAT1 cells compared to the sequence of the original clinical 255

specimen. A synonymous change was detected in one A(H3N2) clinical specimen after 256

ACCEPTED

on April 9, 2020 by guest

http://jcm.asm

.org/D

ownloaded from

14

passage in MDCK-SIAT1 cells (T with A) and a single non-synonymous change was 257

detected in one A(H3N2) clinical specimen after passage in MDCK cells (G316A) 258

leading to an alanine to tyrosine change at aa106. These mutations appeared stable in the 259

cell lines and were detected after both single and multiple passages (Table 1). 260

261

Interestingly, for influenza B viruses, 8 base pair (bp) changes resulting in 3 amino acid 262

(aa) changes were observed after initial passage in both MDCK cells and MDCK-SIAT1 263

cells (N197T, S216F and G230D). Two of the non-synonymous mutations were present 264

as mixed populations in some of the cultures (S216F, G230D). Further mutations were 265

detected after five passages in the two cell lines, with one non-synonymous change in 2/6 266

MDCK-passaged viruses (T199I) and a synonymous change in both MDCK-and MDCK-267

SIAT1-passaged viruses (a906g). The HA sequence changes were seen for the same 268

viruses in both cell lines suggesting these represent a general adaptation to cell culture, 269

rather than a specific adaptation to culture in MDCK-SIAT1 cells. 270 ACCEPTED

on April 9, 2020 by guest

http://jcm.asm

.org/D

ownloaded from

15

DISCUSSION 271

In this study, the usefulness of MDCK-SIAT1 cells for isolation of influenza virus from 272

stored human clinical samples compared to conventional MDCK cells was investigated. 273

While previous small studies have demonstrated some improvement in isolation rates, 274

few laboratories routinely use MDCK-SIAT1 or the similar cell line, ST6Gal I (16, 25). 275

The data reported here confirm that MDCK-SIAT1 cells could be used to isolate 276

influenza A(H1N1 and H3N2) and B viruses more efficiently from stored clinical 277

specimens than the parental MDCK cells, in a large number of samples collected in 2006 278

to 2007. The viruses isolated had fewer aa mutations in the HA-1 domain of the HA gene 279

following multiple passages in MDCK-SIAT1 cells than in MDCK cells. In addition, 280

MDCK-SIAT1 cells were able to support higher levels of virus growth for A(H1N1) and 281

A(H3N2) viruses compared to MDCK cells. 282

283

Infection of cells with influenza virus is limited by the number of virions in the clinical 284

specimen and the avidity of the interaction between virions and receptors, which 285

comprises both the individual affinity of the HA for sialic acid-linked receptor and the 286

number of receptors available on the cell (or virion) surface. The increased level of α-2,6-287

linked sialic acid receptors on MDCK-SIAT1 cells should increase the avidity of the 288

interaction, hence is likely to contribute to the higher recovery of human influenza 289

viruses from stored clinical samples by MDCK-SIAT1 cells compared to MDCK cells. 290

No pattern was present between influenza A(H1N1) virus recovery and year or location 291

of clinical specimen. However a yearly breakdown revealed that A(H3N2) viruses 292

appeared to be drifting in their receptor specificity, with more viruses recovered in both 293

ACCEPTED

on April 9, 2020 by guest

http://jcm.asm

.org/D

ownloaded from

16

cell lines in 2006 compared to 2007 where the majority of A(H3N2) viruses were 294

recovered only in MDCK-SIAT1 cells. There was no significant difference in the 295

log10TCID50 titres of A(H3N2) samples from 2006 to 2007 recovered in MDCK-SIAT1 296

cells, suggesting that the amount of virus in the samples was not a limiting factor (data 297

not shown). The density of HA on the virion surface may have altered between 2006 and 298

2007 A(H3N2) viruses, a feature seen with some H5N1 viruses (17). Most likely, 299

however, the affinity of the HA for α-2,6-linked sialic acid receptors has altered over 300

time. Reduction in the affinity of A(H3N2) viruses has been reported previously, with a 301

loss of binding to chicken RBC by A(H3N2) viruses seen over the past 10-15 years (15, 302

22, 26, 28). This may be attributed to a reduced affinity for sialic acid-linked receptors, 303

particularly α-2,6-linked receptors, which are at lower levels on chicken (and turkey) 304

