1-s2.0-s1055790304000326-main

7/28/2019 1-s2.0-S1055790304000326-main

1/18

Distribution of introns in the mitochondrial gene nad1 in landplants: phylogenetic and molecular evolutionary implications

Olena Dombrovska and Yin-Long Qiu*

Department of Ecology and Evolutionary Biology, University of Michigan, 830 North University Avenue, Ann Arbor, MI 48109-1048, USA

Institute of Systematic Botany, University of Zurich, Zollikerstrasse 107, 8008 Zurich, Switzerland

Received 22 July 2003; revised 17 December 2003

Available online 27 February 2004

Abstract

Forty-six species of diverse land plants were investigated by sequencing for their intron content in the mitochondrial gene nad1. A

total of seven introns, all belonging to group II, were found, and two were newly discovered in this study. All 13 liverworts examined

contain no intron, the same condition as in green algae. Mosses and hornworts, however, share one intron by themselves and

another one with vascular plants. These intron distribution patterns are consistent with the hypothesis that liverworts represent the

basal-most land plants and that the two introns were gained in the common ancestor of mosseshornwortsvascular plants after

liverworts had diverged. Hornworts also possess a unique intron of their own. A fourth intron was found only in Equisetum L.,

Marattiaceae, Ophioglossum L., Osmunda L., Asplenium L., and Adiantum L., and was likely acquired in their common ancestor,

which supports the monophyly of moniliformopses. Three introns that were previously characterized in angiosperms and a few

pteridophytes are now all extended to lycopods, and were likely gained in the common ancestor of vascular plants. Phylogenetic

analyses of the intron sequences recovered topologies mirroring those of the plants, suggesting that the introns have all been

vertically inherited. All seven nad1 group II introns show broad phylogenetic distribution patterns, with the narrowest being in

moniliformopses and hornworts, lineages that date back to at least the Devonian (345 million years ago) and Silurian (435 million

years ago), respectively. Hence, these introns must have invaded the genes via ancient transpositional events during the early stage of

land plant evolution. Potentially heavy RNA editing was observed in nad1 of Haplomitrium Dedecek, Takakia Hatt. & Inoue,

hornworts, Isoetes L., Ophioglossum, and Asplenium. A new nomenclature is proposed for group II introns.

2004 Elsevier Inc. All rights reserved.

Keywords: Genomic structural characters; Group II introns; Intron nomenclature; Land plant phylogeny; Mitochondrial DNA;nad1; RNA editing

1. Introduction

Evolution of land plants (embryophytes) fundamen-

tally altered the terrestrial ecosystem and set the stage

for evolution of other land-dwelling life (Gensel and

Edwards, 2001; Graham, 1993; Kenrick and Crane,

1997a). A large number of paleobotanical, morpholog-

ical, and molecular studies have been devoted to un-

derstanding this important event in the history of life on

earth. However, our knowledge on radiation of early

land plants remains incomplete, and in particular several

key questions regarding basal land plant phylogeny are

still controversial. These include: what represents the

first lineage of land plants, which bryophyte group is

sister to vascular plants, and how are several extant

pteridophyte lineages related to each other (Edwards

et al., 1995; Hedderson et al., 1998; Kenrick and Crane,

1997b; Lewis et al., 1997; Mishler et al., 1994; Nickrent

et al., 2000; Nishiyama and Kato, 1999; Pryer et al.,

2001; Qiu et al., 1998; Renzaglia et al., 2000; Samigullin

et al., 2002; Taylor, 1995; Wellman et al., 2003)? Clearly,

more data are needed to resolve these issues.

The mitochondrial genome in land plants is a rich

source of information to investigate plant phylogeny

(Beckert et al., 1999, 2001; Qiu et al., 1998, 1999; Vange-

row et al., 1999). Two sets of introns have been found in

angiosperms (Kubo et al.,2000; Notsu et al.,2002; Unseld

et al., 1997) and the liverwort Marchantia polymorpha

(Oda et al., 1992), respectively. Most of the angiosperm

* Corresponding author. Fax: 1-734-764-0544.

E-mail address: [email protected] (Y.-L. Qiu).

1055-7903/$ - see front matter 2004 Elsevier Inc. All rights reserved.

doi:10.1016/j.ympev.2003.12.013

Molecular Phylogenetics and Evolution 32 (2004) 246263

MOLECULAR

PHYLOGENETICS

AND

EVOLUTION

www.elsevier.com/locate/ympev
http://mail%20to:%[email protected]/http://mail%20to:%[email protected]/http://mail%20to:%[email protected]/

7/28/2019 1-s2.0-S1055790304000326-main

2/18

introns are now known to extend their presence to gym-

nosperms, pteridophytes, and even hornworts, mosses, or

liverworts (Beckert et al., 1999, 2001; Gugerli et al., 2001;

Hashimoto and Sato, 2001; Malek and Knoop, 1998;

Malek et al., 1997; Pruchner et al., 2001, 2002; Qiu et al.,

1998). Theintrondistributionpatternscan be used to infer

phylogenetic relationships among basal lineages of landplants, given that conservative genomic structural

changes have proven to be informative markers in re-

solving difficult phylogenetic issues (Manhart and Pal-

mer, 1990; Raubeson and Jansen, 1992).

The plant mitochondrial gene nad1 contains four

group II introns in angiosperms (Chapdelaine and Bo-

nen, 1991; Conklin et al., 1991; Kubo et al., 2000; Notsu

et al., 2002; Unseld et al., 1997; Wissinger et al., 1991),

but none in Marchantia (Oda et al., 1992) nor in several

green algae that have been sequenced for their mito-

chondrial genomes: Prototheca wickerhamii(Wolff et al.,

1994), Chlorogonium elongatum (Kroymann and Zet-

sche, 1998), Nephroselmis olivacea and Pedinomonas

minor (Turmel et al., 1999), Scenedesmus obliquus (Kuck

et al., 2000; Nedelcu et al., 2000), Mesostigma viride

(Turmel et al., 2002a), Chaetosphaeridium globosum

(Turmel et al., 2002b), Chara vulgaris (Turmel et al.,

2003), and Chlamydomonas reinhardtii [M.W. Gray,

unpublished data (GenBank Accession No. U03843);

one group I intron has been reported in Chlamydomonas

eugametos nad1 (Denovan-Wright et al., 1998)]. The first

three angiosperm introns have been shown to be present

in a few basal pteridophytes (Gugerli et al., 2001; Malek

and Knoop, 1998), and the last one is present

throughout land plants except liverworts (Qiu et al.,1998). An additional group II intron, located upstream

of the first angiosperm intron, has been found in the

moss Ceratodon purpureus (Malek and Knoop, 1998).

However, the information on the full intron content in

nad1 across land plants, especially in bryophytes, is still

lacking. It would be desirable to obtain this information

to trace origins of these introns, to test whether they

follow vertical inheritance or undergo horizontal trans-

fer, and to examine their frequency of secondary losses.

Understanding evolution of these introns will not only

ensure their proper use as phylogenetic markers, but

also will help us to gain insight into their role in shaping

evolution of the mitochondrial genome in land plants.

In this study, we carry out a broad survey of intron

distribution in nad1 in land plants by sequencing the

nearly entire length of the gene, with particularly dense

taxon sampling in liverworts, mosses, and hornworts.

We aim to uncover phylogenetically informative intron

distribution patterns to resolve relationships among

basal land plant lineages. We also seek to understand

the tempo and mode of intron evolution in mitochon-

drial genomes of early land plants, as a relatively large

body of data is now available from both mitochondrial

genome sequencing studies and evolutionary surveys.

2. Materials and methods

2.1. DNA extraction, gene amplification and sequencing,

intron secondary structure modeling

Materials for 46 representatives of all major non-

flowering land plant lineages, including 12 liverworts, 19mosses, four hornworts, two lycopods, eight monili-

formopses (sensu Kenrick and Crane, 1997b, including

Equisetum, Psilotaceae, and ferns), and one gymno-

sperm were collected in the field or greenhouses, care-

fully identified, and properly vouchered (Table 1). All

bryophytes were cleaned and checked under a dissecting

scope to avoid contamination. The voucher information

and GenBank accession numbers are given in Table 1.

The green algae (see Figs. 1 and 2) were used as out-

groups for comparing intron content and timing the

evolutionary origins of the introns in nad1. Total cellu-

lar DNAs were extracted using the cetyltrimethylam-

monium bromide (CTAB) method (Doyle and Doyle,

1987), with 2% polyvinyl pyrrolidone, 0.1% diet-

hyldithiocarbamic acid (sodium salt), and 0.1% ascorbic

acid added, or alternatively using the Plant DNAeasy

kit (Qiagen) according to the manufacturers protocol.

Multiple sets of primers were tested to circumvent any

potential problems caused by direct and reverse RNA-

editing at priming sites, and they are listed in Table 2.

Where possible, a single amplicon was recovered for the

gene. In some species, where the size of nad1 (including

both exons and introns) exceeded the capacity of con-

ventional PCR methods, the gene was amplified and se-

quenced in several overlapping fragments and the nad1gene contig was assembled subsequently. PCR amplifi-

cation reactions contained approximately 10 ng template

DNA, 10 mM Tris/HCl (pH 8.85), 25 mM KCl, 5 mM

(NH4)2SO4, 2 mM MgSO4, 200 lM each dNTP, 0.20 lg

each primer, and 2.0 U Taq DNA polymerase (Qiagen) in

a final volume of 50 ll. The reactions were carried out

using 30 cycles, each consisting of 30 s denaturation at

94 C, 30 s annealing at 52 C, and 14 min extension at

72 C. The first cycle was preceded by an initial denatur-

ation step (4min, 94 C), and the last one was followed by

a 12 min extension step at 72 C. Alternatively, for am-

plifying fragments larger than 3.5 kb, the Expand Long

Template PCR-System (BoehringerMannheim) was

used, following the protocol supplied by the manufac-

turer. PCR fragments, depending on their size, were

cloned with TA-TOPO or XL-TOPO cloning kits (Invit-

rogen). Positive clones were sequenced in both directions

using ABI Prism BigDye Terminator Cycle Sequencing

Ready Reaction Kits on an ABI377 sequencer (both from

Applied Biosystems). M13 universal primers and those

designed to match internal sequences of cloned fragments

(Table 2) were used during sequencing. Sequence

processing and contig assembly were done using the

Sequencher program (Gene Codes Corporation).

