14: forensic serology & dna analysis · 2020. 4. 17. · 14 serology dna.notebook 8 forensic...
TRANSCRIPT
![Page 1: 14: Forensic Serology & DNA Analysis · 2020. 4. 17. · 14 Serology DNA.notebook 8 Forensic Tests for Blood: 1) Luminol >extremely sensitive presumptive test for bloodstains >capable](https://reader036.vdocuments.site/reader036/viewer/2022071403/60f78684b2e68b144e3313b3/html5/thumbnails/1.jpg)
14 Serology DNA.notebook
1
14: Forensic Serology & DNA Analysis
![Page 2: 14: Forensic Serology & DNA Analysis · 2020. 4. 17. · 14 Serology DNA.notebook 8 Forensic Tests for Blood: 1) Luminol >extremely sensitive presumptive test for bloodstains >capable](https://reader036.vdocuments.site/reader036/viewer/2022071403/60f78684b2e68b144e3313b3/html5/thumbnails/2.jpg)
14 Serology DNA.notebook
2
Serologythe study of bodily fluids
– blood– semen– vaginal secretion– pre‑ejaculatory fluid– intestinal fluid/vomit– breast milk– mucus– saliva– sebum (skin oil)– sweat– tears– earwax
![Page 3: 14: Forensic Serology & DNA Analysis · 2020. 4. 17. · 14 Serology DNA.notebook 8 Forensic Tests for Blood: 1) Luminol >extremely sensitive presumptive test for bloodstains >capable](https://reader036.vdocuments.site/reader036/viewer/2022071403/60f78684b2e68b144e3313b3/html5/thumbnails/3.jpg)
14 Serology DNA.notebook
3
Composition of Blood:• Plasma (55%)> the fluid portion of blood> mostly water
• Solids (45%)> erythrocytes (red blood cells)> leukocytes (white blood cells)> platelets
« do not have nucleus/DNA« cause blood to clot« too low = cause excessive bleeding« too high = cause blood clots/heart attack/stroke
![Page 4: 14: Forensic Serology & DNA Analysis · 2020. 4. 17. · 14 Serology DNA.notebook 8 Forensic Tests for Blood: 1) Luminol >extremely sensitive presumptive test for bloodstains >capable](https://reader036.vdocuments.site/reader036/viewer/2022071403/60f78684b2e68b144e3313b3/html5/thumbnails/4.jpg)
14 Serology DNA.notebook
4
Antigens > protein that stimulates the body to produce antibodies against it
> found on the surface of red blood cells
• Blood type A has A antigens on its red blood cell surface• Blood type B has B antigens on its red blood cell surface• Blood type AB has both A and B antigens• Blood type O has neither A nor B antigens
Antibodies
protein in the blood serum that destroys or inactivates a specific antigen
![Page 5: 14: Forensic Serology & DNA Analysis · 2020. 4. 17. · 14 Serology DNA.notebook 8 Forensic Tests for Blood: 1) Luminol >extremely sensitive presumptive test for bloodstains >capable](https://reader036.vdocuments.site/reader036/viewer/2022071403/60f78684b2e68b144e3313b3/html5/thumbnails/5.jpg)
14 Serology DNA.notebook
5
1901 ABO Blood Typing discovered by Karl Landsteiner
1937 Rh factor in blood also discovered by Landsteiner« Rh (+) = has the D antigen on the surface of red blood cells
« Rh (‑) = does not have the D antigen« currently there are 30 human blood group systems« The search for more blood facotrs slowed down in favor of Deoxyribonucleic acid (DNA).
![Page 6: 14: Forensic Serology & DNA Analysis · 2020. 4. 17. · 14 Serology DNA.notebook 8 Forensic Tests for Blood: 1) Luminol >extremely sensitive presumptive test for bloodstains >capable](https://reader036.vdocuments.site/reader036/viewer/2022071403/60f78684b2e68b144e3313b3/html5/thumbnails/6.jpg)
14 Serology DNA.notebook
6
Blood Type Antigens Antibodies
A A anti‑B
B B anti‑A
AB A and B None
O None anti‑A and anti‑B
![Page 7: 14: Forensic Serology & DNA Analysis · 2020. 4. 17. · 14 Serology DNA.notebook 8 Forensic Tests for Blood: 1) Luminol >extremely sensitive presumptive test for bloodstains >capable](https://reader036.vdocuments.site/reader036/viewer/2022071403/60f78684b2e68b144e3313b3/html5/thumbnails/7.jpg)
14 Serology DNA.notebook
7
Forensic Characterization of Blood & Bloodstains
Important Questions:
1) Is it blood?
