γ-aminobutyric acida receptor subunit expression predicts functional changes in hippocampal dentate...

Journal of Neurochemistry, 2001, 77, 1266±1278

g-Aminobutyric acidA receptor subunit expression predicts

functional changes in hippocampal dentate granule cells during

postnatal development

Amy R. Brooks-Kayal,*,²,³ Melissa D. Shumate,§ Hong Jin,* Tatiana Y. Rikhter,*Mary Ellen Kelly* and Douglas A. Coulter*,²

*Pediatric Regional Epilepsy Program and Joseph Stokes Research Institute of The Children's Hospital of Philadelphia,

Philadelphia, USA

Departments of ²Pediatrics and ³Neurology, University of Pennsylvania, Pennsylvania, USA

§Department of Physiology, Medical College of Virginia, Virginia Commonwealth University, Richmond, Virginia, USA

Abstract

Profound alterations in the function of GABA occur over the

course of postnatal development. Changes in GABAA receptor

expression are thought to contribute to these differences in

GABAergic function, but how subunit changes correlate with

receptor function in individual developing neurons has not

been de®ned precisely. In the current study, we correlate

expression of 14 different GABAA receptor subunit mRNAs

with changes in the pharmacological properties of the receptor

in individual hippocampal dentate granule cells over the

course of postnatal development in rat. We demonstrate

signi®cant developmental differences in GABAA receptor

subunit mRNA expression, including greater than two-fold

lower expression of a1-, a4- and g2-subunit mRNAs and

10-fold higher expression of a5-mRNA in immature compared

with adult neurons. These differences correlate both with

regional changes in subunit protein level and with alterations

in GABAA receptor function in immature dentate granule cells,

including two-fold higher blockade by zinc and three-fold lower

augmentation by type-I benzodiazepine site modulators.

Further, we ®nd an inverse correlation between changes in

GABAA receptor zinc sensitivity and abundance of vesicular

zinc in dentate gyrus during postnatal development. These

®ndings suggest that developmental differences in subunit

expression contribute to alterations in GABAA receptor

function during postnatal development.

Keywords: g-aminobutyric acid, g-aminobutyric acidA recep-

tor, benzodiazepine, development, hippocampus, zinc.

J. Neurochem. (2001) 77, 1266±1278.

g-Aminobutyric acid (GABA) is the major inhibitory

neurotransmitter in the adult brain, but in early development

GABA actions can be excitatory where it may function as a

trophic signal (Ben-Ari et al. 1989, 1994; Barbin et al. 1993;

LoTurco et al. 1995; Behar et al. 1996; Liu et al. 1997).

Changes in GABAergic function during development arise

in part from alterations in the chloride ion reversal potential

(Zhang et al. 1991; Owens et al. 1996) mediated by changes

in expression of chloride transport proteins (Rivera et al.

1999). Altered expression of glutamic acid decarboxylase

(Dupuy and Houser 1996), and GABA receptor subtypes

(Laurie et al. 1992; Turgeon and Albin 1994; Brooks-Kayal

et al. 1998a; Caillard et al. 1998; Fritschy et al. 1999) also

contribute to these changes.

Fast synaptic inhibition in mature brain is mediated

primarily by GABAA receptors (GABAARs), heteromeric

protein complexes which form ligand-gated anion-selective

channels. Multiple GABAAR subunits have been identi®ed

(a1±6; b1±4; g1±3; r1±3; d; 1; p; f) (MacDonald and

Olsen 1994; Davies et al. 1997; Whiting et al. 1997;

Barnard et al. 1998; Bonnert et al. 1999), and different

1266 q 2001 International Society for Neurochemistry, Journal of Neurochemistry, 77, 1266±1278

Received January 4, 2001; revised manuscript received February 28,

2001; accepted February 28, 2001.

Address correspondence and reprint requests to Dr Amy Brooks-

Kayal, Division of Neurology, Children's Hospital of Philadelphia,

Abramson Pediatric Research Center, Rm 502, 3516 Civic Center Blvd.,

Philadelphia, PA 19104, USA. E-mail: [email protected]

Abbreviations used: aRNA, antisense RNA; DGC, dentate granule

cell; dNTP, deoxynucleotide triphosphate; GABAAR, GABAA receptor;

GFAP, glial ®brillary acidic protein; IPSC, inhibitory postsynaptic

current; NF-L, neuro®lament-L; P5±7, postnatal day 5±7; P17±21,

postnatal day 17±21; SDS, sodium dodecyl sulfate; ZOL, zolpidem.

