מכון טכנולוגי לישראל–הטכניון

Technion – Israel Institute of Technology

ספרית הטכניוןThe Technion Library

ייקובס'ואן ג'ש ארווין וג"ע בית הספר ללימודי מוסמכיםIrwin and Joan Jacobs Graduate School

© All rights reserved

This work, in whole or in part, may not be copied (in any media), printed, translated, stored in a retrieval system, transmitted via the internet or other electronic means, except for "fair use" of brief quotations for academic instruction, criticism, or research purposes only. Commercial use of this material is completely prohibited.

©

כל הזכויות שמורות

, להפיץ באינטרנט, לאחסן במאגר מידע, לתרגם, להדפיס, )במדיה כלשהי(אין להעתיק , למעט שימוש הוגן בקטעים קצרים מן החיבור למטרות לימוד, חיבור זה או כל חלק ממנו

.ביקורת או מחקר, הוראה .שימוש מסחרי בחומר הכלול בחיבור זה אסור בהחלט

Structure - Function

Investigations of the MntA and

MntC Proteins from

Mesophilic and Thermophilic

Cyanobacteria

Avital Lahav

Structure - Function

Investigations of the MntA and

MntC Proteins from

Mesophilic and Thermophilic

Cyanobacteria

Research Thesis

In Partial Fulfillment of The

Requirements for the

Degree of Master of Science in Chemistry

Avital Lahav

Submitted to the Senate of the Technion – Israel

Institute of Technology

Nisan, 5769 Haifa April 2009

The research was done under the supervision of Prof. Noam

Adir in the Schulich Faculty of Chemistry

I wish to thank my supervisor Prof. Noam Adir

For his help, guidance and understanding during all my

research period.

The generous financial help of the Technion is gratefully

acknowledged

CONTENTS

Abstract 1

Abbreviations 3

1. Introduction 5

1.1 Cellular function of metal ions 5

1.2 Cellular function of manganese 5

1.3 Photosynthetic oxygen evolution 6

1.4 Manganese function in PSII 7

1.5 ABC transporters 8

1.6 Possible mechanism of the ABC transporter 9

1.7 The MntABC manganese transport system 11

1.8 The MntC Solute Binding Protein (SBP) 12

1.9 The MntA Nucleotide Binding Domain (NBD) 13

1.10 Single crystal X- ray crystallography 14

1.10.1 Protein crystallization 15

1.10.2 Basic concepts 15

1.10.2.1 The unit cell 15

1.10.2.2 The asymmetric unit 15

1.10.2.3 The space group 16

1.10.2.4 The reciprocal lattice 16

1.10.2.5 Bragg's law and Miller indices 17

1.10.2.6 The structure factor, Fhkl 18

1.10.3 X-ray source 18

1.10.4 Fourier transformation 18

1.10.5 Scaling and postrefinement 19

1.10.6 Determination of molecule numbers in the unit cell 19

1.10.7 Solution to the phase problem 20

1.10.8 Protein's preparation 20

1.10.9 Crystal mounting 21

2. Research goals 22

3. Research plan 23

4. Materials 24

4.1 General reagents 24

CONTENTS (cont.)

4.2 Enzymes 25

4.3 Biochemical, Recombinant DNA technology and crystallization kits 25

4.4 Other materials 26

4.5 Growth media 26

4.6 Cell lines 26

4.7 Plasmidial vectors and oligonucleotides 27

4.7.1 Vector description 27

4.7.2 Oligonucleotides 27

4.8 Buffers and solutions 28

4.8.1 Solutions for electrophoresis of DNA on agarose gel 28

4.8.2 Buffer for ATP hydrolysis detection 28

4.8.3 Buffers used for protein isolation, purification and crystallization 28

4.8.3.1 Nickel column buffers 29

4.8.3.2 HPLC buffers 29

4.8.3.3 Buffers for dialysis and protein dilution 29

4.8.3.4 Mother liquors 29

4.8.4 Buffers used for SDS-PAGE 29

4.9 Gel recipes 30

4.10 Column material and sources 30

5. Methods 31

5.1 Molecular methods 31

5.1.1 DNA extraction from synechocystis sp. 6803 31

5.1.2 Preparation of competent cells 31

5.1.3 Polymerase Chain Reaction (PCR) 31

5.1.4 Agarose gel electrophoresis of DNA 32

5.1.5 DNA digestion by restriction enzymes 32

5.1.6 Determination of DNA concentration 32

5.1.7 Ligation of PCR product into cloning vector 32

5.1.8 Electro- transformation 32

5.1.9 DNA sequence determination 33

5.2 Protein isolation 33

5.2.1 Overexpression of the MntC and MntA proteins 33

CONTENTS (cont.)

5.2.2 Isolation and primary purification of MntC and MntA proteins 34

5.2.3 SDS- PAGE analysis 34

5.2.4 Chromatographic analysis 34

5.2.4.1 AEC- HPLC and CEC- HPLC 34

5.2.4.1 SEC- HPLC 35

5.2.5 Protein concentration 35

5.2.6 Determination of protein concentration 35

5.2.7 Dialysis 36

5.2.8 Western blot 36

5.2.9 Mass spectroscopy 36

5.2.10 Circular Dichroism spectroscopy (CD) 36

5.2.11 Tryptophan fluorescence 37

5.2.12 Malachite green phosphate assay kit 37

5.3 Computation software 37

5.3.1 Data reduction, scaling and visual analysis 37

5.3.1.1 Mosflm 37

5.3.1.2 CCP4 37

5.3.1.3 PyMol 37

5.3.2 Computational programs 37

5.3.2.1 BLAST 37

5.3.2.2 CLUSTAL X 38

5.3.2.3 Generunner 38

5.3.2.4 Clone Manager 38

5.3.2.5 WebCutter 38

5.3.2.6 Innovagen Peptide property calculator 38

5.3.2.7 DICHROWEB 38

5.3.2.8 PredictProtein 38

5.3.2.9 The ConSeq Server 39

5.3.2.10 LOMETS 39

5.3.2.11 HHpred 39

6. Results 40

6.1 MntC 40

CONTENTS (cont.)

6.1.1 Cloning 40

6.1.2 Overexpression 40

6.1.3 The basic scheme of MntC isolation and purification 40

6.1.4 Crystallization 42

6.1.5 Data collection 43

6.1.6 Crystallization 43

6.2 MntA 45

6.2.1 Cloning and primary overexpression 45

6.2.2 Overexpression 45

6.2.3 Purification 47

6.2.4 Crystallization 49

6.2.5 Tryptophan fluorescence 49

6.2.6 Circular Dichroism (CD) 51

6.2.7 Malachite green phosphate assay 52

6.2.8 Computational modelling 53

7. Discussion 57

7.1 MntC 57

7.2 MntA 58

8. Conclusions and future plans 59

9. References 60

LIST OF FIGURES

Figure Title Page

1 Overall structure of PSII 6

2 Kok catalytic cycle for photosynthetic water oxidation by reduction of the

OEC of PSII 7

3 Structure model of the OEC of PSII 8

4 Crystal structures of bacterial ABC transporters 9

5 A general mechanism for transport 10

6 Topological scheme of ABC importers 12

7 Schematic showing residues in conserved subdomains of NBD1 and NBD2 of

human P-glycoprotein interacting with ATP 14

8 Crystal organization 16

9 Conditions that produce strong diffracted rays 17

10 Growing protein crystals by vapor diffusion 21

11 Research plan 23

12 Preparation of MntC for crystallization 40

13 Purification of MntC 41

14 SEC-HPLC marker plot 41

15 SDS-PAGE of MntC protein 42

16 MntC crystals 42

17 Diffractions presented by the Mosflm program 43

18 MntC model 44

19 Cell free extracts 45

20 Purified MntA effected by the different overexpressions 46

21 Western blot analysis of MntA 47

22 MntA purification 48

23 Preparation of MntA for crystallization 49

24 MntA crystals 49

25 MntA emission spectra 50

26 CD spectra results 51

27 Phosphate standards curve 52

28 Monomeric MntA model

54

LIST OF FIGURES (cont.)

29 Dimeric MntA model 55

30 Net charge of MntC from T. vulcanus 57

31 MntC structure electrostatics 57

LIST OF TABLES

Table Title Page

1 Plasmidial vectors and oligonucleotides 27

2 Oligonucleotides details 28

3 MntC overexpression 40

4 MntA overexpression attempts 46

5 MntA purification attempts 47

6 Secondary structure type comparison 51

7 MntA's malachite green phosphate assay 52

LIST OF EQUATIONS

Equation Title Page

1 Bragg’s law 17

2 Electron density as a Fourier series 19

3 Mattews coefficient 19

4 Protein concentration 35

1

ABSTRACT

Manganese (Mn) is accumulated in high concentrations in various eukaryotic organelles as

well as in the cytoplasm of prokaryotes. In the cyanobacterium Synechocystis sp. PCC 6803,

the high affinity import of Mn in to the cytoplasm is carried out by an ABC (ATP-binding

cassette) transporter.

This ABC transporter complex contains one or two transmembrane domains (MntB), one or

two nucleotide binding domains (NBDs) exposed to the cytoplasm (MntA), and a membrane-

associated periplasmic, substrate binding lipoprotein exposed to the cell surface (MntC).

The structure of the MntC protein has been determined using X-ray crystallography to a

resolution of 2.9Ǻ with manganese in the binding site. This structure showed the presence of

a disulfide bond between Cys219 and Cys268 near the Mn2+

binding site. However, due to the

low resolution of the structure, further investigation is required to fully understand this

proteins function. The most important issues are the exact role of the disulfide bond, that is a

specific characteristic of cyanobacterial manganese solute binding proteins, and the specificity

of the protein towards Mn verses other metal atoms of similar characteristics.

In parallel to the attempts to improve the resolution of the MntC protein from the mesophilic

cyanobacterium Synechocystis we started to investigate the homologous manganese solute

binding protein from the thermophilic cyanobacterium Thermosynechococcus vulcanus. The

rational for this was that perhaps the protein from a thermophilic organism (T. vulcanus grows

in a habitat of 60°C compared to the 20°-30oC habitat of Synechocystis) would yield a more

stable protein and allow for the improvement of the resolution of the MntC protein structure

to afford structural analysis of greater precision.

The mntC gene from Thermosynechococcus vulcanus was cloned and large amounts of highly

purified protein were obtained. Indeed crystals obtained from this protein diffracted to

intermediate resolution, but the structure was unsolvable due to the presence of a large

number of monomers in the asymmetric unit.

The transport mechanism of manganese ions is still unknown, although functionally important

residues are highly conserved among the NBDs, suggesting that the ABC transporters share a

common mechanism of coupling ATP hydrolysis to substrate transport. In order for us to

understand this mechanism and transport, we need to do extensive biochemical analysis

together with the structure determination of the entire MntABC transporter. To this end, we

cloned and overexpressed the MntA protein from Synechocystis sp. PCC 6803. We have

2

found that the protein is expressed in inclusion bodies that can be solubilized in 8M urea. We

managed to find the best conditions to resolubilize the protein and to prove that the protein

has been refolded correctly making it amenable for use in crystallization condition screening

but unfortunately crystals obtained from this protein have not yet yielded X-ray diffraction.

Here we describe the cloning, purification and crystallization attempts together with the

biochemical research of both the MntC protein from T. vulcanus, and the MntA protein from

Synechocystis sp. PCC 6803.

3

Abbreviations

ABC ATP-binding cassette

AEC-HPLC Anion exchange-high performance liquid chromatography

APS Ammonium persulfate

BT Bis- tris

CEC-HPLC Cation exchange-high performance liquid chromatography

CD

DM

Circular dichroism

n-dodecyl- β -D- maltoside

DNA Deoxyribonucleic Acid

dNTP Deoxyribonucleotide triphosphate

DTT D,1-dithiothreitol

E. coli Escherichia coli

ESRF European Synchrotron Radiation Facility

HPLC High performance liquid chromatography

MS Mass Spectrometry

IPTG Isopropyl β-D-thiogalactopyranoside

LB Luria Bertani media

MES 2-(N-morpholino) ethanesulfonic acid

NBD Nucleotide binding domain

OD Optical density

PCR polymerase chain reaction

PDB Protein data bank

PEG Polyethylene glycol

PSII Photosystem II

RPM Rounds per minute

SBP Substrate binding protein

SEC-HPLC Size exclusion-high performance liquid chromatography

SDS Sodium dodecyl sulfate

SDS-PAGE Sodium dodecyl sulfate polyacrylamide gel electrophoresis

TEMED N,N,N`,N`-tetra-methylethylendiamide

TMD Trans membrane domain

UV ultraviolet

4

5

1. Introduction

1.1 Cellular functions of metal ions

Metal ions play vital roles in the catalytic function of many enzymes, in gene regulation and

in free radical homeostasis [1]. Metals are continuously cycled through organisms and their

environment, yet cellular metal concentrations remain more or less constant. Metal

homeostasis is important due to the hazards in metal ion overload as toxic free radicals are

produced from redox reactions that can be catalyzed by metal ions. The required metal-ion

concentration is maintainable primarily by the transport activities across the plasma and

organelle membranes. The molecular identification of metal ion transporters is of great

importance, in particular since an increasing number of human diseases are thought to be

related to disturbances in metal ion homeostasis, including metal ion overload and deficiency

disorders (i.e. anaemia, haemochromatosis, Menkes disease, Wilson's disease), and

neurodegenerative diseases (i.e. Alzheimer's, Friedreich's ataxia and Parkinson's diseases) [2].

Furthermore, susceptibilities to mycobacterial infections are caused by metal ion transporter

defects.

1.2 Cellular Function of manganese

Manganese (Mn) is required in all organisms for normal growth and crucial metabolic

pathways [3, 4]. The most common oxidation states of Mn are: +2,+3,+4,+6 and +7, though

oxidation states from +1 to +7 are observed.

The redox potential of Mn favors its use in a number of protein complexes, especially those

involved in electron transfer. For example, Mn is necessary for the synthesis of secondary

metabolites, for bacterial sporulation and for the production of various antigens and toxins [5].

To date, only a handful of enzymes that require Mn for their activities have been

characterized. These include redox enzymes such as Mn-superoxide dismutase and Mn-

catalase, as well as metabolic enzymes such as pyruvate carboxylase and

phosphoenolpyruvate carboxykinase [3, 4].

In spite of the fact that manganese is necessary for survival and for normal vital functions of

most organisms, it can be also toxic at high levels for instance: manganese can cause a

poisoning syndrome in mammals, with neurological damage which is sometimes irreversible

[6]. Therefore, homeostasis of this metal ion is important.