RBC compared to guinea pig RBC (26). This antigenic drift appears to be more dramatic 305

in the viruses assessed in this study, particularly between 2006 and 2007. Changes in HA 306

sequence between A(H3N2) viruses from 2006 and 2007 viruses have been observed, 307

particularly K140I, R142G and N144D, which are in antigenic site 3 and lie close to the 308

receptor binding region. Although a direct link between these specific mutations and 309

receptor affinity is yet to be confirmed, these aa are found in a high proportion of 310

A(H3N2) 2007 viruses but rarely in 2006 viruses suggesting they may contribute to 311

observed changes in HA binding characteristics. 312

313

RBC agglutination of viruses isolated from cell- or egg-passage is typically used to assess 314

culture-derived modifications and specificity of viral HA for influenza receptors (18, 15, 315

22, 26, 28). In addition, HA inhibition assays with RBC are routinely used to monitor 316

ACCEPTED

on April 9, 2020 by guest

http://jcm.asm

.org/D

ownloaded from

17

antigenic drift of influenza viruses as part of the WHO Global Influenza Programme (5). 317

Therefore any change in the ability of viruses to bind to RBC from different species 318

following passage in MDCK and MDCK-SIAT1 cells is particularly important. 319

Following passage in MDCK-SIAT1 cells, A(H3N2) viruses showed altered 320

agglutination patterns, with the majority of A(H3N2) isolates unable to agglutinate turkey 321

RBC completely. Changes have often been observed in RBC agglutination patterns 322

following passage of viruses in embryonated chicken eggs compared to MDCK cells 323

(18), but this is generally attributed to changes in HA specificity due to the increased 324

proportion of α-2,3-linked receptors in eggs compared to MDCK cells and produces 325

viruses equally capable of binding both chicken and turkey RBC (18). However there 326

were few sequence changes in HA following passage in MDCK-SIAT1 cells compared to 327

the original clinical sample and little variation in HA sequence between MDCK and 328

MDCK-SIAT1-passaged A(H3N2) viruses, despite the altered agglutination patterns. 329

This further suggests agglutination differences are a feature of passage in MDCK-SIAT1 330

cells. Differences in agglutination patterns have also been reported following passage of 331

A(H3N2) viruses in Vero cells compared to MDCK cells (36) where viruses grown in 332

Vero cells lost their ability to agglutinate chicken erythrocytes . While viruses isolated 333

from both cell lines had identical HA-1 (and other gene) sequences, the HA from Vero 334

cell derived viruses had a different glycosylation pattern with oligosaccharides of the 335

high mannose type unlike MDCK derived viruses. When some of these mannose 336

residues were removed enzymatically, the Vero-derived viruses had their ability to 337

agglutinate chicken erythrocytes restored. No such differences were observed with 338

A(H1N1) viruses grown in Vero cells (36). As MDCK-SIAT1 cells were engineered by 339

ACCEPTED

on April 9, 2020 by guest

http://jcm.asm

.org/D

ownloaded from

18

transfection with the human CMP-N-acetylneuraminate β-galactoside α-2,6-340

sialyltransferase gene, glycosylation patterns on the HA of budding viruses may also be 341

altered. Thus to ensure accurate detection of A(H3N2) viruses following passage in 342

MDCK-SIAT1 cells, we would advise the use of mammalian RBC for haemagglutination 343

assays. 344

345

As shown here and previously reported, unlike embryonated chicken eggs, influenza 346

virus propagation in MDCK cells results in little genetic variation in the HA-1 gene when 347

compared to the original infecting sample (6, 13, 20, 26, 30, 32, 33, 34, 37, 39). However 348

two interesting aa mutations were detected as a stable change in more than one virus. The 349

D190N mutation has been previously been reported in egg-passaged A(H1N1) viruses (9, 350

31, 33, 24) and shown to dominate in egg-passaged A(H1N1) viruses even if it was 351

originally present as a minor species (33). As the side chain at position 190 of HA 352

interacts with the 9-hydroxyl group of sialic acid (45), the D190N mutation increases 353

binding to chicken embryo chorio-allantoic membranes and decreases the affinity of virus 354

for α-2,6-linked sialic acid receptors (9). N197 (with T199) is a N-linked glycosylation 355

sequon in the HA-1 region of recent influenza B viruses (N-X-T/S – aa196-198 for 356

B/Yamagata-lineage, 197-199 for B/Victoria lineage). Although egg-passaged viruses 357

predominantly select for variants that no longer have this glycosylation site, MDCK cells 358

can support growth of virus with or without the glycosylation at position 197 (6, 37). 359