subunit combinations produce recombinant receptor with

distinct functional properties (Vicini 1991). Varying the a-

and g-subtypes confers differences in benzodiazepine

pharmacology and inhibition by zinc (Draguhn et al. 1990;

vonBlankenfeld et al. 1990; Luddens and Wisden 1991;

White and Gurley 1995; Fisher and Macdonald 1998). The

b-subtype affects channel properties (Verdoorn et al. 1990),

benzodiazepine ef®cacy (Sigel et al. 1990; vonBlankenfeld

et al. 1990), af®nity for GABA analogues, phosphorylation-

mediated receptor modulation (McDonald et al. 1998), and

ef®cacy of allosteric modulation by the barbiturates,

loreclezole and steroids (Bureau and Olsen 1990, 1993;

Donnelly and MacDonald 1996). GABAAR-subunit expres-

sion varies in different brain regions, cell types and during

ontogeny. Developmental changes in GABAAR-subunit

expression have been documented in a variety of cell

types at regional (Gambarana et al. 1991; Zhang et al. 1991;

Bovolin et al. 1992; Laurie et al. 1992; Poulter et al. 1992;

Brooks-Kayal and Pritchett 1993; Fritschy et al. 1994) and

cellular levels (Brooks-Kayal et al. 1998a). Developmental

changes in the function and pharmacology of GABAARs in

different cell types have also been demonstrated (Rovira and

Ben-Ari 1991, 1993; Smart et al. 1991; Mathews et al. 1994;

Oh et al. 1995; Gibbs et al. 1996; Hollrigel and Soltesz

1997; Kapur and Macdonald 1999; Cohen et al. in press),

but how these changes correlate with subunit expression

within individual neurons has not been precisely de®ned.

GABAergic innervation of dentate granule cells (DGCs)

plays a critical role in determining information ¯ow between

entorhinal cortex and hippocampus. Developmental altera-

tions in DGC GABAAR properties could signi®cantly affect

hippocampal functions such as learning and memory, as

well as seizure susceptibility, in early childhood. To better

understand how changes in GABAAR-subunit composition

contribute to developmental alterations in receptor function,

expression of GABAAR-subunit mRNAs were pro®led in

individual DGCs from rats in the ®rst postnatal week

through adulthood and correlated with the pharmacological

properties of the receptors in the same cells.

Materials and methods

Acute isolation of neurons

Dentate granule cells (DGCs) were acutely isolated from rats aged

between 5 days and adulthood (90 days or older) according to

previously published protocols (Brooks-Kayal et al. 1998b). Brains

were dissected in chilled, oxygenated (95% O225% CO2) arti®cial

cerebrospinal ¯uid (aCSF) solution composed of (in mm): 201

sucrose, 3 KCl, 1.25 NaHPO4, 2 MgCl2, 2 CaCl2, 26 NaHCO3, and

10 dextrose. Hippocampal slices (450 mm) were cut on a vibratome

and incubated for 1 h in an oxygenated medium containing (in

mm): 120 NaCl, 5 KCl, 1 MgCl2, 1 CaCl2, 25 glucose, and 20

piperazine-N,N 0-bis-(2-ethanesulfonic acid) (PIPES), pH adjusted

to 7.0 with NaOH at 328C. Slices were enzymatically digested

20±30 min in 3 mg/mL Sigma (St Louis, MO, USA) protease

XXIII in PIPES, thoroughly rinsed, and incubated another 30 min

in PIPES medium before dissociation. The dentate gyrus was

visualized with dark-®eld microscopy, 1 mm2 chunks were cut,

then cells were mechanically dissociated and plated onto 35 mm

culture dishes in N-2-hydroxyethylpiperazine-N 0-2-ethane sulfonic

acid (HEPES) medium composed (in mm): 155 NaCl, 3 KCl, 1

MgCl2, 3 CaCl2, 0.0005 tetrodotoxin, and 10 HEPES-Na1, pH

adjusted to 7.4 with NaOH.