6

1.3 Photosynthetic oxygen evolution

Photosystem II (PSII) is a protein complex in the thylakoid membranes of oxygenic

photosynthetic organisms including cyanobacteria, eukaryotic algae and green plants. During

photosynthesis, the oxygen evolving complex (OEC), located in the lumen exposed domain of

PSII, catalyzes oxygen evolution, from the dissociation of water (H2O) [7]. Protons from H2O

are released into the lumen, establishing the membrane pH gradient (from the lumen to the

stroma) necessary for ATP synthesis (Figure 1). Electrons are removed from the H2O and

serve to form reducing agents.

Solar energy absorbed by antenna system is transferred to the chlorophyll P680. The excited

P680* decays to the oxidized state, P680

+, by electron transfer to a pheophytin molecule (Pheo).

The charge-separated state is stabilized by electron transfer to a primary plastoquinone (PQ)

electron acceptor (QA), which functions as a one-electron carrier, and then to a secondary PQ

electron acceptor (QB) [8, 9], which after reduction by two electrons and double protonation

by protons from the stromal side of the membrane, forms plastohydroquinone (PQH2) which

leaves the reaction center. Then, the QB site is reoccupied by another PQ molecule, and P680+

is being reduced back to P680 by electrons from the oxygen evolving complex (OEC). During

each catalytic cycle, two PQ molecules are reduced and protonated, two water molecules are

oxidized, four protons are removed from the stroma and later transferred to the lumen to be

utilized for ATP formation.

Figure 1: Overall structure

of PSII. The major

polypeptide subunits and ET

pathway (marked by solid

arrows) are shown. Broken

arrows indicate secondary

ET pathways, which may

play a photoprotective role.

The figure is adopted from

Sprovierol M. E. (2007).

7

1.4 Manganese function in PSII

In oxygenic photosynthetic organisms, Mn is absolutely required for light-induced

dissociation of water to molecular oxygen [10]. The OEC of PSII contains four Mn atoms,

one calcium atom as well as one chloride atom that play important redox roles during the

oxidation of water, many of the ligands for this four - Mn ensemble are provided by amino

acid residues in the D1 polypeptide that form the catalytic core of the OEC. In addition, this

cluster is stabilized by a '33 kDa' manganese-stabilizing protein (MSP) [11]. It is also known

that the assembly of the functional Mn cluster in the PSII complex requires light

(photoactivation) [12].

The oxygen evolution by water cleavage is catalyzed according to the "Sn-state" catalytic

cycle (Figure 2) proposed by Joliot and Kok [13, 14], where n indicates the number of

oxidizing equivalents stored by Mn cluster. This catalytic cycle is composed of five

transitions between four states, in each transition between the four states S0- S4 an electron is

removed before releasing O2 between the S4 state and S0 state.

According to recent renovated models, the architecture of the Photosynthetic OEC has been

proposed [8, 15]. The high-valent Mn center contains the oxidation states III and IV and five

or six ligands, respectively. Mn(4) and Ca+2

are bound to the substrate water molecules

(Figure 3). The respective substrate oxygen atoms are 2.72Ǻ apart in the S1 state and might be

brought closer together after deprotonation of the Mn bound water to achieve O–O bond

formation during the S4- S0 transition. E333 amino acid from the subunit D1 (D1-E333) is

ligated to both Mn(3) and Mn(2), and there are hydrogen bonds between the carboxylate

group of D1-E333 and the protonated carboxylate group of CP43-E354. D1-D342, CP43-

E354 and D1-D170 are bonded to Mn(1), Mn(3) and Mn(4), respectively. Both D1- E189 and

D1-H332 are ligated to Mn(2). In addition, there is a calcium-bound chloride ion positioned

Figure 2: Kok catalytic cycle for photosynthetic water oxidation by reduction of the

OEC of PSII. Dotted arrows indicate reactions that relax the system to stable state S1

within minutes. For simplicity, deprotonation reactions steps are omitted.

The figure is adopted from Sprovierol M. E. (2007).

8

3.1Ǻ from Ca+2

and 3.2Ǻ from the phenoxy oxygen of D1-Y161, which has been shown to be

the redox-active tyrosine [8].

.

1.5 ABC transporters

Transporters catalyze the thermodynamically unfavorable translocation of substrates against a

transmembrane concentration gradient through the coupling to a second, energetically

favorable process. One of the most widespread families of transporters, the ABC family, uses

the binding and hydrolysis of ATP to power a specific substrate translocation. The ABC

transporter complex contains one or two trans membrane domains (TMD), one or two

nucleotide binding domains (NBD) exposed to the cytoplasm to transfer energy for the

transport and sometimes a membrane-associated periplasmic, substrate binding protein (SBP)

exposed to the cell surface [16, 17, 18, 19].

ABC transporters diverse with respect to physiological function and even TMDs have distinct

primary sequences and can vary in the number of transmembrane helices. What ties the family

together are two highly conserved NBDs that contain critical sequence motifs for ATP

binding and hydrolysis. ABC transporter family includes importers and exporters depending

on the direction of translocation of their substrate. Exporters are found in both prokaryotes

and eukaryotes, where they extrude diverse substrates, including drugs and antibiotics from

Figure 3: Structural model of the OEC of PSII. Water molecules are coordinated to Mn(4) and

Ca2+

, respectively. All amino acid residues correspond to the D1 protein subunit unless otherwise

indicated.

The figure is adopted from Sprovierol M. E. (2007).

9

the cytoplasm. Importers are found exclusively in prokaryotes and are involved in the uptake

of extracellular nutrients. Another difference between exporters and importers is that the

substrates of ABC exporters enter the translocation pathway from the cytoplasm or form the

lipid bilayer, whereas ABC importers require a SBP that captures the solutes and feeds them

to the external face of the transporter [18, 20, 21].

The SBP is either located in the periplasm of Gram-negative bacteria or maintained by a

cytoplasmic membrane associated N-terminal acylation anchor in the Gram-positive bacteria

[22, 23, 24].

Till now, the structure of ten ABC-transporters transferring seven different molecules have

been structurally characterized but they do not include those that participate in the transport of

metal ions [25] (Figure 4).

1.6 Possible mechanism of the ABC transporter

With the structures of eight ABC transporters available, a mechanistic scheme emerges

that rationalizes ATP-driven transport [18, 25, 35]. The key to unidirectional transport seems

to be the ATP-driven conversion of the inward-facing state. When the NBDs are open, the

Figure 4: Crystal structures of bacterial ABC transporters. Half of each

transporter is green, while the other half is blue (if NBDs and TMDs are separate

polypeptides, they are different shades of green or blue). If present, periplasmic

binding proteins that deliver substrate to the transporter are red.

The figure is adopted from Procko, E. et al (2009).

10

substrate-binding cavity formed by the TMDs faces inwards toward the cytosolic NBDs.

Binding of ATP molecules at the interface of the NBDs closes the gap between the conserved

ATP-binding motifs. As this gap closes, so does the distance between the attached TMD's

coupling helices, causing the TMDs to flip from the inward-facing to the outward-facing

conformation.

ABC exporters such as Savl866 [17] may then extrude bound substrate by presenting a cavity

of low affinity to the extracellular medium. In ABC importers, the rearrangements may not

only affect the TMDs, but probably propagate to the attached binding protein, whose lobes

they force apart, thus releasing bound substrate. The substrate may diffuse on a relatively

straight trajectory from the binding site through the open gate and into the translocation

pathway formed by the TMD's. For the NBDs to reopen, contacts at both ATPase sites need to

be weakened, likely requiring hydrolysis of both ATP molecules for transporters with 2

consensus sites. When the NBDs return to the open conformation, the substrate-binding cavity

also returns to facing the cytosol. ABC importers can now release the substrate, and ABC

exporters can now uptake the substrate from the cytosol (Figure 5).

Figure 5: A general mechanism for substrate transport. A. A

mechanism for substrate transport in bacterial importer. A substrate

binding protein is required to capture the solutes and feed them to the

external face of the transporter; B. A mechanism for substrate transport in

exporters. The substrate and the nucleotide binding site are both located on

the cytoplasmic side of the membrane.

The figure is adopted from Procko, E. et al (2009).

11

1.7 The MntABC manganase transport system

Manganese is accumulated in high concentrations in various eukaryotic organelles as well as

in the cytoplasm of prokaryotes, implying that the uptake of manganese must be carried out

by some energized pumping mechanism [3]. In the cyanobacteria, manganese is required for

the light-dependent oxidation of water into molecular oxygen by PSII [10].

In 1995, Bartsevich & Pakrasi [20] identified the MntABC operon encoding for an ABC

transporter of Mn from the periplasm to the cytoplasm of the cyanobacteria: Synechocystis sp.

PCC 6803. This was the first molecular identification of a Mn transporter protein in any

organism. Since then, more bacterial Mn transporters have been characterized [26]. The

MntABC operon includes three closely linked genes in the following order: mntC, which

encodes the substrate-binding protein (SBP); mntA, which encodes the ATP-binding protein

(NBD); and mntB, which encodes the transmembrane domain (TMD). This high affinity

manganese transport system is expressed only under conditions of limiting concentrations

(submicromolar) of manganese [20, 27, 28, 29]. At higher concentrations, there is another

system which transfers Mn ions [21, 23, 30]. The control of expression is performed on the

level of transcription by a two-component regulatory system performed by the ManS/ManR

proteins [31]. In addition, a second regulatory system mediated by the RfrA protein [32],

comes into play at higher concentrations of manganese. Thus, this controlled expression of

highly affinity and specificity transporter shows that cyanobacteria have evolved an elaborate

scheme to coordinate the uptake of the important manganese.

PSII complexes may require Mn+2

replenishment during PSII repair. However, PSII de novo

biogenesis occurs in the periplasm, and so under conditions of limiting concentrations of

manganese, the mntABC transport system would remove manganese from the periplasm to

the cytoplasm, hindering PSII biogenesis [24].

12

1.8 The MntC Solute Binding Protein (SBP)

The SBP component of this ABC system, the MntC protein, is a periplasic protein that is

tethered to the membrane via an N-terminal acylation. This form of linkage is prevalent in

Gram-positive bacteria, but not in the Gram-negative bacteria (to which cyanobacteria

belong) (Figure 6). This peculiarity could be due to the importance of manganese in

cyanobacteria [24, 33].

The structure of the MntC protein from Synechocystis sp. PCC 6803 has been recently

determined [24] using X-ray crystallography to a 2.9Å resolution. The protein was

crystallized as a trimer in the asymmetric unit.

The bound Mn ion is tetravalently coordinated by two histidine residues (His89, His154) via

their Nε2 nitrogen atoms, one aspartic acid (Asp295) via Oδ2 and one glutamic acid (Glu220)

via Oε1. The most important difference between MntC and previously determined SBPs is the

presence of a disulfide bond between Cys219 and Cys268 close to the metal binding site. The

cysteine residues at these positions are not conserved in the SBPs of cluster IX proteins which

are involved in metal ion transport, however, they were found in the sequence of

cyanobacterial MntC homologues such as Thermosynechococcus vulcanus. It was suggested

that the reduction of the disulfide bond can control the affinity of MntC towards Mn+2

. This

Figure 6: Topological scheme of ABC importers. A. ABC importers in Gram-

negative bacteria; B. ABC exporters in Gram-positive bacteria. The SBP

component is tethered to the membrane via an N-terminal acylation.

The figure is adopted from Kanteev, M. Master thesis (2007).

13

may imply that due to the special requirements of Mn in cyanobacteria the presence of the

disulfide bond may be important for determining the fate of the imported Mn ion.

1.9 The MntA Nucleotide Binding Domain (NBD)

The NBD component of this ABC system, the MntA protein, is a cytoplasmic protein that

provides the energy required to transfer Mn2+

into the cell by binding and hydrolyzing ATP.

The MntA nucleotide sequence contains Several conserved NBD's sequence motifs that are

either involved in ATP binding and hydrolysis or in facilitating crucial interfaces in the

assembled transporter [34, 35]:

The ‘P-loop’ (or ‘Walker-A’ motif) that binds the nucleotide.

The ‘Walker-B’ motif that provides a conserved glutamate (negatively charged)

residue that orchestrates the nucleophilic attack on ATP via a water molecule.

The ‘LSGGQ’ motif (is also called: ‘C-loop’ or ‘ABC signature motif’) contacts the

nucleotide in the ATP-bound state.

The ‘Q-loop’ is thought to sense the γ-phosphate and involved in the contact interface

with the TMD.

The ‘D-loop’ is involved in the contact interface between the two NBDs and possibly

in other tasks.

The ‘A-loop’ that provides an aromatic side chain residue that stacks against the

adenine of bound nucleotide [36].

The ‘switch motif’ that contains a histidine side chain thought to contribute to the

catalytic reaction.

The crystal structures of isolated NBDs have revealed a conserved fold. The arrangement of

these domains in the functional ABC transporter is also conserved.

A key element of this (‘head-to-tail’) arrangement is that the two NBDs present their

conserved sequence motifs at the shared interface: Two ATP-binding sites are mainly formed

between the P-loop of one NBD and the LSGGQ motif of the other and vice versa.

In the ATP-bound state of isolated NBDs or full transporters, two ATP molecules are

sandwiched at the NBD–NBD interface (Figure 7).

14

Most of the isolated NBDs are monomers in the absence of the TMDs.

Addition of ATP under non-hydrolyzing conditions (or non-hydrolyzable ATP analogues

such as AMP-PNP) causes these monomeric NBDs to dimerize [35]. The situation is different

in full transporters, where the crystal structures reveal continued contact between the NBDs

whether nucleotide is present or not.

1.10 Single crystal X-ray crystallography

Interpretation of X-ray diffraction is the most common experimental means of obtaining a

resolution of individual atoms in the large molecule. Obtaining atomic resolution of proteins

is not possible with visible light waves which are longer than the ~1.5Å distance between the

bonded of the molecule. Electromagnetic radiation of this wavelength falls into the X-ray

range of 0.1 to 100Å, allowing X-rays to be diffracted by atoms in molecules which can result

Figure 7: Schematic showing residues in conserved subdomains of NBD1 and

NBD2 of human P-glycoprotein interacting with ATP. ATP is sandwiched

between the Walker A and B, and A, Q and H loops of the NBD1 and the C

(signature) region and D-loop of the NBD2 (top) and vice versa (bottom).

The figure is adopted from Ambudkar, V. et al (2006).

15

in an atomic resolution description of the diffracting material [37]. The diffraction is analyzed

from crystals and not from a single molecule because most of the X-rays will pass through a

single molecule without being diffracted, and the few diffracted beams will be undetectable.