O. Dombrovska, Y.-L. Qiu / Molecular Phylogenetics and Evolution 32 (2004) 246263 247

7/28/2019 1-s2.0-S1055790304000326-main

3/18

Table 1

Plant material used in this study, intron presence (+) or absence ()) in the mitochondrial gene nad1, and GenBank accession number of the sequence

Species Vouchera Accession No.

nad1, one

accession #

nad1i258 nad1i287 nad1i 348 nad1i394 nad1i

GymnospermsCycas revoluta Thunb. Qiu94051 + AY

Moniliformopses

Asplenium nidus L. Qiu94081 AY354954 + ) ) + )

Adiantum sp. Qiu95118 AY354953 + ) ) + )

Osmunda regalis L. Qiu96171 + AY

Ophioglossum lusitanicum L. Qiu98097 +AY354943 ) AY354943 ) AY354943 ) AY354943 + AY

AY35

Marattia attenuata Lab. Qiu96169 +AY354948 ) AY354948 ) AY354948 +AY354948 + AY

Angiopteris evecta (G.Forst.) Hoffm. Qiu96170 +AY354947 ) AY354947 ) AY354947 +AY354947 + AY

Equisetum arvense L. Qiu94003 AY354940 + ) ) + )

Psilotum nudum (L.) P.Beauv. Qiu94002

Lycopods

Isoetes sp. Qiu96272 AY354939 ) ) ) + )

Huperzia lucidula (Michx.) Trevis. Qiu94173 AY354938 ) ) ) + +

Hornworts

Notothylas breutelii (Gottsche) Gottsche Qiu97078 AY354981 ) + + ) )

Phaeoceros carolinianus (Michx.) Prosk. Qiu97002 AY354980 ) + + ) )

Megaceros tosanus Steph. Qiu97001 AY354979 + ) )

Anthoceros agrestis Paton Qiu99112 AY354978 ) + + ) )

Mosses

Hypnum cupressiforme Hedw. Qiu99079 AY354976 ) + ) ) )

Brachythecium rutabulum (Hedw.) BSG. Qiu94071 AY354975 ) + ) ) )

Thuidium recognitum (Hedw.) Lindb. Qiu94174 AY354974 ) + ) ) )

Anomodon viticulosus (Hedw.) Hook. & Tayl. Qiu99066 AY354973 ) + ) ) )

Hedwigia ciliata (He dw.) P.Beauv. Qiu99056 AY354972)

+) ) )Rhizogonium paramattense (Mull. Hal.) Qiu98069 AY354971 ) + ) ) )

Reichardt

Bartramia halleriana Hedw. Qiu99062 AY354970 ) + ) ) )

Leucobryum albidum (Brid.) Lindb. Qiu94075 AY354969 ) + ) ) )

Dicranum scoparium Hedw. Qiu94073 AY354968 ) + ) ) )

Mnium sp. Qiu94097 AY354935 ) + ) ) )

Gymnostomum rucurvirostrum Hedw. Qiu94072 AY354936 ) + ) ) )

Fissidens dubius P.Beauv. Qiu99069 AY354967 ) + ) ) )

Tetraphis pellucida Hedw. Qiu00001 AY354956 ) + ) ) )

Polytrichum juniperum Hedw. Qiu94176 AY354966 ) + ) ) )

7/28/2019 1-s2.0-S1055790304000326-main

4/18

Sequence alignment was performed using ClustalX

program (Thompson et al., 1997). Secondary structure

models of group II introns were inferred according to

the consensus model of Michel et al. (1989) on Foldalign

server (Mathews et al., 1999; Zuker et al., 1999). Manual

adjustments were made after computer-assisted folding

analysis.

2.2. Group II intron nomenclature

Because there is a great deal of confusion on intron

names in literature due to lack of a standard nomen-

clature, we develop a system here for group II introns

that is similar to what has been proposed for group I

introns in ribosomal DNA (Johansen and Haugen,

2001), which has been adopted for archael introns

(Nakayama et al., 2003). The intron name in our system

will be composed of: (1) gene name, (2) the letter i for

intron, and (3) insertion site in the orthologous gene of

M. polymorpha, and it will always be italicized. For

example, nad1i728 refers to an intron located in the gene

nad1 of a given species at the M. polymorpha nucleotide

position 728 (an alignment of the exon sequence of the

species and that of M. polymorpha will be necessary to

identify the intron insertion site).

Compared to the group I intron nomenclature, our

system has omitted use of the species name acronym and

the genome (chloroplast, mitochondrial, or nuclear)

designation letter as part of the formal intron name. In-

stead, we recommend that all that information as well as

other information such as trans-splicing (Malek and

Knoop, 1998), presence of ORF (Zimmerly et al., 2001),status within a twintron (Hallick et al., 1993), and intron

phase (Sharp, 1981) be amended to the formal intron

name in particular studies when the need of incorporating

such information arises. Thus, this system has advantages

of being flexible and convenient in communication.

Marchantia polymorpha is chosen as a reference spe-

cies because its mitochondrial and chloroplast genomes

have been sequenced (Oda et al., 1992; Ohyama et al.,

1986) and they contain most of the genes that have been

found so far in organellar genomes of land plants and

other photosynthetic eukaryotes. In cases where

M. polymorpha lacks an ortholog, or orthologous part

due to deletion, of the gene in which an intron has been

found in one or several species, the exon sequence of the

species in which the intron was first discovered will be

used as the reference. The insertion site in this species

will be used with a superscript asterisk followed by

the species name in a parenthesis. For example,

ycf66i106(Chaetosphaeridium globosum) refers to an

intron present at position 106 in the chloroplast gene

ycf66(which is absent in M. polymorpha) and it was first

discovered in C. globosum, which has been used as the

reference species. For introns located in the 50 and 30 un-

translated regions, a ) and + sign will be usedAtrichumangustatum(Brid.)BSG.

Qiu94074

AY354934

)

+

)

)

)

)

+

Diphysciumfoliosum(Hedw.)Mohr

Qiu99083

AY354933

)

+

)

)

)

)

+

SphagnumrecurvumP.Beauv.

Qiu94175

AY354932

)

+

)

)

)

)

+

Takakiaceratophylla(Mitt.)Grolle

Qiu97125

AY354937

)

+

)

)

)

)

+

TakakialepidozioidesHatt.&Inoue

Qiu97126

AY354977

)

+

)

)

)

)

+

Liverworts

Frullaniadilatata(L.)Dumort.

Qiu99058

AY354962

)

)

)

)

)

)

)

Radulacomplanata(L.)Dum.

Qiu99075

AY354961

)

)

)

)

)

)

)

Plagiochilaasplenioides(L.)Dum.

Qiu99064

AY354960

)

)

)

)

)

)

)

Lophocoleaheterophylla(Schrad.)Dum

.

Qiu98007

AY354959

)

)

)

)

)

)

)

Marsupellaemarginata(Ehrh.)Dumor

t.

Qiu99077

AY354958

)

)

)

)

)

)

)

Pelliasp.

Qiu95001

AY354964

)

)

)

)

)

)

)

MetzgeriatemperataKuwahara

Qiu98008

AY354931

)

)

)

)

)

)

)

MetzgeriaconjugataLindb.

Qiu99080

AY354965

)

)

)

)

)

)

)

Conocephalumsp.

Qiu94096

AY354957

)

)

)

)

)

)

)

Ricciocarposnatans(L.)Corda

Qiu97153

AY354929

)

)

)

)

)

)

)

Blasiapusilla(Micheli)L.

Qiu99108

AY354963

)

)

)

)

)

)

)

Haplomitriummnioides(Lindb.)Schust.

Qiu97127

AY354930

)

)

)

)

)

)

)

a

ThevoucherswithnumbersbetweenQiu94001and97999aredepositedatIndianaUniversityHerbarium(IND,Bloomington

,IN,USA),andthosewithnumbersbetwee

nQiu98001and00999

atUniversityofZurichHerbarium(Z,Zurich,Switzerland).


7/28/2019 1-s2.0-S1055790304000326-main

5/18

Fig. 1. The exon phylogeny of the mitochondrial nad1 from 64 species of land plants and green algae (Nephroselmis olivacea (AF110138) was used as

the outgroup). Shown here is a maximum likelihood tree ()Ln likelihood 14993.51076). The branch length difference is contributed by both the

divergence level and length of the sequences analyzed. Asterisks mark the nodes collapsed in the strict consensus tree of 25,941 most parsimonious

trees (length: 3106 steps, CI (consistency index): 0.4858, and RI (retention index): 0.6863). The only difference between the likelihood and parsi-

monious trees concerns placement ofOphioglossum, Psilotum, and Osmunda. Bootstrap values higher than 50% are shown above the branches. The

taxa with sequences from the GenBank are underlined:Prototheca (NC_001613), Mesostigma (AF353999), Pedinomonas (NC_000892), Scenedesmus

(AF204057), Chlorogonium (Y13644), Chlamydomonas (U03843), Chaetosphaeridium (NC_004118), Marchantia (NC_001660), Ginkgo (AF227466,

AF227470), Gnetum (AF227467, AF227471), Pinus (AF160261), Arabidopsis (Y08501, Y08502), Petunia (X60400-X60403), Oenothera (AH003143),

Beta (NC_002511), Oryza (AB076665), and Triticum (X57965-X57968).

