1 computational genomics biol 8803 a spring 2011 king jordan & andy conley office hours by...
TRANSCRIPT
![Page 1: 1 Computational Genomics BIOL 8803 A Spring 2011 King Jordan & Andy Conley Office hours by appointment: king.jordan@biology.gatech.edu 404-385-2224 Cherry](https://reader033.vdocuments.site/reader033/viewer/2022051516/56649ef45503460f94c07ce2/html5/thumbnails/1.jpg)
1
Computational Genomics
BIOL 8803 A Spring 2011
King Jordan & Andy Conley
Office hours by appointment:[email protected]
404-385-2224Cherry Emerson 215
Cherry Emerson 217
![Page 2: 1 Computational Genomics BIOL 8803 A Spring 2011 King Jordan & Andy Conley Office hours by appointment: king.jordan@biology.gatech.edu 404-385-2224 Cherry](https://reader033.vdocuments.site/reader033/viewer/2022051516/56649ef45503460f94c07ce2/html5/thumbnails/2.jpg)
2
Genomics involves the characterization & study of complete genomes
Genomics = experimentation + computation
Computers needed to handle large data sets (obvious, perhaps trivial)
Computers needed to convert information into knowledge
Genome sequencing efforts (along with functional genomics efforts) yield information alone
Computational tools must be applied to bring light to that information
Genomics & Computation
![Page 3: 1 Computational Genomics BIOL 8803 A Spring 2011 King Jordan & Andy Conley Office hours by appointment: king.jordan@biology.gatech.edu 404-385-2224 Cherry](https://reader033.vdocuments.site/reader033/viewer/2022051516/56649ef45503460f94c07ce2/html5/thumbnails/3.jpg)
3
ATGTCTCTGAGGAGCGGCGGGCGGCGGCGCGCGGACCCAGGCGCGGATGGCGAGGCCAGCAGGGATGATG GCGCCACTTCCTCAGTTTCGGCACTCAAGCGCCTGGAACGGAGTCAGTGGACGGATAAGATGGATTTGCG GTTTGGTTTTGAGCGGCTGAAGGAGCCTGGTGAGAAGACAGGCTGGCTCATTAACATGCATCCTACCGAG ATTTTAGATGAAGATAAGCGCTTAGGCAGTGCAGTGGATTACTACTTTATTCAAGATGACGGAAGCAGAT TTAAGGTGGCTTTGCCCTATAAACCGTATTTCTACATTGCGACCAGAAAGGGTTGTGAGCGAGAAGTTTC ATCTTTTCTCTCCAAGAAGTTTCAGGGCAAAATTGCAAAAGTGGAGACTGTCCCCAAAGAGGATCTGGAC TTGCCAAATCACTTGGTGGGTTTGAAGCGAAATTACATCAGGCTGTCCTTCCACACTGTGGAGGATCTTG TCAAAGTGAGGAAGGAGATCTCCCCTGCCGTGAAGAAGAACAGGGAGCAGGATCACGCCAGCGACGCGTA CACAGCTCTGCTTTCCAGTGTTCTGCAGAGGGGCGGTGTCATTACTGATGAAGAGGAAACCTCTAAGAAG ATAGCTGACCAGTTGGACAACATTGTGGACATGCGCGAGTACGATGTTCCCTACCACATCCGCCTCTCCA TTGACCTGAAGATCCACGTGGCTCATTGGTACAATGTCAGATACCGAGGAAATGCTTTTCCGGTAGAAAT CACCCGCCGAGATGACCTTGTTGAACGACCTGACCCTGTGGTTTTGGCATTTGACATTGAGACGACCAAA CTGCCCCTCAAGTTTCCTGATGCTGAGACAGACCAGATTATGATGATTTCCTACATGATCGATGGCCAGG GCTACCTCATCACCAACAGGGAGATTGTTTCAGAAGATATTGAAGATTTTGAGTTCACCCCCAAGCCAGA ATATGAAGGCCCCTTTTGTGTCTTCAATGAACCCGATGAGGCTCATCTGATCCAAAGGTGGTTTGAACAC GTCCAGGAGACCAAACCCACCATCATGGTCACCTACAACGGGGACTTTTTTGACTGGCCATTTGTGGAGG CCCGGGCAGCAGTCCACGGTCTGAGCATGCAGCAGGAGATAGGCTTCCAGAAGGACAGCCAGGGGGAGTA