A crystal contains huge numbers of molecules in the specific orientations, such that diffracted

beams for all molecules can add up to produce a measurable signal of the diffracted X-ray

beam. The X-ray scattering is determined by the density of electrons within the crystal. From

the electron density it is possible (at high enough resolution) to discern the positions of atoms

and from them interpret the geometry of the bonds that make up the molecule being studied.

1.10.1 Protein crystallization

The dynamics within the cell, the mechanisms responsible for the dynamics, and the cell's

interactions with the exterior are equally important. To understand those, one need’s to

delineate how the building block molecules respond to chemical and physical forces, how the

responses are regulated, and how the responses are transmitted through the hierarchy of

assemblies and higher structures. These properties can be addressed by X-ray crystallography.

1.10.2 Basic concepts

1.10.2.1 The unit cell

The unit cell is the smallest translationally repeating unit that makes up the crystal. Its

dimensions are given as three lengths: a, b, and c, and three angles: α, β and γ. The

dimensions of the unit cell determine the spot spacing on the diffraction image: it is a

reciprocal relation, so the larger the cell the more spots present for each unit area. The

positions and symmetry of the diffraction spots can be used to determine the crystal system.

1.10.2.2 The asymmetric unit

The asymmetric unit is the minimal arrangement of molecules in the unit cell that can be

reproduced by symmetry operations. This is the smallest repeating component (Figure 8).

16

1.10.2.3 The space group

The space group is determined by the symmetry relationship of the asymmetric units within

the unit. A total of 230 space groups exist. They are combined from the following symmetry

operations: 2, 3, 4, and 6-fold rotation and screw axes, mirror planes, glide planes and also

centering of symmetry.

However, due to the chirality of all biological molecules, the space groups that contain a

centre of symmetry, a mirror plane or a glide plane are eliminated, leaving only 65 space

groups applicable to biological macromolecules [37].

1.10.2.4 The reciprocal lattice

The diffraction pattern consists of reflection (spots) on an orderly array on the film. The

spacing of reflections in the lattice on the film is called the "reciprocal lattice" because of its

inverse relationship to the real lattice which is composed of the spacing of the unit cells in the

crystal.

Because the real lattice spacing is inversely proportional to the spacing reflections, the

dimensions of the unit cell of a crystal can be calculated from the spacing of the reciprocal

lattice on the x-ray film.

Figure 8: Crystal organization.

The figure is adopted from http://www.rcsb.org/pdb/home/home.do

17

1.10.2.5 Bragg’s law and Miller indices

W.L. Bragg showed that a set of parallel planes with index h,k,l and interplanar spacing dhkl

produces a diffracted beam when x- rays of wavelength λ impinge upon the planes at an angle

θ and are reflected at the same angle (Figure 9), only if:

Equation 1: Bragg's law.

2dsinθ=nλ

n is an integer.

For other angles of incidence θ', that don’t fulfill this condition, waves emerging from

successive planes are out of phase, so they interfere destructively, and no beam emerges at

that angle.

Whenever a crystal is placed in an x-ray beam, it has to be rotated because only a subset of

planes will fulfill Bragg’s law. That is the reason why a diffraction experiment involves the

collection of diffraction images at different orientations of the crystal.

The directions of reflection, as well as the number of reflections, depend only on unit cell

dimensions and not upon the contents of the unit cell.

Miller indices: h,k,l, identify a particular set of equivalent, parallel planes (as described by

Bragg’s law) in the reciprocal lattice which cut the x, y, z axes of the unit cell respectively.

Figure 9: Conditions that produce strong diffracted rays. The dots represent two

parallel planes of lattice points with interplanar spacing d. Two rays are reflected from

them at angle θ.

The figure is adopted from www.microscopy.ethz.ch

18

1.10.2.6 The structure factor, Fhkl

The structure factor is a wave created by the superposition of many individual waves, each

resulting from diffraction by an individual atom in the unit cell.

1.10.3 X-ray source

In the conventional source, used in in-house diffractometers, a heated filament produces

electrons that are accelerated by an electric field. The electrons bombard a metal target, most

commonly copper, resulting in a high energy electron displacement of an electron from low-

lying orbital in the target metal atom. Then, an electron from higher orbital, drops into the

resulting vacancy, emitting its excess energy as an X- ray photon [37].

Synchrotron radiation is the electromagnetic radiation emitted by electrons (or any charged

particle) when they are forced into curved motion and in accelerators, driven by energy from

radio- frequency transmitters and maintained in circular motion by powerful magnets.

The X-rays produced by the source are next conditioned by a number of optical elements

installed between the source and sample position, delivering an optimized beam at the crystal.

Three types of devices are commonly used. A monochromator system selects a single

wavelength from the source spectrum. During data collection, the direct beam is blocked just

beyond the crystal by a metal beam stop. The power of X-rays emitted in synchrotron

beamlines is hundreds to thousands of times greater than a diffractometer source [38]. A

diffraction data set may take days to collect using a diffractometer as the source, while the

same information is obtainable in minutes at a synchrotron facility.

1.10.4 Fourier transformation

The electron density is a periodic function. Periodic functions are definable by Fourier as the

sum of sine and cosine functions. The Fourier transform describes the mathematical

relationship between molecule's electron clouds (real space: ρ(x,y,z)), and its diffraction pattern

(reciprocal space: F(h,k,l)) [37]. Fourier transform of structure factors possesses three

characteristic features: amplitude, frequency and phase. In the case of a diffraction pattern, the

frequency is that of the X-ray source used to create the diffraction. The amplitude is

obtainable from the intensity of reflection h,k,l since Fhkl α (Ihkl)1/2

, but the phase of each

reflection is not recorded on the film. This is known as the phase problem.

Because the Fourier transform operation is reversible, the electron density is in turn the

transform of the structure factors as follows:

19

Equation 2: Electron density as a Fourier series.

ρ(x,y,z) = V-1

ΣhΣkΣl |F(hkl)|e (-2πi(hx + ky +lz - α

hkl))

This equation shows the electron density (ρ(x,y,z)) as a function of the known amplitudes |F(hkl)|

and the unknown phases αhkl of each reflection represented by its Miller indices h, k, l. V is

the volume of the unit cell.

1.10.5 Scaling and postrefinement

A full data set may consist of hundreds of separate images taken at different orientations of

the crystal. Each spot on the image is assigned an index to determine the highest symmetry

lattice of the crystal- its space group. The next stage of the data processing is the measurement

of the intensities of the spots. Intensities of diffracted spots vary from one image to the next as

a result of variability in both the diffracting power of crystals and the intensity of the x-ray

beam. The accuracy of the measurement of the intensities is of paramount importance. A scale

factor must be allocated so that the intensities of all the images in the data set will be with a

consistent intensity scale due to the mosaic nature of a protein crystal, each lattice point acts a

small three dimensional sphere not as an infinitesimal point. The consequence of this is that

during the oscillation range a reflection may only be partially recorded. Data from partial

reflections can be interpreted accurately through postrefinment of the intensity data. This

process provides a correction factor to convert the measured intensity of the partial reflection

so that it is indicative of a full reflection.

1.10.6 Determination of molecule numbers in the unit cell

Reciprocal lattice spacings are the inverse of real lattice spacings, making it possible to

measure unit cell dimensions from film spacing.

The number of molecules in the asymmetric unit is determined by the use of

the Matthews Coefficient, Vm, which gives the ratio between the volume of the unit cell (Å3)

and the total weight of protein in the unit cell (dalton) as follows:

Equation 3: Matthews coefficient.

Vm=V/MW*Z*X

V=unit cell volume.

MW=molecular weight of protein.

Z= number of asymmetric units in unit cell.

X= number of molecules in unit cell.

20

Analysis of globular proteins showed fraction of crystal volume occupied by solvent to range

from 27% to 78%, with the most common value being around 43%. Matthews empirically

determined that the most probable values of X are those which give Matthews coefficients

between 1.68 Å3/Dalton and 3.53 Å

3/Dalton. The most commonly observed value of Vm is

near the value of 2.15 Å3/Dalton [39].

1.10.7 Solution of the phase problem

The phase angle can be determined in a variety of ways. The simplest technique is known as

molecular replacement and requires the knowledge of homologous protein's determined

structure in order to determine the orientation and position of the molecules within the unit

cell. In the cases where such information isn't available, techniques such as multiple

isomorphous replacement or multiple anomalous dispersion can be used.

1.10.8 Protein's preparation

In order to crystallize a protein for X-ray diffraction analysis the purified protein must be

grown from aqueous solutions, ones to which it is tolerant, these solutions are called mother

liquors.

Some factors require consideration such as protein homogeneous and purity, maintenance of a

particular pH, concentration of protein, temperature and precipitants that cause the protein to

precipitate out of solution.

A common feature of nucleation and growth is that both are critically dependent on what is

termed the supersaturation of the mother liquor giving rise to the crystals.

This is a non-equilibrium condition in which some quantity of the macromolecule in excess of

the solubility limit, under specific chemical and physical conditions, is nonetheless present in

solution.

Two of the most commonly used methods for protein crystallization fall under the category of

vapor diffusion [40]. These are known as the hanging drop and sitting drop methods (Figure

10). Both entail a droplet containing purified protein, buffer, and precipitant being allowed to

equilibrate with a larger reservoir containing similar buffers and precipitants in higher

concentrations. Initially, the droplet of protein solution contains an insufficient concentration

of precipitant for crystallization, but as water vaporizes from the drop and transfers to the

reservoir, the precipitant concentration and the protein concentration increase to a level

optimal for crystallization. Since the system is in equilibrium, these optimum conditions are

maintained until the crystallization is complete.

21

The number of bonds (salt bridges, hydrogen bonds, and hydrophobic interactions) that a

conventional molecule forms with its neighbors in a crystal, provide the lattice interactions

essential for crystal maintenance [41].

The hanging drop method differs from the sitting drop method in the vertical orientation of

the protein solution drop within the system. Both methods require a closed system, that is, the

system must be sealed off from the outside.

1.10.9 Crystal mounting

Preparation of a crystal for data collection entails placing it in cryoprotected mother liquor for

~10sec to wash of the old mother liquor. Then, picking it up in a small circular loop of nylon

fiber and immediately freezing it with liquid nitrogen. The droplet of mother liquor keeps the

crystal hydrated and the cryoprotectant prevents ice crystals from forming during the freezing.

The loop is mounted onto the goniometer between an X-ray source and a detector which

records the position and intensity of diffracted X- rays. There it is held in a stream of cold

nitrogen gas coming from a reservoir of liquid nitrogen to maintain a temperature of -100°C.

The advantage of collecting data at very low temperature is that it increases the molecular

order in the crystal and improves diffraction and reduces the radiation damage to the crystal to

allow collection of more data [37].

Figure 10: Growing protein crystals by vapor diffusion.

The hanging drop and the sitting drop are both entail a droplet containing purified

protein, buffer, and precipitant.

The figure is adopted from Kanteev, M. Master thesis (2007)

22

2. Research goals

The structure of the MntC protein has been determined [24], however, due to the low

resolution of the structure, there are still things that need to be further investigated such as the

exact role of the disulfide bond that is a specific characteristic of cyanobacterial manganese

solute binding proteins and the specificity of the protein towards Mn verses other metal atoms

of similar characteristics. To answer these questions we need to achieve our first goal- The

crystallization and the high resolution structure determination of the MntC protein from the

thermophilic cyanobacterium Thermosynechococcus vulcanus, which may yield a structural

analysis of greater precision.

In order for one to understand the mechanism of the entire transporter system, the entire

transporter complex from the Synechosystis sp. PCC 6803 has to be characterized

biochemically and determined structurally, trapped in distinct states to reveal the

conformational changes concomitant with substrate transport and ATP hydrolysis.

This brings us to our second goal, the construction, biochemical investigation and

characterization of the NBD protein from this cyanobacterium named the MntA protein.

Metal ion transporters provide the very important delicate balance of metal transport across

the membrane, so, understanding the model and mechanism of the ABC transporter may

contribute to finding ways to harm this balance and this will initiate the rational design for

drugs.

Nevertheless, because the structures of some investigated ABC transporters agree well with

the genetic, biochemical and structural data of crucial human homologues, the ABC

transporter structures from bacteria may serve as valuable structural models of human

homologues and can contribute to multidrug resistance of cancer cells by catalyzing the

extrusion of cytotoxic compounds used in cancer therapy.

23

3. Research plan

The basis of the plan for both the MntC and the MntA protein is expressing and purifying

high amounts of homogenous, clean and correctly folded protein so it can be crystallized and

diffracted to high resolutions (Figure 11):

Experimental procedure for both the proteins:

C-terminal 6xHis tagged gene

was cloned into high expression

vector.

The protein was overexpressed

in E. coli.

The protein was purified.

The protein was concentrated.

The protein was characterized

biochemically.

The protein was crystallized.

Attempts were made to determine

the structure of the protein.

Computational modeling of the

protein was used.

Computational modeling of the

protein has been compared to

the experimental one.

Figure 11: Research plan.

24

4. Materials

4.1 General reagents

Reagent Manufacture

Acetic acid FRUTAROM

Acrylamide SIGMA

Acrylamide/bis-Acrylamide 40% SIGMA

Agar DIFCO Laboratories

Agarose (electrophoresis grade) SIGMA

Ammonium Sulphate ((NH4)2SO4) Carlo Erba

Ampicillin sodium crystalline SIGMA

Anti Rabbit igG SIGMA

ATP- Adenosine 5' Triphosphate magnesium salt SIGMA

Bacto-tryptone Becton, Dickinson and Co.

Bacto yeast extract DIFCO Laboratories

BCIP-5 Bromo 4 Chloro 3 indolyl Phosphate

disodium salt

SIGMA

Betaine anhydrous Fluka

Bromphenol blue SIGMA

Chloramphenicol SIGMA

Coomassie Brilliant Blue R-250 SIGMA

DM (n-dodecyl-p-D- maltoside) Antrace

DNA ladder NORGEN

D,1-Dithiothreitol (DTT) SIGMA

Ethidium bromide (EtBr) Bio-Rad Laboratories

Glycerol (Glycerin) J.T.Baker

Hepes (C8H17N2O4SNa) SIGMA

His probe Santa Cruz

Hydrochloric acid 37% (HCl) Carlo Erba Reagents

Imidazole (C3H4N2) FLUKA

Isopropyl β-D-thiogalactopyranoside (IPTG) SIGMA,ORNAT

Kanamycine SIGMA

Magnesium Chloride hexahydrate (MgCl2) Carlo Erba Reagents

Malachite green phosphate assay kit BioAssay systems

25

Reagent Manufacture

Manganous Chloride (MnCl2) Carlo Erba Reagents

Methanol FRUTAROM

Molecular weight markers for SDS-PAGE SIGMA, Bio-Rad Laboratories

NBT-Nitrotetrazolium blue chloride SIGMA

Polyethylene glycol (PEG) Hampton research Corp.

