10...2013/05/08 · bul1 and bul2 are the 86 ppxy-motif proteins that bind to rsp5 by interacting...
TRANSCRIPT
![Page 1: 10...2013/05/08 · Bul1 and Bul2 are the 86 PPxY-motif proteins that bind to Rsp5 by interacting with the WW domain (21), (22). 87 Deletion of BUL1 and BUL2 causes marked stabilization](https://reader034.vdocuments.site/reader034/viewer/2022051902/5ff22e7e74fbdc2a290f2690/html5/thumbnails/1.jpg)
1
Revised manuscript EC00049-13 for Eukaryotic Cell 1
2
Pressure-induced endocytic degradation of the yeast low-affinity 3
tryptophan permease Tat1 is mediated by Rsp5 ubiquitin ligase and 4
functionally redundant PPxY-motif proteins 5
6
7
Asaha Suzuki1§, Takahiro Mochizuki1§, Satoshi Uemura1, Toshiki Hiraki2 8
and Fumiyoshi Abe1,2* 9
10
1Department of Chemistry and Biological Science, College of Science and Engineering, 11
Aoyama Gakuin University, Sagamihara, Japan; 2Institute of Biogeosciences, Japan Agency 12
for Marine-Earth Science and Technology (JAMSTEC), Yokosuka, Japan 13
14
Running title: High pressure triggers degradation of Tat1. 15
16
§These authors contributed equally. 17
*Corresponding author: 18
5-10-1 Fuchinobe, Chuo-ku, Sagamihara 252-5258, Japan 19
Phone: +81-42-759-6233 20
Fax: +81-42-759-6511 21
E-mail: [email protected] 22
23
Copyright © 2013, American Society for Microbiology. All Rights Reserved.Eukaryotic Cell doi:10.1128/EC.00049-13 EC Accepts, published online ahead of print on 10 May 2013
on January 3, 2021 by guesthttp://ec.asm
.org/D
ownloaded from
![Page 2: 10...2013/05/08 · Bul1 and Bul2 are the 86 PPxY-motif proteins that bind to Rsp5 by interacting with the WW domain (21), (22). 87 Deletion of BUL1 and BUL2 causes marked stabilization](https://reader034.vdocuments.site/reader034/viewer/2022051902/5ff22e7e74fbdc2a290f2690/html5/thumbnails/2.jpg)
2
ABSTRACT 24
Cells of Saccharomyces cerevisiae express the two tryptophan permeases Tat1 and Tat2, 25
which have different characteristics in terms of their affinity for tryptophan and intracellular 26
localization. Although the high-affinity permease Tat2 has been well documented in terms of 27
its ubiquitin-dependent degradation, the low-affinity permease Tat1 has not yet been fully 28
characterized. Here we show that high hydrostatic pressure of 25 MPa triggers the 29
degradation of Tat1 which depends on Rsp5 ubiquitin ligase and an EH-domain protein End3. 30
Tat1 was resistant to 3-h cycloheximide treatment, suggesting that it is highly stable under 31
normal growth conditions. The ubiquitination of Tat1 most likely occurs at the N-terminal 32
lysines 29 and 31. Simultaneous substitution of arginine for the two lysines prevented Tat1 33
degradation but either of them alone did not, indicating that the role of lysines 29 and 31 is 34
redundant. When cells were exposed to high pressure, Tat1-GFP was completely lost from the 35
plasma membrane, while substantial amounts of Tat1K29R-K31R-GFP remained. The HPG1-1 36
(Rsp5P514T) and rsp5-ww3 mutations stabilized Tat1 under high pressure but any one of the 37
rsp5-ww1, rsp5-ww2, bul1Δbul2Δ and single deletions for genes encoding arrestin-related 38
trafficking adaptors did not. However, simultaneous loss of 9 arrestins and Bul1/Bul2 39
prevented Tat1 degradation at 25 MPa. The results suggest that multiple PPxY-motif proteins 40
share some essential roles in regulating Tat1 ubiquitination in response to high hydrostatic 41
pressure. 42
43
INTRODUCTION 44
The genome of the yeast Saccharomyces cerevisiae encodes 24 amino acid permeases and 45
their homologous proteins. These permeases consist of 12 transmembrane domains (TMDs) 46
and cytoplasmic tails and have unique characteristics in their substrate specificity, affinity, 47
capacity, and posttranslational modification (1–3). Tryptophan is hydrophobic, bulky, and one 48
of the sparsest amino acids in nutrients and nature. This leads to the concept that the 49
tryptophan uptake machinery can be evolutionarily specialized in heterotrophic organisms. In 50
on January 3, 2021 by guesthttp://ec.asm
.org/D
ownloaded from
![Page 3: 10...2013/05/08 · Bul1 and Bul2 are the 86 PPxY-motif proteins that bind to Rsp5 by interacting with the WW domain (21), (22). 87 Deletion of BUL1 and BUL2 causes marked stabilization](https://reader034.vdocuments.site/reader034/viewer/2022051902/5ff22e7e74fbdc2a290f2690/html5/thumbnails/3.jpg)
3
S. cerevisiae, tryptophan is imported by facilitated diffusion through Tat1 and Tat2, which are 51
the low-affinity and high-affinity tryptophan permease, respectively. TAT1 and TAT2 were 52
originally identified as genes conferring resistance to the immunosuppressive agent 53
tacrolimus (FK506) (4, 5). Because tryptophan uptake is highly sensitive to diverse 54
environmental stresses, it becomes the limiting factor for cell growth in 55
tryptophan-auxotrophic strains. Of the two permeases, Tat2 has been relatively well 56
characterized in terms of ubiquitin-dependent degradation and intracellular trafficking. In 57
response to nutrient deprivation or rapamycin treatment, Tat2 undergoes ubiquitination in a 58
manner dependent on Rsp5 ubiquitin ligase, followed by vacuolar degradation (6). 59
Appropriate delivery of Tat2 to the cell surface requires ergosterol (7, 8) and 60
glycosylphosphatidylinositol-anchored proteins (9). 61
We reported that hydrostatic pressure at nonlethal levels of 15 to 25 MPa (~150 to 250 62
kg•cm–2) or low temperature of 15 °C compromised the uptake of tryptophan and thereby 63
inhibited growth of tryptophan-auxotrophic strains (10). Overexpression of TAT2 confers the 64
ability of growth under these conditions (10). When cells were incubated under high pressure 65
or low temperature, Tat1 and Tat2 undergo vacuolar degradation in a manner dependent on 66
Rsp5 ubiquitin ligase (11, 12). High hydrostatic pressure has a profound impact on lipid 67
membranes, primarily resulting in tighter packing and restriction of acyl-chain motion in a 68
manner analogous to decreasing temperature (13–15). With increasing pressure, the 69
gel-to-liquid crystalline coexistence region is shifted toward higher temperatures by 70
approximately 22°C/100 MPa (14). In this regard, tryptophan uptake is hypersensitive to 71
reduction in membrane fluidity caused by either increasing pressure or decreasing 72
temperature. Tryptophan uptake is also sensitive to some agents such as 4-phenylbutyrate (16), 73
isoflurane (17) and phytosphingosine (18) that potentially have disturbing effects on the 74
membrane, and overexpression of TAT2 confers resistance to the agents. Accordingly, 75
hydrostatic pressure in combination with temperature is a unique parameter to elucidate the 76
function and regulation of tryptophan permeases by altering the membrane structure and 77
on January 3, 2021 by guesthttp://ec.asm
.org/D
ownloaded from
![Page 4: 10...2013/05/08 · Bul1 and Bul2 are the 86 PPxY-motif proteins that bind to Rsp5 by interacting with the WW domain (21), (22). 87 Deletion of BUL1 and BUL2 causes marked stabilization](https://reader034.vdocuments.site/reader034/viewer/2022051902/5ff22e7e74fbdc2a290f2690/html5/thumbnails/4.jpg)
4
lipid–protein interactions without introducing any components into the system (19, 20). 78