CAAGGCGCCCCAGTGCATCCACATGGACTGCCTCAGGTGGGTGAAGAGGGACAGTTACCTTCCTGTGGGC AGTCATAATCTCAAGGCGGCCGCCAAGGCCAAGCTAGGCTATGATCCCGTGGAGCTAGACCCGGAGGACA TGTGCCGGATGGCCACGGAGCAGCCCCAGACTCTGGCCACGTATTCTGTGTCAGATGCTGTCGCCACTTA CTACCTGTACATGAAGTACGTCCACCCATTCATCTTTGCTCTGTGCACCATTATTCCCATGGAGCCCGAC GAGGTGCTGCGGAAGGGCTCTGGCACTCTGTGTGAGGCCTTGCTGATGGTGCAGGCCTTCCACGCCAACA TCATCTTCCCCAACAAGCAAGAGCAGGAGTTCAATAAGCTGACGGACGACGGACACGTGCTGGACTCTGA GACCTACGTCGGGGGCCACGTGGAGGCCCTCGAGTCTGGGGTTTTCCGCAGCGATATCCCTTGCCGGTTT AGGATGAATCCTGCCGCCTTTGACTTCCTGCTGCAGCGGGTTGAGAAGACCTTGCGCCACGCCCTTGAGG AAGAGGAGAAAGTGCCTGTGGAGCAAGTCACCAACTTTGAAGAGGTGTGTGATGAGATTAAGAGCAAGCT TGCCTCCCTGAAGGACGTTCCCAGCCGCATCGAGTGTCCACTCATCTACCACCTGGACGTGGGGGCCTGA
![Page 4: 1 Computational Genomics BIOL 8803 A Spring 2011 King Jordan & Andy Conley Office hours by appointment: king.jordan@biology.gatech.edu 404-385-2224 Cherry](https://reader033.vdocuments.site/reader033/viewer/2022051516/56649ef45503460f94c07ce2/html5/thumbnails/4.jpg)
4
Experimentation:1. Extract DNA from biological sample2. Produce (characterize) sequence from extracted DNA
Computation:1. Interpret (read) results from sequencing reactions2. Output experimental results in human/computer readable format3. Assemble sequence fragments into contiguous sequences (contigs)4. Find (predict) gene locations in raw sequence (exon/intron boundaries)5. Annotate (predict) the function of the genes6. Compare genome sequences within and between species7. Create databases that allow for searching and dissemination of
genome annotations
Therefore:Computation is more critical to genomics than experimentation!
Experimentation vs. Computation
![Page 5: 1 Computational Genomics BIOL 8803 A Spring 2011 King Jordan & Andy Conley Office hours by appointment: king.jordan@biology.gatech.edu 404-385-2224 Cherry](https://reader033.vdocuments.site/reader033/viewer/2022051516/56649ef45503460f94c07ce2/html5/thumbnails/5.jpg)
5
In this class, you the students will complete all of the computational phases of a complete (microbial) genome project
Starting with unassembled genome sequence data
Haemophilus haemolyticus provided by the Centers for Disease Control
Finishing with a publicly available genome sequence browser
This course is unlike any course you have had before
This course is entirely practical
This course is centered on work and results
This course is real – you will be solving an actual problem with real data
Reality-based course
![Page 6: 1 Computational Genomics BIOL 8803 A Spring 2011 King Jordan & Andy Conley Office hours by appointment: king.jordan@biology.gatech.edu 404-385-2224 Cherry](https://reader033.vdocuments.site/reader033/viewer/2022051516/56649ef45503460f94c07ce2/html5/thumbnails/6.jpg)
6
Why run a course like this?