Pottasium chloride (KCl) MERCK

Sodium acetate (Na-acetate) MERCK

Sodium chloride (NaCl) FRUTAROM

Sodium dodecyl sulfate (SDS) Biochemical

Sodium hydroxide (NaOH) FRUTAROM

Sorbitol (D) SIGMA

N,N,N’,N’–tetra-methylethyenediamide (TEMED) Bio-Rad Laboratories

Tris (C4H11NO3) SIGMA

Urea J. T Baker

X-gal SIGMA

4.2 Enzymes

Enzyme Manufacture

Ex-taq Takara

Restriction enzymes Bio-labs

Tripsin SIGMA

4.3 Biochemical, Recombinant DNA Technology and Crystallization Kits

Solution Manufacture

CryoPro Hampton Research Corp.

Crystal ScreenTM

Hampton Research Corp.

Crystal Screen 2TM

Hampton Research Corp.

Gell PCR DNA fragments extraction kit HiYield

Index TM

Hampton Research Corp.

Plasmid DNA purification- miniprep Promega

26

4.4 Other materials

Material Manufacture

Centricon 30K Amicon

Dialysis bags Spectrum, Inc.

Electroporation cuvettes Cell projects

Petri dished Miniplast

Syringe driven filter 0.45μm Millipore Corp.

Tissue culture test plates 24 wells TPP

4.5 Growth media

Luria Bertani (LB) media: 1% Bacto tryptone, 0.5% Bacto-Yeast extract, 1% NaCl.

LB-Agar (for plates): 1% Bacto tryptone, 0.5% Bacto-Yeast extract, 1% NaCl, 2%

Agar.

4.6 Cell lines

E.coli strain XL1-blue (Stratagene) - was used as host for the t-easy and pET 20b

vectors.

E.coli strain M15 (Qiagene) – was used as host for the over expression vector pQE60.

E.coli strain BL-21 pLysS (Novagen) – was used as host for the over expression

vector pET 20b.

Bacterial strains were grown at 37°C in LB medium and LB agar supplemented with

corresponded antibiotics.

27

4.7 Plasmidial vectors and oligonucleotides

Table 1: Plasmidial vectors and oligonucleotides.

Vector

name

Cloned

gene Stability Inducer Cell line

Cell line

stability Source

pQE60 MntC Amp IPTG M15 Kanamycine QIAGENE

pET 20b MntA Amp IPTG

BL-

21(DE3)

pLysS;

XL1-Blue

Chloramphenicol NOVAGENE

pGEM- T

Easy MntA Amp IPTG XL1-Blue none Promega

4.7.1 Vector description

pGEM- T Easy: This vector was used for the cloning of PCR products. The vector

contains T7 and SP6 RNA polymerase promoters.

pET20b: Expression of C-terminal 6xHis tagged proteins in E.coli using this vector is

based on T7 promoter transcription-translation system.

pQE60: Expression of C-terminal 6xHis tagged proteins in E.coli using this vector is

based on T5 promoter transcription-translation system.

4.7.2 Oligonucleotides

The oligonucleotides were supplied from SIGMA. They were planned such that their

sequence contains arround 50% G-C without creating secondary structures and that the added

restriction enzymes recognition sites, didn't appear in the gene sequence. As follows there are

primer sequences:

F-2nd

-ATG-E-Nco1 (MntC): 5`–GTCTCCCCTCAGTGTATCGG – 3`

R-E-BamH1 (MntC): 5`–TTCAACATAAATCAGGGCAT – 3`

F- nde1 mnta new: 5` – CATATGGCAGCCACCCTATCTCGTCTTGATAT – 3`

R- xho1 mnta new: 5` – CTCGAGCGCATCTACCTCTGTCGATTCAAACA– 3`

28

More details of these oligonucleotides are in the following table:

Table 2: Oligonucleotides details.

Oligonucleotide name Length (bp) Comments

F-2nd

-ATG-E-Nco1 (MntC)

20

Cloning of the gene encoding to MntC to

the pQE60 vector with His-tag on the

C-terminal (N-terminal, forward)

R-E-BamH1 (MntC)

20

Cloning of the gene encoding to MntC to

the pQE60 vector with His-tag on the

C-terminal and without a stop codon

(C-terminal, reverse)

F- nde1 mnta new

32

Cloning of the gene encoding to MntA to

the pET 20b with His-tag on the C-terminal

(N-terminal, forward)

R- xho1 mnta new 32

Cloning of the gene encoding to MntA to

the pET 20b with His-tag on the C-terminal

and without a stop codon

(N-terminal, forward)

4.8 Buffers and Solutions

4.8.1 Solutions for electrophoresis of DNA on agarose gel

TAE running Buffer: 40mM Tris-base, 40mM acetic acid, 1mM EDTA.

Agarose gel: 1% agarose in TAE buffer.

4.8.2 Buffer for ATP hydrolysis detection

KCl 100mM; MgCl2 100mM; Tris 50mM pH=8; DTT 1mM.

4.8.3 Buffers used for protein isolation, purification and crystallization

Lysis buffer_1: 50mM Tris pH=8.

Lysis buffer_2: 50mM Tris pH=8, 8M Urea.

29

4.8.3.1 Nickel column buffers

Wash buffer_1: 50mM Tris pH=8, 300mM NaCl, 20mM Imidazole.

Wash buffer_2: 50mM Tris pH=8, 300mM NaCl, 20mM Imidazole, 8M Urea.

Wash buffer_3: 50mM Tris pH=8, 300mM NaCl, 20mM Imidazole, 2M Urea.

Elution buffer_1: 50mM Tris pH=8, 300mM NaCl, 250mM Imidazole.

Elution buffer_2: 50mM Tris pH=8, 300mM NaCl, 250mM Imidazole, 8M Urea.

Elution buffer_3: 50mM Tris pH=8, 300mM NaCl, 250mM Imidazole, 2M Urea.

4.8.3.2 HPLC buffers

AEC-HPLC Buffer A_1: 50mM Tris pH=8.

AEC-HPLC Buffer A_2: 50mM Tris pH=8, 2M Urea.

AEC-HPLC Buffer B_1: 50mM Tris pH=8, 1M NaCl.

AEC-HPLC Buffer B_2: 50mM Tris pH=8, 1M NaCl, 2M Urea.

CEC-HPLC Buffer A_1: 50mM Sodium acetate (Na-acetate) pH=5.5.

CEC-HPLC Buffer B_1: 50mM Sodium acetate (Na-acetate) pH=5.5, 1M NaCl.

SEC-HPLC Buffer_1: 50mM Tris pH=8, 100mM NaCl.

SEC-HPLC Buffer_2: 50mM Tris pH=8, 100mM NaCl, 2M Urea.

4.8.3.3 Buffers for dialysis and protein dilution

50mM Tris pH=8.

50mM Tris pH=8, 2M Urea/ 4M Urea/ 6M Urea.

4.8.3.4 Mother liquors

0.1M BT pH7, 1.8M (NH4)2SO4.

0.1M Hepes pH7, 1.8M (NH4)2SO4.

0.1M MgCl2, 0.1M NaAcetate tryhydrate pH 4.6, 18% PEG 400.

0.2M MgCl2 hexahydrate, 0.1M Hepes sodium pH 7.5, 30% PEG 400.

4.8.4 Buffers used for SDS-PAGE

Resolving buffer x 8: 3M Tris (ph=8.8).

Stacking buffer x 4: 0.5M Tris (pH=6.8).

Running buffer x 5: 125mM Tris, 960mM Glycine.

30

Sample buffer x 5: 6% Lauryl sulphate lithium salt, 0.15M DTT, 0.5M Tris.

(pH=6.8), 30% glycerol, 0.01% bromphenol blue.

Staining solution: 0.25% coomassie brilliant blue, 50% methanol, 7% acetic

acid.

Destaining solution: 10% Methanol, 10% Acetic acid.

4.9 Gel recipes

Resolving gel: 14% Acrylamide, 0.4% bis-Acrylamide, 1% APS, 0.1%

TEMED in resolving buffer.

Stacking gel: 6% Acrylamide, 0.15% bis-Acrylamide, 2% APS, 0.2% TEMED

in stacking buffer.

4.10 Column material and sources

Columns for analytical size SEC-HPLC: PL-GFC 1000Å (Polymer Laboratories).

Preparation AEC-HPLC: PL-SAX 1000Å (Polymer Laboratories).

Preparation CEC-HPLC: PL-SCX (Polymer Laboratories).

Nickel column: Ni-NTA Agarose, QIAGENE.

31

5. Methods

5.1 Molecular methods

5.1.1 DNA extraction from Synechocystis sp. PCC 6803

100mL mature cells were washed once with BGII and resuspended in 1ml buffer (5mM Tris

pH 8.5). 1g of glass beads (100U) were added and the mixture vortexed 60 seconds.

After centrifuging the beads, the supernatant was added to 1ml phenol chloroform and

vortexed 30 seconds before centrifugation (5 min, 15,000rpm). To the aqueous phase 3M

sodium acetate and ethanol were added in a ratio of 10 : 1 : 25 and the solution was left for 60

minutes at -20ºC. After centrifugation (20 min, 15,000rpm) the DNA extract was washed

once with 70% ethanol and once dry suspended in 50 µl buffer (5mM Tris pH 8.5) [42].

5.1.2 Preparation of competent cells

In this method, E.coli species of BL-21(DE3) pLysS and XL1-blue were prepared. 25 ml

starter culture of bacteria which were grown overnight at 37°C was prepared. The starter was

inoculated with 0.5 liter of LB and the cells were grown at 37°C till OD600~0.8. The cells

were chilled on ice for 15-30 min and pelleted by centrifugation (5000rpm, 10min, 4°C). The

precipitate was resuspended with 750 ml of sterile double distilled cold water and was

recovered by another centrifugation (5000rpm, 10min, and 4°C). The precipitate was then

resuspended with 10 ml 10% glycerol solution, centrifuged and then the precipitate was

resuspended again with 2ml 10% glycerol solution. The suspension was divided into small

aliquots and frozen at -80°C.

5.1.3 Polymerase Chain Reaction (PCR)

PCR method was used for enzymatically synthesizing and amplifying the DNA encoding

sequences of the MntA from Synechocystis and MntC from T. vulcanus genes. The reaction

uses two oligonucleotide primers designed to hybridize to opposite strands of the DNA that is

to be amplified. The cycling protocol consists of 25-30 1 min cycles of three temperatures:

strand denaturation at 95°C, primer annealing at 55°C and primer extension by the enzyme

Taq polymerase at 72°C. The PCR reaction mixture contained 1μl of each oligonucleotide

(100 ng/μl), 2μl buffer, 1.6 μl dNTPs, 1.5μl DNA, 0.1μl Taq and was made up to a final

volume of 20μl.

32

5.1.4 Agarose gel electrophoresis of DNA

Electrophoresis in agarose gel is used for separating DNA fragments on the basis of their

molecular weights. The DNA fragments in this project were resolved on 1% agarose gels. The

gel was prepared by boiling 0.8gr of agarose in 80 ml 1x TAE, cooling the mixture, adding 4

µl ethidium bromide to final concentration of 0.5 μg/ml, and then setting this in the gel

former.

The gel run in 1x TAE. 2.5-20 μl DNA was mixed with 0.5 volume of DNA loading dye and

loaded into the gel. Ethidium bromide intercalates DNA, and in this state fluoresces when

illuminated by ultraviolet (UV) light. The DNA was visualized and photographed by

illuminating the gel with UV light on a transilluminator. Gel DNA extraction was performed

according to manufactures instructions.

5.1.5 DNA Digestion by Restriction Enzymes

Restriction enzymes usage was performed according to manufacture instructions.

In general, plasmid DNA was cut with a 2-5 fold excess of enzyme (units) over DNA

(unit/pmol) for 3 hours at 37°C.

5.1.6 Determination of DNA Concentration

DNA concentration and purity was determined by U.V absorbance. Absorbance of DNA

samples was performed using a quartz cuvette at wavelengths 260nm and 280nm.

Absorbance at 260nm x 50 gives concentration of double stranded DNA sample in μg/ml.

The ratio of absorbance 260/280 should fall between 1.8 and 2.0 for pure DNA with

smaller ratios indicating contamination [43].

5.1.7 Ligation of PCR Product into Cloning Vector

T4 DNA ligase enzyme was used to combine the DNA insert fragments with the linearized

cloning vector. The ligation mixture was incubated over night at room temperature, followed

by dialysis to purify the plasmid.

5.1.8 Electro-transformation

In the electroporation method, the plasmidial DNA is inserted to competent cells by an

electric shock that causes modifications in the permeability of cell membrane.

33

A 50 μl of cell suspension, which was thawed on ice, was mixed with 1-2μl of DNA. The

Gene Pulser apparatus was set at 25μF and 2.5 kV. The Pulse Controller was set to 200Ω.

The mixture of cells and DNA was transferred to a cold 0.2 cm electroporation cuvette.

A single pulse at the above settings was applied. Immediately after the electroporation, the

cell suspension was resuspended with 300-600μl of LB, and was transferred to

microcentrifuge tube. As a recovery, the tube was shaken at 37°C for an hour. Following this

stage, 100 μl of the cells were plated on petri dishes containing LB, and the appropriate

antibiotics.

Isolation of plasmid DNA (mini prep) was performed according to the manufacturer's

instructions.

5.1.9 DNA sequence determination:

Sequence determination of DNA was performed by DANYEL BIOTECH using the

florescence detection automated DNA sequence analysis method [44].

5.2 Protein Isolation

5.2.1 Overexpression of the MntC and MntA Proteins

The MntC gene from T. vulcanus was cloned into the pQE60 plasmid which contains a C

terminal His tag in its sequence. The MntA gene from Synechocystis was cloned into the pET

20b plasmid which contains a C terminal His tag in its sequence.

100μl of each of the transformed E.coli cells were grown in 10ml of LB supplemented with

the appropriate antibiotics (100 mg/ml ampicillin and 50mg/ml kanamycin for MntC and 100

mg/ml ampicillin and 34 mg/ml chloramphenicol) overnight at 37°C. This starter solution was

used to inoculate 500 ml of LB medium with the same antibiotics concentration mentioned

above. This solution was shaken at 37°C until the mid-logarithmic growth phase was reached

at OD600~0.8. At that point 1mM of Isopropyl-β-D-thiogalactopyranoside (IPTG) was added,

and the culture was shaken for further 4 hours at 37°C.