Although Tat1 and Tat2 are homologous with a sequence identity of 39%, they are more 79
different than might first be surmised. In the presence of a normal or high concentration of 80
tryptophan (20–40 μg•ml–1 or 200 μg•ml–1, respectively), Tat1 predominantly localizes to the 81
plasma membrane, whereas Tat2 is more abundant in endosomes and multivesicular bodies (7, 82
11). Mutations rendering growth at 25 MPa in a tryptophan-auxotrophic strain have yielded 83
HPG (high-pressure growth) 1, a semidominant allele of RSP5, occurring as a mutation in the 84
catalytic HECT (homologous to E6-AP C-terminus) domain (11). Bul1 and Bul2 are the 85
PPxY-motif proteins that bind to Rsp5 by interacting with the WW domain (21), (22). 86
Deletion of BUL1 and BUL2 causes marked stabilization of Tat2, although it has no effect on 87
Tat1 degradation (11). In the membrane flotation assay in which crude membrane extracts are 88
treated with cold Triton X-100, Tat2 is associated with detergent-soluble membranes (7, 11), 89
while Tat1 is associated with detergent-resistant membranes, so-called lipid rafts (11). Upon 90
the HPG1 mutation, Tat2 becomes associated with lipid rafts, while Tat1 remains in rafts. 91
When yeast cells are starved of nutrients, Tat2 degradation is initiated by covalent binding of 92
ubiquitin to lysine residues in the N-terminal domain (6). Substitution of arginines for the five 93
lysines prevents Tat2 from degradation. However, ubiquitin binding site of Tat1 is still 94
unknown. 95
It was shown that members of a family of arrestin-related trafficking adaptors (ARTs or 96
arrestins hereafter) mediate the ubiquitination and endocytosis of amino acid permeases such 97
as lysine permease Lyp1 (23), arginine permease Can1 (23, 24), methionine permease Mup1 98
(23), glutamate permease Dip5 (25) and Tat2 (26) in response to specific amino acids or 99
environmental stresses (see reviews: (27), (28)). The arrestins possess the PPxY motif and 100
mediate Rsp5-dependent ubiquitination of these amino acid permeases. In the case of Lyp1, 101
Art1 is required for lysine-induced endocytosis, while Art2 is required for 102
cycloheximide-induced endocytosis (23). Art3 is required for the endocytosis of Dip5 in 103
response to excess glutamate (25). Systematic analysis of 9 ART genes revealed that their 104
on January 3, 2021 by guesthttp://ec.asm
.org/D
ownloaded from
![Page 5: 10...2013/05/08 · Bul1 and Bul2 are the 86 PPxY-motif proteins that bind to Rsp5 by interacting with the WW domain (21), (22). 87 Deletion of BUL1 and BUL2 causes marked stabilization](https://reader034.vdocuments.site/reader034/viewer/2022051902/5ff22e7e74fbdc2a290f2690/html5/thumbnails/5.jpg)
5
simultaneous deletions block the endocytosis of Tat2 in response to excess tryptophan or 105
cycloheximide (26). While either ART1 or ART2 restores the tryptophan-induced endocytosis 106
of Tat2, ART1 does not restore cycloheximide-induced endocytosis (26). Accordingly, 107
arrestins are unlikely to be general regulators of the degradation of amino acid permeases but 108
rather participate in their signal-dependent endocytosis. 109
In this paper, we show that lysine residues 29 and 31 in the N-terminal domain are 110
required for Tat1 ubiquitination, which depends on Rsp5, and one of the two lysines is 111
sufficient for degradation in response to increased hydrostatic pressure. We also show that 112
pressure-induced Tat1 ubiquitination is mediated by functionally redundant multiple 113
PPxY-motif proteins including the arrestins and Bul1/Bul2. For simplicity, ‘ART’ is used as a 114
synonym for yeast arrestin genes except for ‘9-arrestin’ to note simultaneous deletions of 115
ART1, ART2, ART3, ART4, ART5, ART6, ART7, ART8 and ART10 (26). 116
117
MATERIALS AND METHODS 118
Yeast strains and culture conditions 119
Strains used in this study are listed in Table 1. Strains EN60 and EN67 are kind gifts from H. 120
R. B. Pelham of MRC laboratory of Molecular Biology (26). Cells were grown at 25 °C with 121
shaking in synthetic complete (SC) medium with slight modification (tryptophan 40 μg/mL; 122
leucine 90 μg/mL; valine was eliminated; Ref. 11). High-pressure cultivation of the cells was 123
carried out as described previously (10, 11). Other materials are laboratory stocks (29, 30). 124
125
Construction of plasmids 126
PCR-based site-directed mutagenesis was performed to create one or multiple 127
lysine-to-arginine (K>R) substitutions in the Tat1 N-terminal domain using a QuikChange II 128
site-directed mutagenesis kit (Agilent Technologies Inc., Santa Clara, CA, USA) or 129
PrimerSTAR mutagenesis basal kit (TaKaRa Bio Inc., Otsu, Shiga, Japan). Relevant primers 130
and p3HA-TAT1c (3HA-tagged TAT1 driven by its own promoter in YCplac33 (URA3 CEN4) 131
on January 3, 2021 by guesthttp://ec.asm
.org/D
ownloaded from
![Page 6: 10...2013/05/08 · Bul1 and Bul2 are the 86 PPxY-motif proteins that bind to Rsp5 by interacting with the WW domain (21), (22). 87 Deletion of BUL1 and BUL2 causes marked stabilization](https://reader034.vdocuments.site/reader034/viewer/2022051902/5ff22e7e74fbdc2a290f2690/html5/thumbnails/6.jpg)
6
as a template were used for PCR amplification (11). The appropriate base substitution was 132
confirmed by sequencing the entire region of the TAT1 open reading frame (ORF) using the 133
relevant sequence primers. 134
Plasmids containing TAT1-13c-Myc-GFP (simply denoted TAT1-GFP hereafter) and its 135
mutant forms driven by the TAT1 own promoter were constructed as follows. pSCU709 136
(GAL1 promoter-13c-Myc-GFP-CYC1 terminator, URA3, 2 μ, a kind gift from T. Ushimaru of 137
Shizuoka University) was used to generate a plasmid containing TAT1-13c-Myc-GFP (simply 138
denoted TAT1-GFP hereafter). pSCU709 was digested with SacI and BamHI to remove the 139
GAL1 promoter from the plasmid. The TAT1 ORF and its own promoter region were 140
amplified by PCR using pTAT1c as a template and 141
GGGAACAAAAGCTGGAGCTCCATCCTTGTTTAAGTAAACCATTTATGT and 142
TTAATTAACCCGGGGGATCCGCACCAGAAATTGGTCATCCTCTTAAAA as primers 143
(sequences complementary to the ends of the digested plasmid are underlined). The linearized 144
plasmid and the PCR product were introduced into strain YPH499 to generate 145
pSCU709-TAT1-GFP in cells based on homologous recombination. The plasmid was isolated, 146
and the entire TAT1 ORF was sequenced. The KpnI sites are located at the 313–318th position 147
of the TAT1 ORF and its 3' downstream region in YCplac33. pSCU709-TAT1-GFP was 148
digested with KpnI to obtain a fragment containing TAT1-GFP lacking the first 315 149
nucleotides of the ORF. It was fused to the longer fragment either from p3HA-TAT1c or 150
p3HA-TAT1-K29R-K31Rc digested with KpnI to give p3HA-TAT1-GFPc (3HA-tagged 151
TAT1-GFP driven by its own promoter, URA3 CEN4) or p3HA-TAT1-K29R-K31R-GFPc 152
(3HA-tagged TAT1-K29R-K31R-GFP driven by its own promoter, URA3, CEN4), 153
respectively. 154
155
Construction of mutant strains 156
PCR-based gene disruption was performed on the wild-type strain YPH499 to create the 157
end3Δ::URA� using primers 158
on January 3, 2021 by guesthttp://ec.asm
.org/D
ownloaded from
![Page 7: 10...2013/05/08 · Bul1 and Bul2 are the 86 PPxY-motif proteins that bind to Rsp5 by interacting with the WW domain (21), (22). 87 Deletion of BUL1 and BUL2 causes marked stabilization](https://reader034.vdocuments.site/reader034/viewer/2022051902/5ff22e7e74fbdc2a290f2690/html5/thumbnails/7.jpg)