2) Is it human blood?
3) Whose blood is it?
![Page 8: 14: Forensic Serology & DNA Analysis · 2020. 4. 17. · 14 Serology DNA.notebook 8 Forensic Tests for Blood: 1) Luminol >extremely sensitive presumptive test for bloodstains >capable](https://reader036.vdocuments.site/reader036/viewer/2022071403/60f78684b2e68b144e3313b3/html5/thumbnails/8.jpg)
14 Serology DNA.notebook
8
Forensic Tests for Blood:
1) Luminol> extremely sensitive presumptive test for bloodstains> capable of detecting blood dliuted up to 300,000 times> chemiluminescence (emission of light) occurs when reacted with the iron content in hemoglobin
> false positives (substances not of interest that can also produce the same results) include copper, bleach and horseradish
![Page 9: 14: Forensic Serology & DNA Analysis · 2020. 4. 17. · 14 Serology DNA.notebook 8 Forensic Tests for Blood: 1) Luminol >extremely sensitive presumptive test for bloodstains >capable](https://reader036.vdocuments.site/reader036/viewer/2022071403/60f78684b2e68b144e3313b3/html5/thumbnails/9.jpg)
14 Serology DNA.notebook
9
2) Phenolphthalein> aka Kastle‑Meyer color test> prelminary/presumptive blood test> reacts with hemoglobin to produce a deep pink color> false positives include broccoli, cauliflower, potatoes, horseradish, etc.
![Page 10: 14: Forensic Serology & DNA Analysis · 2020. 4. 17. · 14 Serology DNA.notebook 8 Forensic Tests for Blood: 1) Luminol >extremely sensitive presumptive test for bloodstains >capable](https://reader036.vdocuments.site/reader036/viewer/2022071403/60f78684b2e68b144e3313b3/html5/thumbnails/10.jpg)
14 Serology DNA.notebook
10
3) Hematrace> a confirmatory test for human blood> stain extract is applied to the bottom of the test strip> resembles pregnancy test
![Page 11: 14: Forensic Serology & DNA Analysis · 2020. 4. 17. · 14 Serology DNA.notebook 8 Forensic Tests for Blood: 1) Luminol >extremely sensitive presumptive test for bloodstains >capable](https://reader036.vdocuments.site/reader036/viewer/2022071403/60f78684b2e68b144e3313b3/html5/thumbnails/11.jpg)
14 Serology DNA.notebook
11
Forensic Test for Semen
1) Visual examination> look for white crusty substance in an obvious area
2) Alternate Light Source (ALS)> light source with control over wavelength in the Ultraviolet, infrared and visible range
> used to screen large areas for traces of physical evidence> causes most body fluids to glow (semen, saliva, vaginal secretion, etc.)
![Page 12: 14: Forensic Serology & DNA Analysis · 2020. 4. 17. · 14 Serology DNA.notebook 8 Forensic Tests for Blood: 1) Luminol >extremely sensitive presumptive test for bloodstains >capable](https://reader036.vdocuments.site/reader036/viewer/2022071403/60f78684b2e68b144e3313b3/html5/thumbnails/12.jpg)
14 Serology DNA.notebook
12
3) Acid Phosphatase (AP) Test> a presumptive color test for semen> acid phosphatase is an enzyme found in high concentration in semen
![Page 13: 14: Forensic Serology & DNA Analysis · 2020. 4. 17. · 14 Serology DNA.notebook 8 Forensic Tests for Blood: 1) Luminol >extremely sensitive presumptive test for bloodstains >capable](https://reader036.vdocuments.site/reader036/viewer/2022071403/60f78684b2e68b144e3313b3/html5/thumbnails/13.jpg)
14 Serology DNA.notebook
13
4) Prostate Specific Antigen (PSA) Test> confirmatory test for semen> p30 (a prostate specific protein) produces positive results> resembles home pregnancy test
![Page 14: 14: Forensic Serology & DNA Analysis · 2020. 4. 17. · 14 Serology DNA.notebook 8 Forensic Tests for Blood: 1) Luminol >extremely sensitive presumptive test for bloodstains >capable](https://reader036.vdocuments.site/reader036/viewer/2022071403/60f78684b2e68b144e3313b3/html5/thumbnails/14.jpg)
14 Serology DNA.notebook
14
5) Microscopic Sperm Search> confirmatory test for semen> performed under 400X magnification on a light microscope with a color stained slide
> search for the presence of spermatozoa (sperm)> normal male releases 250‑600 million sperms during an ejaculation
Possible reasons for negative sperm search:– sperm may bind tightly to clothing– sperms are extremely brittle when dry– sperms are easily washed off– oligospermia (abnormally low sperm count)– aspermia (no sperm in the seminal fluid)