Voltage-clamp recordings in isolated neurons

Using the whole cell variant of the patch clamp technique, neurons

were voltage-clamped at 2 20 mV using a pipette solution con-

taining (in mm): 100 Trizma phosphate (dibasic), 28 Trizma base,

11 ethylene-glycol-bis-(aminoethylether)-N,N,N 0,N 0-tetraacetic acid,

2 MgCl2, 0.5 CaCl2, and 4 Mg21-ATP, 1 U/ul RNasin, pH 7.35.

Given the intracellular and extracellular chloride concentrations,

this provided a 50-mV driving force for chloride currents as

assessed by the Goldman±Hodgkin±Katz equation. All voltages

were corrected post hoc for a 4-mV junction potential. Recordings

were ampli®ed using an Axopatch 200 A ampli®er (Axon

Instruments, Foster City, CA, USA) and ®ltered at 5 kHz before

storage on a PCM device at 44 kHz (Neurodata Instruments, New

York, NY, USA). Electrode glass was autoclaved, all solutions

were prepared from nuclease-free chemicals using autoclaved

ultrapure water and all personnel wore gloves throughout all

experiments to minimize potential nuclease contamination. Record-

ing duration was limited to 10±15 min since this seemed to

facilitate success of subsequent RNA ampli®cation. All drugs were

applied using a 14 barrel `sewer pipe' perfusion system, with a

100±200 ms solution change time. GABA and zinc were obtained

from Sigma (St Louis, MO, USA), and zolpidem (ZOL) from RBI

(Natick, MA, USA). ZOL was dissolved as stock solution in

DMSO. DMSO at comparable concentrations to ®nal dilutions

(0.01%) had no effect on cell properties or GABA responses.

Current density was calculated on the basis of the maximal

response of a neuron to application of 1 mm GABA divided by the

membrane capacitance of the cell, which was read directly off the

capacitance compensation potentiometer on the patch ampli®er, as

previously detailed by Gibbs et al. (1997). Current density was

quanti®ed assuming a speci®c membrane capacitance of 1 mF/cm2

(Oh et al. 1995; Gibbs et al. 1997; Gentet et al. 2000). For

statistical analyses, signi®cance was tested using the Student's

unpaired t-test or the Mann±Whitney Rank Sum test for groups

with unequal variance. Curves were ®tted using the Marquardt±

Levenberg non-linear least-squares algorithm (Origin; Microcal

Software, Northampton, MA, USA).

MRNA measurement

Relative expression of GABAAR mRNAs within individual acutely

isolated DGCs were measured using the technique of single-cell

antisense RNA (aRNA) ampli®cation (VanGelder et al. 1990;

Eberwine et al. 1992) modi®ed as recently described in detail

(Brooks-Kayal et al. 1998a,b). Following patch-clamp recording,

neuronal contents were aspirated into the micropipette. Samples of

extracellular medium are also aspirated, and processed in parallel

with cellular aspirates, to assess for potential mRNA contamination

of medium from dying cells. The contents of each microelectrode

were expelled into a microcentrifuge tube, and ®rst-strand cDNA

Hippocampal GABAA receptor development 1267

q 2001 International Society for Neurochemistry, Journal of Neurochemistry, 77, 1266±1278

synthesis performed using 1 mm deoxynucleotide triphosphates

(dNTPs), 0.5 unit/mL avian myeloblastosis virus reverse transcrip-

tase (AMVRT, Seikagaku America, Ijamsville, MD, USA) and

2 ng/mL oligonucleotide-T7 primer (5 0-AAACGACGGCCAG

TGAATTGTAATACGACTCACTATAGGCGCT24-3 0) at 428C

for 60±90 min. Following phenol±chloroform extraction and

ethanol precipitation with 1 mg Escherichia coli tRNA as carrier,

double-stranded DNA was made by incubation with dNTPs

(1 mm), T4 DNA polymerase (1 U) and the Klenow fragment of

DNA Polymerase I (1 U) (148C for 14±18 h). The single-stranded

hairpin loop was removed with S1 nuclease (1 U), the ends of the

double-stranded template were blunted with T4 DNA polymerase

(0.5 U) and the Klenow fragment of DNA Polymerase I (0.5 U) at

378C for 2 h, then drop-dialyzed for 4 h against RNAse-free water

to remove unincorporated dNTPs. Twenty-®ve percent of the

cDNA recovered from the ®lter was used for synthesis of ampli®ed

aRNA in 40 mm Tris (pH 7.4), 10 mm NaCl, 10 mm MgCl2, 5 mm

dithiothreitol, with addition of 250 mm ATP, GTP, and UTP,

50 mm CTP, 15 pmol of [a-32P]CTP (3000 Ci/mmol, Amersham,

Arlington, IL, USA), 20 U of RNAasin, and 2000 units of T7 RNA

polymerase (Epicentre Technologies, Madison, WI, USA) at 378C

for 4 h. aRNA was then again synthesized into a single-stranded

cDNA template for a second round of ampli®cation. The ®nal

aRNA synthesis includes 25 pmol of [a-32P]CTP in an in vitro

transcription reaction with the same composition as the ®rst aRNA

ampli®cation reaction, except for 1 mm CTP.