7
5’-ATGCCCAAGTTGGAACAATTTGAAATAAAAAAATACTGGCAAATCTTCTCGGGT159
TTGAAAAATTCAATTCATCATTTTTT-3’ and 160
5’-TCAATTGATTTCTGCTTGTAATGCTTGCAATTCGTGTCTCTTATTGTTCAAGTAAT161
TCTCTGGATTAGTCTCATCCTTCA-3’ (sequences complementary to YEplac195 are 162
underlined) and YEplac195 as a template. It was also performed to create art1Δ::KanMX, 163
art2Δ::KanMX, art3Δ::KanMX, art4Δ::KanMX, art5Δ::KanMX, art6Δ::KanMX, 164
art7Δ::KanMX, and art8Δ::KanMX, using relevant primers (20-mer oligonucleotides 165
upstream and downstream of individual open reading frames) and the genome DNA from the 166
corresponding deletion strains of the EUROSCARF yeast deletion library (cat. no. 95400.H3, 167
Invitrogen, Carlsbad, CA, USA) as templates. 168
The point mutations rsp5-ww1 (W257G) and rsp5-ww2 (W359G) were introduced into 169
the YPH499 genome as described previously for the rsp5-ww3 (W451G) mutant (31) by 170
replacing RSP5 in the genome with RSP5 containing the rsp5-ww1 or the rsp5-ww2 mutation. 171
Each GGG>CCC base substituion was created in plasmid pFA499c that contained RSP5 172
driven by its own promoter (11) using the QuikChange II site-directed mutagenesis kit and 173
primers for rsp5-ww1 (5'-CACAAGGACTACCACTGGGAAACGTCCAACGC-3' and 174
5'-GCGTTGGACGTTTCCCAGTGGTAGTCCTTGTG-3'; the mutation sites are underlined), 175
and rsp5-ww2 (5'-CTAGAACAACCACTGGGGTGGATCCAAGGAGAC-3' and 176
5'-GTCTCCTTGGATCCACCCCAGTGGTTGTTCTAG-3'; the mutation sites are 177
underlined). The resulting rsp5-ww1 or rsp5-ww2 DNA fragment was introduced into plasmid 178
YIplac211 (URA3) to transform strain YPH499. Multiple Ura3+ transformants were incubated 179
in YPD medium overnight, and the cells were spread on SD plates containing uracil and 0.1% 180
5-fluoroorotic acid. Multiple colonies were isolated, and the rsp5-ww1 and rsp5-ww2 181
mutations of the clones were confirmed by DNA sequencing of the genome locus using the 182
relevant primers. 183
184
Western blotting 185
Exponentially growing cells (1.0–1.5 × 107 cells•ml–1) were collected by centrifugation, and 186
whole-cell extracts were prepared for Western blotting as described previously (11). To avoid 187
the non-specific removal of ubiquitin from ubiquitinated Tat1, PR-619, a non-selective 188
on January 3, 2021 by guesthttp://ec.asm
.org/D
ownloaded from
![Page 8: 10...2013/05/08 · Bul1 and Bul2 are the 86 PPxY-motif proteins that bind to Rsp5 by interacting with the WW domain (21), (22). 87 Deletion of BUL1 and BUL2 causes marked stabilization](https://reader034.vdocuments.site/reader034/viewer/2022051902/5ff22e7e74fbdc2a290f2690/html5/thumbnails/8.jpg)
8
cell-permeable inhibitor of ubiquitin isopeptidases (LifeSensors, Malvern, PA, USA), was 189
added to the cells at 20 μM during the preparation of the whole cell extracts. The extracts 190
were subjected to centrifugation at 13,000 × g for 10 min to yield the P13 membranes. The 191
supernatants were subjected to centrifugation at 100,000 × g for 30 min to yield the P100 192
membranes. Antibodies were used for HA (16B12, BabCO, Richmond, CA, USA), Adh1 193
(Rockland antibodies and assays, Gilbersville, PA, USA), Pma1 (EnCor Biotechnology Inc., 194
Gainesville, FL, USA) and Dpm1 (5C5A7, Life Technologies Corp., Carlsbad, CA, USA). 195
Adh1 and Pma1 were used as loading controls for the whole cell extracts and the P13 196
membranes, respectively. Dpm1 was used as a loading control for both P13 and P100 197
membranes. The signals were detected in an ImageQuant LAS4000 mini (GE Healthcare Life 198
Sciences, Piscataway, NJ, USA). 199
200
Fluorescence microscopy 201
Cells expressing GFP-tagged Tat1 proteins were imaged on a fluorescence microscope model 202
IX70 (Olympus, Co. Ltd., Tokyo, Japan). 203
204
RESULTS 205
Tat1 undergoes endocytic degradation in response to high pressure 206
Our previous study showed that Tat1 undergoes Rsp5-dependent degradation in response to 207
high hydrostatic pressure (11). We first compared the Tat1 degradation between cells with 208
high-pressure treatment and cycloheximide treatment. Whole-cell extracts for Western 209
blotting were prepared from cells after exposure to pressure of 25 MPa or cycloheximide (100 210
μg/mL at 0.1 MPa) for 3 h. We found that Tat1 was highly stable without a significant 211
decrease in its level after 3-h cycloheximide treatment. In contrast, Tat1 was decreased 212
considerably after high-pressure treatment for 3 h. A control protein, Adh1, was not degraded 213
after the cycloheximide- or high-pressure treatment. The result suggests that high pressure 214
promotes the degradation of Tat1 (Fig. 1A). Some higher molecular-weight bands were 215
on January 3, 2021 by guesthttp://ec.asm
.org/D
ownloaded from
![Page 9: 10...2013/05/08 · Bul1 and Bul2 are the 86 PPxY-motif proteins that bind to Rsp5 by interacting with the WW domain (21), (22). 87 Deletion of BUL1 and BUL2 causes marked stabilization](https://reader034.vdocuments.site/reader034/viewer/2022051902/5ff22e7e74fbdc2a290f2690/html5/thumbnails/9.jpg)
9
detected above the main Tat1 band upon overexposure in signal detection (Fig. 1A, 216
arrowheads, see below). 217
To eliminate the possibility that the decrease in Tat1 under these conditions could be 218
attributed to any non-physiological causes, e.g., mechanical pinching off due to perturbation 219
of the membrane by high pressure, we examined whether Tat1 was maintained in the 220
endocytosis-deficient end3Δ mutant at 25 MPa. We also extended the analysis by 221
fractionating the membranes. As demonstrated previously, Tat1 was predominantly localized 222
in the P13 membranes in which the plasma membrane was enriched. Small amounts of Tat1 in 223
the P100 membranes are likely to be associated with endosomes. The end3Δ mutation reduced 224
Tat1 from the P100 membranes. When pressure of 25 MPa was applied to the end3Δ cells, 225
substantial amounts of Tat1 remained in the P13 membranes, while it was reduced from the 226
P13 membranes in the wild-type cells (Fig. 1B). A non-ubiquitinated control protein, Pma1, 227
remained unchanged in the wild-type and the end3Δ cells upon the high-pressure treatment. 228
These results suggest that high pressure enhances the ubiquitination and/or endocytosis of 229
Tat1. It is unlikely that high pressure generally promotes ubiquitination/endocytosis of 230
membrane proteins because the rate of Tat2 degradation is much more rapid with 231
cycloheximide treatment (~30 min) (31) than with high-pressure treatment (> 2 h) (11). It is 232
known that excess amounts of tryptophan in medium induces the degradation of Tat2 (7). 233
However, the Tat1 level remained almost unchanged when cells were cultured with various 234
concentrations of tryptophan (4–200 μg/mL) (our unpublished observation). Therefore, we 235
assume that the cells specifically respond to changes in hydrostatic pressure and downregulate 236
Tat1 in a manner dependent on Rsp5-mediated ubiquitination and endocytosis. 237
238
Lysine residues 29 and 31 are targets of Tat1 ubiquitination 239
We next determined the target lysine(s) for ubiquitination of Tat1 in its N-terminal domain. 240