Cells were harvested by centrifugation (7000 rpm, 10 min, 4°C) and frozen at -20°C till

protein purification was performed.

34

5.2.2 Isolation and primary purification of MntC and MntA proteins:

Frozen cells were resuspended in Lysis buffer and broken by French Press at 1500 atm. The

lysate was then centrifuged (17,000, 30min, 4°C) to separate the pellet and supernatant. In

MntA protein, if Urea wasn't added in the Lysis buffer, at that point the pellet was harvested

with 8M Urea and was then centrifuged again (17,000, 15min, 4°C) to get the protein in the

supernatant fraction. The supernatant in both cases was loaded on a Nickel column for

purification of 6xHis-tagged proteins by gravity-flow chromatography, then it was washed in

30ml wash buffer and eluted with 5ml elution buffer as 5 fractions. The MntA supernatant

was washed in a buffer containing 2-8M urea and eluted with a corresponding concentration

of urea.

5.2.3 SDS-PAGE analysis

The fractions containing protein was identified by SDS-PAGE analysis which seperates

proteins by electrophoresis [45]. Anion detergant SDS allows separation under an electric

field so that the protein movement in denaturative gel containing SDS is only according to

protein's molecular weights without charge influence. SDS-PAGE contains resolving gel that

is firstly topped with water and some minutes after termination of the polymerization, the

water is replaced by the stacking gel mixture. protein samples in volume 10-15μl were

incubated for 3 min at 80°C in sample buffer containing DTT, centrifuged for 2 min at

13Kxg, and placed into gels slots. The apparatus was filled up with running buffer containing

0.1% SDS. Gels were run at room temperature at 25mA for each plate. After completion of

electrophoresis, the gels were placed in the staining solution and shacked gently. After 5 min

the staining solution was poured off and the excess dye was removed by a destain solution,

until the gel background was clear.

5.2.4 Chromatographic analysis

The HPLC analysis was performed using- MERCK HITACHI UV detector L-7400 and

MERCK HITACHI pump L-7100.

5.2.4.1 AEC-HPLC and CEC-HPLC

Columns for CEC-HPLC /AEC-HPLC containing a negative/ positive charged, immobile

matrix able to bound positive/negative charged proteins in solution respectively, according to

their pI and the pH of the buffer. They elution of the bound protein is due to a competition

with the rising concentration of the NaCl in the buffer.

35

Columns for CEC-HPLC and AEC-HPLC were equilibrated with the appropriate buffer

until a stable baseline was achieved. According to the absorbance change at a giving time that

was monitored at 280nm, the purified protein was collected.

5.2.4.2 SEC-HPLC

This column is able to separate proteins according to their size. Column for SEC-HPLC and

was equilibrated with the appropriate buffer until a stable baseline was achieved. SEC-HPLC

was calibrated with molecular mass standards.

According to the absorbance change at a giving time that was monitored at 280nm, the protein

was detected.

5.2.5 Protein concentration

The concentration and purification of the protein was done using a centricon ultrafiltration

device. Centricon concentrators can fractionate proteins on the basis of molecular weight

(MW). The centricon was filled with up to 2 ml of protein mixture, centrifuged to 100µl-

1ml. For extra purification of the protein from molecules such as salts and imidazole, the

centricon was filled again with appropriate buffer, centrifuged again to get the concentrated

and filtered fraction.

5.2.6 Determination of protein concentration

Protein concentration was determined by measuring the optical absorption of the polypeptide

backbone in the near UV. The samples were mixed with double distilled water to a final

volume of 1000μl. The same volume of buffer was diluted in double distilled water and was

used as reference solution. Measurements the absorbance (A) of the water protein solutions at

280, 220, 215, 210, 205nm in 1cm path length cuvette was performed with a spectrometer-

HITACHI U-2000.

Equation 4: Protein concentration.

Protein concentration (mg/ml) =

{[A220/11+ A215/15+ A210/20.5+ A205/(27+(120xA280/A205))]/4} x dilution factor.

36

5.2.7 Dialysis

Dialysis was used to remove from the protein elution's molecules that are small enough to

pass through a semipermeable membrane such as salts and imidazole and to gradually lower

the urea concentration.

5.2.8 Western blot

Western blot was used to detect the specific 6xHis-tagged protein in the elutions. First, gel

electrophoresis was used to separate the denatured proteins by the length of the polypeptide.

The proteins were then transferred to a nitrocellulose membrane. After blocking, a dilute

solution of primary anti-his antibody was incubated with the membrane for an hour. Then, the

membrane was rinsing to remove unbound primary antibody before it was exposed to

secondary antibody, "anti-rabbit". The secondary antibody is linked to a reporter enzyme,

"Alkaline phosphatase" that enhances the signal to locate the protein.

5.2.9 Mass spectroscopy

Mass spectrometry (MS) was performed for the detection of the protein from the SDS-PAGE

gel suspected sample. The sample was loaded onto the MS instrument, and its compounds

were ionized, resulting in the formation of ions. The mass to charge ratio of the particles is

then calculated from the motion of the ions as they transit through electromagnetic fields. The

peptide sequence of a molecule is deciphered through the set of fragment masses and

compared against a library of mass spectra to detect the protein sequence.

Mass spectroscopy was performed at the Smoler Proteomics Center, Technion.

5.2.10 Circular Dichroism spectroscopy (CD)

The CD spectra of a molecule is obtained by measuring the difference in absorption between

left and right circularly polarised light by a chiral chromophore. CD of the amide

chromophore reports on the presence or absence of ordered secondary structure [46].

CD spectroscopy was performed on a Jasco detector at the lab of prop. Zeev Gross, Technion,

with the help of Dr. Atif Mahammed, and was analyzed using the DICROWEB server [47].

37

5.2.11 Tryptophan fluorescence

Tryptophan fluorescence was used as an indicator for the protein's refolding according to the

spectrum's shift [48].

The fluorospectrophotometer was a Varian Cary Eclipse.

5.2.12 Malachite green phosphate assay kit

The malachite green phosphate assay is based on quantification of the green complex formed

between malachite green, molibdate and free phosphate. The complex is calibrated with free

phosphate standards. The kit can be used for ATP hydrolysis detection.

5.3 Computation Software

5.3.1 Data reduction, scaling and visual analysis

5.3.1.1 Mosflm

Mosflm (http://www.mrc-lmb.cam.ac.uk/harry/mosflm/) is a program intended for integrating

single crystal diffraction data from area detectors.

5.3.1.2 CCP4

CCP4 (http://www.ccp4.ac.uk/) was used for crystallographic refinement.

5.3.1.3 PyMol

The structure files were displayed with the molecular graphics program, PyMol

(http://pymol.sourceforge.net/). This program allowed visual analysis of proteins in order to

infer structural alignments, compare functionally important sites and to visualize electrostatic

potential of proteins.

5.3.2 Computational programs

5.3.2.1 BLAST

The Basic Local Alignment Search Tool from NCBI (http://www.ncbi.nlm.nih.gov/BLAST/)

was used to identify homologous proteins by pairwise comparison that searches local

alignments.

38

5.3.2.2 CLUSTAL X

Protein sequences were aligned using the identity matrix ClustalX

(http://www.es.embnet.org/Doc/clustalw/clustalx.html) with pairwise gap penalties of 10 for

gap opening and 0.1 for gap extension, and multiple alignment penalties of 10 for gap

opening and 0.2 for gap extension.

5.3.2.3 Generunner

Generunner program was used for analysing DNA or amino acid sequences, translation of

DNA and designing Oligonucleotides that conform to certain specifications including a

majority percentage of G and C, absence of hairpin loops and moderate melting temperature.

5.3.2.4 Clone Manager

Clone Manager Suite from Sci-Ed Software is a comprehensive software package with an

integrated set of tools. It was used to simulate virtual cloning.

5.3.2.5 WebCutter

Web cutter on-line program (http://rna.lundberg.gu.se/cutter2/) was used for helping

restriction map DNA sequences planning.

5.3.2.6 Innovagen Peptide property calculator

This web program (http://www.innovagen.se/custom-peptide-synthesis/peptide-property-

calculator/peptide-property-calculator.asp) was used for calculating protein's Molecular

weight and isoelectric point.

5.3.2.7 DICHROWEB

DICHROWEB, (http://www.cryst.bbk.ac.uk/cdweb/html/home.html) is an online server for

protein secondary structure analyses from circular dichroism spectroscopic data [47].

5.3.2.8 PredictProtein

PredictProtein (http://www.predictprotein.org) is a service that was used for sequence

analysis, structure and function prediction. When a protein sequence is submitted,

PredictProtein retrieves similar sequences in the database and predicts aspects of protein

structure and function.

39

5.3.2.9 The ConSeq Server

ConSeq (http://conseq.bioinfo.tau.ac.il/) is a web server that was used for the identification of

biologically important residues in protein sequences. Given a query protein sequence, the

server automatically collects its homologous sequences and multiply aligns them. A

phylogenetic tree for the homologues is derived. The server then calculates the substitution

rate at each position in the MSA, taking into account the evolutionary relations between the

homologues. Relative solvent accessibility predictions are assigned to each amino acid in the

sequence, to finally indicate residues that have potential structural or functional importance

[49].

5.3.2.10 LOMETS

LOMETS (Local Meta-Threading-Server) is an on-line web service used for protein structure

prediction (http://zhang.bioinformatics.ku.edu/LOMETS/). It generates 3D models by

collecting consensus target-to-template alignments from 9 locally-installed threading

programs.

5.3.2.11 HHpred

We used HHpred (http://toolkit.tuebingen.mpg.de/hhpred) for Homology detection & 3D

model structure prediction by HMM-HMM comparison.

40

6. Results

6.1 MntC

6.1.1 Cloning

The mntC gene containing 939 bp, was cloned into the pQE60 vector using oligonucleotides

with restriction enzyme recognition sites for Nco1 and BamH1 on the forward and reverse

oligonucleotides, respectively. The presence of a His-tag on the C- terminus of the protein

assures that only complete product from the mntC gene will be purified. This stage was

performed by Dr. Meira Frank.

6.1.2 Overexpression

Table 3: MntC overexpression.

Induction time (hours) IPTG concentration (mM) Induction temperature (°C)

4 1 37

6.1.3 The basic scheme of MntC isolation and purification

Figure 12: preparation of MntC for crystallization.

41

SDS-PAGE analysis showed that the Ni-column allows the isolation and purification of

large quantities of protein from the soluble fraction. Following a wash of the protein to

remove imidazole (using a centricon ultrafiltration device), the MntC protein was further

purified by AEC-HPLC. MntC eluted in the flow-through at pH=8 (Figure 13-A). Then,

additional purification preformed by CEC-HPLC. The MntC binds to this column and was

eluted by addition of 30% NaCl at pH=5.5 (Figure 13-B).

This purified fraction was identified by SEC-HPLC as monomeric (Figure 14).

y = -7.792x + 18.48

3.5

4

4.5

5

5.5

6

6.5

1.6 1.65 1.7 1.75 1.8

log

MW

Ve/V0

HPLC calibration in Tris pH=8

Figure 14: SEC-HPLC calibration curve. According to the calibration curve

the 34.3 kDa monomeric MntC protein is expected to be eluted in 14.3 min

(Ve/V0=1.79). The MntC eluted after 14.6 min, implying that the purified

MntC is a monomer.

Figure 13: Purification of MntC. A. AEC-

HPLC. Elution of the MntC protein after 3

min (Flow-through); B. CEC- HPLC. Elution

of the MntC protein after 20 min (30% NaCl).

42

The CEC-HPLC purified fraction was washed to remove NaCl and concentrated to ~5

mg/ml via centricon.

SDS-PAGE analysis showed one highly purified band with a molecular weight of ~34kDa

(Figure 15). This fraction was identified as composed of MntC-His by Western blot

analysis.

6.1.4 Crystallization

A small number of crystals were obtained after a period of 3 weeks – 2 months by using the

hanging drop method. Most of the crystals were shaped as "needles" that were difficult to

separate and mount. We tried to find other crystallization conditions by using Crystal Screen

Kit (Hampton Research), but the protein only crystallized in the presence of 0.1M BT pH7,

1.8M (NH4)2SO4 or 0.1M Hepes pH7, 1.8M (NH4)2SO4.

We managed to obtain several valuable crystals (Figure 16) that were mounted in the presence

of cryoprotectors.

3 1 2 4 5 6

A B

Figure 16: MntC crystals. A.

Needles; B. Single large, 0.2 m

crystal.

Figure 15: SDS- PAGE of the MntC protein. Lanes 1-3: Elutions of MntC

from the Nickel column; Lane 6: The concentrated eluted MntC protein

from CEC-HPLC; Lanes 4-5: Molecular Weight markers.

MntC protein at ~34 kDa

43

6.1.5 Data collection

The crystals diffracted to a resolution of 3- 4Å and several data sets were collected (Figure

17). In most cases the Mosflm program failed to determine the space group of the crystal

which is the first step necessary in data processing. When the space group was determined,

the diffraction was unsolvable due to our estimation that the number of molecules in the

asymmetric unit is large (6-24).

6.1.6 Computational modelling.

Since the structure of MntC from T. vulcanus has not been determined, we used

computational structural biology programs to create a model. The model was created using

the previously determined homologues MntC protein from Synechocystis sp. PCC 6803. The

homology between the two proteins is 54%.

The MntC protein from Synechocystis was determined with manganese in its binding site so

the prediction of the MntC T. vulcanus manganese binding site was available.

The RMSD between the structures is very low- implying on great similarity between the

structure and the model, and the manganese binding site is composed from the same amino

acids.

Furthermore, the MntC Synechocystis structure showed the presence of a disulfide bond

between Cys219 and Cys268 near the Mn2+

binding site. This bond is also present in the

MntC T. vulcanus model between Cys203 and Cys252 (Figure 18).

Figure 17: X-ray diffraction of MntC crystal obtained at ESRF. The

right hand frame shows an enlargement of the left hand frame.

44

Figure 18: MntC model. A. The MntC protein model from T. vulcanus; B. The

structure of the MntC protein from Synechocystis (PDB code: 1XVL(; C. Alignment

of the two MntC proteins structure results in an RMSD=0.115Å (T. vulcanus-

green, Synechocystis- cyan, manganese ion- purple); D. Manganese binding site of

MntC from T. vulcanus contains the following residues: Glu 204, Asp 279, His 73,

His138; E. Manganese binding site of MntC from Synechocystis contains the

following residues: Glu 220, Asp 295, His 89, His154; F. Alignment of the two

MntC proteins structure with a focus on the manganese binding site and the disulfide

bond which exists in both structures (T. vulcanus structure is indicated in green,

Synechocystis structure is indicated in cyan, the disulfide bond is highlighted in a

white circle).