250 O. Dombrovska, Y.-L. Qiu / Molecular Phylogenetics and Evolution 32 (2004) 246263

7/28/2019 1-s2.0-S1055790304000326-main

6/18

Fig. 2. Intron distribution in the mitochondrial nad1 of land plants and green algae. The species are arranged into phylogenetic groups. The coding

sequences (gray boxes) are drawn to an approximate scale, with all intron positions marked. Rectangular boxes denote complete coding sequences;

triangle-edged boxes indicate partial coding sequences.Trans-spliced introns are represented by shifted exon boxes. Species with data from literature

are underlined. The numbers in parentheses after intron names indicate intron phases. *For nad1i728, (1) all mosses except Takakia (both species)

and Sphagnum have lost the matR, (2) splicing status in Psilotum and Ophioglossum is unknown due to the partial sequences obtained, (3) presence of

the cis-spliced intron in the four gymnosperms (except in Pinus where splicing status is unknown) has been demonstrated by Southern hybridizations

(Qiu and Palmer, in press) and matR sequencing (Qiu et al., 1999), and (4) trans-splicing in Beta, Petunia, Triticum, and Oryza evolved independently

(Qiu and Palmer, in press).


7/28/2019 1-s2.0-S1055790304000326-main

7/18

before the insertion site, respectively. Clearly, future

discoveries will present situations for which amendment

to this nomenclature will be necessary.

2.3. Phylogenetic analyses

Because bryophytes often grow as a mixture of several

species, the chance of cross-contamination could still exist

even though we made an effort to check tissue purity

under a dissecting scope. To confirm that the sequences

obtained wereindeedfrom the specieswe targeted andnot

from biological contaminants, we performed phyloge-

netic analyses on the exon sequences ofnad1, using both

the parsimony and maximum likelihood methods as im-

plemented in PAUP* 4.0b10 (Swofford, 2003). In the

parsimony analysis, we weighted all characters and mu-

tations equally. For the maximum likelihood analysis, we

used the HYK85 model with the following settings: two

Table 2

Primers used for mitochondrial nad1 gene amplification and sequencing

Forward primers Reverse primers

Location Sequence Location Sequence

Mp nad1-1 50-ATGAGAATTTATCTAATTGG-30

Ol nad1i258-1327 50-TAGGCCACTCTGAATTCC-30

Mp nad1-82 CTAGCWGAACGWAAAGTCATGGC Ol nad1i258-2118 CTTTCAGTCGAGTGTCTGGAA

Mp nad1-153 GTTACAACCTTTDGCWGAYGG Mp nad1-292 GACAATACCATACCATAATCMp nad1-191 AAGARCCTATTTTAYYRAGTAGTGCT Hl nad1i394-1007 GTCGGTTATTCCATCTCC

Ol nad1i258-763 CARGTGCGCAAGGACCTKWMAC Hl nad1i394-1476 AGCRARGTGCAGARAACRCG

Ol nad1i258-1213 TTCGGAGAGGTCCTATCG Hl nad1i394-1486 CGATAGAGGAAAGCGAGGTGC

Mp nad1-264 TTTGGTTGCTTGGGCGGTTATC Mp nad1-395 TCCTGAAAAAGCATATTTGGRAT

Aa nad1i287-334 ACTATGCGGACATCTTAC Mp nad1-407 ATCGTAATGCTCCYARAAADG

Mp nad1-292 GATTATGGTATGGTATTGTC At-nad1i477-12 ACCTTCGCGGATCCAAACGCGCTC

Hl nad1i394-369 TGTAYGCTGTCTTGCTTCCT At-nad1i477-21 TGCTGCGGTTCCCTTCGGTCCGTTA

Hl nad1i394-705 CTCRAATCYCACGAATCC At nad1i477-479 CTTCCAACGTCAACCTGCG

Hl nad1i394-1060 MGRTGGAAACAAGCAGCG At nad1i477-720 GTRTTGAGTAGGCAGCGCC

Hl nad1i394-1341 CTGGGTACTGAGCCCTTTGC Mp nad1-623

GCGACTRATTCMGCTTCTGCTTCTGGTA Hl nad1i394-1350 GGAACCWTTGTAMCYTAGAKAC

Mp nad1-625 TTCTGCYTCDGCYTCTGG Mp nad1-404 ATGCTTTTYTRGGAGCATTACGAT

Hl nad1i669-1185 ATCTAGGTATATGTTGGTAA Mp nad1-408 TTTTTYRGGAGSWTTACGDTCTG

Hl nad1i669-2391 GTGTGAAGGCAGGACCMS At nad1i477-379 CCTGATCTGGATAACGATAG

Hl nad1i669-2628 CAGCCGCAATAACAGCAC At nad1i477-481 CMAATGGACTCTACRAGGACCMp nad1-671 AGAGCAAAYCCCATDGAVG At nad1i477-586 GGGCTGTAGGTGATAAYGC

Mp nad1-703 CTCATTAAGATCATATTAGCATACTC Mp nad1-623

TACCAGAAGCAGAAGCKGAATYAGTCGC At nad1i728-168 CTTAGATARGTCGTCCGATGGGT

Mp nad1-636 AGCTGAATTMGTHGCDGG At nad1i728-126 GARGGGTAGCCTGGTGTGTARGC

Hl nad1i669-538 RAGTATRATGACCTGGTCG At nad1i728-450 TCTCCCAGRACCARAATGATTATC

Hl nad1i669-984 CACRATCMATATACACACC0 At nad1i728-1712 GGTTTAGACTKGATTYGCTCATA

Hl nad1i669-1435 TACGCCGTTACAATACGCAGA At nad1i728-2070 TCTTTACTAAGTGTCCCTGGCGGT

Hl nad1i669-1818 GGAGCTGGTCTCAGATGATG At nad1i728-2087

GCTATGCRAGATYTCTCTTGATCTTTGC Hl nad1i669-2290 CATTMTTGMTTGGCGAAG

At nad1i728-2229 TCGTCTGCGTCCTCTTCGTTC Mp nad1-670 TCYTCWATGGGRTTTGCTYTKTT

At nad1i728-2490 GTRAATATAGCRGACCAGCGRAT Mp nad1-709 GCYAATATGATCTTAATGAG

At nad1i728-2517 GARGATTTGTGCTTGTKGGC Mp nad1-714 TATGATCTTAATGAGGTGCGGAG

Mp nad1-762 TAGGAATATCTAGGATGGGCAGC Mp nad1-725

TGAGGTGCGGAGCYTTGCATCYGACATT Mp nad1-789 CGAGCCCGGAATCACCTGG

At nad1i728-432 GTAAACTCATTRRACAGG Mp nad1-832 CCCATATATATACMAACAAAAGGGAAt nad1i728-745 CGGTACYCGAATCYATTTACGA Mp nad1-858 MGATATCGWGGAAATGCTGCRC

At nad1i728-766 AKCCCGAGTTTCYAGACACAT Mp nad1-966 TTAAGRAAGCCATTCAAAGGCT

At nad1i728-1028 CAGTGTACTACTATCACCCCTAC

At nad1i728-1249 GCYTACACACCAGGCTACCCYTC

At nad1i728-1852 TAGAGAAGCGTCGGAGAGTA

At nad1i728-1852 TRGARAAGCGTCGGAGAGTAAAGCACC

At nad1i728-1859 GCGTCGGAGAGTAAAGCACCGTATC

At nad1i728-1870 TAAAGCACCGTATCCATCTCACAG

At nad1i728-2890 RGCCTCATAGTGCCTCCTGT

At nad1i728-3128 CAAAAGACTGCTAGTGGCGTCC

* Numbers correspond to the 50 and 30 positions of the forward and reverse primers in Marchantia polymorpha (Mp) mitochondrial nad1 gene

(NC_001660, Oda et al., 1992), Arabidopsis thaliana (At) introns nad1i477** and nad1i728 (NC_001284, Unseld et al., 1997), and Anthoceros agrestis

(Aa) nad1i287, Huperzia lucidula (Hl) nad1i394 and nad1i669, and Ophioglossum lucitanicum (Ol) nad1i258 (all from this study). Amplification

primers are underlined. Two 50-end nucleotides (TT) from Arabidopsis thaliana nad1i477 (NC_001284) actually belong to the upstream exon. Here we follow the

corrected exonintron boundary, starting nucleotide counting in the intron from GTGCG. . .


7/28/2019 1-s2.0-S1055790304000326-main

8/18

substitution types (HYK85 variant), a transition/trans-

version ratio of 2 (j 4.2901951), empirical base fre-

quencies (A 0:23129; C 0:17128; G 0:21140; T

0:38603), no invariable sites, equal rates for all sites,

number of distinct data patterns under this model 932,

molecular clock not enforced, starting branch lengths

obtained using RogersSwofford approximation method,branch-length optimizationone-dimensional Newton

Raphson with pass limit 20, delta 1e ) 06, and )ln L

(unconstrained)unavailable due to missing data and/or

ambiguities. A heuristic search was conducted to find the

trees of the shortest length or the highest likelihood using

simple (for the parsimony analysis) or as is (for the

maximum likelihood analysis) taxon-addition replicates,

one tree held at each step during stepwise addition, TBR

branch swapping, steepest descent option in effect, Mul-

Trees option in effect and no upper limit of MaxTrees.

A bootstrap analysis was conducted using the parsimony

method to test robustness of the topology, using 100 re-

sampling replicates and the same tree search procedure as

described above except with SPR branch swapping.

We also carried out phylogenetic analyses on intron

sequences, to evaluate how intron phylogenies reflect the

plant phylogeny and to determine whether an intron

originated via a single acquisition event followed by

vertical inheritance or through multiple independent

gains caused by horizontal transfers. Because the par-

simony and maximum likelihood analyses produced

virtually identical results on the exon data (see Fig. 1

legend), we conducted only parsimony analyses for the

intron sequences. For two introns (nad1i287 and

nad1i728) with data from a relatively large number ofspecies, the same heuristic tree search method and

bootstrap analysis procedure as the exon sequence

analyses were used, except with the TBR branch swap-

ping option. For other five introns that had data from

only a small number of species, we were able to use the

branch-and-bound or exhaustive tree search methods to

find the most parsimonious tree(s). The bootstrap

analysis procedure was the same as in the exon analysis.