According to HMMTOP (http://www.enzim.hu/hmmtop/), a program for transmembrane helix 241
prediction (32, 33), the cytoplasmic N-terminal domain of Tat1 is composed of 99 amino 242
on January 3, 2021 by guesthttp://ec.asm
.org/D
ownloaded from
![Page 10: 10...2013/05/08 · Bul1 and Bul2 are the 86 PPxY-motif proteins that bind to Rsp5 by interacting with the WW domain (21), (22). 87 Deletion of BUL1 and BUL2 causes marked stabilization](https://reader034.vdocuments.site/reader034/viewer/2022051902/5ff22e7e74fbdc2a290f2690/html5/thumbnails/10.jpg)
10
acids in which 11 lysine residues are located. We created K>R substitutions with various 243
combinations in the N-terminal domain to determine lysine residues prerequisite for 244
degradation of Tat1. In the process of substituting arginines for all of the 11 lysines, we first 245
obtained 16 plasmids expressing the Tat1 K>R variants (Table 2, p3HA-TAT1-AS1c to 246
AS16c). Whole-cell extracts were prepared from the plasmid-bearing cells for Western blot 247
analysis. The quantity of variant Tat1 proteins was almost the same as the wild-type Tat1 (Fig. 248
2A). We found that at least two higher molecular-weight bands with additional masses of 8 249
and 16 kDa appeared above the main wild-type Tat1 band (Fig. 2A, arrowheads). They 250
probably correspond to mono- and diubiquitinated forms of Tat1, respectively. These two 251
higher molecular-weight bands were much weaker in cells harboring the variant TAT1 252
plasmids AS5, AS6, AS7, AS8, AS9, AS10, and AS11 (Fig. 2A). Accordingly, two lysines 253
among those at positions 10, 29, 31, 39, 56, and 71 can be the ubiquitination targets. We next 254
created single and double K>R variants to determine ubiquitin acceptors in the N-terminal 255
domain. Simultaneous K29R and K31R substitution (K29R-K31R) and 11K>R substitution 256
resulted in the complete loss of the higher molecular-weight bands, but that of K39R and 257
K56R (K39R-K56R) did not (Fig. 2B). In our preliminary experiment, we confirmed the 258
ubiquitin conjugation at these two lysines by performing immunoprecipitation of Tat1 and its 259
mutant forms in cells co-expressing c-Myc-tagged ubiquitin, followed by the detection of 260
covalently bound ubiquitin molecules with c-Myc antibody. c-Myc ubiquitin was detected in 261
Tat1 but not in Tat1K29R-K31R and Tat111K>R (data not shown). These results suggest that K29 262
and K31 are target lysines for Rsp5-dependent ubiquitination. In the process of this analysis, 263
we noticed that the appearance of the higher molecular-weight bands in the single K>R 264
substitutions, K10R, K29R, K31R, K39R, and K56R, varied with experiments. This implies 265
that ubiquitination of Tat1 potentially occurs on lysines other than K29 and K31. However, 266
we show below that K29 and K31 are crucial for pressure-induced degradation of Tat1. 267
268
Ubiquitination of either lysine 29 or 31 is sufficient for pressure-induced degradation of 269
on January 3, 2021 by guesthttp://ec.asm
.org/D
ownloaded from
![Page 11: 10...2013/05/08 · Bul1 and Bul2 are the 86 PPxY-motif proteins that bind to Rsp5 by interacting with the WW domain (21), (22). 87 Deletion of BUL1 and BUL2 causes marked stabilization](https://reader034.vdocuments.site/reader034/viewer/2022051902/5ff22e7e74fbdc2a290f2690/html5/thumbnails/11.jpg)
11
Tat1 270
We next examined whether K29 and K31 were required for pressure-induced Tat1 degradation. 271
While substantial decrease was observed in wild-type Tat1, Tat1K10R, Tat1K29R, Tat1K31R, 272
Tat1K39R, Tat1K56R, and Tat1K39R-K56R, the amount of Tat1K29R-K31R, Tat1K10R-K29R-K31R and 273
Tat111K>R remained almost unchanged after the cells were exposed to high pressure for 3 h 274
(Fig. 2C). The result indicates that either K29 or K31 is required for pressure-induced Tat1 275
degradation. 276
To examine whether the K29R-K31R substitution altered the intracellular localization of 277
Tat1, GFP-tagged Tat1 was expressed in the cell. Tat1-GFP predominantly localized to the 278
plasma membrane (Fig. 3). There was no marked difference in the plasma membrane 279
localization between Tat1-GFP and Tat1K29R-K31R-GFP at 0.1 MPa (Fig. 3). When cells were 280
exposed to pressure of 25 MPa for 3 h, Tat1-GFP was completely lost from the plasma 281
membrane and transported to the vacuole for degradation. In contrast, substantial amounts of 282
Tat1K29R-K31R-GFP remained in the plasma membrane under the same condition (Fig. 3). 283
Interestingly, the vacuoles were also GFP positive in cells expressing Tat1K29R-K31R-GFP. This 284
result suggests that high hydrostatic pressure enhances the vacuolar sorting of newly 285
synthesized Tat1 from the Golgi apparatus to the vacuole in a manner independent of K29- 286
and K31-linked ubiquitination as well as sorting of Tat1 that preexists in the plasma 287
membrane in a manner dependent on K29 and K31. 288
289
Pressure-induced endocytic degradation of Tat1 redundantly depends on PPxY-motif 290
proteins 291
Pressure-induced Tat1 degradation is prevented by the HPG1 mutation (e.g., HPG1-1, 292
Rsp5P514T) but not by bul1Δbul2Δ (Fig. 4A, Ref. 11). The dispensability of Bul1 and Bul2 is 293
in sharp contrast to Tat2 degradation in which Bul1 is strictly required (7, 11). This implies 294
that PPxY proteins other than Bul1 and Bul2 mediate Rsp5-dependent ubiquitination of Tat1. 295
We first analyzed the effect of rsp5-ww mutations on pressure-induced Tat1 degradation. The 296
on January 3, 2021 by guesthttp://ec.asm
.org/D
ownloaded from
![Page 12: 10...2013/05/08 · Bul1 and Bul2 are the 86 PPxY-motif proteins that bind to Rsp5 by interacting with the WW domain (21), (22). 87 Deletion of BUL1 and BUL2 causes marked stabilization](https://reader034.vdocuments.site/reader034/viewer/2022051902/5ff22e7e74fbdc2a290f2690/html5/thumbnails/12.jpg)
12
base substitutions were introduced in the genome of strain YPH499 to create the rsp5-ww1 297
(W257G), rsp5-ww2 (W359G) and rsp5-ww3 (W451G) mutations. We found that Tat1 was 298
similarly degraded in the rsp5-ww1 and rsp5-ww2 mutants as in the wild-type strain, although 299
certain amounts remained in the rsp5-ww3 mutant (Fig. 4A). This suggests that other PPxY 300
proteins mediate Tat1 ubiquitination through the interaction with the Rsp5 WW3 domain but 301
probably partially redundant with other Rsp5 WW domains in response to high pressure. This 302
prompted us to screen for the yeast arrestins. 303
Next, we created single deletions of ART1 to ART8 in the YPH499 genome. ART9 304
deletion was not performed because Art9 does not have the canonical PPxY motif. ART10 305
deletion in the YPH499 genome has not been successful for unknown reasons. We found that 306
none of the single deletions of ART genes prevented Tat1 degradation at 25 MPa, suggesting 307
that the role of the arrestins is redundant (Fig. 4B). Simultaneous deletions of ART1, ART2, 308
ART3, ART4, ART5, ART6, ART7, ART8 and ART10 (9-arrestin; Ref. 26) slightly prevented 309
Tat1 degradation, and combined 9-arrestin and bul1Δbul2Δ substantially but not fully 310
stabilized Tat1 at 25 MPa (Fig. 4C). This in turn suggests that 9 arrestins and Bul1/Bul2, and 311
possibly other proteins, share some essential functions in regulating Tat1 ubiquitination 312