This course meets a specific need for more practical training that has been articulated by Bioinformatics students and faculty
Real world training on the most up-to-date technological platforms – e.g. we will analyze 454 sequence data and use the latest in analytical (computational) tools
There is no way to ‘spoon-feed’ this kind of knowledge and experience to students (‘sage on the stage’ will not work here)
The only way to relate these skills is to have you do them yourselves – this is the ultimate ‘active learning’ course
The burden of making this course successful will be placed squarely on the students
![Page 7: 1 Computational Genomics BIOL 8803 A Spring 2011 King Jordan & Andy Conley Office hours by appointment: king.jordan@biology.gatech.edu 404-385-2224 Cherry](https://reader033.vdocuments.site/reader033/viewer/2022051516/56649ef45503460f94c07ce2/html5/thumbnails/7.jpg)
7
The corporate model
In order to facilitate this novel pedagogical model, we will be adopting a corporate model for the course
Chief Executive Officer (CEO) – King Jordan
Chief Operating Officer (COO) – Andy Conley
Chief Information Officer (CIO) – Troy Hilley (behind the scenes)
Share holders – Leonard Mayer and the Meningitis Lab at the CDC
Management & Employees – you the students
Consultants – expert guest lecturers
![Page 8: 1 Computational Genomics BIOL 8803 A Spring 2011 King Jordan & Andy Conley Office hours by appointment: king.jordan@biology.gatech.edu 404-385-2224 Cherry](https://reader033.vdocuments.site/reader033/viewer/2022051516/56649ef45503460f94c07ce2/html5/thumbnails/8.jpg)
8
Corporate responsibilities
CEO – establish plan of attack, assemble team, provide resources, delegate activities
COO – oversee and inform all use of technology, liaison between employees (i.e. students) and CEO and CIO, runs software
CIO – maintain and run hardware, install software, trouble-shoot
Share holders – set up problem and provide raw data
Consultants – provide employees with expert guidance on the use of technology and analysis of data
![Page 9: 1 Computational Genomics BIOL 8803 A Spring 2011 King Jordan & Andy Conley Office hours by appointment: king.jordan@biology.gatech.edu 404-385-2224 Cherry](https://reader033.vdocuments.site/reader033/viewer/2022051516/56649ef45503460f94c07ce2/html5/thumbnails/9.jpg)
9
Guest lecturers (consultants) [i]
Leonard Mayer - CDC Meningitis Laboratory - Haemophilus haemolyticus
Scott Sammons - CDC Bioinformatics Core Facility - Bioinformatics of 454 Genome Sequencing
Andrey Kislyuk - Georgia Tech Bioinformatics - Genome Assembly
Mark Borodovsky - Georgia Tech BME & CSE - Gene Prediction
![Page 10: 1 Computational Genomics BIOL 8803 A Spring 2011 King Jordan & Andy Conley Office hours by appointment: king.jordan@biology.gatech.edu 404-385-2224 Cherry](https://reader033.vdocuments.site/reader033/viewer/2022051516/56649ef45503460f94c07ce2/html5/thumbnails/10.jpg)
10
Guest lecturers (consultants) [ii]
Leonardo Mariño-Ramírez – National Center for Biotechnology Information (NCBI) – Functional genomics
Xin Wang - CDC Meningitis Laboratory – Functional genomics of Haemophilus haemolyticus
Alejandro Caro - Georgia Tech Biology – Comparative Genomics
Andy Conley - Georgia Tech Bioinformatics - Generic Model Organism Database Software Platform
![Page 11: 1 Computational Genomics BIOL 8803 A Spring 2011 King Jordan & Andy Conley Office hours by appointment: king.jordan@biology.gatech.edu 404-385-2224 Cherry](https://reader033.vdocuments.site/reader033/viewer/2022051516/56649ef45503460f94c07ce2/html5/thumbnails/11.jpg)
11
Employee (student) responsibilities
Technology acquisition – learn relevant approaches and tools including the underlying theory
Choice of appropriate technology – evaluate the performance of different tools, choose the best tool(s) for the job
Explanation of technology acquisition and choice – clearly relate to your peers why you made the choices you did, relative assessment of performance should be used here, demo showing preliminary results, if complementary approach needed then explain
Knowledge distribution – for each group, ensure that classmates from other groups also acquire knowledge and experience in your domain of expertise
Perform analysis – do the actual analysis your group is charged with, report the results to the class in a lecture and on the Wiki, get the results into the genome browser, iterate as needed