Slot-blot preparation and expression pro®les

Fourteen GABAA receptor subunit cDNAs (a1±6, b1±3, g1±3, d, 1),

b-actin (internal reference), glial ®brillary acidic protein (GFAP,

control for glial contamination), neuro®lament-L (NF-L, marker for

neuronal phenotype) and pBluescript plasmid (background) cDNAs

were included on each slot blot. GABAA receptor cDNAs were

obtained from the late Dr Dolan Pritchett, except 1 cDNA which

was provided by Dr Ewen Kirkness. Identity of all GABAA

receptor subunit cDNAs were con®rmed by sequencing. All

GABAAR cDNAs include the full coding region except a2, a4,

g1 and d. a2 is a 100-bp fragment from the distal 3 0 end of the

coding region (bp 1206±1306). a4-, g1- and d-cDNAs are each

. 1 kb fragments including the distal 3 0-coding region (a4-bp

694±1725; g1-bp 445±1483; d -bp 524±1580). b-Actin cDNA is a

460-bp fragment (bp1236±1694). GFAP and NF-L clones were

provided by Drs James Eberwine and Virginia Lee, respectively, at

University of Pennsylvania. Each blot was prehybridized for 12 h

at 428C in 5 mL of prehybridization solution (50% formamide,

5 � saline sodium citrate solution (pH 7.0), 5 � Denhardt's

solution, 0.1% sodium dodecyl sulfate (SDS), 1 mm sodium

pyrophosphate and 100 mg/mL salmon sperm DNA), then hybrid-

ized with the radiolabeled aRNA probe from an individual cell for

48 h (428C). The blots were washed to a ®nal concentration of

0.2 � SSC at 428C for 30 min, then directly exposed for 2 h to a

Molecular Dynamics Phosphor-Image screen with a linear dynamic

range over ®ve orders of magnitude. All hybridization signals fell

well within this dynamic range.

Quantitation and statistical analysis

Intensity of the autoradiographic signal was measured by three-

dimensional laser scanning densitometry utilizing Image-Quant

software from Molecular Dynamics. For each blot, the relative

abundance of each subunit mRNA was calculated as the

hybridization signal for that subunit cDNA divided by the

hybridization signal for b-actin cDNA on the blot for that cell.

Presence of a subunit mRNA was de®ned as hybridization signal

above background by greater than or equal to 1% of the b-actin

cDNA signal on the blot. This value was selected because it

represents ^ 1 SD of the estimated variability in background noise

(based on differences in hybridization signal for bluescript plasmid

cDNA and GFAP cDNA). anova analysis was used for statistical

comparison of the mean relative expression for each subunit in each

of the three age groups (postnatal days 5±7, postnatal days 17±21

and adult), and for subunits which demonstrated a statistically

signi®cant difference between age groups on anova, post hoc

t-tests were performed between groups. To ascertain that changes in

relative expression of GABAAR subunits were not secondary only

to developmental changes in b-actin expression, relative abundance

of each subunit in each cell was also calculated as a fraction of

NF-L in that cell. All statistical comparisons were run using both

calculations of relative abundance (as a fraction of b-actin and as a

fraction of NF-L) and results were not different.

Western blotting

Dentate gyrus was rapidly microdissected from hippocampal slices

from three rats in each age-group and solubilized in 100 mL

2 � SDS, sonicated and boiled for 10 min. Protein concentration of

each sample was established using the Bradford kit from Bio-Rad

Laboratories (Hercules, CA, USA) and spectrophotometry.

Twenty-®ve micrograms of total protein was separated on a 7%

polyacrylamide gel, then transferred to nitrocellulose. The nitro-

cellulose was incubated overnight at 48C in rabbit anti-alpha 1

antibody (gift of Dr Ruth McKernan, Merck, Sharp & Dohme

Research Laboratories, Essex, UK) diluted 1 : 100 in 5% non-fat

dried milk. The blot was rinsed with PBS with Tween, then

incubated with anti-rabbit IgG conjugated to HRP (BioRad).

Following rinsing, the blot was incubated with enhanced chemi-

luminescent reagent (ECL; Amersham) then apposed to X-ray ®lm.

Single bands of the appropriate size (,50 kDa) were identi®ed and

quanti®ed using NIH Image software. Protein samples from all nine

animals were run on a single gel, and quanti®ed together. The

experiment was performed in duplicate, and the immunoreactivity

averaged for each sample. The mean immunoreactivity for the three

age groups were compared using an unpaired two-tailed t-test.