through the interaction with Rsp5. However, we cannot rule out the possibility that the 313
simultaneous loss of the 11 PPxY proteins indirectly causes the stabilization of Tat1 by 314
exerting effects on any downstream proteins involved in the endocytic degradation of Tat1. 315
Analysis of the 9-arrestin bul1Δbul2Δ mutant with BUL1 or BUL2 on the plasmid would 316
clarify which alternative is responsible for pressure-induced Tat1 degradation when Art 317
proteins are absent. Unlike the observation by Nikko and Pelham (26), the 9-arrestin 318
bul1Δbul2Δ mutant did not exhibit slow growth under normal culture conditions when using 319
our modified SC medium (see Materials and Methods). 320
321
DISCUSSION 322
Endocytic degradation of Tat1 in response to high pressure 323
on January 3, 2021 by guesthttp://ec.asm
.org/D
ownloaded from
![Page 13: 10...2013/05/08 · Bul1 and Bul2 are the 86 PPxY-motif proteins that bind to Rsp5 by interacting with the WW domain (21), (22). 87 Deletion of BUL1 and BUL2 causes marked stabilization](https://reader034.vdocuments.site/reader034/viewer/2022051902/5ff22e7e74fbdc2a290f2690/html5/thumbnails/13.jpg)
13
The present study demonstrated that high hydrostatic pressure triggers the degradation of Tat1 324
in a manner dependent on ubiquitination and subsequent endocytosis. Under normal growth 325
conditions, the low-affinity tryptophan permease Tat1 is highly stable with a half-life much 326
longer than the doubling time of proliferating cells (>> 3 h), as opposed to the rapid turnover 327
of the high-affinity tryptophan permease Tat2 (~ 30 min) (31). Tat1 is insensitive to 328
cycloheximide or varied concentrations of tryptophan in culture medium (our unpublished 329
observation), while Tat2 undergoes rapid degradation in response to excess tryptophan and 330
cycloheximide (7, 26). Therefore, the ubiquitination machinery may specifically perform 331
quality control of Tat1 when cells are exposed to non-lethal levels of hydrostatic pressure. 332
Pressure-induced Tat1 degradation requires one of the N-terminal lysine residues 29 and 31, 333
and simultaneous K29R-K31R substitution results in the marked stabilization of Tat1. 334
According to the protein mobility on SDS-PAGE, the two higher molecular-weight bands 335
appeared to be attributed to the mono- and double monoubiquitinated forms of Tat1 at 336
positions 29 and/or 31. 337
338
Regulation of Tat1 degradation mediated by multiple PPxY-motif proteins 339
We showed that the WW3 domain of Rsp5 was important but probably redundant with other 340
WW domains for pressure-induced degradation of Tat1. In fact, many proteins can bind two 341
of three WW domain of Rsp5 (34). In contrast to the requirement for specific arrestins for the 342
degradation of Can1, Lyp1, Itr1, Dip5 or Jen1, 9 arrestins and Bul1/Bul2 redundantly regulate 343
Tat1 degradation. Furthermore, the fact that Tat1 was not fully stabilized in the 9-arrestin 344
bul1Δbu2Δ mutant at high pressure suggests the presence of additional PPxY-motif proteins 345
that play a role in Tat1 degradation in response to high pressure. This is similar to the uracil 346
permease Fur4 with respect to the redundancy of 9 arrestins and Bul1 for vacuolar 347
degradation after the addition of uracil or cycloheximide (26). It was reported that Art1 and 348
Art2 effectively complement the 9-arrestin bul1Δ strain in Fur4 degradation, although Art8 349
showed weaker activity (26). The degradation of Tat2 is also blocked in the rsp5-ww3 mutant 350
on January 3, 2021 by guesthttp://ec.asm
.org/D
ownloaded from
![Page 14: 10...2013/05/08 · Bul1 and Bul2 are the 86 PPxY-motif proteins that bind to Rsp5 by interacting with the WW domain (21), (22). 87 Deletion of BUL1 and BUL2 causes marked stabilization](https://reader034.vdocuments.site/reader034/viewer/2022051902/5ff22e7e74fbdc2a290f2690/html5/thumbnails/14.jpg)
14
and the bul1Δ strain. Art1 and Art2 restore Tat2 degradation in the 9-arrestin mutant with 351
excess tryptophan, whereas Art8 partially restores it with cycloheximide treatment (26). 352
Nikko and Pelham mentioned a scheme of transporter regulation in which specificity is 353
provided by arrestin interactions that promote endocytosis, and this is followed by further, 354
relatively non-specific ubiquitination in endosomes (26). It is still unclear how the 355
functionally redundant PPxY-motif proteins recognize Tat1 specifically after cells are exposed 356
to high pressure. One possible explanation is that high pressure may perturb the structure of 357
the raft domain, leading to the release of Tat1 from the rafts to non-rafts and thus enhancing 358
the endocytosis of Tat1 for degradation. In the case of Can1, the addition of arginine releases 359
Can1 from the raft domain, followed by endocytic degradation (35). In this regard, the 360
structural instability of Tat1 within the unfavorable non-raft environments could provide an 361
opportunity to expose the hydrophobic TMD peptides of Tat1 to the cytoplasm, and thereby a 362
broad range of arrestins might become capable of interacting with the hypothetically 363
denatured forms of Tat1 through hydrophobic interactions. In this sense, the ubiquitin system 364
would differentiate dysfunctional membrane proteins from intact ones through the function of 365
arrestins. It would be worthwhile elucidating whether high pressure disrupts the raft structure 366
mechanically or blocks delivery of raft components such ergosterol and sphingolipids to the 367
plasma membrane, and whether Tat1 can be released from the rafts. 368
A recent key finding on the nutrient-sensing pathway is that TORC1 controls nutrient 369
uptake by targeting the ubiquitin-mediated endocytosis of specific amino acid permeases. 370
Endocytic downregulation of Can1 is promoted by cycloheximide, and this effect is abrogated 371
by treatment of the cells with rapamycin, a TORC1 inhibitor (24). Cycloheximide also 372
triggers the endocytosis of Mup1, and rapamycin abrogates the effect. However, rapamaycin 373
does not affect the methionine-induced endocytosis of Mup1. Thus, TORC1 signaling 374
promotes the endocytosis of multiple cell surface proteins as a general mechanism to limit 375
protein abundance at the plasma membrane. In the presence of nutrients, TORC1 kinase 376
inactivates a downstream kinase Npr1 by phosphorylation. In this situation, the Rsp5-Art1 377
on January 3, 2021 by guesthttp://ec.asm
.org/D
ownloaded from
![Page 15: 10...2013/05/08 · Bul1 and Bul2 are the 86 PPxY-motif proteins that bind to Rsp5 by interacting with the WW domain (21), (22). 87 Deletion of BUL1 and BUL2 causes marked stabilization](https://reader034.vdocuments.site/reader034/viewer/2022051902/5ff22e7e74fbdc2a290f2690/html5/thumbnails/15.jpg)
15
complex is translocated to the plasma membrane to ubiquitinate Can1 (24). Starvation or 378
rapamycin treatment inhibits TORC1, which in turn activates Npr1 by dephosphorylation. The 379
activated Npr1 is translocated to the plasma membrane and phosphorylates Art1. Then, 380
Rsp5-Art1 is dissociated from the plasma membrane, and hence Can1 ubiquitination does not 381
occur (24). 382
TORC1 also controls nitrogen-induced Gap endocytosis in a manner dependent on Npr1 383