![Page 12: 1 Computational Genomics BIOL 8803 A Spring 2011 King Jordan & Andy Conley Office hours by appointment: king.jordan@biology.gatech.edu 404-385-2224 Cherry](https://reader033.vdocuments.site/reader033/viewer/2022051516/56649ef45503460f94c07ce2/html5/thumbnails/12.jpg)
12
Benchmarks for success1. Actively engage in classroom discussions and lab work
2. Demonstrate that your group understands the theory and the state-of-the art for your specific analytical phase (Group Presentation I)
3. Clearly justify your choice of the tool(s) to be used for your analytical phase, demonstrate comparative performance (Group Presentation II)
4. Do analysis, produce & document results, present results and integrate into genome browser
5. Work closely as needed to help other groups succeed in their phases and to help other groups acquire knowledge and experience in your domain
6. Innovation is key – you must show innovations & improvements over
previous years classes
![Page 13: 1 Computational Genomics BIOL 8803 A Spring 2011 King Jordan & Andy Conley Office hours by appointment: king.jordan@biology.gatech.edu 404-385-2224 Cherry](https://reader033.vdocuments.site/reader033/viewer/2022051516/56649ef45503460f94c07ce2/html5/thumbnails/13.jpg)
13
What’s new this semester
New organism Haemophilus haemolyticus – previous 3 years used Neisseria
meningitidis (course is a collaboration with the CDC Meningitis Laboratory)
Less biological information & insight available
But …
No completely sequence genome of Haemophilus haemolyticus available
This year’s course is wide open: new challenges & tremendous opportunity
New deliverable: draft of a manuscript – will be put together in close collaboration with members of the Meningitis Lab
![Page 14: 1 Computational Genomics BIOL 8803 A Spring 2011 King Jordan & Andy Conley Office hours by appointment: king.jordan@biology.gatech.edu 404-385-2224 Cherry](https://reader033.vdocuments.site/reader033/viewer/2022051516/56649ef45503460f94c07ce2/html5/thumbnails/14.jpg)
14
Students will break into 5 groups, each of which will be charged with completing one specific computational phase of the project
1. Genome Assembly
2. Gene Prediction
3. Gene Functional Annotation
4. Comparative Genomics
5. Production of a Genome Browser
Group activities
![Page 15: 1 Computational Genomics BIOL 8803 A Spring 2011 King Jordan & Andy Conley Office hours by appointment: king.jordan@biology.gatech.edu 404-385-2224 Cherry](https://reader033.vdocuments.site/reader033/viewer/2022051516/56649ef45503460f94c07ce2/html5/thumbnails/15.jpg)
15
Group composition
Bioinformatics students have varying backgrounds and skill sets
E.g. Some of you come from math/physics, some may be biologists, others may be programmers (of course the ideal student will have a combination of these skills)
Groups should be made of up of individuals with complementary skill sets:
Each group should have one or more members who can program efficiently
Each group should have members who can work comfortably in the Unix/Linux command line environment
Each group should have members with biological training and perspective
Ideally, groups should have members with specific-skills relevant to each task – e.g. gene finding experience for gene prediction & database experience for the genome browser group – but students will also want to join groups that provide an opportunityto learn new skills (2 groups per student)
![Page 16: 1 Computational Genomics BIOL 8803 A Spring 2011 King Jordan & Andy Conley Office hours by appointment: king.jordan@biology.gatech.edu 404-385-2224 Cherry](https://reader033.vdocuments.site/reader033/viewer/2022051516/56649ef45503460f94c07ce2/html5/thumbnails/16.jpg)
16
Group seed members(please arrange to see Andy)
1. Genome Assembly – Shiyuyun Tang, Shrutii Sarda
2. Gene Prediction – Tianjun Ye, Vani Rajan
3. Functional Annotation – Kevin Lee, Shaopu Qin
4. Comparative Genomics – Erin Cook, Racchit Thapliyal
5. Genome Browser – Aswathy Sebastian, Robert Petit
![Page 17: 1 Computational Genomics BIOL 8803 A Spring 2011 King Jordan & Andy Conley Office hours by appointment: king.jordan@biology.gatech.edu 404-385-2224 Cherry](https://reader033.vdocuments.site/reader033/viewer/2022051516/56649ef45503460f94c07ce2/html5/thumbnails/17.jpg)
17
Group member questionnaire
Programming Unix/Linux Biology Database
Shiyuyun Tang...