Timm's staining

At the appropriate age, under deep anesthesia, all rats were

perfused intracardially using a gravity feed system. The perfusion

procedure was similar to that described by Sloviter (Sloviter 1982)

and involved the following: (1) saline, 3 min; (2) 0.37% sul®de

solution, 2 min; (3) saline, 3 min; and (4) 4.0% paraformaldehyde-

15 min. Brains remained in situ overnight, then were stored in

®xative for at least 3 days prior to storage in a 30% sucrose solution

of 0.1 m phosphate buffer. Brains were stored for up to 8 days

following perfusion at which time they were cut into 40 mm

sections and mounted on gelatinized slides. Within 1 week of

sectioning, sections were stained with a modi®cation of the Timm's

procedure (for details see (Sloviter 1982) and counterstained with

cresyl violet. Intensity of Timm's staining was analyzed using

computer-assisted density measurements.

1268 A. R. Brooks-Kayal et al.


Density measurements

Three coronal sections per rat were examined. Sections chosen for

analysis were between 2.56 and 3.14 mm posterior to bregma

according to an adult stereotaxic atlas (Paxinos and Watson 1986).

Sections for postnatal 5±7- and postnatal 17±21-day-old rats were

matched to those analyzed in the adult. At 40 � magni®cation,

images were captured digitally on a computer using a Leica image

analysis system. Light intensity and ®lter settings were maintained

at a constant level for all specimens. Once an image was captured

to screen it was converted to a gray scale. For each section we

determined the density score for the alveus and the density score for

the hilus (at the very tip of the blade). The hilar density score was

divided by the background alveus score for each section. The three

normalized values were than averaged for each rat. The average of

four animals at each developmental age was than determined and

plotted.

Results

Increased total GABAAR mRNA expression correlates

with higher GABA ef®cacy in individual DGCs during


We combined the techniques of single-cell aRNA ampli®-

cation and whole-cell patch clamp recording to examine

subunit mRNA expression and GABAAR function in

individual dentate granule neurons acutely isolated from

rat pups in the ®rst and third postnatal weeks (Fig. 1) and

compared it to our previous ®ndings in adult rats (Brooks-

Kayal et al. 1998b). GABAAR-subunit mRNA expression

was examined in 22 dentate granule cells (DGCs) isolated

from postnatal day 5±7 pups (P5±7), 21 DGCs from

postnatal day 17±21 pups (P17±21) and 17 DGCs from

adult rats (from a minimum of six animals in each age

group). The success rate for aRNA ampli®cation was 92%

of cells isolated from postnatal 5±7 pups, 91% from

postnatal 17±21 pups and 77% from adults. Mean total

expression of GABAAR-subunit mRNAs (total hybridiz-

ation signal for all subunits relative to expression of b-actin

within each cell) was nearly two-fold lower in immature

DGCs compared with those isolated from adult animals

(Fig. 2a; anova, p , 0.0001). This increase in mean total

GABAAR-subunit mRNA expression was associated with a

greater than two-fold increase in mean GABA current

density (normalized to cell capacitance) during postnatal

development in a subset of the same neurons (n � 14 adult

cells and n � 18 cells each at postnatal 5±7 and postnatal

17±21; Figs 2b and c; anova, p , 0.001). This change in

GABA ef®cacy occurred in the absence of any signi®cant

alteration in GABA EC50 (Fig. 2d).

Increased relative expression of a1-mRNA correlates

with higher zolpidem sensitivity within individual DGCs

during postnatal development

In addition to the overall increase in GABAAR mRNA

expression, a signi®cant alteration in the relative expression

Fig. 1 Whole-cell patch clamp recordings coupled with aRNA

expression pro®les from single dentate granule neurons acutely iso-

lated from a postnatal day 5±7 (a) and day 17±21 (b) rat pup.

Upper panels: Responses to concentration-clamp application of

GABA (10 mM) and modulation of the 10 mM GABA response by

coapplied zolpidem (ZOL; 100 nM) and zinc (100 mM). Middle panels:

Slot-blot demonstrating hybridization intensities of GABAAR-subunit

mRNAs for the same cell for which physiology responses are

illustrated in upper panel. The radiolabeled ampli®ed aRNA probe

from each cell was hybridized against a slot-blot containing

GABAAR-subunit cDNAs: a1±6 (A1-A6), b1±3 (B1-B3), g1±3

(B4-B6), d and 1 (C1, C2), glial ®brillary acidic protein (C3), neuro-

®lament-L (C4), b-actin (C5), and pBluescript (C6). The value for

the slot containing pBluescript cDNA is considered background;

NF-L expression serves as a marker for neuronal phenotype; GFAP

expression acts as a control for glial contamination, and b-actin

expression acts as an internal reference value. Lower panels: Rela-

tive expression of each GABAAR subunit within this same cell calcu-

lated as hybridization signal for each subunit divided by the

hybridization signal for b-actin within the cell.



of individual subunit mRNAs occurred over the course

of postnatal development. Mean relative expression of

a1-mRNA in DGCs increased three-fold between postnatal

day 5±7 and adulthood (Figs 3a and b; anova, p , 0.001).