and the 14-3-3 proteins (36). Under nitrogen-poor conditions, Bul1 and Bul2 are 384
phosphorylated in an Npr1-dependent manner and bind to the 14-3-3 proteins, which inhibit 385
the capacity of Bul proteins to induce Gap1 ubiquitination. Upon the addition of ammonium 386
ions, Bul proteins are dephosphorylated, concomitantly dissociated from the 14-3-3 proteins, 387
and then ubiquitinated by Rsp5 (36). The PPxY and arrestin motif of Bul proteins are required 388
for ammonium-induced ubiquitination of Gap1. The role of Bul proteins in Gap1 389
ubiquitination is in sharp contrast to their dispensability in pressure-induced Tat1 degradation. 390
It is known that the 14-3-3 proteins and Rod1/Art4 coordinately regulate ubiquitination of 391
lactate transporter Jen1 (37). Whether the pressure-induced Tat1 degradation also involves 392
phosphorylation/dephosphorylation of any arrestins is unknown. 393
It is evident that there are considerable differences in the way plasma membrane 394
transporters are regulated through the functions of PPxY-motif proteins and Rsp5 in response 395
to a broad range of environmental cues. A specific distinction that sets hydrostatic pressure 396
apart from other cues, such as nutrients, salt, urea, or organic solvents, is that pressure merely 397
changes the equilibria among preexisting components depending on the magnitude of volume 398
changes (38, 39). Thus, hydrostatic pressure can bring minor elements out of the background 399
noise and into the foreground for direct observation and study. In this sense, ubiquitination 400
and/or endocytosis of Tat1 occur at an extremely slow rate under normal growth conditions at 401
atmospheric pressure but it becomes possible to analyze them at high hydrostatic pressures, 402
probably because the rate-limiting step in the degradation of Tat1 is accompanied by a large 403
negative volume change. 404
on January 3, 2021 by guesthttp://ec.asm
.org/D
ownloaded from
![Page 16: 10...2013/05/08 · Bul1 and Bul2 are the 86 PPxY-motif proteins that bind to Rsp5 by interacting with the WW domain (21), (22). 87 Deletion of BUL1 and BUL2 causes marked stabilization](https://reader034.vdocuments.site/reader034/viewer/2022051902/5ff22e7e74fbdc2a290f2690/html5/thumbnails/16.jpg)
16
405
ACKNOWLEDGEMENTS 406
We thank Hugh R. B. Pelham for providing yeast strains; Takashi Ushimaru for GFP 407
plasmids; Yoichi Noda for valuable suggestions; Hiroki Deguchi and Mai Nagata for technical 408
assistances. This work was supported by a grant from the Japan Society for the Promotion of 409
Science (No. 22658031 to F. Abe). 410
411
REFERENCES 412
413
1. Nelissen B, De Wachter R, Goffeau A. 1997. Classification of all putative permeases and 414
other membrane plurispanners of the major facilitator superfamily encoded by the 415
complete genome of Saccharomyces cerevisiae. FEMS Microbiol. Rev. 21: 113-134. 416
2. Sophianopoulou V, Diallinas G. 1995. Amino acid transporters of lower eukaryotes: 417
Regulation, structure and topogenesis. FEMS Microbiol. Rev. 16: 53-75. 418
3. Lauwers E, Erpapazoglou Z, Haguenauer-Tsapis R, Andre B. 2010. The ubiquitin code 419
of yeast permease trafficking. Trends Cell Biol. 20: 196-204. 420
4. Heitman J, Koller A, Kunz J, Henriquez R, Schmidt A, Movva NR, Hall MN. 1993. 421
The immunosuppressant FK506 inhibits amino acid import in Saccharomyces cerevisiae.. 422
Mol. Cell. Biol.13: 5010-5019. 423
5. Schmidt A, Beck T, Koller A, Kunz J, Hall MN. 1998. The TOR nutrient signalling 424
pathway phosphorylates NPR1 and inhibits turnover of the tryptophan permease. EMBO J. 425
17: 6924-6931. 426
6. Beck T, Schmidt A, Hall MN. 1999. Starvation induces vacuolar targeting and degradation 427
of the tryptophan permease in yeast. J. Cell Biol. 146: 1227-1238. 428
7. Umebayashi K, Nakano A. 2003. Ergosterol is required for targeting of tryptophan 429
permease to the yeast plasma membrane. J. Cell Biol.161: 1117-1131. 430
8. Daicho K, Makino N, Hiraki T, Ueno M, Uritani M, Abe F, Ushimaru T. 2009. Sorting 431
defects of the tryptophan permease Tat2 in an erg2 yeast mutant. FEMS Microbiol. Lett. 432
298: 218-227. 433
9. Okamoto M, Yoko-o T, Umemura M, Nakayama K, Jigami Y. 2006. 434
Glycosylphosphatidylinositol-anchored proteins are required for the transport of 435
detergent-resistant microdomain-associated membrane proteins Tat2p and Fur4p. J. Biol. 436
on January 3, 2021 by guesthttp://ec.asm
.org/D
ownloaded from
![Page 17: 10...2013/05/08 · Bul1 and Bul2 are the 86 PPxY-motif proteins that bind to Rsp5 by interacting with the WW domain (21), (22). 87 Deletion of BUL1 and BUL2 causes marked stabilization](https://reader034.vdocuments.site/reader034/viewer/2022051902/5ff22e7e74fbdc2a290f2690/html5/thumbnails/17.jpg)
17
Chem. 281: 4013-4023. 437
10. Abe F, Horikoshi K. 2000. Tryptophan permease gene TAT2 confers high-pressure 438
growth in Saccharomyces cerevisiae.. Mol. Cell. Biol. 20: 8093-8102. 439
11. Abe F, Iida H. 2003. Pressure-induced differential regulation of the two tryptophan 440
permeases Tat1 and Tat2 by ubiquitin ligase Rsp5 and its binding proteins, Bul1 and Bul2. 441
Mol. Cell. Biol. 23: 7566-7584. 442
12. Nagayama A, Kato C, Abe F. 2004. The N- and C-terminal mutations in tryptophan 443
permease Tat2 confer cell growth in Saccharomyces cerevisiae. under high-pressure and 444
low-temperature conditions. Extremophiles 8: 143-149. 445
13. Winter R. 2002. Synchrotron X-ray and neutron small-angle scattering of lyotropic lipid 446
mesophases, model biomembranes and proteins in solution at high pressure. Biochim. 447
Biophys. Acta 1595: 160-184. 448
14. Winter R, Dzwolak W. 2005. Exploring the temperature-pressure configurational 449
landscape of biomolecules: From lipid membranes to proteins. Philos. Transact A. Math. 450
Phys. Eng. Sci. 363: 537-62; discussion 562-563. 451
15. Matsuki H, Goto M, Tada K, Tamai N. 2013. Thermotropic and barotropic phase 452
behavior of phosphatidylcholine bilayers. Int. J. Mol. Sci. 14: 2282-2302. 453
16. Liu M, Brusilow WS, Needleman R. 2004. Activity of the yeast Tat2p tryptophan 454
permease is sensitive to the anti-tumor agent 4-phenylbutyrate. Curr. Genet. 46: 256-268. 455
17. Palmer LK, Wolfe D, Keeley JL, Keil RL. 2002. Volatile anesthetics affect nutrient 456
availability in yeast. Genetics 161: 563-574. 457
18. Skrzypek MS, Nagiec MM, Lester RL, Dickson RC. 1998. Inhibition of amino acid 458
transport by sphingoid long chain bases in Saccharomyces cerevisiae. J. Biol. Chem. 273: 459
2829-2834. 460
19. Abe F. 2004. Piezophysiology of yeast: Occurrence and significance. Cell. Mol. Biol. 461
(Noisy-le-grand) 50: 437-445. 462
20. Abe F. 2007. Exploration of the effects of high hydrostatic pressure on microbial growth, 463
physiology and survival: Perspectives from piezophysiology. Biosci. Biotechnol. 464
Biochem.71: 2347-2357. 465
21. Yashiroda H, Oguchi T, Yasuda Y, Toh-E A, Kikuchi Y. 1996. Bul1, a new protein that 466
binds to the Rsp5 ubiquitin ligase in Saccharomyces cerevisiae. Mol. Cell. Biol.16: 467
3255-3263. 468
22. Yashiroda H, Kaida D, Toh-e A, Kikuchi Y. 1998. The PY-motif of Bul1 protein is 469
on January 3, 2021 by guesthttp://ec.asm
.org/D
ownloaded from