Studies using cell- and egg-passaged viruses and viruses modified by reverse genetics 360

which contain the mutation, demonstrated that the binding affinity to horse RBC was 361

inhibited by glycosylation, however the loss of the glycosylation site did not affect the 362

ACCEPTED

on April 9, 2020 by guest

http://jcm.asm

.org/D

ownloaded from

19

affinity for α−2,3- or α-2,6-linked sialic acid receptors. This suggests a role for steric 363

hindrance at this aa site in the influenza B HA which may also affect the antigenicity of 364

the virus (6, 37). Although we have only sequenced one sample from each passage in our 365

studies, the use of high fidelity Taq and the repeated incidence of the same mutation after 366

multiple passages in MDCK cells confirm the importance of the D190N and 367

N197T/T199I mutations. Analysis of HA sequences from viruses routinely passaged at 368

the WHO Collaborating Centre in Melbourne in the past three years revealed that D190N 369

occurred in 14% (9/64) of randomly selected MDCK-passaged viruses, whilst the 370

N197T/T199I mutations have also been detected in this, and other, laboratories (23). 371

372

This study showed that MDCK-SIAT1 cells, which expressed enhanced levels of α-2,6-373

linked sialic acid receptors, supported isolation of more recent human influenza viruses 374

from a large panel of stored clinical samples and grew viruses to a higher titre than 375

conventional MDCK cells. Most importantly, virus from stored clinical specimens that 376

could not be recovered after inoculation in MDCK cells, was recovered after inoculation 377

in MDCK-SIAT1 cells. Thus, we propose that MDCK-SIAT1 cells or a similar line, such 378

as ST6Gal-1 cells, be used routinely, along with or even in place of conventional MDCK 379

cells to isolate human influenza viruses to ensure an accurate representation of currently 380

circulating influenza strains. This maybe increasingly important if difficulty in isolating 381

A(H3N2) viruses in MDCK cells, as seen in recent years, continues. Further studies will 382

however, be required to determine if MDCK-SIAT1 and other equivalent cell lines are as 383

efficient as MDCK cells in isolating and propagating avian influenza viruses such as 384

A(H5N1) viruses from humans. While these cell lines have been shown to express 385

ACCEPTED

on April 9, 2020 by guest

http://jcm.asm

.org/D

ownloaded from

20

slightly lower or similar levels of α-2,3-linked receptors (the receptor for avian influenza 386

viruses) (16, 25), no comprehensive evaluation has been performed to date. 387

388

ACCEPTED

on April 9, 2020 by guest

http://jcm.asm

.org/D

ownloaded from

21

ACKNOWLEDGEMENTS 389

The authors thank Professor Hans-Dieter Klenk for providing MDCK-SIAT1 cells and 390

the National Influenza Centres and other submitting laboratories for providing the human 391

clinical specimens used for analysis in this paper. The authors also thank their colleagues 392

at the WHO Influenza Collaborating Centre for expert technical assistance and advice. 393

The Melbourne WHO Collaborating Centre for Reference and Research on Influenza is 394

supported by the Australian Government Department of Health and Ageing. 395

ACCEPTED

on April 9, 2020 by guest

http://jcm.asm

.org/D

ownloaded from

22

REFERENCES 396

397

1. Baum, L.G., and J.C. Paulson. 1990. Sialyloligosaccharides of the respiratory 398

epithelium in the selection of human influenza virus receptor specificity. Acta 399

Histochem Suppl. 40:35-8. 400

2. Belsey, M.J., B. de Lima, A.K. Apvlou, and J.W. Savopoulos. 2006. Influenza 401

vaccines. Nat Rev Drug Discov. 5(3):183-184. 402

3. Burnet, F. 1940. Influenza virus infections of the chick embryo by the amniotic 403

route. Aust. J. Exp Biol and Med Sci. 18:353-360. 404

4. Burnet, F. 1941. Growth of influenza virus in the allantoic cavity of the chick 405

embryo. Aust. J. Exp. Med. Sci. 19:291-295 406

5. Centre for Disease Control (CDC), Public Health Service, US Department of 407

Health and Human Services. 1982. Concepts and Procedures for Laboratory-408

based Influenza Surveillance. 409

6. Chen, Z., A. Aspelund, and H. Jin. 2008. Stabilizing the glycosylation pattern of 410

influenza B hemagglutinin following adaptation to growth in eggs. Vaccine. 411

26:361-371. 412

7. Couceiro, J.N., J.C. Paulson, and L.G. Baum. 1993. Influenza virus strains 413

selectively recognize sialyloligosaccharides on human respiratory epithelium; the 414

role of the host cell in selection of hemagglutinin receptor specificity. Virus Res. 415