![Page 15: 14: Forensic Serology & DNA Analysis · 2020. 4. 17. · 14 Serology DNA.notebook 8 Forensic Tests for Blood: 1) Luminol >extremely sensitive presumptive test for bloodstains >capable](https://reader036.vdocuments.site/reader036/viewer/2022071403/60f78684b2e68b144e3313b3/html5/thumbnails/15.jpg)
14 Serology DNA.notebook
15
Items often examined for blood & semen:> sexual assault evidence collection kit (rape kit)> clothing> bedding> carpeting> furniture> automotive upholstery> assault weapon
![Page 16: 14: Forensic Serology & DNA Analysis · 2020. 4. 17. · 14 Serology DNA.notebook 8 Forensic Tests for Blood: 1) Luminol >extremely sensitive presumptive test for bloodstains >capable](https://reader036.vdocuments.site/reader036/viewer/2022071403/60f78684b2e68b144e3313b3/html5/thumbnails/16.jpg)
14 Serology DNA.notebook
16
Heredity
gene– the basic unit of heredity– consists of a DNA segment on a chromosome
chromosome– a threadlike structure in the cell nucleus
– 46 chromosomes per human cell (except 23 in reproductive cells)
![Page 17: 14: Forensic Serology & DNA Analysis · 2020. 4. 17. · 14 Serology DNA.notebook 8 Forensic Tests for Blood: 1) Luminol >extremely sensitive presumptive test for bloodstains >capable](https://reader036.vdocuments.site/reader036/viewer/2022071403/60f78684b2e68b144e3313b3/html5/thumbnails/17.jpg)
14 Serology DNA.notebook
17
X chromosomethe female sex chromosome
Y chromosomethe male sex chromosome
The egg always contains the X chromosome.The sperm cell may contain either X or Y chromosome.
XX g femaleXY g male
![Page 18: 14: Forensic Serology & DNA Analysis · 2020. 4. 17. · 14 Serology DNA.notebook 8 Forensic Tests for Blood: 1) Luminol >extremely sensitive presumptive test for bloodstains >capable](https://reader036.vdocuments.site/reader036/viewer/2022071403/60f78684b2e68b144e3313b3/html5/thumbnails/18.jpg)
14 Serology DNA.notebook
18
• Locusthe physical location of a gene on a chromosome
• Allelesone member of a gene pair
• homozygoushaving two identical alleles in a gene pair
• heterozygoushaving two different alleles in a gene pair
• genotypethe particular combination of alleles in a gene
• phenotypethe physical manifestation of a genetic trait (shape,
color, blood type, etc.)
![Page 19: 14: Forensic Serology & DNA Analysis · 2020. 4. 17. · 14 Serology DNA.notebook 8 Forensic Tests for Blood: 1) Luminol >extremely sensitive presumptive test for bloodstains >capable](https://reader036.vdocuments.site/reader036/viewer/2022071403/60f78684b2e68b144e3313b3/html5/thumbnails/19.jpg)
14 Serology DNA.notebook
19
Punnet Square
used to determine the genotype/phenotype of offsprings
Mother'sgenotype
A
B
Father'sgenotype
O O
AO
BO BO
AO50% AO A
50% BO B
genotype phenotype
Question:
What are the percent probability of each blood type of a child reproduced by parents whose genotypes are AA and BO?
![Page 20: 14: Forensic Serology & DNA Analysis · 2020. 4. 17. · 14 Serology DNA.notebook 8 Forensic Tests for Blood: 1) Luminol >extremely sensitive presumptive test for bloodstains >capable](https://reader036.vdocuments.site/reader036/viewer/2022071403/60f78684b2e68b144e3313b3/html5/thumbnails/20.jpg)
14 Serology DNA.notebook
20
Deoxyribonucleic acid (DNA)
the molecules that carry the genetic information
1868 DNA first discovered by Friedrich Miescher
1953 DNA structure model (the double helix) by Watson and Crick
1985 Dr. Alec Jeffreys discovered that portions of DNA in certain genes are unique to each individual
DNA Fingerprinting (aka DNA profiling or DNA Typing)
![Page 21: 14: Forensic Serology & DNA Analysis · 2020. 4. 17. · 14 Serology DNA.notebook 8 Forensic Tests for Blood: 1) Luminol >extremely sensitive presumptive test for bloodstains >capable](https://reader036.vdocuments.site/reader036/viewer/2022071403/60f78684b2e68b144e3313b3/html5/thumbnails/21.jpg)
14 Serology DNA.notebook
21
Complementary Base Pairing
the specific pairing of > Adenine with Thymine> Guanine with Cytosine
Example:
TATT GTAA GTCA
ATAA CATT CAGT
All of the human chromosomes together contain about 3 billion base pairs.