![Page 18: 10...2013/05/08 · Bul1 and Bul2 are the 86 PPxY-motif proteins that bind to Rsp5 by interacting with the WW domain (21), (22). 87 Deletion of BUL1 and BUL2 causes marked stabilization](https://reader034.vdocuments.site/reader034/viewer/2022051902/5ff22e7e74fbdc2a290f2690/html5/thumbnails/18.jpg)
18
essential for growth of Saccharomyces cerevisiae under various stress conditions. Gene 470
225: 39-46. 471
23. Lin CH, MacGurn JA, Chu T, Stefan CJ, Emr SD. 2008. Arrestin-related 472
ubiquitin-ligase adaptors regulate endocytosis and protein turnover at the cell surface. Cell 473
135: 714-725. 474
24. MacGurn JA, Hsu PC, Smolka MB, Emr SD. 2011. TORC1 regulates endocytosis via 475
Npr1-mediated phosphoinhibition of a ubiquitin ligase adaptor. Cell 147: 1104-1117. 476
25. Hatakeyama R, Kamiya M, Takahara T, Maeda T. 2010. Endocytosis of the aspartic 477
acid/glutamic acid transporter Dip5 is triggered by substrate-dependent recruitment of the 478
Rsp5 ubiquitin ligase via the arrestin-like protein Aly2. Mol. Cell. Biol. 30: 5598-5607. 479
26. Nikko E, Pelham HR. 2009. Arrestin-mediated endocytosis of yeast plasma membrane 480
transporters. Traffic 10: 1856-1867. 481
27. Leon S, Haguenauer-Tsapis R. 2009. Ubiquitin ligase adaptors: Regulators of 482
ubiquitylation and endocytosis of plasma membrane proteins. Exp. Cell Res. 315: 483
1574-1583. 484
28. Becuwe M, Herrador A, Haguenauer-Tsapis R, Vincent O, Leon S. 2012. 485
Ubiquitin-mediated regulation of endocytosis by proteins of the arrestin family. Biochem. 486
Res. Int. 2012: 242764. 487
29. Sikorski RS, Hieter P. 1989. A system of shuttle vectors and yeast host strains designed 488
for efficient manipulation of DNA in Saccharomyces cerevisiae. Genetics 122: 19-27. 489
30. Gietz RD, Sugino A. 1988. New yeast-escherichia coli shuttle vectors constructed with in 490
vitro mutagenized yeast genes lacking six-base pair restriction sites. Gene 74: 527-534. 491
31. Hiraki T, Abe F. 2010. Overexpression of Sna3 stabilizes tryptophan permease Tat2, 492
potentially competing for the WW domain of Rsp5 ubiquitin ligase with its binding protein 493
Bul1. FEBS Lett. 584: 55-60. 494
32. Tusnady GE, Simon I. 1998. Principles governing amino acid composition of integral 495
membrane proteins: Application to topology prediction. J. Mol. Biol. 283: 489-506. 496
33. Tusnady GE, Simon I. 2001. The HMMTOP transmembrane topology prediction server. 497
Bioinformatics 17: 849-850. 498
34. Hesselberth JR, Miller JP, Golob A, Stajich JE, Michaud GA, Fields S. 2006. 499
Comparative analysis of Saccharomyces cerevisiae WW domains and their interacting 500
proteins. Genome Biol.7: R30. 501
35. Grossmann G, Malinsky J, Stahlschmidt W, Loibl M, Weig-Meckl I, Frommer WB, 502
on January 3, 2021 by guesthttp://ec.asm
.org/D
ownloaded from
![Page 19: 10...2013/05/08 · Bul1 and Bul2 are the 86 PPxY-motif proteins that bind to Rsp5 by interacting with the WW domain (21), (22). 87 Deletion of BUL1 and BUL2 causes marked stabilization](https://reader034.vdocuments.site/reader034/viewer/2022051902/5ff22e7e74fbdc2a290f2690/html5/thumbnails/19.jpg)
19
Opekarova M, Tanner W. 2008. Plasma membrane microdomains regulate turnover of 503
transport proteins in yeast. J. Cell Biol. 183: 1075-1088. 504
36. Merhi A, Andre B. 2012. Internal amino acids promote Gap1 permease ubiquitylation via 505
TORC1/Npr1/14-3-3-dependent control of the bul arrestin-like adaptors. Mol. Cell. 506
Biol.32: 4510-4522. 507
37. Becuwe M, Vieira N, Lara D, Gomes-Rezende J, Soares-Cunha C, Casal M, 508
Haguenauer-Tsapis R, Vincent O, Paiva S, Leon S. 2012. A molecular switch on an 509
arrestin-like protein relays glucose signaling to transporter endocytosis. J. Cell Biol. 196: 510
247-259. 511
38. Balny C, Masson P, Heremans K. 2002. High pressure effects on biological 512
macromolecules: From structural changes to alteration of cellular processes. Biochim. 513
Biophys. Acta 1595: 3-10. 514
39. Lassalle MW, Akasaka K. 2007. The use of high-pressure nuclear magnetic resonance to 515
study protein folding. Methods Mol. Biol. 350: 21-38. 516
517
518
on January 3, 2021 by guesthttp://ec.asm
.org/D
ownloaded from
![Page 20: 10...2013/05/08 · Bul1 and Bul2 are the 86 PPxY-motif proteins that bind to Rsp5 by interacting with the WW domain (21), (22). 87 Deletion of BUL1 and BUL2 causes marked stabilization](https://reader034.vdocuments.site/reader034/viewer/2022051902/5ff22e7e74fbdc2a290f2690/html5/thumbnails/20.jpg)
20
FIGURE LEGENDS 519
FIG. 1. Endocytotic degradation of Tat1 in response to high pressure. (A) The wild-type 520
cells were exposed to cycloheximide (CHX, 100 μg/mL) or pressure of 25 MPa (HP) for 3 h. 521
The whole cell extracts were prepared for Western blotting analysis using anti-HA antibody to 522
detect the 3HA-Tat1 proteins. Relative amounts of 3HA-Tat1 to Adh1 were calculated from 523
the signals detected in an ImageQuant LAS4000 mini. Arrowheads denote the higher 524
molecular-weight bands of 3HA-Tat1. (B) The wild-type and the end3Δ cells were exposed to 525
pressure of 25 MPa for 3 h. The P13 and P100 membranes were collected from the whole cell 526
extracts (W) by differential centrifugation. Adh1 and Pma1 were used as loading controls for 527
the whole cell extracts and the P13 membranes, respectively. Dpm1 was used as a loading 528
control for both P13 and P100 membranes. 529
530
FIG. 2. Determination of lysine residues required for ubiquitin-dependent Tat1 degradation. 531
The 3HA-Tat1 proteins with multiple (A) or single or double (B) K>R substitutions were 532
visualized by Western blotting analysis using anti-HA antibody. The AS numbers are listed in 533
Table 2. Asterisks denote plasmids containing either the K29R or K31R substitution (*) or 534
both K29R and K31R substitutions (**). Arrowheads denote the higher molecular-weight 535
bands of 3HA-Tat1. (C) The wild-type cells expressing the 3HA-Tat1 proteins with single or 536
multiple K>R substitutions were exposed to pressure of 25 MPa for 3 h. The whole cell 537
extracts were prepared for Western blotting analysis to detect the variant 3HA-Tat1 proteins. 538
Adh1 was used as a loading control. 539
540
FIG. 3. Intracellular localization of Tat1 and Tat1K29R-K31R under atmospheric pressure or high 541
pressure. The wild-type cells were transformed with the centromeric plamsmid 542
p3HA-TAT1-GFPc or p3HA-TAT1-K29R-K31R-GFPc. The GFP-tagged Tat1 proteins were 543
visualized under fluorescence microscopy after the cells were incubated at 0.1 MPa or 25 544
MPa for 3 h. 545
on January 3, 2021 by guesthttp://ec.asm
.org/D
ownloaded from
![Page 21: 10...2013/05/08 · Bul1 and Bul2 are the 86 PPxY-motif proteins that bind to Rsp5 by interacting with the WW domain (21), (22). 87 Deletion of BUL1 and BUL2 causes marked stabilization](https://reader034.vdocuments.site/reader034/viewer/2022051902/5ff22e7e74fbdc2a290f2690/html5/thumbnails/21.jpg)
21
546
FIG. 4. The role of the Rsp5 WW domain and the multiple PPxY proteins in Tat1 degradation 547
responding to high pressure. (A) Cells of the wild-type, HPG1-1, rsp5-ww1, rsp5-ww2, 548
rsp5-ww3 and bul1Δbul2Δ strains were exposed to pressure of 25 MPa for 3 h. (B) Cells of 549
the wild-type and art single deletion mutants were exposed to pressure of 25 MPa for 3 h. (C) 550
Left, Cells of the wild-type (BY4742), 9-arrestin (EN60), and 9-arrestin bul1Δbul2Δ (EN67) 551