29(2):155-65. 416

8. Cox, M.M. 2008. Progress on baculovirus-derived influenza vaccines. Curr. 417

Opin. Mol. The. 10(1):56-61. 418

ACCEPTED

on April 9, 2020 by guest

http://jcm.asm

.org/D

ownloaded from

23

9. Gambaryan, A.S., J.S. Robertson, and M.N. Matrosovich. 1999. Effects of 419

egg-adaptation on the receptor-binding properties of human influenza A and B 420

viruses. Virology. 258:232-239. 421

10. Gaush, C.R., and T.F. Smith.1968. Replication and plaque assay of influenza 422

virus in an established line of canine kidney cells. Appl. Microbio. 16:588-594 423

11. Govorkova, E.A., N. V. Kaverin, L. V. Gubareva, B. Meignier, and R. G. 424

Webster. 1995. Replication of influenza A viruses in a green monkey kidney 425

continuous cell line (Vero). J. Infect. Dis. 172:250-253 426

12. Govorkova, E.A., G. Murti, B.Meignier, C. de Taisne, and R.G. Webster. 427

1996. African green monkey kidney (Vero) cells provide an alternative host cell 428

system for influenza A and B viruses. J Virol. 70(8):5519-5524 429

13. Govorkova E.A., S. Kodihalli, I.V. Alymova , B. Fanget, and R.G. Webster. 430

1999b. Growth and immunogenicity of influenza viruses cultivated in Vero or 431

MDCK cells and in embryonated chicken eggs. Dev Biol Stand 98:39-51 432

14. Govorkova E.A., M.N. Matrosovich, A.B. Tuzikov, N.V. Bovin, C. Gerdil, B. 433

Fanget, and R.G. Webster. 1999a. Selection of receptor-binding variants of 434

human influenza A and B viruses in baby hamster kidney cells. Virology 435

262(1):31-8. 436

15. Grassauer, A., A.Y. Egorov, B. Ferko, J. Romanova, H. Katinger, and T. 437

Muster. 1998. A host-restriction-based selection system for influenza 438

haemagglutinin transfectant viruses. J. Gen. Virol. 79:1405-1409. 439

16. Hatakeyama, S., Y. Sakai-Tagawa, M. Kiso, H. Goto, C. Kawakami, K. 440

Mitamura, N. Sugaya, Y. Suzuki, and Y. Kawaoka. 2005. Enhanced expression 441

ACCEPTED

on April 9, 2020 by guest

http://jcm.asm

.org/D

ownloaded from

24

of an α-2,6-linked sialic acid on MDCK cells improves isolation of human 442

influenza viruses and evaluation of their sensitivity to a neuraminidase inhibitor. 443

J. Clin. Microbiol. 43(8):4139-4146. 444

17. Horimoto, T., S. Murakami, Y. Muramoto, S. Yamada, K. Fujii, M. Kiso, K. 445

Iwatsuki-Horimoto, Y. Kino and Y. Kawaoka. 2007. Enhanced growth of seed 446

viruses for H5N1 influenza vaccines. Virology. 366(1):23-27/ 447

18. Ito T, Y. Suzuki, A. Takada, A. Kawamoto, K. Otsuki, H. Masuda, M. 448

Yamada, T. Suzuki, H. Kida, and Y. Kawaoka. 1997a. Differences in sialic 449

acid-galactose linkages in the chicken egg amnion and allantois influence human 450

influenza virus receptor specificity and variant selection. J Virol. 71(4):3357-62. 451