A B C

D E F

45

6.2 MntA

6.2.1 Cloning and primary overexpression

The mntA gene containing 783 bp was cloned into the pET20b vector using oligonucleotides

with restriction enzyme recognition sites for Nde1 and Xho1 on the forward and reverse

oligonucleotides, respectively. The presence of a His-tag on the C- terminus of the protein

assures that only complete product from the mntA gene will be purified. The cloned mntA

gene was sent to sequencing which confirmed that the entire sequence was cloned.

6.2.2 Overexpression

The MntA protein was expressed in inclusion bodies obtained as the pellet fraction after

French press cell disruption. The pellet can be solubilized in urea (Figure 19). This fraction

was identified as composed of mainly MntA-His by both western blot analysis (Figure 21)

and mass spectrometry (75% coverage).

3 1 2 4 5 6

Figure 19: Cell free extracts. Lane 1: Molecular weight marker; Lane 2: Cell's

soluble fraction. There is a small band at ~28kDa indicating poor expression of

MntA in this fraction; Lane 3: Cell's insoluble fraction, after being solubilized

in 8M urea. There is a large band at ~28kDa indicating extensive expression of

MntA in this fraction; Lane 4: Cell's insoluble fraction, after being solubilized

in 2M urea. There is a small band at ~28kDa indicating that not the entire

amount of MntA was able to be solubilized in 2M urea; Lane 5: Cell's insoluble

fraction, after being solubilized in 4M urea. There is a small band at ~28kDa

indicating that not the entire amount of MntA was able to be solubilized in 4M

urea; Lane 6: Cell's insoluble fraction, after being solubilized in 6M urea. There

is a large band at ~28kDa indicating that a large amount of MntA was able to

be solubilized in 6M urea, however, there is less quantity of the protein

compared to the one that was solubilized in 8M urea.

MntA protein at ~28 kDa.

37 kDa

25 kDa

46

Several experiments have been performed to try and express the MntA protein in the soluble

fraction (Table 4):

Table 4: MntA overexpression attempts.

Experiment

number

Induction

time

(hours)

IPTG

concentration

(mM)

Induction

temperature

(°C)

pH MntA's

location

1. 4 1 37 8 insoluble

fraction

2. 4 0.5 37 8 insoluble

fraction

3. 2 1 37 8 insoluble

fraction

4. 2 1 25 8 insoluble

fraction

5. 4 1 37 6 insoluble

fraction

In each of the experiments the insoluble fraction was solubilized in 8M urea. The MntA

protein was purified using Ni-column (Figure 20).

1 2

Figure 20: Purified MntA effected by the different overexpressions. Lane 1: Elution

number 3 from the cell's soluble fraction of expression number 1. There is a very small

band at ~28kDa indicating poor expression of MntA in this fraction. This is similar to all

the elutions of the soluble fraction from all the different experiments mentioned at Table 2;

Lane 2: Elutions number 3 from the insoluble fraction of expression number 1, after it was

solubilized in 8M urea. There is a large band at ~28kDa indicating extensive expression of

MntA in this fraction. This is similar to all the elutions of the insoluble fraction from all the

different experiments mentioned at Table 2, although the elutions from experiment number

1 gave slightly larger amount of more purified protein.

MntA protein at

~28 kDA.

47

6.2.3 Purification

Since it appeared that in all conditions the MntA protein is expressed as inclusion bodies, it

was clear that the protein would have to be solubilized and then refolded. The solvent that

solubilized the inclusion bodies contained urea after attempts to solubilize the inclusion

bodies with different treatments with the detergent n-dodecyl-β-D-maltoside were

unsuccessful. We used urea to afford sufficient solubility to the protein based on a

crystallization protocol of sparingly soluble stress related proteins [50]. This is a generally

advantageous method to obtain diffraction quality protein crystals at urea concentration of

2M. Attempts were made to find the way to achieve elutions from the Ni column containing

the balance between achieving large amounts of highly purified protein that is solubilized in

the lowest urea concentration:

Table 5: MntA purification attempts.

Experiment number Urea concentration in

the lysis buffer (M)

Urea concentration in

the insoluble fraction*

(M)

Urea concentration

in the elution

buffer (M)

1. 0 8 2

2. 0 8 8

3. 4 --------- 2

4. 8 --------- 2

5. 8 --------- 8

* In the purification attempts where urea was added to the lysis buffer, only one soluble

fraction containing the protein was obtained after French- press cell disruption.

Figure 21: Western blot analysis of

MntA. Lane 1-5: Elutions number 1-5

from the insoluble fraction of expression

number 1, after it was solubilized in 8M

urea.

MntA protein at

~28 kDA.

1 2 3 4 5

48

Again, a delicate balance had to be maintained between lowering the urea concentration to its

minimum by gradual dialysis and still preserving high MntA concentration without formation

of aggregations. In most purifications the urea concentration was lowered to 2M and the

MntA could be concentrated to 6 mg/ml. The only time the urea concentration was lowered to

~0M, was in experiment number 1, where the initial urea concentration in the elutions was

low (2M). After the aggregation was removed a surprising MntA concentration of ~3 mg/ml

nearly without urea was obtained. This was the first and only time the MntA concentration

was maintainable without urea.

MntA protein

at ~28 kDA.

1 2 3 4 5

Figure 22: MntA purification.

Lane 1: Elution number 3 from experiment number 1 yielded poor amount of purified

MntA protein; Lane 2: Elution number 3 from experiment number 2 yielded large amount

of purified MntA protein; Lane 3: Elution number 3 from experiment number 3 yielded

smaller amount of less purified MntA protein then in experiment number 2; Lanes 4 and

5: Elutions number 3 from experiments number 4 and 5, respectively, yielded large

amounts of less purified MntA protein then in experiment number 2.

49

From all the purification attempts, a basic scheme of MntA isolation and purification emerges

(Figure 23):

6.2.4 Crystallization

A small number of crystals were obtained after a period of 4 days – 2 weeks after the MntA

was purified using purification number 1, in the only time that nearly all of the urea was

removed (all other crystallization attempts were in the presence of 2M urea), leaving still a

maintainable MntA concentration (~ 3mg/ml). The protein crystallized by the hanging drop

method in the presence of 0.1M MgCl2, 0.1M NaAcetate tryhydrate pH 4.6, 18% PEG 400; or

0.2M MgCl2 hexahydrate, 0.1M Hepes sodium pH 7.5, 30% PEG 400.

We managed to obtain several crystals (Figure 24) that were mounted in the presence of

cryoprotectors, but the crystals didn't yield diffraction.

6.2.5 Tryptophan fluorescence

The fluorescence of a folded protein is a mixture of the fluorescence from individual aromatic

residues. However, tryptophan has much stronger fluorescence and higher quantum yield than

the other two aromatic amino acids. Nevertheless, resonance energy transfer can occur from

proximal phenylalanines to tyrosines and from tyrosines to tryptophans. This is the reason

why the fluorescence spectrum of a protein containing the three residues usually resembles

that of tryptophan (According to "Intrinsic Fluorescence of Proteins and Peptides"

Figure 24: MntA crystals.

Figure 23: preparation of MntA for crystallization.

50

http://dwb4.unl.edu/Chem/CHEM869N/CHEM869NLinks/pps99.cryst.bbk.ac.uk/projects/gm

ocz/fluor.htm).

When excited at 295 nm, the tryptophan fluorescence spectrum shifts to shorter wavelength as

the polarity of the solvent surrounding the tryptophan residue decreases, making the

tryptophan fluorescence an indicator for the protein's state of folding [48]:

While a red shift in the tryptophan fluorescence will indicate a more unfolded protein, a blue

shift will indicate that the tryptophan residue has become embedded in a less polar

surrounding. Since during folding most proteins tend to hide their hydrophobic cores from the

surrounding solvent, a tryptophan fluorescence blue-shift can indicate folding.

Tryptophan fluorescence can be quenched by neighboring acidic groups such as aspartic acid

and glutamic acid which can also be used to obtain information about the state of the protein's

refolding.

According to the theoretical model of the MntA protein (Figure 28-F), its single tryptophan is

almost fully solvated. Its neighbors are an aspartic acid and a glutamic acid .The MntA

fluorescence was measured in the presence of 8M urea and following a rapid dilution to 2M

urea (at the same final protein concentration) to try and assess whether removal of the urea

afforded protein refolding: In 8M urea, the MntA emission maximum is at 357nm. In 2M urea

the MntA emission maximum is blue shifted to 349nm and is quenched by ~9.5% (Figure 25).

If the MntA was still completely unfolded in 2M urea we would expect that a blue shift would

not occur. If the protein had refolded incorrectly, with the tryptophan completely embedded in

the protein's core, we would expect a larger blue shift (of ~ 20nm). The fact that there was

also a quenching of the fluorescence could indicate that the aspartic acid and glutamic acid

residues are in close contact with the tryptophan residue, again hinting that the protein is not

unfolded.

Figure 25:

MntA emission

spectra.

51

6.2.6 Circular Dichroism (CD)

A chiral chromophore absorbs the polarized light according to its chemical surrounding. In

proteins, optical activity arises from the asymmetric α-carbon atoms of the peptide bond,

making CD useful to detect the presence or the absence of ordered secondary structure

content in a given protein (Figure 26).

CD spectra couldn’t be performed on MntA solubilized in 2M urea due to the high absorbance

of urea in ~200nm. The urea was removed (~0M). Due to the MntA's tendency to aggregate

without urea, CD was performed on much diluted protein (~0.1mg/ml).

Table 6: secondary structure type comparison.

Secondary structure type Alpha helix Beta sheet Other

% in protein according to predictions 31.92 22.69 45.38

% in protein according to the CD results algorithm 47 28 25

The first row of table 6 indicates on MntA secondary structure prediction compared to the CD

spectra analysis of purified MntA as it is indicated in the second row. DICHROWEB web

server analyzed of CD spectroscopic data using the CDSSTR algorithm were to provide

calculated secondary structure content [47].

Figure 26: CD spectra results. Far UV CD spectra associated with various types

of secondary structure. Solid line, -helix; long dashed line, beta sheet.

Superposition of the two lines between 200- 240nm, gives approximately the

spectra shown in B; B. Far UV CD spectra of purified MntA.

Figure 26-A is adopted from Sharon, M. Kelly et al (2005).

A. B.

52

One can see that the CD results of secondary structure content is similar to the prediction,

applying that the purified MntA has an ordered secondary structure.

6.2.7 Malachite green phosphate assay

The complex was calibrated with free phosphate standards (Figure 27). The reaction was

completed within 20 min at 25°C and monitored at 650nm.

This assay couldn’t be performed on MntA solubilized in 2M urea due to the high absorbance

of urea in 650nm. The urea was removed (~0M) after the sample's dilution by 50 fold. The

dilution of the sample was also performed to overcome the MntA's tendency to aggregate

without urea. The MntA protein's concentration in the assay was ~0.1mg/ml.

The ability of cloned and purified MntA protein to hydrolyze ATP was measured as the

difference in phosphate concentration in samples with/without MntA (Table 7). The

phosphate concentration ("x" in the linear fit equation) was calculated from the absorbance

("y" in the linear fit equation).

Table 7: MntA's malachite green phosphate assay

Sample number Additives

O.D

[Phosphate],

µM

sample 1- no protein 20µl ATP+ 780µl 50 mM Tris buffer+

200µl malachite green 0.47 5.25 µM

sample 2- 0.01 mg/ml

MntA protein

20µl ATP+ 770µl 50 mM Tris buffer+

200µl malachite green 0.51 5.91µM

y = 0.060x + 0.155

0

0.5

1

1.5

2

2.5

3

0 10 20 30 40 50

OD, 650nm

[Phosphate], µM

Phosphate standards curve

Figure 27: Phosphate calibration curve. Blue curve: the phosphate calibration curve.

Pink line: Linear fit of the calibration curve. The linear fit equation is indicated.

53

Adding MntA to the assay increases the free phosphate concentration (Table 7), which applies

on the existence of hydrolysis. However these results are preliminary and aren’t significant.

Perhaps for more significant results that clearly support the existence of hydrolysis, the assay

should be performed on MntA fused to MntB as it is on the native cell form.

6.2.8 Computational modelling.

Since the structure of MntA from Synechocystis sp. PCC 6803 is not determined yet, we used

computational programs (see above) to create its model. The model was created based on the

NBD structure from a branched chain amino acid transporter from hyperthermophilic archeon

Methancoccus jannaschii that was determined as a monomer in the asymmetric unit, with

bound ADP [51], so the prediction of the MntA Synechocystis ADP binding site was

available. The homology between the two proteins is 32%. MntA contains all the NBD motifs

(Figure 28) and so the model illustrated the presence of these motifs with orientation towards

the ADP.

Another model was created based on the NBD structure of a metal-chelate-type transporter

HI1470/1 from H. influenza. This structure was solved as a dimer fused to the TMD dimer in

the asymmetric unit [52]. The homology between the two proteins is 30%. In the model of the

dimer one can see the orientation of the motif in first NBD towards the motives in the second

one. Two positions for two ATP molecules are created at the NBD- NBD interface between

the ‘Walker A’ of one NBD and the ‘ABC signature’ motif of the other and vice versa (Figure

29).

54

Figure 28: Monomeric MntA model. A. ConSeq output of MntA sequence. Highlighted in

pink are the NBD motives. All the motives relevant to NBD's are found in the MntA

protein; B. NBD motives in the MntA sequence. Each color corresponds to indicate

motives: orange- A-loop, cyan- Walker-A, white- Walker-B, purple- switch motif, pink-

ABC signature, yellow- Q-loop, blue- D-loop; C. MntA model. With the ADP indicated as

spheres and the NBD motives highlighted corresponding to the colors mentioned in B; D.

MntA motives in the orientation towards ADP. A-loop, Walker-A and Walker- B remaining

close to the ADP; E. Alignment of the two NBD structures gave RMSD=1.896 Ǻ, (green-

MntA structure from Synechocystis, cyan- NBD model from Methancoccus jannaschii, red

spheres- ADP); F. Other orientation of MntA model with ADP and the motives are shown

along with the only tryptophan amino acid (colored in red) in the protein and its acidic

neighbors (colored in turquoise) that are indicated in the tryptophan florescence assay.