strains were exposed to pressure of 25 MPa for 3 h. The whole cell extracts were prepared for 552
Western blotting analysis to detect the variant 3HA-Tat1 proteins. Adh1 was used as a loading 553
control. Right, Relative amounts of 3HA-Tat1 to Adh1 were calculated from the signals 554
detected in an ImageQuant LAS4000 mini. Data are shown as mean ± standard deviation 555
from three independent experiments. 556
557
on January 3, 2021 by guesthttp://ec.asm
.org/D
ownloaded from
![Page 22: 10...2013/05/08 · Bul1 and Bul2 are the 86 PPxY-motif proteins that bind to Rsp5 by interacting with the WW domain (21), (22). 87 Deletion of BUL1 and BUL2 causes marked stabilization](https://reader034.vdocuments.site/reader034/viewer/2022051902/5ff22e7e74fbdc2a290f2690/html5/thumbnails/22.jpg)
Table 1. Strains used in this study
Strain Genotype Source or reference
YPH499 (Wild type) MATa ura3-52 lys2-801 ade2-101 trp1-Δ63 his3-Δ200 leu2-Δ1 29
FAM1 MATa ura3-52 lys2-801 ade2-101 trp1-Δ63 his3-Δ200 leu2-Δ1 end3Δ::URA3 This study
FAY18A MATa ura3-52 lys2-801 ade2-101 trp1-Δ63 his3-Δ200 leu2-Δ1 HPG1-1 (Rsp5P514T) 11
FAJ75 MATa ura3-52 lys2-801 ade2-101 trp1-Δ63 his3-Δ200 leu2-Δ1 bul1Δ::HIS3 bul2Δ::LEU2 11
FAS626 MATa ura3-52 lys2-801 ade2-101 trp1-Δ63 his3-Δ200 leu2-Δ1 rsp5-ww1 (Rsp5W257G) This study
FAS630 MATa ura3-52 lys2-801 ade2-101 trp1-Δ63 his3-Δ200 leu2-Δ1 rsp5-ww2 (Rsp5W359G) This study
FAS634 MATa ura3-52 lys2-801 ade2-101 trp1-Δ63 his3-Δ200 leu2-Δ1 rsp5-ww3 (Rsp5W451G) 31
FAS510 MATa ura3-52 lys2-801 ade2-101 trp1-Δ63 his3-Δ200 leu2-Δ1 art1Δ::KanMX This study
FAS511 MATa ura3-52 lys2-801 ade2-101 trp1-Δ63 his3-Δ200 leu2-Δ1 art2Δ::KanMX This study
FAS516 MATa ura3-52 lys2-801 ade2-101 trp1-Δ63 his3-Δ200 leu2-Δ1 art3Δ::KanMX This study
FAS519 MATa ura3-52 lys2-801 ade2-101 trp1-Δ63 his3-Δ200 leu2-Δ1 art4Δ::KanMX This study
FAS523 MATa ura3-52 lys2-801 ade2-101 trp1-Δ63 his3-Δ200 leu2-Δ1 art5Δ::KanMX This study
FAS526 MATa ura3-52 lys2-801 ade2-101 trp1-Δ63 his3-Δ200 leu2-Δ1 art6Δ::KanMX This study
FAS532 MATa ura3-52 lys2-801 ade2-101 trp1-Δ63 his3-Δ200 leu2-Δ1 art7Δ::KanMX This study
FAS535 MATa ura3-52 lys2-801 ade2-101 trp1-Δ63 his3-Δ200 leu2-Δ1 art8Δ::KanMX This study
BY4742 (Wild type) MATα his3Δ1 leu2Δ0 lys2Δ0 ura3Δ0 EUROSCARF
EN60 (9-arrestin) MATα his3Δ1 leu2Δ0 lys2Δ0 ura3Δ0 art1Δ art2Δ art3Δ art4Δ art5Δ art6Δ art7Δ art8Δ art10Δ 26
EN67 (9-arrestin bul1bul2) MATα his3Δ1 leu2Δ0 lys2Δ0 ura3Δ0 art1Δ art2Δ art3Δ art4Δ art5Δ art6Δ art7Δ art8Δ art10Δ bul1Δ bul2Δ 26
on January 3, 2021 by guesthttp://ec.asm
.org/D
ownloaded from
![Page 23: 10...2013/05/08 · Bul1 and Bul2 are the 86 PPxY-motif proteins that bind to Rsp5 by interacting with the WW domain (21), (22). 87 Deletion of BUL1 and BUL2 causes marked stabilization](https://reader034.vdocuments.site/reader034/viewer/2022051902/5ff22e7e74fbdc2a290f2690/html5/thumbnails/23.jpg)
Table 2. Plasmids used in this study
Plasmid Description Source or reference
YCplac33 URA3 CEN4 30
YCplac111 LEU2 CEN4 30
p3HA-TAT1c 3HA-TAT1 driven by TAT1 promoter in YCplac33 11
p3HA-TAT1c-LEU 3HA-TAT1 driven by TAT1 promoter in YCplac111 This study
p3HA-TAT1-AS1c 3HA-TAT1-K10, 39R in p3HA-TAT1c This study
p3HA-TAT1-AS2c 3HA-TAT1-K10, 39, 71R in p3HA-TAT1c This study
p3HA-TAT1-AS3c 3HA-TAT1-K10, 39, 56, 71R in p3HA-TAT1c This study
p3HA-TAT1-AS4c 3HA-TAT1-K10, 39, 56, 71, 87R in p3HA-TAT1c This study
p3HA-TAT1-AS5c 3HA-TAT1-K10, 29, 31, 39, 56, 71R in p3HA-TAT1c This study
p3HA-TAT1-AS6c 3HA-TAT1-K10, 29, 31, 39, 56, 71, 87R in p3HA-TAT1c This study
p3HA-TAT1-AS7c 3HA-TAT1-K10, 29, 31, 39, 56, 71, 87, 95R in p3HA-TAT1c This study
p3HA-TAT1-AS8c 3HA-TAT1-K10, 29, 31, 39 ,56, 62, 64, 71, 87R in p3HA-TAT1c This study
p3HA-TAT1-AS9c 3HA-TAT1-K10, 29, 31, 39, 56, 71, 87, 92, 95R in p3HA-TAT1c This study
p3HA-TAT1-AS10c 3HA-TAT1-K10, 29, 31, 39, 56, 64, 71, 87, 92, 95R in p3HA-TAT1c This study
p3HA-TAT1-AS11c 3HA-TAT1-K10, 29, 31, 39, 56, 62, 64, 71, 87, 92, 95R (11K>R) in p3HA-TAT1c This study
p3HA-TAT1-AS12c 3HA-TAT1-K10R in p3HA-TAT1c This study
p3HA-TAT1-AS13c 3HA-TAT1-K29R in p3HA-TAT1c This study
p3HA-TAT1-AS14c 3HA-TAT1-K31R in p3HA-TAT1c This study
p3HA-TAT1-AS15c 3HA-TAT1-K39R in p3HA-TAT1c This study
p3HA-TAT1-AS16c 3HA-TAT1-K56R in p3HA-TAT1c This study
p3HA-TAT1-AS17c 3HA-TAT1-K39R-K56R in p3HA-TAT1c This study
p3HA-TAT1-AS18c 3HA-TAT1-K29R-K31R in p3HA-TAT1c This study
p3HA-TAT1-AS19c 3HA-TAT1-K10R-K29R-K31R in p3HA-TAT1c This study
pSCU709 13c-Myc-GFP (URA3 2 μ) Provided by T. Ushimaru
p3HA-TAT1-GFPc 3HA-TAT1-13c-Myc-GFP driven by TAT1 promoterin YCplac33 This study
p3HA-TAT1-K29R-K31R-GFPc 3HA-TAT1-K29R-K31R-13c-Myc-GFP driven by TAT1 promoter in YCplac33 This study
on January 3, 2021 by guesthttp://ec.asm
.org/D
ownloaded from
![Page 24: 10...2013/05/08 · Bul1 and Bul2 are the 86 PPxY-motif proteins that bind to Rsp5 by interacting with the WW domain (21), (22). 87 Deletion of BUL1 and BUL2 causes marked stabilization](https://reader034.vdocuments.site/reader034/viewer/2022051902/5ff22e7e74fbdc2a290f2690/html5/thumbnails/24.jpg)
A CHX HPA CHX HP
0 3 0 3
Tat1
Time (h)
Adh1
Tat1(over
exposure)
WT end3ΔB
(%)100 83 100 27Tat1/Adh1
W P13 P100 W P13 P100 W P13 P100 W P13 P100
0.1 MPa 25 MPa 0.1 MPa 25 MPa
WT end3ΔB
Tat1
Pma1Pma1
Dpm1
Fig. 1. Suzuki et al.
on January 3, 2021 by guesthttp://ec.asm
.org/D
ownloaded from
![Page 25: 10...2013/05/08 · Bul1 and Bul2 are the 86 PPxY-motif proteins that bind to Rsp5 by interacting with the WW domain (21), (22). 87 Deletion of BUL1 and BUL2 causes marked stabilization](https://reader034.vdocuments.site/reader034/viewer/2022051902/5ff22e7e74fbdc2a290f2690/html5/thumbnails/25.jpg)
ATat1(over
exposure)
Adh1
BB
Tat1(over
exposure)
Adh1
WT K10R K29R K31R K39R K56R K31R K56R K31R 11K>RK29R- K39- K29R-C K10R-
0.1 25 0.1 25 0.1 25 0.1 25 0.1 25 0.1 25 0.1 25 0.1 25 0.1 25 0.1 25 Pressure(MPa)
WT K10R K29R K31R K39R K56R K31R K56R K31R 11K>R
Tat1
Adh1
Fig. 2. Suzuki et al.
on January 3, 2021 by guesthttp://ec.asm
.org/D
ownloaded from
![Page 26: 10...2013/05/08 · Bul1 and Bul2 are the 86 PPxY-motif proteins that bind to Rsp5 by interacting with the WW domain (21), (22). 87 Deletion of BUL1 and BUL2 causes marked stabilization](https://reader034.vdocuments.site/reader034/viewer/2022051902/5ff22e7e74fbdc2a290f2690/html5/thumbnails/26.jpg)
Tat1-GFP Tat1K29R-K31R-GFPDICGFP DICGFP
0.1 MPa
GFP DICGFP
25 MPa
DIC
Fig. 3. Suzuki et al.
on January 3, 2021 by guesthttp://ec.asm
.org/D
ownloaded from
![Page 27: 10...2013/05/08 · Bul1 and Bul2 are the 86 PPxY-motif proteins that bind to Rsp5 by interacting with the WW domain (21), (22). 87 Deletion of BUL1 and BUL2 causes marked stabilization](https://reader034.vdocuments.site/reader034/viewer/2022051902/5ff22e7e74fbdc2a290f2690/html5/thumbnails/27.jpg)
A HPG1-1 ww1 ww2 ww3rsp5
bul1Δbul2ΔWTP
0.1 25 0.1 25 0.1 25 0.1 25 0.1 25 0.1 25
Tat1
Pressure(MPa)
WT art1Δ art2Δ art3Δ art4Δ art5Δ art6Δ art7Δ art8ΔB
Adh1
0.1 25 0.1 25 0.1 25 0.1 25 0.1 25 0.1 25 0.1 25 0.1 25 0.1 25
T t1
Pressure(MPa)
Tat1
Adh1
WT 9-arrestin
0.1 25 0.1 25 0.1 25
9-arrestinbul1Δbul2Δ
Pressure(MPa)
C
ou
nt
(%)
Tat1
Adh1
Rel
ativ
e am
o
Fig. 4. Suzuki et al.
0.1 25 0.1 25 0.1 25
WT 9-arrestin 9-arrestinbul1Δbul2Δ
Pressure(MPa)
on January 3, 2021 by guesthttp://ec.asm
.org/D
ownloaded from