Kevin LeeErin Cook
.
.
Robert Petit...
Aswathy Sebastion...
![Page 18: 1 Computational Genomics BIOL 8803 A Spring 2011 King Jordan & Andy Conley Office hours by appointment: king.jordan@biology.gatech.edu 404-385-2224 Cherry](https://reader033.vdocuments.site/reader033/viewer/2022051516/56649ef45503460f94c07ce2/html5/thumbnails/18.jpg)
18
No freeloaders
Active participation by all group members is required
Delegation of workload within groups will be entirely determined by the groups
Group members should invest substantial time and effort upfront to ensure optimal analytical design strategy and workflow
If problems arise in terms of effort distribution – i.e. if individual members are not contributing sufficiently – then there are 3 successive levels of control to address this:
1. Work to resolve issue within group (use peer pressure)
2. Consult with COO Andy Conley as to how best resolve issue
3. If steps 1 and then 2 fail, consult with me and I will address the issue
![Page 19: 1 Computational Genomics BIOL 8803 A Spring 2011 King Jordan & Andy Conley Office hours by appointment: king.jordan@biology.gatech.edu 404-385-2224 Cherry](https://reader033.vdocuments.site/reader033/viewer/2022051516/56649ef45503460f94c07ce2/html5/thumbnails/19.jpg)
19
If You Slack Off I Will KnowAnd Your Grade Will SufferAs A Result – This Class is
NOT an Automatic A1. Showing up Late to Class
2. Missing Class
3. Not Being Engaged in Class
4. Not Contributing to Group Efforts
5. Blind/Mis-informed Use of Tools
6. Copying From Previous Years Classes
![Page 20: 1 Computational Genomics BIOL 8803 A Spring 2011 King Jordan & Andy Conley Office hours by appointment: king.jordan@biology.gatech.edu 404-385-2224 Cherry](https://reader033.vdocuments.site/reader033/viewer/2022051516/56649ef45503460f94c07ce2/html5/thumbnails/20.jpg)
20
Sharing knowledge across groups
Each group is ultimately responsible for one and only one phase of the genome project
This means that for much of the course students will not be actively engaged in computational genomics problem solving
How you choose to spend this time will determine to a great extent how much you get out of the course
By no means should you wait until your part of the course to start working on your problem – research into your area and the tools available should begin right away
In addition, groups will be responsible for sharing the knowledge they gain with members of other groups
The process will also involve active learning and will take the form of in class laboratories and demonstrations that will be conducted by each group (more to follow on this)
![Page 21: 1 Computational Genomics BIOL 8803 A Spring 2011 King Jordan & Andy Conley Office hours by appointment: king.jordan@biology.gatech.edu 404-385-2224 Cherry](https://reader033.vdocuments.site/reader033/viewer/2022051516/56649ef45503460f94c07ce2/html5/thumbnails/21.jpg)
21
Group presentations
Each group will be responsible for making a series of class presentations, labs and demos
1. Background & Strategy – explain theoretical background for what you will do, related state of the art, lay-out your general strategy
2. Tool Demo & Preliminary Results – explain and justify your selection of the best tool(s) to use to solve the problem, should include comparative results analysis, demo the tool in such a way that all students can use it, present some preliminary results
3. Results – give a detailed presentation of your final results, show carefully what was done and how final results were achieved, illustrate the kinds of problems that arose and how they were dealt with, results should be reproducible based documentation provided on Wiki page
![Page 22: 1 Computational Genomics BIOL 8803 A Spring 2011 King Jordan & Andy Conley Office hours by appointment: king.jordan@biology.gatech.edu 404-385-2224 Cherry](https://reader033.vdocuments.site/reader033/viewer/2022051516/56649ef45503460f94c07ce2/html5/thumbnails/22.jpg)
22
Labs & Demos
In order to enable the sharing of knowledge and experience between groups, each group will be responsible for conducting one in class laboratory session and one in class demonstration
The lab sessions will take place during the second group presentation