3. Results

Among the 46 species of diverse land plants we exam-

ined (Table 1), amplification of almost entire nad1 coding

region encompassing all known intron positions was

possible for a majority of the species. However, only

partial coding regions of varyinglengths covering some of

the intron positions were obtained from Isoetes, Psilotum

Sw., Angiopteris Hoffm., Marattia Sw., Ophioglossum,

Osmunda, and Cycas L.. Our analyses of the exon se-

quences produced a phylogeny (Fig. 1) that is in general

agreement with the relationships of these plants as re-

ported in published studies (Hedderson et al., 1998; Lewis

et al., 1997; Newton et al., 2000; Pryer et al., 2001) and in

our own unpublished analysis of six genes from over 180

land plants. However, there were several anomalies in the

exon phylogeny, e.g., Haplomitrium falling into the clade

of leafy and simple thalloid liverworts, paraphyly of

mosses, and Takakia being sister to hornworts. Several

factors may have contributed to these results: short se-

quences used for such a broad range of taxa, uneven RNAediting patterns (see below), and insufficient taxon sam-

pling. Nonetheless, we think that theexon phylogeny does

suggest that nad1 is a useful phylogenetic marker and that

all of the sequences obtained are indeed from the species

we targeted, i.e., not from biological contaminants.

A total of seven introns were found, and all of them

belong to group II (Table 1, Fig. 2). Five of them have

been reported before (Chapdelaine and Bonen, 1991;

Conklin et al., 1991; Kubo et al., 2000; Malek and

Knoop, 1998; Notsu et al., 2002; Wissinger et al., 1991),

and two are newly discovered in this study. They all

have characteristic group II intron primary and sec-

ondary structural features: the consensus sequence of

GBGYG at the 50-end (the second nucleotide consensus

needs to be expanded; the consensus sequence of AY at

the 30-end is not being followed by many group II in-

trons, including three of the seven introns reported here:

nad1i348, nad1i669, and nad1i728); six double helical

domains radiating from a central wheel; the bulging A

residue at the 7th8th position from the 30-end in do-

main VI, which is required for lariat formation and in-

tron excision; and the conserved domain V with a

GNRA terminal tetraloop (for six out of seven introns)

(Lambowitz and Belfort, 1993; Qin and Pyle, 1998).

For 12 liverworts, we obtained the full length codingregion ofnad1 using primers that covered start and stop

codons (Metzgeria conjugata and M. temperata missed

two codons at the 30-end), and found no introns at all

(Table 1, Fig. 2). This is the same condition as reported in

Marchantia (Oda et al., 1992). In other land plants, the

introns showed lineage-specific distribution patterns as

described below.

3.1. nad1i258

This is a novel intron we discovered in the present

study; its secondary structure is shown in Fig. 3A. It is

present in all the moniliformopses for which we could get

a sequence of this region of the gene: Equisetum, Ophio-

glossum, Angiopteris, Marattia, Adiantum, and Asple-

nium, but is absent from green algae, bryophytes and

other vascular plants (Table 1, Fig. 2). Its typical length is

approximately 900 bp, with an exception in Ophioglos-

sum, where the intron contains a remnant ORF, resulting

in a length of 2598 bp. Our phylogenetic analyses show

that the evolutionary historyof the intron parallels that of

the plants (Fig. 4A; Pryer et al., 2001), suggesting that the

intron was acquired in the common ancestor of monili-

formopses and has been inherited vertically.


7/28/2019 1-s2.0-S1055790304000326-main

9/18

Fig. 3. Inferred secondary structure of two newly discovered group II introns in the mitochondrialnad1. (A) nad1i258 from Marattia attenuata and

(B) nad1i348 from Phaeoceros carolinianus.


7/28/2019 1-s2.0-S1055790304000326-main

10/18

3.2. nad1i287

This intron, being orthologous to the one discovered

in Ceratodon purpureus by Malek and Knoop (1998),

was found in all 19 mosses and three hornworts we in-

vestigated (no PCR product was obtained from

Megaceros D.H. Campbell), and has an average length

of 900 bp. It is absent in green algae and other lineages

of land plants (Table 1, Fig. 2). The intron phylogeny

(Fig. 4B) is in agreement with that of the plants (Newton

et al., 2000), indicating vertical transmission of the

intron in the mosses and hornworts.

Fig. 4. Phylogenies of the seven introns found in the mitochondrial nad1 of land plants. The numbers above the branches are bootstrap values.

The taxa with sequences from the GenBank are underlined: Ceratodon (Y17810), Isoetes lac. (Y17812), Pinus (AF160261), Osmunda 1 (Y17815),

Equisetum tel. (Y17811), and Notothylas (AF068932). (A) nad1i258, the single shortest tree found in an exhaustive tree search (length: 1033 steps,

CI: 0.9555, and RI: 0.8357). (B) nad1i287, the strict consensus tree of 10 shortest trees found in a heuristic search (length: 694 steps, CI: 0.7277, and

RI: 0.7970). (C) nad1i348, the single shortest tree found in an exhaustive tree search (length: 73 steps, CI: 0.9863, and RI: 0.8000). (D) nad1i394, thesingle shortest tree found in an exhaustive tree search (length: 1057 steps, CI: 0.9574, and RI: 0.9240). (E) nad1i477, the single shortest tree found

in an exhaustive tree search (length: 2223 steps, CI: 0.9353, and RI: 0.6949). (F) nad1i669, the single shortest tree found in an exhaustive tree search

(length: 1708 steps, CI: 0.9895, and RI: 0.9669). (G) nad1i728, the strict consensus tree of 12 shortest trees found in a heuristic search (length: 7556

steps, CI: 0.6546, and RI: 0.5223).


7/28/2019 1-s2.0-S1055790304000326-main

11/18

3.3. nad1i348

This is another new intron we discovered, and its

secondary structure is shown in Fig. 3B. It is present

in all four hornworts we examined: Anthoceros [Mic-

heli] L., Megaceros, Phaeoceros Proskauer and Not-

othylas Sull., but absent in green algae and all otherland plants (Table 1, Fig. 2). The intron has a typical

length of 600 bp. Our phylogenetic analyses indicate

that it has been transmitted vertically following its

acquisition in the common ancestor of hornworts

(Fig. 4C).

3.4. nad1i394

This intron is orthologous to the cis-spliced nad1Ti1

in Isoetes lacustris reported by Malek and Knoop

(1998) and the trans-spliced first intron of nad1 in

angiosperms (Chapdelaine and Bonen, 1991; Conklin

et al., 1991; Wissinger et al., 1991). According to our

survey, it is also present, in a cis-spliced form as in

Isoetes lacustris, in Huperzia Bernh., Isoetes sp., Eq-

uisetum arvense, Angiopteris, Marattia, Adiantum, and

Asplenium, but absent entirely in bryophytes and green

algae (Table 1, Fig. 2). Among the species investi-

gated, the intron size ranges from 1400 to 2000 bp in

most species, but in Isoetes it drops dramatically to

520 bp. This sharp decrease of intron size in Isoetes

has been observed earlier by Malek and Knoop (1998)

for this intron as well as for two other introns in nad2

and nad5. It appears now that the decrease of intron

size is restricted to only Isoetes; the other lycopod weexamined, Huperzia, has a normal-sized intron. The

absence of this intron in Ophioglossum (Fig. 2) and

Equisetum telmateia (Malek and Knoop, 1998) can be

explained by secondary losses. The intron phylogeny

(Fig. 4D) essentially agrees with the plant phylogeny

(Pryer et al., 2001), with the exception of Equisetum

embedded in Marattiaceae. This topological anomaly

may be caused by insufficient taxon sampling, rather

than serving as evidence of intron horizontal transfer.

Distribution of the intron in land plants (Fig. 2) is

mostly consistent with the hypothesis of a single origin

of the intron in the beginning of vascular plant evo-

lution followed by independent losses. Our failure to

amplify the portion of the gene covering the intron

insertion site in Psilotum, Osmunda, and Cycas, if not

due to technical reasons, could be an indication that

this intron is present in a trans-spliced state in these

plants, as multiple independent evolutions of trans-

splicing have been detected in another nad1 intron,

nad1i728 (Conklin et al., 1991; Kubo et al., 2000;

Notsu et al., 2002; Qiu and Palmer, in press; Wis-

singer et al., 1991). Further investigation in these

plants would be desirable to find out the exact status

of the intron.

3.5. nad1i477

This intron is orthologous to the second intron in

nad1 of angiosperms (Chapdelaine and Bonen, 1991;

Conklin et al., 1991; Wissinger et al., 1991). It has been

reported to be present in Huperzia lucidula and a large

number of seed plants by Gugerli et al. (2001) and Wonand Renner (2003) using either sequencing or Southern

hybridization. In this survey, we found that this intron is

present in Huperzia lucidula (the same DNA was used

for both Gugerli et al., 2001, and this study), Angiop-

teris, Marattia, Ophioglossum, Osmunda, and Cycas, but

absent in green algae, bryophytes, and four vascular

plants that were sequenced through the intron insertion

site, Isoetes, Equisetum, Adiantum, and Asplenium (Table

1, Fig. 2). Clearly, absence of the intron in the four

vascular plants represents secondary losses, as has been

observed earlier in some seed plants (Gugerli et al.,

2001). The size of this intron shows a full range of

variation from 896 bp in Arabidopsis to 2844 bp in

Ophioglossum, unlike nad1i394 which has a bimodal size

distribution. The intron phylogeny (Fig. 4E) agrees well

with the plant phylogeny. Judging from the data shown

here and in Gugerli et al. (2001), the intron was most

likely acquired in the common ancestor of vascular

plants and has been vertically inherited ever since, with

secondary losses in a small number of plant lineages.

3.6. nad1i669

This is another trans-spliced intron in angiosperms

(Chapdelaine and Bonen, 1991; Conklin et al., 1991;Wissinger et al., 1991), and its cis-spliced ortholog has

been isolated from Equisetum telmateia and Osmunda

regalis (Malek and Knoop, 1998). In this study, we ob-

tained sequences ofcis-spliced introns from Huperzia and

Psilotum as well as from a different species of Equisetum

(E. arvense) and a different accession ofOsmunda regalis

than those used by Malek and Knoop (1998) (Table 1,

Fig. 2). The size of the intron varies from 1561 bp in E.

arvense to 3090 bp in Huperzia, with size in Psilotum and

Osmunda being intermediate. The intron phylogeny

(Fig. 4F) shows no sign of horizontal transfer. Besides its

entire absence in green algae and bryophytes, the intron is

also absent in Isoetes, Adiantum, and Asplenium, which

can be attributed to secondary losses (Fig. 2). Its distri-

bution pattern is consistent with the idea that the intron

was gained in the ancestor of vascular plants. Failure of

obtaining PCR product in Angiopteris, Marattia, Ophio-

glossum,and Cycas again could indicate presence oftrans-

spliced introns in these plants.