A C

B

E

F

D

55

Figure 29: Dimeric MntA model. A. MntA dimer predicted structure. When present, the

two ATP molecules are sandwiched at the NBD–NBD interface between the ‘Walker A’

(colored in cyan) of one NBD and the ‘ABC signature’ motif (colored in pink) of the

other and vice versa. The colors correspond to the motives as in figure 28; B. MntA dimer

predicted structure, different orientation, closer look; C. The contact interface between the

two NBDs, bottom view. The D- loop motive (colored in blue) is suspected to be

primarily involved with this contact; D. The contact interface between NBD and TMD,

side view (The MntB model, colored in cyan, is based on the TMD from HI1470/1

structure);

A

B

C D

F G

E

56

Figure 29 (cont.):

E. Fused NBD structure electrostatics bottom view twisted in 90°, with transparency of the

surface showing the cartoon structure. In blue are the positive patches, in red are the

negative patches and in white are the hydrophobic ones. The interface is composed of

hydrophobic connections as well as in polar ones; F. Structure electrostatics between

MntABC transporter's TMD and NBD. Blue positive patch of MntB connecting to the red

negative patch located in the interface of MntA; G. Structure electrostatics of dimeric

TMD and NBD from MntABC transporter. Most of the predicted MntB is hydrophobic as

it is TMD, except in the interface contact with MntA and MntC, and the MntA is more

polar.

57

7. Discussion

7.1 MntC

Although the great similarity between the MntC protein structure features from Synechocystis

and from T. vulcanus, a big difference has emerged from the purification by AEC-HPLC. The

MntC protein from T. vulcanus was eluted in the flow-throw in pH=8 fraction while the MntC

protein from Synechocystis was bound to the column and was eluted with addition of NaCl.

This difference can be explained by the difference in these protein’s predicted iso-electric

point (pI T. vulcanus =7.8 compared to pI Synechocystis =4.2), which indicates that they will have a

different electric charge in pH=8 (Figure 30).

This can be supported by the difference in the MntC surface electrostatics as predicted from

the model of MntC from T. vulcanus and the structure of MntC from Synechocystis.

The model of MntC from T. vulcanus showed more positive patches, with a positive total

charge (Figure 31), compared to the negative total charge of the MntC from Synechocystis

structure.

Figure 30: Net charge of MntC from T. vulcanus.

The "y" axis integer as "Z" indicates the net charge. In

pH~8 the net charge is neutral so it isn't bound to the

AEC-column at this pH. In pH~5.5 the net charge is

positive so it is bound to the CEC-column at this pH.

A B

Figure 31: MntC structure electrostatics. In blue are the positive patches, in red

are the negative patches and in white are the hydrophobic ones. The MntC

structure is transparent in green and manganese ion is transparent as a pink sphere;

A. A MntC protein model from T. vulcanus with generated electrostatics. The total

charge is 1.0 in relative units; B. A MntC protein structure from Synechocystis

with generated electrostatics. The total charge is -18.4 in relative units.

58

7.2 MntA

The overexpression attempts (Table 4) were similar in that none of the induction conditions

resulted in soluble MntA.

Nevertheless, because of the fact that none of the crystals obtained from a specific purification

scheme, yielded diffraction, other purification experiments and crystallization conditions may

be applied.

The existence of a small blue shift (~7 nm) in the tryptophan florescence implies on the

tryptophan's location facing the solvent, but with more hydrophobic surrounding as it is on the

prediction. This result, together with the protein's quenching that implies on acidic neighbors

(again, as in the prediction) implies on the correct refolding of the MntA protein in 2M urea.

CD spectra of MntA shows a positive peak around 200nm, which doesn't exist in unordered

proteins, as well as a negative value at 220 nm which differs from unordered proteins, there a

value near zero exist. These values are distinct enough to distinguish MntA from unfolded

protein (According to "DisProt, Database of Protein Disorder" http://www.disprot.org/).

From the models that are based on NBD structures solved as monomer and dimer are

indicating on the fact that most of the isolated NBDs are monomers in the absence of the

TMDs. Addition of ATP under non-hydrolyzing conditions causes these monomeric NBDs to

dimerize. The situation is different in full transporters, where the crystal structures reveal

continued contact between the NBDs whether nucleotide is present or not [18, 35, 52].

59

8. Conclusions and future plans

The pursuit of obtaining large quantities of purified and homogenous MntA and MntC

proteins was successful: We managed to clone and to gradually find and improve the

purification scheme for both of the proteins.

Although the fact that the MntA protein in its native Synechocystis sp. PCC 6803 form is

bound to a hydrophobic, transmembrane protein and when cloned is expressed in inclusion

bodies, we managed to solubilize , purify and even crystallize it, however, we have yet

proved that we maintained its correct refolding.

The small amount of crystals that were obtained from the MntC protein were found to yield

an unsolvable diffraction due to high number of monomers in the asymmetric unit.

Following the progress in obtaining large amounts of purified MntA and MntC proteins,

biochemical and biophysical studies can be done to show the existence of native

functionalities and to determine the sequence of events during the reaction cycle of Mn

transport and ATP hydrolysis.

Additional research and techniques need to be applied to determine the ability of the purified

MntA to bind and hydrolyze ATP as it was implied from our research.

Future research determining the ability of MntC to bind Mn and its affinity towards other

metals needs to be implemented.

Furthermore, the pursuit of high quality crystal structures of the proteins is a priority. This

should be done by searching for better crystallization conditions. The recloning of the MntC

protein without the loops of variable structure may yield better crystals.

In addition, since the MntB protein is highly hydrophobic, it was cloned and co-expressed

together with the MntA, thinking this might help the overexpression, purification and

crystallization of the MntB protein. This study is still at its first steps and future expression

techniques (and maybe other recloning path) should be performed to get better expression of

the MntB protein.

Knowing the structure of a complete ABC importer system, trapped in distinct states,

including performing site-directed mutagenesis on its components will probe the

conformational changes during the transport cycle.

60

9. References

1. Frantisek Supek et al (1997) Function of metal-ion homeostasis in the cell

division cycle, mithochondrial protein processing, sensitivity to mycobacterial

infection and brain function. The Journal of Experimental Biology 200: 321–

330.

2. Andreas Rolfs and Matthias A. Hediger (1999) Metal ion transporters in

mammals: structure, function and pathological implications. Journal of

Physiology 518: 1-12.

3. Frausto da Silva, J.J.R. and Williams, R.J.P. (1991) The Biological Chemistry of

the elements: the Inorganic Chemistry of Life. Oxford University Press, New

York.

4. Pecoraro,V.L. (1992) Manganese Redox Enzymes. VCH Publishers Inc. New

York.

5. Silver, S. and Jasper, P. (1977) Microorganisms and Minierals. Marcel Dekker

Inc., New York.

6. Mergler, D. et al Manganese neurotoxicity, a continuum of dysfunction: Results

from a community based study. Neurotoxicology [Neurotoxicology] 20, no. 2-3:

327-342.

7. Debus, R. (1992) The Manganese and Calcium ions of Photosynthetic Oxygen

Evolution. Biochim. Biophys. Acta. 1102: 269-352.

8. Sproviero1, M. E. (2007) Quantum mechanics/molecular mechanics structural

models of the oxygen-evolving complex of photosystem II. Current Opinion in

Structural Biology 17:173–180.

9. Bowes, J. M., Crofts A. R., Itoh S. (1979) High-potential acceptor for

photosystem II. Biochim Biophys Acta 547:320-335.

10. Cheniae, G.M. (1970) Photosystem II and O2 evolution. Animii Rev. Planit

Phy.siol. 20: 467-498.

11. Bricker, T. M. (1992) Oxygen evolution in the absence of the 33-kilodalton

manganese-stabilizing protein. Biochemistry 31: 4623–4628.

12. Cheniae, G.M. and Martin, I.F. (1969) Photoreactivation of manganese catalyst

in photosynthetic oxygen evolution. Planit Physiol. 44: 351-360.

13. Joliot P., Barbieri G., Chabaud R. (1969) A new model of photochemical centers

in system-2. Photochem Photobiol 10: 309.

61

14. Kok, B., Forbush B., McGloin M. (1970) Cooperation of charges in

photosynthetic O2 evolution. 1. A linear four step mechanism. Photochem

Photobiol 11:457-475.

15. Ferreira K. N. et al (2004) Architecture of the photosynthetic oxygen-evolving

center. Science 303:1831-1838.

16. Kaspar, P. Locher et al (2002) The E. coli BtucD Structure: A Framework for

ABC Transporter -Architecture and Mechanism. Science 296: 1091-1098.

17. Roger J. P. Dawson et al (2006) Structure of a bacterial multi-drug ABC

transporter. Nature 443: 180-185.

18. Hollenstein, K. et al (2007) Structure of an ABC transporter in complex with its

binding protein. Nature 446: 213-216.

19. Borths, E. L. et al (2005) In vitro functional characterization of BtuCD-F, the

Escherichia coli ABC transporter for vitamin B-12 uptake. Biochemistry 44:

16301-16309.

20. Bartsevich, V. V., Pakrasi, H. B. (1995) Molecular identification of an ABC

transporter complex for manganese: analysis of a cyanobacterial mutant strain

impaired in the photosynthetic oxygen evolution process. EMBO J 14: 1845-

1853

21. Kanteev, M. (2007). Structure-Function investigation of Manganese transporters.

The role of the disulphide bond in the MntC protein. Master thesis.

22. Amram-Anati Rina (2002). Progress in Determination of 3D structures of

proteins Involved in Manganese Functions in Phtosynthesis Organisms. PhD

thesis.

23. Rukhman, V. (2005) Determination of the three dimensional structure of MntC:

a periplasmic manganese transport protein from Synechocystis sp. PCC 6803.

PhD thesis.

24. Rukhman, V., Anati, R. Melamed-Frank, M. Adir, N., (2005) The MntC crystal

structure suggests that import of Mn+2

in Cyanobacteria is redox controlled.

J.Mol.Biol. 348: 961-969.

25. Procko, E. et al (2009) The mechanism of ABC transporters: general lessons

from structural and functional studies of an antigenic peptide transporter. The

FASEB Journal article.

26. Jakubovics, N. S. and Jenkinson H. F. (2001) Out of the iron age: new insights

into the critical role of manganese homeostasis in bacteria. Microbiology 147-7:

1709-1718.

62

27. Bhattacharyya-Pakrasi, M. et al (2002) Manganese transport and its regulation in

bacteria. Biochem. Soc. Trans 30: 768–770.

28. Pakrasi, H. et al (2001). Transport of metals: a key process in oxygenic

photosynthesis. In Regulation of Photosynthesis (Aro, E.-M. & Andersson, B.,

eds), pp. 253–264, Kluwer Academic Publishers, Dordrecht.

29. Bartsevich, V. V., Pakrasi, H. B. (1999). Membrane Topology, the

transmembrane Protein Component of an ABC Transporter System for

Manganese in the Cyanobacterium Synechosystis sp. PCC 6803. J.Bacteriol.

181(1): 3591-3593.

30. Bartsevich, V. V., Pakrasi, H. B. (1996). Manganese transport in the

cyanobacterium Synechosystis sp. PCC 6803. J.Biol.Chem. 271: 26057-26061.

31. Ogawa, T. et al (2002). A two component signal transduction pathway regulates

manganese homeostasis in Synechocystis 6803, a photosynthetic organism. J.

Biol. Chem. 277: 28981–28986.

32. Chandler, L. E., Bartsevich, V. V. & Pakrasi, H. B. (2003). Regulation of

manganese uptake in Synechocystis 6803 by RfrA, a member of a novel family

of proteins containing a repeated five- residues domain. Biochemistry, 42, 5508–

5514.

33. Adir, N., Rukhman, V., Anati, R., Brumshtein, B. (2002). Prelimenary X-ray

crystallography analysis of a soluble form of MntC, a periplamic manganese-

binding component of an ABC-type Mn transporter from Synachocystis cp. PCC

6803.Acta Crystallog. Sect.D. 58: 1476-1478.

34. Hung, L. W. et al (1998) Crystal structure of the ATP-binding subunit of an

ABC transporter. Nature 396: 703-707.

35. Hollenstein K. et al (2007) Structure and mechanism of ABC transporter

proteins. Current Opinion in Structural Biology 17:412–418.

36. Ambudkar, V. et al (2006) The A-loop, a novel conserved aromatic acid

subdomain upstream of the Walker A motif in ABC transporters, is critical for

ATP binding. FEBS Letters 580-4: 1049-1055.

37. Gale, R. (2000) Crystallography Made Crystal Clear. San Diego: Academic

Press, 2nd

edition.

38. Mitchell, E. Kuhn, P. and Garman, E. (1999) Demystifying the synchrotron trip:

a first time user’s guide. Structure 7: R111–R121.

39. Mattews, B.W (1968) Solvent content of protein crystal. Mol.Biol. 33: 491-497.

63

40. Smyth, M.S and Martin, J.H.J. (2000) X ray crystallography. J Clin Pathol: Mol

Pathol 53: 8–14.

41. McPherson, A. (2004) Introduction to protein crystallization. Methods 34: 254–

265.

42. Vermaas, W. F. J. (1998) Methods Enzymol, 297: 293–310.

43. Sambrook, J. et al (1989) Molecular Cloning: a laboratory manual. 2nd

ed. N.Y,

Cold Spring Harbor Laboratory Press, 1659.

44. Smith, L.M. et al (1986) Fluorescence detection in automated DNA- sequence

analysis. Nature, 321: 674–679.

45. Laemmli, UK (1970) Nature, 227: 680–685.

46. Sharon, M. Kelly et al (2005) How to study proteins by circular dichroism.

Biochimica et Biophysica Acta, 1751: 119 – 139.

47. Lee Whitmore and Wallace B. A. (2004) DICHROWEB, an online server for

protein secondary structure analyses from circular dichroism spectroscopic data.

Nucleic Acids Research 32: W668–W673.

48. Duy, C. and Fitter, J. (2006) How aggregation and conformational scrambling of

unfolded states govern fluorescence emission spectra. Biophysical Journal 90:

3704–3711.

49. Berezin1, C. et al (2004) ConSeq: the identification of functionally and

structurally important residues in protein sequences. Bioinformatics application

note. 20-8:1322-1324.

50. Dines, M. et al (2006) Crystallization of sparingly soluble stress-related proteins

from cyanobacteria by controlled urea solublization. Journal of Structural

Biology 158: 116-121.

51. Karpowich, N. et al (2001) Crystal structures of the MJ1267 ATP binding

cassette reveal an induced-fit effect at the ATPase active site of an ABC

transporter. Structure 9: 571-586.