In the lab sessions, each group will come up with a series of computational exercises that can be started in class and completed in or out of class
Groups will be responsible for coming up with a rubric by which students from other groups work will be evaluated
Group leading the demo will be responsible for assigning grades to each other group
The demo sessions will take place during the third group presentation and may extend (as needed) into the fourth presentation
![Page 23: 1 Computational Genomics BIOL 8803 A Spring 2011 King Jordan & Andy Conley Office hours by appointment: king.jordan@biology.gatech.edu 404-385-2224 Cherry](https://reader033.vdocuments.site/reader033/viewer/2022051516/56649ef45503460f94c07ce2/html5/thumbnails/23.jpg)
23
Manuscript preparation
The class manuscript will be prepared in close collaboration with the Meningitis
Lab members from the CDC (Lee Katz)
Each group will be responsible for writing up a part of the manuscript
Groups must work together to ensure coherence of the manuscript – it will not
be sufficient for each group to write up their section and submit
I recommend that each group have (at least) one person responsible for
the integration of their write up with the other groups
I will expect to see an outline of the manuscript mid-semester from these
group representatives
![Page 24: 1 Computational Genomics BIOL 8803 A Spring 2011 King Jordan & Andy Conley Office hours by appointment: king.jordan@biology.gatech.edu 404-385-2224 Cherry](https://reader033.vdocuments.site/reader033/viewer/2022051516/56649ef45503460f94c07ce2/html5/thumbnails/24.jpg)
24
Group evaluation & grading(see syllabus for details)
1. All class members will be evaluated on their overall class participation including lab exercises – 12.5% of final grade
2. Group presentation I – 12.5% of final grade
3. Group presentation II & Lab – 12.5% of final grade
4. Group presentation III & Demo – 12.5% of final grade
5. Final Results and Manuscript – 50% of final grade
![Page 25: 1 Computational Genomics BIOL 8803 A Spring 2011 King Jordan & Andy Conley Office hours by appointment: king.jordan@biology.gatech.edu 404-385-2224 Cherry](https://reader033.vdocuments.site/reader033/viewer/2022051516/56649ef45503460f94c07ce2/html5/thumbnails/25.jpg)
25
Contingency plans
The coursework is inherently sequential & progressive
The successful completion of each phase of the analysis hinges upon the previous step
We will implement a series of contingency plans in the event that any given step in the analytical pipeline breaks down
E.g. if the assembly doesn’t work then we can provide an assembled genome, stripped of annotation, to the gene prediction group
Hopefully we will not have to resort to this (has not happened yet)
![Page 26: 1 Computational Genomics BIOL 8803 A Spring 2011 King Jordan & Andy Conley Office hours by appointment: king.jordan@biology.gatech.edu 404-385-2224 Cherry](https://reader033.vdocuments.site/reader033/viewer/2022051516/56649ef45503460f94c07ce2/html5/thumbnails/26.jpg)
26
Computational resources
The School of Biology has provided a dedicated Linux server for this course – compgenomics.biology.gatech.edu
In addition, all lab computers run Mac OSX with Unix terminals
We have installed a number of bioinformatics software packages on the server and on the lab computers – we can install more as needed
Andy Conley will describe this resource and the other lab facilities shortly
All systems and install requests are to be made through Andy Conley (NOT Troy Hilley – don’t bother Troy)
![Page 27: 1 Computational Genomics BIOL 8803 A Spring 2011 King Jordan & Andy Conley Office hours by appointment: king.jordan@biology.gatech.edu 404-385-2224 Cherry](https://reader033.vdocuments.site/reader033/viewer/2022051516/56649ef45503460f94c07ce2/html5/thumbnails/27.jpg)
27
Wiki Page
There is a course Wiki Page http://compgenomics2011.biology.gatech.edu
Lectures, readings and all course information can be found on the page
Andy will explain the page shortly
All protocols and results are to be carefully documented on the page
The first things to do today are:1. Choose up teams (decide on group composition)2. Build your personal Wiki page profiles3. Log into the compgenomics server