19. Ito, T., Y. Sazuki, L. Mitnaul, A. Vines, H. Kida, and Y. Kawaoka. 1997b. 452

Receptor specificity of influenza A viruses correlates with the agglutination of 453

erythrocytes from different animals. Virology 227:493-499. 454

20. Katz, J.M., M. Wang, and R.G. Webster. 1990. Direct sequencing of the HA 455

gene of influenza (H3N2) virus in original clinical samples reveals sequence 456

identity with mammalian cell-grown virus. J Virol. 64(4):1808-1811. 457

21. Kistner, O., M.K. Howard, M.Spruth, W. Wodal, P. Bruhl, M. Gerencer, 458

B.A. Crowe, H. Savidis-Dacho, I. Livey, M. Reiter, I. Mayerhofer, C. Tauer, 459

L. Grillberger, W. Mundt, F.G. Falkner and P.N. Barrett. 2007. Cell culture 460

(Vero) derived whole virus (H5N1) vaccine based on wild-type virus strain 461

induces cross-protective immune responses. Vaccine 25(32):6028-6036. 462

22. Lindstrom, S., S. Sugita, A., Endo, M., Ishida, P., Huang, S.H. Xi, and K. 463

Nerome. 1996. Evolutionary characterization of recent human H3N2 influenza A 464

ACCEPTED

on April 9, 2020 by guest

http://jcm.asm

.org/D

ownloaded from

25

isolates from Japan and China: novel changes in the receptor binding domain. 465

Arch. Virol. 141(7):1349-1355. 466

23. Macken, C., H. Lu, J. Goodman and L. Boykin. 2001 "The value of a database 467

in surveillance and vaccine selection." in Options for the Control of Influenza IV. 468

A.D.M.E. Osterhaus, N. Cox & A.W. Hampson (Eds.) Amsterdam: Elsevier 469

Science, 103-106. 470

24. Matrosovich, M., A. Tuzikov, N. Bovin, A. Gambaryan, A. Klimov, M.R. 471

Castrucci, I. Donatelli, and Y. Kawaoka. 2000. Early alterations of the receptor-472

binding properties of H1, H2 and H3 avian influenza virus hemagglutinins after 473

their introduction into mammals. J. Virol. 74(18):8502-8512. 474

25. Matrosovich, M., T. Matrosovich, J. Carr, N.A. Roberts, and H.-D. Klenk. 475

2003. Overexpression of the a-2,6-sialyltransferase in MDCK cells increases 476

influenza virus sensitivity to neuraminidase inhibitors. J. Virol 77(15):8418-8425 477

26. Mederios, R., N. Escriou, N. Naffakh, J-C., Manuguerra, and S. van der 478

Werf. 2001. Hemagglutinin residues of recent human A(H3N2) influenza viruses 479

that contribute to the inability to agglutinate chicken erythrocytes. Virology. 480

289:74-85. 481

27. Meguro H., J.D. Bryant, A.E. Torrence, and P.F. Wright. 1979. Canine kidney 482

cell line for isolation of respiratory viruses. J. Clin Microbiol 9(2):175-179 483

28. Nobusawa, E., H. Ishihara, T. Morishita, K. Sato, and K. Nakajima. 2000. 484

Change in receptor-binding specificity of recent human influenza A viruses 485

(H3N2): a single amino acid change in hemagglutinin altered its recognition of 486

sialyloligosaccharides. Virology. 278(2):587-96. 487

ACCEPTED

on April 9, 2020 by guest

http://jcm.asm

.org/D

ownloaded from

26

29. Oxford, J.S., C. Manuguerra, O. Kistner, A. Linde, M. Kunze, W. Lange, B. 488

Schweiger, G. Spala, H. Rebelo de Andrade, P.R. Pérez Breña, J. Beytout, L. 489

Brydak, D. Caraffa de Stefano, O. Hungnes, J. Kyncl, E. Montomoli, A. Gil 490

de Miguel, R. Vranckx and A. Osterhaus. 2005. A new European perspective of 491

influenza pandemic planning with a particular focus on the role of mammalian 492

cell culture vaccines. Vaccine. 23(46-47):5440-5449. 493

30. Robertson, J.S., C.W. Naeve, R.G. Webster, J.S. Bootman, R. Newman, and 494

G.C. Schild. 1985. Alterations in the hemagglutinin associated with adaptation of 495

influenza B virus to growth in eggs. Virology 143(1):166-174. 496

31. Robertson, J.S., J.S. Bootman, R. Newman, J.S. Oxford, R.S. Daniels, R.G. 497

Webster, and G.C. Schild. 1987. Structural changes in the hemagglutinin which 498

accompany egg adaptation of an influenza A (H1N1) virus. Virology 160:31-37. 499

32. Robertson, J.S., J.S. Bootman, C. Nicolson, D. Major, E.W. Robertson, and 500

J.M. Wood. 1990. The Hemagglutinin of influenza B viruses present in clinical 501

material is a single species identical to that of mammalian cell-grown virus. 502