52. Pinkett, H. W. et al (2007) An inward-Facing confirmation of a Putative Metal-

chelate Type ABC Transporter. Science 315: 373–377.

I

חקר מבנה ותפקוד של

MntC -ו MntAחלבוני

מציאנובקטריה מזופילית

ותרמופילית

אביטל להב

II

חקר מבנה ותפקוד של

MntC -ו MntAחלבוני

מציאנובקטריה מזופילית

ותרמופילית

על מחקרחיבור

לשם מילוי חלקי של הדרישות לקבלת התואר

מגיסטר למדעים בכימיה

אביטל להב

מכון טכנולוגי לישראל -הוגש לסנט הטכניון

2009 אפרילט חיפה "תשס ניסן

III

נעם אדיר' המחקר נעשה בהנחיית פרופ

ש שוליך"ע בפקולטה לכימיה

, נעם אדיר על עזרתו הרבה' אני מודה לפרופ

. הנחייתו וסבלנותו לכל אורך המחקר

מכון טכנולוגי לישראל –אני מודה לטכניון

על תמיכתו הכספית הנדיבה בהשתלמותי

IV

תקציר

למתכות תפקידים בריאקציות . לתפקודי התא הקשורות של אורגניזמים שונים ניתן למצוא מגוון מתכות יהםבתא

ולכן חוסר ברגולציה על ביטוי גנים ובשמירת ההומיאוסטזיס של רדיקלים חופשיים , אנזימים שוניםקטליטיות של

עלולות המתכות ,אם הן נמצאות בכמות מופרזת בתאגם , למרות זאת. של מתכות כמעט תמיד מוביל למות התא

, א את האורגניזמים השוניםדבר שהבי -חייבת להיות תחת בקרה כוולגרום נזק ולכן כניסתן לתא ודרך טיפולן בת

. הדוקהלפתח מערכות שונות אשר תפקידן להוביל מתכות לתוך התא בספציפיות ותחת בקרה ,במהלך האבולוציה

הבנת מנגנון הטרנספורט וידיעת ולכן לעצירת התרבותם יביא, אלו לפתוגנים מתכותכניסת המונעמנגנון מציאת

יש בהםבזמנים אלו דבר הרצוי, הביא לפיתוח של תרופות חדשותהמבנים של החלבונים המשתתפים בו יכול ל

. עמידות לאנטיביוטיקה ופתחאשר עליה במספר זני החיידקים

אשר נמצאת הן ABC (ATP-Binding Cassette) transporter אחת ממערכות הטרנספורט היא מערכת של

אשר מוליכות, permeases גדולה של מערכת זו שייכת למשפחה. בתאים אאוקריוטים ובתאים פרוקריוטים

. בספציפיות גדולה ,מולקולות שונות דרך הממברנה התאית

ABC transporters קיימים גם כ- exporters אשר מעבירים סובסטרט מחוץ לציטופלסמה וגם כ- importers,

רנספורט נעשה הט בשני המקרים. לתוך הציטופלסמה יםמעבירים סובסטרט שם הם, בתאים פרוקריוטים בלבד

. מועדף אנרגתיתהתהליך –ATPבצימוד להידרוליזת

ABC transporters חלבון טרנס ממברנלי המצוי בממברנה : בנויים כקומפלקס המורכב משלושה חלבונים

מחובר לחלבון המצוי בציטופלסמה ומפרק חלבון זה, הציטופלסמטית המסייע במעבר הסובסטרט דרך הממברנה

.ATP רק ב ,אליהם אשר כ יוצרים דימרים"לו בדחלבונים א-importers פרוקריוטים מצטרף חלבון תאים ב

רק , ABC transportersלמרות שקיימים אלפי . סובסטרטה את קושרושם בפריפלזמההנמצא שלישי מסיס

.נחקרהמנגנון עדיין לבודדים מהם ישנו מבנה פתור ו

יםחיידק -נמצא בציאנובקטריה טרנספורטר זה MntABC.נה המכו ABC transporter בעבודה זו התמקדנו ב

,למרות זאת .ביכולת נדידתםהוא םיתרונו פוטוסינתזהה מקיימים את תהליךשבדומה לצמחים םייפוטואוטוטרופ

מפתחים יכולת הציאנובקטריה ,לכן .באזור ימי תםהימצאועת למשל ב ,ינטיםימחסור בנוטר יש להם לעיתים

. ABC transporter -חשיבות מערכת ה אשר מהווה את רחיותהכהכנסת מתכות

MntABC זהוABC transporter הראשונה משאבת המנגן זוהי. מעביר מנגן מהפריפלסמה לציטופלסמהה

יוני מנגן בתהליך הראשוני של חמצון 4הפוטוסינתזה דרושים מהלךבשל העובדה כי ב רבהנה ולה חשיבות ישאופי

העובדה כי II (PSII .)פיגמנט מערכת האור -של קומפלקס החלבון lumen -החשוף לחלק המים המתרחש ב

מיקרומולריים הגנום -משאבה אחרת המכניסה מנגן לציטופלסמה ואילו בריכוזי מנגן תת נהבריכוזי מנגן גבוהים יש

נון בקרה חשוב מעלה מנג ,כל כך למנגן גבוהה תות ואפיניוספציפיהינה בעלת מתחיל לבטא את המשאבה הזו ש

. ומראה איך התא לא מבזבז אנרגיה לבניית המשאבה כשלא צריך אותה

. "MntC"-סובסטרט במשאבה זו המכונהההוא חלבון קושר MntABC -ה הראשון בו התמקדנו מתוךהחלבון

י "נפתר במעבדתנו ע Synechocystis sp. PCC 6803מהציאנובקטריה המזופילית MntCמבנהו של החלבון

דברים נםאך בעקבות בעיות רזולוציה יש ,יון מנגן באתר קשירת המתכת עם 2.9Ǻ מן לידי רזולוציה שלכלריה רוו

V

מתכות ידועים כמו תפקיד הקשר הדיסולפידי שנמצא ליד מקום קישור המנגן והספציפיות של המנגן לעומת שאינם

:הציאנובקטריה התרמופיליתלכן ניסינו לענות על שאלות אלו מ .אחרות בעלות מאפיינים דומים

Thermosynechococcus vulcanus, .זן זה של ציאנובקטריה גדל ב- C°60 בניגוד לציאנובקטריה המזופילית

30 - -שגדלה בoC °20 לחלבון ונוכל לפתור את מבנהו ברזולוציות סטביליותחשבנו שהתרמופיליות תביא , ולכן

. פילית ונוכל להשוות בין שניהםיותר מהחלבון מהציאנובקטריה המזו בוהותג

ביולוגיה השתמשנו בכלים של , ישירות מהציאנובקטריהMntC -מכיוון שקשה להשיג כמויות גדולות של חלבון ה

הנמצא פידי שמעגן את החלבון לממברנה יביטוי ללא הזנב הל ווקטורל ת הגן לחלבון זהמולקולרית כדי לשבט א

וקטור ו. טרמינלי על מנת לקבל רמת ניקיון נוספת C-טידינים בקצה הבציאנובקטריה ובתוספת של שישה היס

לאחר מכן החלבון בוטא ביתר בחיידקים אשר פוצצו לקבלת פרקציה מסיסה . E. coliהביטוי הוכנס לחיידקי

החלבון נאסף . בקצהוהוספו י ששת ההיסטידינים ש"שהועברה בקולונת ניקל להפרדת החלבון הנקשר לקולונה ע

לקבלת החלבון בפרקציה הראשונה שאינה נקשרת לקולונה וכך הוא PH=8 -ר בקולונת מחליף אניונים בוהועב

- ולכן ב PH=7.8 -הנקודה האיזואלקטרית המצופה מהחלבון היא ב. מנוקה מחלבונים אחרים שנקשרים אליה

PH=5.5 ן הועבר בקולונת מחליף הפונטציאל האלקטרוסטטי המצופה על פני שטח החלבון הוא חיובי וככזה החלבו

התקבל מונומר נקי . NaCl 30%בתוספת של יצאו לקבלתו בפרקציה הנקשרת לקולונה PH=5.5 -קטיונים ב

, בנוסף. ולקבל מהם דיפרקציה להפרידם, םשים מחטיים שמאוד קשה להוציאלמדי אשר הועמד לגיבוש לקבלת גבי

הערכה שקיימים לא ניתנת לפתירה בשל זו אך בינוניתיה התקבלו גבישים גדולים ומחוספסים שנתנו אמנם דיפרקצ

. המולקולה ביחידה האסימטרית מספר רב של עותקי

הומולוגיה 54%) ההומולוגי ס מבנה החלבון "מהציאנובקטריה התרמופילית ע MntC-בנינו מודל של חלבון ה

ות את הסופרפוזיציה והזהות בין אותן ניתן היה לראבו , דומה מודלציאנובקטריה המזופילית לקבלת מה (א"ברצף ח

MntC א שקושרות את המנגן בשני החלבונים ואת מקום הקשר הדיסולפידי שנפוץ בחלבונים הומולוגיים ל "ח

.פ השטח"בפוטנציאל האלקטרוסטטי ע ניקרו הבדלים, למרות זאת .בציאנובקטריה

: מזופיליתקושר הסובסטרט מהציאנובקטריה ה MntCשמבנהו של חלבון למרות

Synechocystis sp. PCC 6803 עדיין חסרים מבניהם של שאר חלבוני ה, נפתר- MntABC מציאנובקטריה זו

. MntA-מטרנספורטר זה הנקרא NBD-כדי להבין את מנגנון הטרנספורט ולכן התמקדנו גם בחלק הב

טרמינלי שלאחר מכן הוכנס C -ביטוי בתוספת של שישה היסטידינים בקצה ה ווקטורלגן לחלבון זה שיבטנו את ה

נסיונות ' ולאחר מס inclusion bodies -ב והחלבון בוטא ביתר בחיידקים אשר פוצצו לקבלת. E. coliלחיידקי

לקבלת החלבון המומס והעברתו urea 8M י"כושלים להעברתו לפרקציה מסיסה הוחלט להמיס את החלבון ע

-החלבון נאסף ולאחר מכן ה. י ששת ההיסטידינים שבקצהו"בקולונת ניקל להפרדת החלבון הנקשר לקולונה ע

urea 0~ עד להגעה לריכוז שלי דיאליזה "הוצאה בהדרגה עM החלבון כדי לאפשר את קיפולו מחדש ולאחר מכן

. גבישים שלא נתנו דיפרקציה גובש לקבלת

NBDכי הוא מכיל את כל שבעת המוטיבים של חלבון אינו ר MntA -ן הלפי תוצאות ניתוח הרצף של חלבו

, כדי להרכיב את המודל שלוב MntA -של חלבון ה בחיפוש אחר מבנה פתור מהומולוג. ATPהמבצע הידרוליזת

:נמצא המבנה הפתור של

VI

"Branched chain amino acid transporter from hyperthermophilic archeon Methancoccus

jannaschii" של חלבון ה מודלהלפי . א"ברצף ח 32%כבעל הומולוגיה של- MntA ומצה חהראינו כי שהרכבנו

ליד .כמעט כולה חשופה לממס ולא נמצאת בפנים ההידרופובי של החלבון, היחידה בחלבון ,"טריפטופאן" האמינית

. אספרטית וחומצה גלוטמית חומצה -ישנן שתי חומצות אמינו טעונות שלילית חומצה אמינית זו

blue shift י התרחשותו של"ע מראה על סביבתה בכךא טריפטופאן תלוית ממס ו"של ח הפליטה הפלואורסנטית

כשהחלבון מקופל מתרחש ,בשל כך. של אורך הגל בפליטה המקסימלית כאשר עוברים לסביבה פחות פולארית

blue shift וכשהחלבון פרוס ישנוred shift . אשר יש לידה כיורדת א טריפטופאן "עוצמת הפליטה של חכן כמו

של החלבון הנתון בעת ערעורו קטן וגם ירידה בעוצמת הפליטה blue shiftקבלת , לכןו שכנים טעונים שלילית

של החלבון למבנה מחדשעל קיפולו מרמז urea M8 לעומת חלבון הנתון בריכוז של urea M2בריכוז של

. נכון שלישוני

: לחלבון CDבדיקת נערכההתקפל למבנהו השניוני בחזרה לדעת שהחלבון כדי

בקשר הפפטידי הוא כרומופור כיראלי שמסובב אור αהבדיקה מראה את מבנהו השניוני של החלבון משום שפחמן

מראות שהחלבון מורכב התקבלוהתוצאות ש. ביבה הכימית שלובצורה מסוימת והסיבוב ימינה ושמאלה נובע מהס

. דבר המרמז על קיפול נכון למבנה השניוני -בהתאם להערכה βמדפי -הליקסים ו α -מ

:של החלבון ATPעל מנת לזהות פעילות הידרוליזת מלכיט גרין לזיהוי פוספטנעשתה בדיקת

קיבלנו .פוספטה ו שלריכוז מלכיט גרין הקשור לפוספט חופשי לבין ו שלבליעת את הקשר ביןערכה זו מראה

. מובהקת מראות זאת בצורההמרמזות על קיומה של הידרוליזה אך לא מקדמיות ותתוצא

חלבון ביטוי וניקוי שלשיטות נמצאו .גבישים ונתקבלו MntCהניקיון של חלבון שופרה רמת המחקרבמהלך

MntA שה הקבצורה לא מסיסה לאחר ביטויו מתקבלשבתא הציאנובקטריה מצוי בחיבור עם חלבון הידרופובי ו

.ממנו התקבלו גבישים אשר ומקופל נכון חלבון נקי אף התקבללבסוף לניקוי והפרדה ו

MntABC-יש לקבל מבנים של כל חלקי ה ATP, -בכדי להבין את מנגנון הטרנספורט והצימוד להידרוליזת ה

transporter יניות לסובסטרט האופימחקר זה צריך להיות מלווה בבדיקות ביוכימיות להשוואת .בכל מיני מצבים

. ATPוהידרוליזת

יםשונ דרכי ביטויניתן גם למצוא .החלבונים גיבושל תנאים נוספיםי מציאת "לשם כך יש לשפר את הגבישים ע

קטורים ואו לו הםבקצותיללא אזורים בעיתיים הגנים המקודדים לחלבונים אלו את מחדש טשבל ףואשל החלבון

MntA -חלבון המשותף של ביטוי של מנגנון טרנספורט זה הינו ההבנהאת להעמיק לכוי נוסף אשר דבר. אחרים

ו של טויכנראה בבי יעזורממברנלי ההידרופובי במשאבה ו -החלק הטרנס אשר מהווה את MntB -לחלבון ה

.האחרון