Mean relative expression of other a subunits also changed

signi®cantly during postnatal development. Mean relative

expression of both a3- and a4-mRNAs increased over two-

fold during DGC development (Figs 3a and b; anova,

p , 0.001), although neither was the predominant a subunit

at any age. Relative expression of a5-mRNA in DGCs

decreased 10-fold between postnatal 5±7 and adulthood

(Figs 3a and b; anova, p , 0.001). a2-Subunit mRNA was

moderately expressed in all ages, and did not change

signi®cantly over time.

To examine whether the increase in a1-mRNA expression

in DGCs was associated with altered levels of a1-subunit

protein, western blot analysis was performed on dentate

gyrus tissue (DG) microdissected from three rats from each

age group using a1-subunit speci®c antibodies (Fig. 3c).

Levels of a1 immunoreactivity in DG increased . 3.5-fold

between postnatal 5±7 and postnatal 17±21 and another

two-fold between postnatal 17±21 and adult (Fig. 3c; seven-

fold increase over the course of postnatal development,

anova, p , 0.0001). To explore how these changes in

Fig. 2 Total GABAA receptor-subunit mRNA expression and recep-

tor current density is lower in immature dentate granule neurons. (a)

Bar graph demonstrating mean (^ SE) total expression of GABAAR-

subunit mRNAs (total hybridization signal for all subunits relative to

expression of b-actin within each cell) at different developmental

ages. GABAAR-subunit mRNA expression was examined in 22 dentate

granule cells (DGCs) isolated from postnatal day 5±7 pups (P5±7), 21

DGCs from postnatal day 17±21 pups (P17±21) and 17 DGCs from

adult rats. Note the signi®cantly lower expression of GABAAR-mRNA

in immature (P5±7 and P17) compared with adult DGCs. All values

are mean ^SEM (**p , 0.01, t-test). (b) Responses to concentra-

tion-clamp application of increasing concentrations of GABA to

DGCs of different developmental ages. (c) Bar graph demonstrating

mean (^ SE) maximal current evoked by application of 1 mM

GABA (normalized to cell capacitance) in DGCs of different develop-

mental ages (n � 14 adult cells and n � 18 cells at younger

time points). Note that although there is some degree of variability

within cells of a given age, the average ef®cacy of GABA is signi®-

cantly higher in adult compared with immature DGCs. (**p , 0.01,

t-test). (d) Concentration-response plot comparing GABA-evoked

responses (normalized to maximal response) in dentate granule

neurons from the three different age groups. Note that although

adult DGCs had signi®cantly larger amplitude GABA-evoked

responses at a given GABA concentration relative to immature cells

[see (b) and (c) above] there was no difference in GABA potency.

Curves are generated from a best-®t sigmoidal dose response

curve, using the Marquardt±Levenberg non-linear least squares

algorithm (EC50 � 25.8 mM; Hill coef®cient 1.0).



a1-subunit mRNA and protein may relate to GABAAR

function within individual DGCs, augmentation of the

GABA response by the type-I benzodiazepine site modu-

lator zolpidem was examined in a subset of the ampli®ed

cells (n � 10 adult, n � 12 P17±21 and n � 15 P7±10).

Recombinant heterotrimeric GABAARs (ax,by,gz) contain-

ing an a1 subunit demonstrate increased augmentation by

zolpidem compared with GABAARs containing other a

subunits (Pritchett et al. 1989a; Pritchett and Seeburg 1990;

Puia et al. 1991). As might be predicted, based on the

increased relative expression of a1-mRNA in DGCs and a1

protein in DG seen during postnatal development, mean

augmentation of the GABA response by zolpidem increases

three-fold between postnatal 5±7 and adulthood (Figs 3d

and e; anova, p � 0.01).