Virology. 179(1):35-40. 503

33. Roberston, J.S., C. Nicolson, J.S. Bootman, D. Major, E.W. Robertson, and 504

J.M. Wood. 1991. Sequence analysis of the haemagglutinin (HA) of influenza A 505

(H1N1) viruses present in clinical material and comparison with the HA of 506

laboratory-derived virus. J. General Virol. 72: 2671-2677. 507

34. Rocha, E.P., X. Xu, H.E. Hall, J.R. Allen, H.L. Regnery, and N.J. Cox. 1993. 508

Comparison of 10 influenza A (H1N1 and H3N2) haemagglutinin sequences 509

ACCEPTED

on April 9, 2020 by guest

http://jcm.asm

.org/D

ownloaded from

27

obtained directly from clinical specimens to those of MDCK cell- and egg-grown 510

viruses. J. General Virol. 74:2513-2518. 511

35. Rogers, G.N., and J.C. Paulson. 1983. Receptor determinants of human and 512

animal influenza virus isolates: differences in receptor specificity of the H3 513

hemagglutinin based on species of origin. Virology 127(2):361-73. 514

36. Romanova, J., D. Katinger, B. Ferko, R. Voglauer, L. Mochalova, N. Brown, 515

W. Lim, H., Katinger, and A. Egorov. 2003. Distinct host range of influenza 516

H3N2 virus isolates in Vero and MDCK cells is determined by cell specific 517

glycosylation pattern. Virology 307:90-97 518

37. Saito, T., Y. Nakaya, T. Suzuki, R. Ito, T. Saito, H. Saito, S. Takao, K. 519

Sahara, T. Odagiri, T. Murata, T. Usui, Y. Suzuki, and M. Tashiro. 2004. 520

Antigenic alteration of influenza B virus associated with loss of a glycosylation 521

site due to host-cell adaptation. J. Medical Virol. 74:336-343. 522

38. Schepetiuk SK, and T. Kok. 1993. The use of MDCK, MEK and LLC-MK2 cell 523

lines with enzyme immunoassay for the isolation of influenza and parainfluenza 524

viruses from clinical specimens. J. Virol. Methods 42(2-3):241-250 525

39. Schild, G.C., J.S. Oxford, J.C. de Jong, and R.G. Webster. 1983. Evidence for 526

host-cell selection of influenza virus antigenic variants. Nature. 303(5919):706-527

709. 528

40. Seo, S.H., O Goloubeva, R. Webby, and R.G. Webster. 2001. Chacterization of 529

a porcine lung epithelial cell line suitable for influenza virus studies. J. Virol. 530

75(19):9517-9525. 531

ACCEPTED

on April 9, 2020 by guest

http://jcm.asm

.org/D

ownloaded from

28

41. Tannock, G.A., J.A. Paul, R. Herd, R.D. Barry, A.L. Reid, M.J. Hensley, R.S. 532

Gillett, S.M. Gillett, P. Lawrance, R.L. Henry and N.A. Saunders. 1989. 533

Improved colorimetric assay for detecting influenza B virus neutralizing antibody 534

responses to vaccination and infection. J Clin Microbiol. 27(3):524-8. 535

42. Tobita, K. 1975. Permanent canine kidney (MDCK) cells for isolation and plaque 536

assay of influenza B viruses. Med Microbiol Immunol 162(1):23-7 537

43. Tobita, K., A. Sugiura, C. Enomote and M. Furuyama. 1975. Plaque assay and 538

primary isolation of influenza A viruses in an established line of canine kidney 539

cells (MDCK) in the presence of trypsin. Med Microbiol Immunol. 162(2):9-14 540

44. Trusheim, H., B. Roth, R. Wilms, S. Jung, R. Muth, M. Eggers, M. Enders, 541

M. Elsen, C. Lenz-Bauer, K. Schwartz, E. Veit, and T. Schaar. 2007. The 542

MDCK 33016-PF cell-line is not only suitable for the production of cell-based 543

influenza vaccine but is also an ideal substrate for influenza virus isolation. 544