3.7. nad1i728

This intron is orthologous to the nad1.i4 that has

previously been isolated from Sphagnum L. and


7/28/2019 1-s2.0-S1055790304000326-main

12/18

Notothylas (Qiu et al., 1998) as well as several angio-

sperms (Chapdelaine and Bonen, 1991; Conklin et al.,

1991; Kubo et al., 2000; Notsu et al., 2002; Thomson

et al., 1994; Unseld et al., 1997; Wahleithner et al., 1990;

Wissinger et al., 1991). It has also been shown to be

present in a large number of land plants except liver-

worts according to the Southern hybridizations (Qiuet al., 1998; Qiu and Palmer, in press) and matR (an

ORF encoded within the intron) sequencing (Anderberg

et al., 2002; Qiu et al., 1999). Here, we report sequences

of this intron from 19 mosses, 3 hornworts (the Not-

othylas intron sequence was taken from Qiu et al. (1998)

and hence was not included in this count), and 9 pteri-

dophytes (Table 1, Fig. 2). The intron in hornworts and

pteridophytes shows a range of size variation from

2221 bp in Osmunda to 4037 bp in Marattia. However, in

mosses, while two Takakia species still have a full-sized

intron (slightly over 2800 bp), Sphagnum and other

mosses have lost most or all of their matR (with the

intron size being 1452bp in Sphagnum and around

850 bp in all other mosses). The portion of matR still

present in Sphagnum is the X domain, which is impli-

cated in intron splicing and is usually retained in any

group II intron that contains an ORF (Mohr et al.,

1993). The phylogeny of the intron (Fig. 4G) mirrors

that of the plants rather well, indicating that the intron

has been inherited vertically since its acquisition in the

common ancestor of non-liverwort land plants as sug-

gested by Qiu et al. (1998). For both Psilotum and

Ophioglossum, we obtained only partial sequences of the

intron using primers in the adjacent exons and in 5 0- or

30

-end of the intron, and thus cannot confirm splicingstatus of the intron. Isoetes was reported to lack the

intron in a Southern hybridization survey (Qiu et al.,

1998), and our attempt to use PCR to check for the

presence of the intron failed this time.

4. Discussion

4.1. Phylogenetic implications of intron distribution in

nad1 of land plants

A total of seven introns, all belonging to group II,

have been discovered in the mitochondrial gene nad1

through surveys of a large number of land plants by this

study and many others (Chapdelaine and Bonen, 1991;

Conklin et al., 1991; Gugerli et al., 2001; Kubo et al.,

2000; Malek and Knoop, 1998; Notsu et al., 2002; Qiu

et al., 1998; Qiu and Palmer, in press; Thomson et al.,

1994; Unseld et al., 1997; Wahleithner et al., 1990;

Wissinger et al., 1991). Yet, no intron has been found in

the 12 liverworts sequenced in this study nor in

Marchantia by Oda et al. (1992), which span most of the

liverwort diversity: Calobryales, Marchantiales, Metz-

geriales, and Jungermanniales (Schuster, 1966, 2000).

This complete absence of introns in liverworts is the

same condition as in the green algal outgroups (Kroy-

mann and Zetsche, 1998; K uck et al., 2000; Nedelcu

et al., 2000; Turmel et al., 1999, 2002a,b, 2003; Wolff

et al., 1994; M.W. Gray, unpublished data). The sole

group I intron in nad1 of Chlamydomonas eugametos

(Denovan-Wright et al., 1998), but not in C. reinhardtii(M.W. Gray, unpublished data (GenBank Accession

No. U03843)), is irrelevant to the discussion here, as its

distribution clearly suggests that it was gained via hor-

izontal transfer.

Earlier, Qiu et al. (1998) used the hypothesized gains

of nad1i728 (nad1.i4 in their nomenclature) and two

other introns in the mitochondrial gene cox2, cox2i373

and cox2i691, to argue for the basal-most position of

liverworts among land plants. Nickrent et al. (2000)

suggested that absence of these introns in the liverworts

could be caused by secondary losses, as seen in some

plants reported in Qiu et al. (1998). Further, Nishiyama

and Kato (1999), Nickrent et al. (2000), and Renzaglia

et al. (2000) conducted phylogenetic analyses of multi-

gene data sets (with limited taxon sampling) and sper-

matogenesis characters and concluded that hornworts

occupy the basal-most position in land plants. In light of

the data presented here, we believe that the most par-

simonious explanation for intron distribution in nad1 is

still that liverworts, not hornworts, represent the oldest

land plants, and that both nad1i287 and nad1i728 were

gained in the common ancestor of mosseshornworts

vascular plants after liverworts had diverged. While the

former was lost in the ancestor of vascular plants, the

latter had been retained. The idea of a single gain ofnad1i287 in a common ancestor of mosses and horn-

worts can only be entertained if the two groups form a

clade, but both published studies (Kenrick and Crane,

1997b; Mishler et al., 1994; Nickrent et al., 2000; Ni-

shiyama and Kato, 1999; Renzaglia et al., 2000; see also

Qiu and Lee, 2000) and our unpublished multigene

analysis of land plant phylogeny have failed to recover

this topology. If we follow the hornwort basal hypoth-

esis, both introns would have to be gained in the com-

mon ancestor of land plants and lost in liverworts, with

an additional loss ofnad1i287in vascular plants since no

study so far has suggested a sister relationship of liver-

worts and vascular plants (Qiu and Lee, 2000). This

scenario is significantly less parsimonious than the ex-

planation offered by the liverwort basal hypothesis. The

hornwort basal hypothesis is also contradicted by the

distribution of two other mitochondrial group II in-

trons, one in nad2 (nad2i1282, Pruchner et al., 2002) and

the other in nad5 (nad5i477, Malek and Knoop, 1998),

both of which are present in vascular plants and horn-

worts but not in liverworts and mosses. Meanwhile, two

introns in nad7, nad7i40, and nad7i209, have now been

found in mosses, hornworts, and vascular plants but not

in liverworts, thus adding more evidence to the liverwort


7/28/2019 1-s2.0-S1055790304000326-main

13/18

basal hypothesis (Hashimoto and Sato, 2001; Pruchner

et al., 2001; N. Sato, personal communication). There-

fore, the overall intron distribution in the mitochondrial

genes (cox2, nad1, nad2, nad5, and nad7) is more con-

sistent with the liverwort basal hypothesis than with the

hornwort basal hypothesis.

The liverwort basal hypothesis received an indirectsupport from recently completed studies of chloroplast

genome sequencing of Physcomitrella patens (a moss,

Sugiura et al., 2003), Anthoceros formosae (Kugita et al.,

2003a), Psilotum nudum (Wakasugi et al., unpublished

data, GenBank Accession No. AP004638), and Adian-

tum capillus-veneris (Wolf et al., 2003). In Marchantia

(Ohyama et al., 1986), Physcomitrella, and Chaetosph-

aeridium (Turmel et al., 2002b), the inverted repeat in

the chloroplast genome does not include the genes ndhB,

rps7, and rps12 (partial). However, Anthoceros cpDNA

has these three genes as part of its inverted repeat, a

condition otherwise only seen in Psilotum, Adiantum,

and other vascular plants such as rice (Hiratsuka et al.,

1989) and tobacco (Wakasugi et al., 1998). This ex-

pansion of the inverted repeat to encompass these three

genes can almost certainly be regarded as a synapo-

morphy to unite hornworts and vascular plants, a rela-

tionship alluded to by the aforementioned phylogenetic

distribution of nad2i1282 and nad5i477 as well as some

sequence analyses (Lewis et al., 1997; Samigullin et al.,

2002; see also Qiu and Lee, 2000) (admittedly, taxon

sampling, in particular of vascular plants, in these se-

quence analyses is rather thin). Lastly, the most recent

report of fossil evidence from the Ordovician rocks of

Oman on sporangium structure that contain sporetetrads characteristic of early land plants also support

the liverwort basal hypothesis (Wellman et al., 2003).

A recent study found that certain genomic structural

changes, such as ribosomal protein gene loss and

transfer from the mitochondrial to nuclear genomes,

occur at rather high frequencies (Adams et al., 2002).

Another study also showed that a group II intron had

likely experienced horizontal transfer from angiosperms

to Gnetum (Won and Renner, 2003). Moreover, deep

losses of introns have clearly happened, as can be seen

from this study and others that investigated mitochon-

drial introns in basal land plants (Beckert et al., 1999,

2001; Pruchner et al., 2002). These studies raise the issue

of utility of genomic structural characters in inferring

plant phylogenetic relationships. However, our phylo-

genetic analyses of intron sequences showed little sign of

independent gains and horizontal transfer of the group

II introns investigated here (Fig. 4). Hence, we contend

that while one certainly cannot use genomic structural

characters, nor any other kind of characters, blindly for

phylogenetic inference, it is appropriate to use intron

distribution patterns, particularly intron gains, if they

are demonstrated to occur at very low frequencies, to

evaluate competing phylogenetic hypotheses. Intron

distribution patterns as well as other genomic structural

characters such as gene order and content in the cpDNA

inverted repeat will add a new source of information for

plant phylogenetic reconstruction.

Another issue that these intron distribution data may

help to resolve is the phylogenetic position of the enig-

matic bryophyte genus Takakia. Though first thought tobe related to liverworts (Hattori and Inoue, 1958;

Schuster, 1966) or as an independent lineage at the same

rank as liverworts, mosses, and hornworts (Crandall-

Stotler, 1986), discovery of antheridia and sporophytes

has revived an earlier idea that the genus shows affinity

to mosses (Mizutani, 1967; Smith and Davison, 1993).