Changes in a1- and g2-subunit mRNA expression

correlate with altered zinc sensitivity during DGC


Signi®cant alterations were also seen in relative expression

of g-subunit mRNAs within individual DGCs during

postnatal development. Relative expression of g2-mRNA

Fig. 3 Developmental alterations in GABAA receptor a-subunit

expression correlate with changes in sensitivity to zolpidem in

DGCs. Histograms demonstrating mean (^ SE) relative expression

of the different a-subunit mRNAs as a fraction of b-actin expression

in the same cells (a) and as a fraction of adult expression (b) in

DGCs isolated from rats of different developmental ages (n � 22

from postnatal 5±7 pups, 21 from postnatal 17±21 pups and 17

DGCs from adults). Note the signi®cantly lower relative expression

of a1- and a4-mRNA and higher relative expression of a5-mRNA in

immature compared with adult DGCs. a6-mRNA expression was not

above background at any age point (a), and is not included in

normalized histogram (b). (**p , 0.01, t-test). (c) Upper panel:

Representative western blot demonstrating a1-immunoreactivity in

homogenates from dentate gyrus microdissected from three rats at

each developmental age. Twenty-®ve micrograms of total protein

were run in each lane, and samples from all ages were reacted

together. Note the progressive increase in immunoreactivity present

in dentate gyrus between postnatal 5±7 pups (lanes 1±3), postnatal

17±21 pups (lanes 4±6), and adults (lanes 7±9). Lower panel: Bar

graph illustrating the mean a1-immunoreactivity (expressed as per-

cent of adult value) from the three animal studied at each age. All

values are mean ^SEM (**p , 0.01, t-test). Note the seven-fold

increase in mean a1-immunoreactivity between the ®rst postnatal

week and adulthood (ANOVA, p , 0.001). (d) Responses to

concentration-clamp application of GABA (10 mM) and modulation of

the 10 mM GABA response by coapplied zolpidem (ZOL; 100 nM) in

DGCs of different developmental ages. Note the greater augmenta-

tion of the GABA-response by zolpidem in the adult DGCs compared

with immature DGCs (percentage augmentation noted to right of

tracings for each age). Vertical calibration bar is 240, 200 and

220 pA for postnatal 5±7, postnatal 17±21 and adult recordings,

respectively. (e) Histogram illustrating the mean percentage aug-

mentation of the 10 mM GABA response by 100 nM zolpidem for den-

tate granule neurons from animals of different ages (n � 15 from

P5±7 pups, 12 from P17±21 pups and 10 from adults). Note that

the level of zolpidem augmentation was signi®cantly lower in imma-

ture dentate granule cells than in adult DGCs. All values are mean

^SEM (**p , 0.01, t-test).



increased two-fold between postnatal 17±21 and adulthood

(Fig. 4a; anova, p , 0.001), while relative expression of

g1-mRNA increased 2.5-fold between postnatal 5±7 and

adulthood (Fig. 4a; anova, p � 0.004). g3-mRNA was not

expressed at levels above background at any developmental

timepoint. Relative expression of d-subunit mRNA also

increased approximately two-fold over the course of post-

natal development (anova, p � 0.004). g1- and d-subunit

mRNAs appeared less abundant than g2-mRNA at every

age, however, comparisons of quantities of different

mRNAs must be done with caution because of potential

differences in rates of ampli®cation, GC content and

hybridization ef®ciencies of different aRNAs. 1-Subunit

mRNA did not change signi®cantly during postnatal

development. How might these changes in g-subunit

mRNA alter GABAAR function? Benzodiazepine sensitivity

in recombinant GABAARs requires the presence of a g

subunit (Pritchett et al. 1989b), and thus a developmental

increase in g1 and g2 expression may contribute to the

increased zolpidem sensitivity seen during postnatal DGC

development (Fig. 3d). In addition, the presence of a g

subunit in recombinant GABAARs markedly reduces zinc

sensitivity compared with receptors containing only a-and b

subunits (Draguhn et al. 1990; Smart et al. 1991; Whiting

et al. 1997). For recombinant GABAARs containing a g

subunit, zinc sensitivity is effected by the a-subtype, with

a1-containing receptors being less sensitive to zinc inhibi-

tion than those containing other a-subtypes (White and

Gurley 1995; Fisher and Macdonald 1998). In immature

DGCs, which express relatively lower levels of g1-, g2- and

a1-mRNAs (Figs 3a and 4a), we found that the maximal

inhibition of the GABA response by 100 mm zinc was more

than two-fold higher than in adult cells (Figs 4b and c;

anova p , 0.001).