Options for the Control of Influenza VI, Toronto, Canada. 545

45. Weiss, W., J.H. Brown, S. Cusack, J.C. Paulson, J.J. Skehel, and D.C. Wiley. 546

1988. Structure of the influenza virus haemagglutinin complexed with its 547

receptor, sialic acid. Nature. 333:426-431. 548

549

550

551

552

553

554

ACCEPTED

on April 9, 2020 by guest

http://jcm.asm

.org/D

ownloaded from

29

FIGURE LEGENDS 555

556

Figure 1. Isolation and passaging of influenza samples in MDCK and MDCK-SIAT1 557

cells 558

Human clinical specimens and cell- and egg-passaged influenza virus samples were 559

cultured in duplicate in MDCK or MDCK-SIAT1 cells for 4 days. Supernatants were 560

collected and influenza virus titres measured by TCID50. Shown in A is the total number 561

of human clinical virus isolates recovered in each cell line, B is the recovery of A(H3N2) 562

viruses from stored clinical samples by year of collection, C shows the titres for 563

individual stored clinical samples (average of duplicates) isolated in either MDCK 564

(black) or MDCK-SIAT1 cells (white) and D shows titres for viruses previously isolated 565

in eggs (squares) or MDCK cells (diamonds); re-passaged in MDCK (black) or MDCK-566

SIAT1 (white) cells. The median is indicated by the horizontal bar. ‘N.R.’ indicates not 567

recovered samples. ‘SIAT1’ indicates MDCK-SIAT1 cells. *p<0.001, **p<0.005, 568

***p<0.0005 569

570

Figure 2. RBC agglutination after cell culture 571

Human clinical specimens cultured in MDCK or MDCK-SIAT1 cells were assayed by 572

haemagglutination assay with either guinea pig or turkey RBC. Shown is the number of 573

haemagglutination positive samples (titre >1) for each RBC type from MDCK- or 574

MDCK-SIAT1-cultured A(H1N1) (white) or A(H3N2) (black) viruses. ‘I/C’ indicates 575

incomplete agglutination and thus the titre was not determined. 576

577

ACCEPTED

on April 9, 2020 by guest

http://jcm.asm

.org/D

ownloaded from

30

Table 1. Sequence mutations in HA gene after passaging in MDCK or MDCK-578

SIAT1 cells 579

Human clinical specimens were passaged five times in either MDCK or MDCK-SIAT1 580

cells in duplicate. HA-1 domain of the HA gene was sequenced after passage 1 (P1) and 581

passage 5 (P5) and mutations (silent and those resulting in an aa change) recorded where 582

there were changes from the sequence obtained directly from the clinical sample; amino 583

acids (aa) are numbered in accordance with the H3 numbering system; base pairs (bp) are 584

numbered with reference to actual sequence numbers of each subtype. * indicates mixed 585

population 586

587

588

ACCEPTED

on April 9, 2020 by guest

http://jcm.asm

.org/D

ownloaded from

31

Table 1 589

590

HA-1

MUTATION CELL PASSAGE

MDCK MDCK-SIAT1 base

pair

amino

acid P1 P5 P1 P5

A(H1N1)

g606a D190N - 4/6 - -

c426g N129K - 1/6* - -

A(H3N2)

g316a A106T 1/5 1/5 - -

t75a - - - 1/5 1/5

B

a590c N197T 2/6 2/6 1/6 2/6

c596t T199I - 2/6 - -

c647t S216F 3/6* 3/6* 3/6* 1/6*

g689a G230D 2/6* 2/6 1/6 2/6

t45g - 1/6 1/6 1/6 1/6

a594g - 1/6 2/6 1/6 2/6

a816g - 1/6 2/6 1/6 2/6

g843a - 1/6 2/6 1/6 2/6

a906g - - 2/6 1/6 2/6

591

ACCEPTED

on April 9, 2020 by guest

http://jcm.asm

.org/D

ownloaded from

0

5

10

15

20

25

30

No.

of

viruses

0

2

4

6

8

10

12

14

Log

10T

CID

50/m

l

A A B A A B(H1N1) (H3N2) (H1N1) (H3N2)

A B

C D

2003

2004

2005

2006

2007

*

***

**

Figure 1

A(H1N1)

A(H3N2)

B

+

-

-

+

+

+

N.R.MDCK

SIAT1

+

-

-

+

+

+

N.R.

ACCEPTED

on April 9, 2020 by guest

http://jcm.asm

.org/D

ownloaded from

MDCK

MDCK-SIAT1

0

5

10

15

20

0

5

10

15

20

No.

of

viruses

TURKEYGUINEA PIG

--

I/C+

++

-+

+-

Figure 2

ACCEPTED

on April 9, 2020 by guest

http://jcm.asm

.org/D

ownloaded from