Recent phylogenetic analyses of morphological and

molecular data seem to support this conclusion, but the

exact placement of Takakia within mosses is far from

being certain (Hedderson et al., 1998; Kenrick and

Crane, 1997b; Mishler et al., 1994; Newton et al., 2000;

Renzaglia et al., 2000). In this study, we found that the

intron content in nad1 of both Takakia species is the

same as 17 diverse mosses we investigated, but different

from that of liverworts and hornworts (Table 1, Fig. 2).

Hence, a moss affinity for the genus seems most prob-

able. Furthermore, our examination of the ORF (matR)

in nad1i728 indicates that the two Takakia species still

have an intact matR, whereas Sphagnum has only the X

domain of the ORF and the other 16 mosses lack the

ORF entirely. Two lines of evidence support the fol-

lowing ordering of the three states in these taxa: Takakia

(ancestral), Sphagnum (intermediate), and all other

mosses (derived). One is that the X domain has been

suggested to be the least dispensable element in group IIintron ORFs since it is involved in intron splicing (Mohr

et al., 1993). The other is that no matR loss has been

observed in any of the large number of other land plants

that have been investigated (Anderberg et al., 2002; Qiu

et al., 1999; Qiu and Palmer, in press). Consequently, the

matR distribution data would support a topology in

which Takakia is sister to the clade of Sphagnum plus

other mosses, as has been recovered in some recent

sequence analyses (Renzaglia et al., 2000; Qiu et al.,

unpublished data).

The data of the present study may also address the

monophyly of moniliformopses, a group that comprises

traditionally circumscribed ferns, Equisetum, and Psi-

lotaceae. The clade was first identified by Kenrick and

Crane (1997b) after they analyzed both extant and ex-

tinct pteridophytes, and was subsequently supported by

both multigene sequence analysis and a shared unique

insertion in the chloroplast gene rps4 (Pryer et al., 2001).

In this study, we found that the ferns (both eusporan-

giate and leptosporangiate) and Equisetum share the

intron nad1i258. Unfortunately, no sequence was ob-

tained from Psilotaceae. Our phylogenetic analyses of

the intron sequences indicate that the intron was most

likely acquired in a single event in the common ancestor


7/28/2019 1-s2.0-S1055790304000326-main

14/18

of moniliformopses and has been inherited vertically

since the acquisition (Fig. 4A). This intron gain would

then be a synapomorphy to support the monophyly of

moniliformopses.

Finally, three introns that were first characterized in

angiosperms, nad1i394, nad1i477, and nad1i669, are now

found to be present throughout vascular plants (Fig. 2).Thus, they were most likely gained in the common an-

cestor of the group. These characters would add to the

large body of information already in existence that

supports the monophyly of vascular plants (Kenrick and

Crane, 1997b).

4.2. Molecular evolutionary implications of intron distri-

bution in nad1 of land plants

One conspicuous aspect of distribution of the seven

nad1 introns in land plants is that they are all of broad

phylogenetic occurrence. The intron that shows the

narrowest phylogenetic range is nad1i258, which is still

found in Equisetum, and eusporangiate and leptospo-

rangiate ferns (Table 1; Fig. 2). The common ancestor of

these plants likely existed between the Silurian and

Devonian (435345 million years ago) (Kenrick and

Crane, 1997a,b). The other intron that is restricted to

only one lineage is nad1i348, which occurs in all four

genera (belonging to the only two families) of hornworts

that were examined (Table 1; Fig. 2). The hornworts as a

lineage must have existed between the mid-Ordovician

(about 450 million years ago) and Silurian, as fossils of

liverwort affinity have been reported from the mid-

Ordovician (Edwards et al., 1995; Taylor, 1995; Well-man et al., 2003) and those of vascular plants from the

lower Silurian (Kenrick and Crane, 1997a,b). All other

five introns are found to be shared by at least two major

lineages of land plants (Table 1; Fig. 2). Hence, these

data suggest that these introns arrived at their current

positions at least during the Silurian to Devonian pe-

riod. There is also evidence suggesting that these and

other group II introns in the non-liverwort land plant

mitochondrial genome originated via transposition from

pre-existing introns in other genes of liverworts [cur-

rently based on data mostly from Marchantia (Oda

et al., 1992)] and other organisms (Dombrovska and

Qiu, in preparation). If these observations hold, it seems

that group II intron transposition was quite active in the

mitochondrial genome during the early stage of land

plant evolution. Meanwhile, among studies that have

surveyed introns in a broad range of land plants (Ha-

shimoto and Sato, 2001; Malek and Knoop, 1998;

Pruchner et al., 2001; Qiu et al., 1998), only one intron

has been shown to be restricted to a single species, the

nad5i392 in Huperzia selago (Vangerow et al., 1999).

This general lack of group II introns with extremely

narrow phylogenetic distribution leads us to conclude

that they have not been actively undergoing transposi-

tion in the recent history of land plant evolution. Fur-

ther, our phylogenetic analyses of all seven nad1 introns

uncovered no evidence of horizontal transfer, specifi-

cally intron homing (Fig. 4). This situation is in stark

contrast to what was reported by Cho et al. (1998) of

rampant horizontal transfer (homing) by a group I in-

tron in the mitochondrial gene cox1 of angiosperms.The only explanation we can offer is that the cox1 intron

carries an endonuclease ORF whereas most of the group

II introns in vascular plant mitochondrial genomes have

lost their ORFs, which contain domains involved in

intron mobility (Mohr et al., 1993; Zimmerly et al.,

2001).

Despite stable inheritance after ancient gains, some of

the introns did experience losses, possibly very deep

losses. The distribution pattern of nad1i287 potentially

suggests a deep loss in the common ancestor of vascular

plants. The likelihood that this intron was gained once

in a common ancestor of mosses and hornworts or twice

in ancestors of each lineage is much less than that of a

single gain in the ancestor of non-liverwort land plants

and a subsequent loss in vascular plants, given the in-

tron phylogeny (Fig. 4B) and current results on land

plant phylogeny reconstruction (Kenrick and Crane,

1997b; Mishler et al., 1994; Renzaglia et al., 2000; Qiu

et al., unpublished data). Three other introns, nad1i394,

nad1i477, and nad1i669, also showed a few sporadic

losses (Fig. 2; Gugerli et al., 2001), but they are all

phylogenetically restricted. Both deep and shallow losses

have also been observed for two cox2 introns in angio-

sperms (Joly et al., 2001; Kudla et al., 2002; Rabbi and

Wilson, 1993; Qiu and Palmer, unpublished data). Theprecise mechanisms for how both deep and shallow in-

tron losses have occurred remain largely unknown at

this stage. Among all plants studied, Isoetes is distinct in

that it has lost two, if not three (the third one possibly

being nad1i728, the exact status of which still cannot be

confirmed by sequencing because of our failure to ob-

tain a PCR product), of the four introns that are usually

present in nad1 in vascular plants (Fig. 2). Even when

introns are present in this and other mitochondrial genes

(nad2 and nad5) in Isoetes, they are unusually small

(384520bp, this study; Malek and Knoop, 1998;

Pruchner et al., 2002). These two lines of evidence sug-

gest that the mitochondrial genome in Isoetes is proba-

bly under strong selection pressure for genome size

reduction, as has been seen in some abnormal genomes

(Douglas et al., 2001).

4.3. RNA editing in nad1 of land plants

RNA editing, post-transcriptional modification of

cytidine to uridine and vice versa in RNAs, has been

reported to occur commonly in organellar genes and

genomes of certain land plants (Giege and Brennicke,

1999; Kugita et al., 2003b; Steinhauser et al., 1999).


7/28/2019 1-s2.0-S1055790304000326-main

15/18

In this study, we noticed that after aligning the exon

sequences from all the plants, some lineages seem to

have numerous aberrant C!T(U) and T(U)!C mu-

tations in the first or second codon positions. Hence, we

checked for the possibility of RNA editing by looking

for whether the mutation has altered a conserved amino

acid or generated an internal stop codon in some cases.Obviously, this approach is not as conclusive and

accurate as cDNA analysis, but has been employed and

proven to be valid by others (Steinhauser et al., 1999).

With this approach, we found that the nad1 gene in the

liverwort Haplomitrium, two Takakia species, all four

hornworts, and several pteridophytes (Isoetes, Ophio-

glossum, Adiantum, and Asplenium) potentially experi-

ence heavy editing, with up to 5.11% of all thenucleotide positions in Anthoceros being edited (Fig. 5).

Fig. 5. Selected codons of the mitochondrialnad1 in land plants showing the extent of RNA editing. Inferred edited nucleotides are underlined, body-

faced ones having been confirmed by cDNA analysis in the studies that reported editing. Editing frequency (%) equals the number of edited nu-

cleotides divided by the exon length examined. Boxes mark stop codons that require editing for conversion. Dots indicate nucleotides identical to

those in Marchantia polymorpha and dashes denote missing data. Marchantia position refers to the position of the first nucleotide in a codon.


7/28/2019 1-s2.0-S1055790304000326-main

16/18

Previously, high frequencies of RNA editing have been

noticed in many of these plants in other mitochondrial

genes, cox3, nad2, nad4, and nad5 (Malek and Knoop,

1998; Malek et al., 1996; Pruchner et al., 2001, 2002).

However, questions remain as to why there is RNA

editing in the first place and why it occurs in certain

lineages but not in others.

Acknowledgments

We thank J.D. Palmer for providing initial ideas on

starting this project, and V. Knoop for stimulating dis-

cussion on plant mitochondrial intron evolution, and

both of them for their advice on developing the intron

nomenclature. We also thank B. Crandall-Stotler and E.

Urmi for help with obtaining plant material. This work

was supported by a Swiss NSF research grant (3100-

053602) and a NSF CAREER Award (DEB 0093012) to

Y.Q.

References

Adams, K.L., Qiu, Y.-L., Stoutemyer, M., Palmer, J.D., 2002.

Punctuated evolution of mitochondrial gene content: high and

variable rates of mitochondrial gene loss and transfer during

angiosperm evolution. Proc. Natl. Acad. Sci. USA 99, 99059912.

Anderberg, A.A., Rydin, C., Kallersjo, M., 2002. Phylogenetic

relationships in the order Ericales s.l.: analyses of molecular data

from five genes from the plastid and mitochondrial genomes. Am.