![Page 22: 14: Forensic Serology & DNA Analysis · 2020. 4. 17. · 14 Serology DNA.notebook 8 Forensic Tests for Blood: 1) Luminol >extremely sensitive presumptive test for bloodstains >capable](https://reader036.vdocuments.site/reader036/viewer/2022071403/60f78684b2e68b144e3313b3/html5/thumbnails/22.jpg)
14 Serology DNA.notebook
22
More than 30% of the human genome is composed of repeating DNA segments.
tandem repeatregion of a chromosome that contains multiple copies of a repeating DNA sequenceex. GTAAGTAAGTAAGTAAGTAAGTAA
restriction enzymechemical that acts as scissors to cut DNA molecule at specific locations
restriction fragment length polymorphism (RFLP)different length fragment of base pairs formed by cutting a DNA molecule with restriction enzymes
![Page 23: 14: Forensic Serology & DNA Analysis · 2020. 4. 17. · 14 Serology DNA.notebook 8 Forensic Tests for Blood: 1) Luminol >extremely sensitive presumptive test for bloodstains >capable](https://reader036.vdocuments.site/reader036/viewer/2022071403/60f78684b2e68b144e3313b3/html5/thumbnails/23.jpg)
14 Serology DNA.notebook
23
Electrophoresis
an old technique used to separate DNA fragments
![Page 24: 14: Forensic Serology & DNA Analysis · 2020. 4. 17. · 14 Serology DNA.notebook 8 Forensic Tests for Blood: 1) Luminol >extremely sensitive presumptive test for bloodstains >capable](https://reader036.vdocuments.site/reader036/viewer/2022071403/60f78684b2e68b144e3313b3/html5/thumbnails/24.jpg)
14 Serology DNA.notebook
24
Polymerase Chain Reaction (PCR)> a technique used to copy or multiplying DNA strands> can amplify minute quantities of DNA> requires much shorter DNA strands than RFLP
Short Tandem Repeats (STR)> the latest method of DNA typing> uses a region of DNA molecule containing short segments of 3 to 7 repeating base pairs
![Page 25: 14: Forensic Serology & DNA Analysis · 2020. 4. 17. · 14 Serology DNA.notebook 8 Forensic Tests for Blood: 1) Luminol >extremely sensitive presumptive test for bloodstains >capable](https://reader036.vdocuments.site/reader036/viewer/2022071403/60f78684b2e68b144e3313b3/html5/thumbnails/25.jpg)
14 Serology DNA.notebook
25
Electropherogram
a plot resulting from automatic sequencing of DNA data
loci (location on chromosome)
repeats (how many times a sequence is repeated)
![Page 26: 14: Forensic Serology & DNA Analysis · 2020. 4. 17. · 14 Serology DNA.notebook 8 Forensic Tests for Blood: 1) Luminol >extremely sensitive presumptive test for bloodstains >capable](https://reader036.vdocuments.site/reader036/viewer/2022071403/60f78684b2e68b144e3313b3/html5/thumbnails/26.jpg)
14 Serology DNA.notebook
26
1) Is this a male or female profile?
2) Which locus is homozygous?
![Page 27: 14: Forensic Serology & DNA Analysis · 2020. 4. 17. · 14 Serology DNA.notebook 8 Forensic Tests for Blood: 1) Luminol >extremely sensitive presumptive test for bloodstains >capable](https://reader036.vdocuments.site/reader036/viewer/2022071403/60f78684b2e68b144e3313b3/html5/thumbnails/27.jpg)
14 Serology DNA.notebook
27
![Page 28: 14: Forensic Serology & DNA Analysis · 2020. 4. 17. · 14 Serology DNA.notebook 8 Forensic Tests for Blood: 1) Luminol >extremely sensitive presumptive test for bloodstains >capable](https://reader036.vdocuments.site/reader036/viewer/2022071403/60f78684b2e68b144e3313b3/html5/thumbnails/28.jpg)
14 Serology DNA.notebook
28
![Page 29: 14: Forensic Serology & DNA Analysis · 2020. 4. 17. · 14 Serology DNA.notebook 8 Forensic Tests for Blood: 1) Luminol >extremely sensitive presumptive test for bloodstains >capable](https://reader036.vdocuments.site/reader036/viewer/2022071403/60f78684b2e68b144e3313b3/html5/thumbnails/29.jpg)
14 Serology DNA.notebook
29
D3S1358 vWA D16S539 D2S1338
D8S1179 D21S11 D18S51
D19S433 TH01 FGA
![Page 30: 14: Forensic Serology & DNA Analysis · 2020. 4. 17. · 14 Serology DNA.notebook 8 Forensic Tests for Blood: 1) Luminol >extremely sensitive presumptive test for bloodstains >capable](https://reader036.vdocuments.site/reader036/viewer/2022071403/60f78684b2e68b144e3313b3/html5/thumbnails/30.jpg)
14 Serology DNA.notebook
30
The Combined DNA Index System (CODIS)> a DNA database developed by the FBI> maintains local, state and national databases of DNA profiles> contains the DNA profiles of convicted offenders, unsolved crime‑scene evidence and missing people
> In 1997, the FBI selected 13 STR loci for their national database.