J. Bot. 89, 677687.

Beckert, S., Muhle, H., Pruchner, D., Knoop, V., 2001. Themitochondrial nad2 gene as a novel marker locus for phylogenetic

analysis of early land plants: a comparative analysis in mosses.

Mol. Phylogenet. Evol. 18, 117126.

Beckert, S., Steinhauser, S., Muhle, H., Knoop, V., 1999. A molecular

phylogeny of bryophytes based on nucleotide sequences of the

mitochondrial nad5 gene. Plant Syst. Evol. 218, 179192.

Chapdelaine, Y., Bonen, L., 1991. The wheat mitochondrial gene for

subunit I of the NADH dehydrogenase complex: a trans-splicing

model for this gene-in-pieces. Cell 65, 465472.

Cho, Y., Qiu, Y.-L., Kuhlman, P., Palmer, J.D., 1998. Explosive

invasion of plant mitochondria by a group I intron. Proc. Natl.

Acad. Sci. USA 95, 1424414249.

Conklin, P.L., Wilson, R.K., Hanson, M.R., 1991. Multiple trans-

splicing events are required to produce a mature nad1 transcript in

a plant mitochondrion. Genes Dev. 5, 14071415.Crandall-Stotler, B., 1986. Morphogenesis, developmental anatomy

and bryophyte phylogenetics: contradictions of monophyly. J.

Bryol. 14, 123.

Denovan-Wright, E.M., Nedelcu, A.M., Lee, R.W., 1998. Complete

sequence of the mitochondrial DNA ofChlamydomonas eugametos.

Plant Mol. Biol. 36, 285295.

Douglas, S., Zauner, S., Fraunholz, M., Beaton, M., Penny, S., Deng,

L.-T., Wu, X., Reith, M., Cavalier-Smith, T., Maier, U.-G., 2001.

The highly reduced genome of an enslaved algal nucleus. Nature

410, 10911096.

Doyle, J.J., Doyle, J.S., 1987. A rapid DNA isolation procedure for

small quantities of fresh leaf tissue. Phytochem. Bull. 19, 1115.

Edwards, D., Duckett, J.G., Richardson, J.B., 1995. Hepatic charac-

ters in the earliest land plants. Nature 374, 635636.

Gensel, P.G., Edwards, D., 2001. Plants Invade the Land: Evolution-

ary and Environmental Perspectives. Columbia University Press,

New York, NY.

Giege, P., Brennicke, A., 1999. RNA editing in Arabidopsis mitochon-

dria effects 441 C to U changes in ORFs. Proc. Natl. Acad. Sci.

USA 96, 1532415329.

Graham, L.E., 1993. Origin of Land Plants. Wiley, New York, NY.

Gugerli, F., Sperisen, C., Buchler, U., Brunner, I., Brodbeck, S.,

Palmer, J.D., Qiu, Y.-L., 2001. The evolutionary split of Pinaceae

from other conifers: evidence from an intron loss and a multigene

phylogeny. Mol. Phylogenet. Evol. 21, 167175.

Hallick, R.B., Hong, L., Drager, R.G., Favreau, M.R., Monfort, A.,

Orsat, B., Spielmann, A., Stutz, E., 1993. Complete sequence of

Euglena gracilis chloroplast DNA. Nucleic Acids Res. 21, 3537

3544.

Hashimoto, K., Sato, N., 2001. Characterization of the mitochondrial

nad7 gene in Physcomitrella patens: similarity with angiosperm

nad7 genes. Plant Sci. 160, 807815.

Hattori, S., Inoue, H., 1958. Preliminary report on Takakia lepido-

zioides. J. Hattori Bot. Lab. 19, 133137.

Hedderson, T.A., Chapman, R., Cox, C.J., 1998. Bryophytes and the

origins and diversification of land plants: new evidence from

molecules. In: Bates, J.W., Ashton, N.W., Duckett, J.G. (Eds.),

Bryology for the Twenty-first Century. W.S. Maney & Son Ltd.,

Leeds, UK, pp. 6577.

Hiratsuka, J., Shimada, H., Whittier, R., Ishibashi, T., Sakamoto, M.,

Mori, M., Kondo, C., Honji, Y., Sun, C.-R., Meng, B.-Y., Li, Y.

-Q., Kanno, A., Nishizawa, Y., Hirai, A., Shinozaki, K., Sugiura,

M., 1989. The complete sequence of the rice (Oryza sativa)

chloroplast genome: intermolecular recombination between distinct

tRNA genes accounts for a major plastid DNA inversion during

the evolution of the cereals. Mol. Gen. Genet. 217, 185194.

Johansen, S., Haugen, P., 2001. A new nomenclature of group I

introns in ribosomal DNA. RNA 7, 935936.

Joly, S., Brouillet, L., Bruneau, A., 2001. Phylogenetic implications of

the multiple losses of the mitochondrial coxII.i3 intron in the

angiosperms. Int. J. Plant Sci. 162, 359373.

Kenrick, P., Crane, P.R., 1997a. The origin and early evolution ofplants on land. Nature 389, 3339.

Kenrick, P., Crane, P.R., 1997b. The Origin and Early Diversification

of Land Plants: A Cladistic Study. Smithsonian Institution Press,

Washington, DC.

Kroymann, J., Zetsche, K., 1998. The mitochondrial genome of

Chlorogonium elongatum inferred from the complete sequence. J.

Mol. Evol. 47, 431440.

Kubo, T., Nishizawa, S., Sugawara, A., Itchoda, N., Estiati, A.,

Mikami, T., 2000. The complete nucleotide sequence of the

mitochondrial genome of sugar beet (Beta vulgaris L.) reveals a

novel gene for tRNACys (GCA). Nucleic Acids Res. 28, 25712576.

Kuck, U., Jekosch, K., Holzamer, P., 2000. DNA sequence analysis of

the complete mitochondrial genome of the green alga Scenedesmus

obliquus: evidence for UAG being a leucine and UCA being a non-

sense codon. Gene 253, 1318.Kudla, J., Albertazzi, F.J., Blazevic, D., Hermann, M., Bock, R., 2002.

Loss of the mitochondrial cox2 intron 1 in a family of monocoty-

ledonous plants and utilization of mitochondrial intron sequences

for the construction of a nuclear intron. Mol. Genet. Genomics

267, 223230.

Kugita, M., Kaneko, A., Yamamoto, Y., Takeya, Y., Matsumoto, T.,

Yoshinaga, K., 2003a. The complete nucleotide sequence of the

hornwort (Anthoceros formosae) chloroplast genome: insight into

the earliest land plants. Nucleic Acids Res. 31, 716721.

Kugita, M., Yamamoto, Y., Fujikawa, T., Matsumoto, T., Yoshinaga,

K., 2003b. RNA editing in hornwort chloroplasts makes more than

half the genes functional. Nucleic Acids Res. 31, 24172423.

Lambowitz, A.M., Belfort, M., 1993. Introns as mobile genetic

elements. Annu. Rev. Biochem. 62, 587622.


7/28/2019 1-s2.0-S1055790304000326-main

17/18

Lewis, L.A., Mishler, B.D., Vilgalys, R., 1997. Phylogenetic relation-

ships of the liverworts (Hepaticae), a basal embryophyte lineage,

inferred from nucleotide sequence data of the chloroplast gene

rbcL. Mol. Phylogenet. Evol. 7, 377393.

Malek, O., Knoop, V., 1998. Trans-splicing group II introns in plant

mitochondria: the complete set ofcis-arranged homologs in ferns,

fern allies, and a hornwort. RNA 4, 15991609.

Malek, O., Brennicke, A., Knoop, V., 1997. Evolution oftrans-splicing

plant mitochondrial introns in pre-Permian times. Proc. Natl.

Acad. Sci. USA 94, 553558.

Malek, O., Lattig, K., Hiesel, R., Brennicke, A., Knoop, V., 1996.

RNA editing in bryophytes and a molecular phylogeny of land

plants. EMBO J. 15, 14031411.

Manhart, J.R., Palmer, J.D., 1990. The gain of two chloroplast tRNA

introns marks the green algal ancestors of land plants. Nature 345,

268270.

Mathews, D.H., Sabina, J., Zuker, M., Turner, D.H., 1999. Expanded

sequence dependence of thermodynamic parameters improves

prediction of RNA secondary structure. J. Mol. Biol. 288, 911940.

Michel, F., Umesono, K., Ozeki, H., 1989. Comparative and functional

anatomy of group II catalytic intronsa review. Gene 82, 530.

Mishler, B.D., Lewis, L.A., Buchheim, M.A., Renzaglia, K.S.,

Garbary, D.J., Delwiche, C.F., Zechman, F.W., Kantz, T.S.,

Chapman, R.L., 1994. Phylogenetic relationships of the green

algae and bryophytes. Ann. Missouri Bot. Gard. 81, 451483.

Mizutani, M., 1967. A new knowledge of archegonia of Takakia

lepidozioides. J. Jpn. Bot. 42, 379381.

Mohr, G., Perlman, P.S., Lambowitz, A.M., 1993. Evolutionary

relationships among group II intron-encoded proteins and identi-

fication of a conserved domain that may be related to maturase

function. Nucleic Acids Res. 21, 49914997.

Nakayama, H., Morinaga, Y., Nomura, N., Nunoura, T., Sako, Y.,

Uchida, A., 2003. An archaeal homing endonuclease I-Pog I

cleaves at the insertion site of the neighboring intron, which has no

nested open reading frame. FEBS 544, 165170.

Nedelcu, A.M., Lee, R.W., Lemieux, C., Gray, M.W., Burger, G.,

2000. The complete mitochondrial DNA sequence ofScenedesmus

obliquus reflects an intermediate stage in the evolution of the greenalgal mitochondrial genome. Genome Res. 10, 819831.

Newton, A.E., Cox, C.J., Duckett, J.G., Wheeler, J.A., Goffinet, B.,

Hedderson, T.A.J., Mishler, B.D., 2000. Evolution of major moss

lineages: phylogenetic analyses based on multiple gene sequences

and morphology. Bryologist 103, 187211.

Nickrent, D.L., Parkinson, C.L., Palmer, J.D., Duff, R.J., 2000.

Multigene phylogeny of land plants with special reference to

bryophytes and the earliest land plants. Mol. Biol. Evol. 17, 1885

1895.

Nishiyama, T., Kato, M., 1999. Molecular phylogenetic analysis

among bryophytes and tracheophytes based on combined data of

plastid coded genes and the 18S rRNA gene. Mol. Biol. Evol. 16,

10271036.

Notsu, Y., Masood, S., Nishikawa, T., Kubo, N., Akiduki, G.,

Nakazono, M., Hirai, A., Kadowaki, K., 2002. The completesequence of the rice (Oryza sativa L.) mitochondrial genome:

frequent DNA sequence acquisition and loss during the evolution

of flowering plants. Mol. Genet. Genomics 268, 434445.

Oda, K., Yamato, K., Ohta, E., Nakamura, Y., Takemura, M.,

Nozato, N., Akashi, K., Kanegae, T., Ogura, Y., Kohchi, T.,

Ohyama, K., 1992. Gene organization deduced from the complete

sequence of liverwort Marchantia polymorpha mitochondrial DNA:

a primitive form of plant mitochondrial genome. J. Mol. Biol. 223,

17.

Ohyama, K., Fukuzawa, H., Kohchi, T., Shirai, H., Sano, T., Sano, S.,

Umesono, K., Shiki, Y., Takeuchi, M., Chang, Z., Aota, S.,

Inokuchi, H., Ozeki, H., 1986. Chloroplast gene organization

deduced from complete sequence of liverwort Marchantia poly-

morpha chloroplast DNA. Nature 322, 572574.

Pruchner, D., Beckert, S., Muhle, H., Knoop, V., 2002. Divergent

intron conservation in the mitochondrial nad2 gene: signatures for

the three bryophyte classes (mosses, liverworts, and hornworts) and

the lycophytes. J. Mol. Evol. 55, 265271.

Pruchner, D., Nassal, B., Schindler, M., Knoop, V., 2001. Mosses

share mitochondrial group II introns with flowering plants, not

with liverworts. Mol. Genet. Genomics 266, 608613.

Pryer, K.M., Schneider, H., Smith, A.R., Cranfill, R., Wolf, P.G.,

Hunt, J.S., Sipes, S.D., 2001. Horsetails and ferns are a mono-

phyletic group and the closest relatives to seed plants. Nature 409,

618622.

Qin, P.Z., Pyle, A.M., 1998. The architectural organization and

mechanistic function of group II intron structural elements. Curr.

Opin. Struct. Biol. 8, 301308.

Qiu, Y.-L., Cho, Y., Cox, J.C., Palmer, J.D., 1998. The gain of three

mitochondrial introns identifies liverworts as the earliest land

plants. Nature 394, 671674.

Qiu, Y.-L., Lee, J., Bernasconi-Quadroni, F., Soltis, D.E., Soltis, P.S.,

Zanis, M., Zimmer, E.A., Chen, Z., Savolainen, V., Chase, M.W.,

1999. The earliest angiosperms: evidence from mitochondrial,

plastid and nuclear genomes. Nature 402, 404407.

Qiu, Y.-L., Lee, J., 2000. Transition to a land flora: a molecular

phylogenetic perspective. J. Phycol. 36, 799802.

Qiu, Y.-L., Palmer, J.D., in press. Many independent origins oftrans-

splicing of a plant mitochondrial group II intron. J. Mol. Evol.

Rabbi, M.F., Wilson, K.G., 1993. The mitochondrial coxII intron has

been lost in two different lineages of dicots and altered in others.

Am. J. Bot. 80, 12161223.

Raubeson, L.A., Jansen, R.K., 1992. Chloroplast DNA evidence on

the ancient evolutionary split in vascular land plants. Science 255,

16971699.

Renzaglia, K.S., Duff, R.J., Nickrent, D.L., Garbary, D.J., 2000.

Vegetative and reproductive innovations of early land plants:

implications for a unified phylogeny. Philos. Trans. R. Soc. B 355,

769793.

Samigullin, T.K., Yacentyuk, S.P., Degtyaryeva, G.V., Valiehoroman,

K.M., Bobrova, V.K., Capesius, I., Martin, W.M., Troitsky, A.V.,

Filin, V.R., Antonov, A.S., 2002. Paraphyly of bryophytes and closerelationship of hornworts and vascular plants inferredfrom analysis

of chloroplast rDNA ITS (cpITS) sequences. Arctoa 11, 3143.

Schuster, R.M., 1966. The Hepaticae and Anthocerotae of North

America, vol. 1. Columbia University Press, New York, NY.

Schuster, R.M., 2000. Austral Hepaticae, Part I. J. Cramer in der

Gebrueder Borntraeger Verlagsbuchhandlung, Stuttgart.

Sharp, P.A., 1981. Speculations on RNA splicing. Cell 23, 643646.

Smith, D.K., Davison, P.G., 1993. Antheridia and sporophytes in

Takakia ceratophylla (Mitt.) Grolle: evidence for reclassification

among the mosses. J. Hattori Bot. Lab. 73, 263271.

Steinhauser, S., Beckert, S., Capesius, I., Malek, O., Knoop, V., 1999.

Plant mitochondrial RNA editing. J. Mol. Evol. 48, 303312.

Sugiura, C., Kobayashi, Y., Aoki, S., Sugita, C., Sugita, M., 2003.

Complete chloroplast DNA sequence of the moss Physcomitrella

patens: evidence for the loss and relocation of rpoA from thechloroplast to the nucleus. Nucleic Acids Res. 31, 53245331.

Swofford, D.L., 2003. PAUP*4.0b10: Phylogenetic analysis using

parsimony. Sinauer, Sunderland, MA.

Taylor, W.A., 1995. Spores in earliest land plants. Nature 373, 391

392.

Thomson, M.C., MacFarlane, J.L., Beagley, C.T., Wolstenholme,

D.R., 1994. RNA editing ofmat-r transcripts in maize and soybean

increases similarity of the encoded protein to fungal and bryophyte

group II intron maturases: evidence that mat-r encodes a functional

protein. Nucleic Acids Res. 22, 57455752.

Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F., Higgins,

D.G., 1997. The ClustalX windows interface: flexible strategies for

multiple sequence alignment aided by quality analysis tools.

Nucleic Acids Res. 24, 48764882.


7/28/2019 1-s2.0-S1055790304000326-main

18/18

Turmel, M., Lemieux, C., Burger, G., Lang, B.F., Otis, C., Plante, I.,

Gray, M.W., 1999. The complete mitochondrial DNA sequences of

Nephroselmis olivacea and Pedinomonas minor: two radically differ-

ent evolutionary patterns within green algae. Plant Cell 11, 1717

1729.

Turmel, M., Otis, C., Lemieux, C., 2002a. The complete mitochondrial

DNA sequence ofMesostigma viride identifies this green alga as the

earliest green plant divergence and a highly compact mitochondrial

genomein theancestor of allgreen plants.Mol. Biol. Evol. 19,2438.

Turmel, M., Otis, C., Lemieux, C., 2002b. The chloroplast and

mitochondrial genome sequences of the charophyte Chaetosphae-

ridium globosum: insights into the timing of the events that

restructured organelle DNAs within the green algal linegae that

led to land plants. Proc. Natl. Acad. Sci. USA 99, 1127511280.

Turmel, M., Otis, C., Lemieux, C., 2003. The mitochondrial genome of

Chara vulgaris: insights into the mitochondrial DNA architecture

of the last common ancestor of green algae and land plants. Plant

Cell 15, 18881903.

Unseld, M., Marienfeld, J.R., Brand, P., Brennicke, A., 1997. The

mitochondrial genome ofArabidopsis thaliana contains 57 genes in

366,924 nucleotides. Nat. Genet. 15, 5761.

Vangerow, S., Teekorn, T., Knoop, V., 1999. Phylogenetic information

in the mitochondrial nad5 gene of pteridophytes: RNA editing and

intron sequences. Plant Biol. 1, 235243.

Wakasugi, T., Sugita, M., Tsudzuki, T., Sugiura, M., 1998. Updated

gene map of tobacco chloroplast DNA. Plant Mol. Biol. Rep. 16,

231241.

Wahleithner, J.A., MacFarlane, J.L., Wolstenholme, D.R., 1990. A

sequence encoding a maturase-related protein in a group II intron

of a plant mitochondrial nad1 gene. Proc. Natl. Acad. Sci. USA 87,

548552.

Wellman, C.H., Osterloff, P.L., Mohiuddin, U., 2003. Fragments of

the earliest land plants. Nature 425, 282285.

Wissinger, B., Schuster, W., Brennicke, A., 1991. Trans-splicing in

Oenothera mitochondria: nad1 mRNA are edited in exon and

trans-splicing group II intron sequences. Cell 65, 473482.

Wolf, P.G., Rowe, C.A., Sinclair, R.B., Hasebe, M., 2003. Complete

nucleotide sequence of the chloroplast genome from a leptospo-

rangiate fern, Adiantum capillus-veneris L. DNA Res. 10, 5965.

Wolff, G., Plante, I., Lang, B.F., Kuck, U., Burger, G., 1994. Complete

sequence of the mitochondrial DNA of the chlorophyte alga

Prototheca wickerhamii: gene content and genome organization. J.

Mol. Biol. 237, 7586.

Won, H., Renner, S.S., 2003. Horizontal gene transfer from

flowering plants to Gnetum. Proc. Natl. Acad. Sci. USA 100,

1082410829.

Zimmerly, S., Hausner, G., Wu, X.-C., 2001. Phylogenetic relation-

ships among group II intron ORFs. Nucleic Acids Res. 29, 1238

1250.

Zuker, M., Mathews, D.H., Turner, D.H., 1999. Algorithms and

thermodynamics for RNA secondary structure prediction: a

practical guide. In: Barciszewski, J., Clark, B.F.C. (Eds.), RNA

Biochemistry and Biotechnology. NATO ASI Series. Kluwer

Academic Publishers, Dordrecht, pp. 1143.


1-s2.0-s1055790304000326-main

Documents