CSF1PO, FGA, THO1, TPOX, VWA, D3S1358, D5S818, D7S820
D8S1179, D13S317, D16S539, D18S51, D21S11
> In 2017, the FBI expanded the selection to 20 STR loci.CSF1PO, FGA, THO1, TPOX, VWA, D3S1358, D5S818, D7S820
D8S1179, D13S317, D16S539, D18S51, D21S11, D1S1656 D2S441, D2S1338, D10S1248, D12S391, D19S433, D22S1045
![Page 31: 14: Forensic Serology & DNA Analysis · 2020. 4. 17. · 14 Serology DNA.notebook 8 Forensic Tests for Blood: 1) Luminol >extremely sensitive presumptive test for bloodstains >capable](https://reader036.vdocuments.site/reader036/viewer/2022071403/60f78684b2e68b144e3313b3/html5/thumbnails/31.jpg)
14 Serology DNA.notebook
31
Possible Issues with DNA Evidence:
1) Mixtures> if more than one person contributes to a sample, then 3 or more alleles will likely be observed in at least one of the tested loci.
> often challenging and subject to multiple interpretations.
![Page 32: 14: Forensic Serology & DNA Analysis · 2020. 4. 17. · 14 Serology DNA.notebook 8 Forensic Tests for Blood: 1) Luminol >extremely sensitive presumptive test for bloodstains >capable](https://reader036.vdocuments.site/reader036/viewer/2022071403/60f78684b2e68b144e3313b3/html5/thumbnails/32.jpg)
14 Serology DNA.notebook
32
![Page 33: 14: Forensic Serology & DNA Analysis · 2020. 4. 17. · 14 Serology DNA.notebook 8 Forensic Tests for Blood: 1) Luminol >extremely sensitive presumptive test for bloodstains >capable](https://reader036.vdocuments.site/reader036/viewer/2022071403/60f78684b2e68b144e3313b3/html5/thumbnails/33.jpg)
14 Serology DNA.notebook
33
2) Degradation> DNA samples degrade when a sample is aged or exposed to harsh conditions such as heat and humidity.
> sometimes difficult to interpret because of the loss of peak height information
> marked by progressively falling peak heights
![Page 34: 14: Forensic Serology & DNA Analysis · 2020. 4. 17. · 14 Serology DNA.notebook 8 Forensic Tests for Blood: 1) Luminol >extremely sensitive presumptive test for bloodstains >capable](https://reader036.vdocuments.site/reader036/viewer/2022071403/60f78684b2e68b144e3313b3/html5/thumbnails/34.jpg)
14 Serology DNA.notebook
34
Mitochondrial DNA (mtDNA)
> found outside of the nucleus of the cell> inherited only from the mother> circular or loop configuration> can be used when nuclear DNA is degraded or only present in small quantity
> reference sample can be obtained from any maternally related relative
> more sensitive than nuclear DNA> all individual of the same maternal lineage are indistinguishable> more rigorous, time consuming and costly than nuclear DNA profiling
![Page 35: 14: Forensic Serology & DNA Analysis · 2020. 4. 17. · 14 Serology DNA.notebook 8 Forensic Tests for Blood: 1) Luminol >extremely sensitive presumptive test for bloodstains >capable](https://reader036.vdocuments.site/reader036/viewer/2022071403/60f78684b2e68b144e3313b3/html5/thumbnails/35.jpg)
14 Serology DNA.notebook
35
Possible Conclusions in Forensic DNA Analysis:
• Inclusion (with small percent uncertainty)> The questioned DNA sample originated from the Known subject
• Exclusion> The questioned DNA sample did not originate from the known subject
• Inconclusive> mixture> biological child> degradation> not enough sample