The physiological consequences of higher GABAAR zinc

sensitivity during early postnatal development will depend

on the amount of zinc present in immature dentate gyrus. To

evaluate the amount of vesicular zinc present in DG during

postnatal development, Timm's staining was performed on

hippocampal slices from four rats in each developmental age

group. Postnatal day 5±7 pups demonstrated very low levels

of Timm's staining in DG, with a progressive increase seen

Fig. 4 Developmental alterations in GABAA

receptor g-subunit expression correlate with

changes in sensitivity to zinc inhibition in

DGCs. (a) Histogram demonstrating mean

(^ SE) relative expression of mRNAs

encoding the g, d, and 1 subunits in DGCs

isolated from rats of different developmental

ages (n � 22 from P5±7 pups, 21 from

postnatal 17±21 pups and 17 DGCs from

adults). Note the signi®cantly lower relative

expression of g1-, g2- and d-mRNA (com-

pared with expression of b-actin in the

same cells) in immature compared with

adult DGCs. (**p , 0.01, t-test). (b)

Responses to concentration-clamp appli-

cation of GABA (10 mM) and modulation of

the 10 mM GABA response by coapplied

zinc (100 mM) in DGCs of different develop-

mental ages. Note the greater inhibition of

the GABA-response by zinc in the immature

DGCs compared with adult DGCs (percen-

tage inhibition in parentheses). Vertical cali-

bration bar is 415, 430, and 150 pA for

postnatal 5±7, postnatal 17±21 and adult

recordings, respectively. (c) Concentration±

response plot comparing inhibition of 10 mM

GABA-responses by increasing concentra-

tions of zinc in dentate granule neurons

from the three different age groups. Note

the signi®cantly greater inhibition of the

GABA-response by 100 mM zinc in DGCs

from postnatal 5±7 (inverted triangles) and

postnatal 17±21 (®lled triangles) pups

compared with adult (®lled circles).



in later postnatal development (postnatal 17±21) and into

adulthood (Fig. 5). These ®ndings demonstrate a strong

inverse temporal correlation between developmental changes

in the zinc sensitivity of GABAARs on DGCs and the

amount of zinc present in dentate gyrus, and may explain, in

part, why the exquisite zinc sensitivity of GABAARs in early

development does not result in pathological hyperexcit-

ability as it may in adult animals with temporal lobe

epilepsy (Brooks-Kayal et al. 1998b).

Expression of b-subunit mRNAs in individual DGCs

during postnatal development

Mean relative expression of b1-mRNA increased more than

two-fold between postnatal 5±7 and adulthood (Fig. 6;

anova p � 0.004). Relative expression of the other b

subunits did not change signi®cantly over the developmental

time window we examined. Speci®c changes in GABAAR

pharmacology which might be associated with alterations in

Fig. 5 Developmental changes in vesicular zinc content in dentate

gyrus. Upper panels (a±c): Photomicrographs of the dentate gyrus

at three developmental stages: (a) adult rat, (b) postnatal 17±21,

and (c) postnatal 5±7. Note the relative lack of zinc staining in the

hilar region of the postnatal 5±7-day-old rat pup compared with that

in the postnatal 17±21-day-old and adult rat. Calibration bar equals

500 mm in each panel. Lower panel: Density measurements are indi-

cated in graph form and con®rm the pattern of zinc staining depicted

in (a±c). Intensity of Timm's staining was analyzed using computer-

assisted density measurements in three sections from each animal

as described in the methods. For each section, density score was

determined for the alveus (considered background) and for the hilus

(at the very tip of the blade). For each section, the hilar density

score was normalized by dividing it by the background alveus score,

and then the three normalized values were averaged for each rat.

The average of four animals in each developmental age group

was than determined and plotted as mean ^SEM (*p , 0.05,

**p , 0.01, t-test). Over the course of postnatal development there

is a greater than four-fold increase in hilar zinc density.

Fig. 6 Developmental changes in b-subunit expression. Histogram

demonstrating mean (^ SE) relative expression of the three different

b-subunit mRNAs in DGCs isolated from rats of different develop-

mental ages (n � 22 from postnatal 5±7 pups, 21 from postnatal

17±21 pups and 17 DGCs from adults). Note the signi®cantly lower

relative expression of b1-mRNA (compared with expression of

b-actin in the same cells) in immature compared with adult DGCs.

All values are mean ^SEM (**p , 0.01, t-test).



functional protein for these subunits were not examined as

part of this study, however, they may well contribute to

postnatal changes in miniature inhibitory postsynaptic

current (IPSC) kinetics (Hollrigel and Soltesz 1997) and

GABAAR loreclezole sensitivity (Kapur and Macdonald

1999) reported by others.

Discussion

In the current study, we demonstrate changes in the pattern

of GABAAR-subunit mRNA expression within individual

DGCs over the course of postnatal development which

correlate with alterations in several parameters of receptor

function including GABA current density, augmentation by

zolpidem and inhibition by zinc. Our ®ndings agree with

results from recombinant receptor studies in heterologous

expression systems and structure-function studies of native

GABAARs in adult neurons (Brooks-Kayal et al. 1998b,

1999) which suggest that subunit mRNA expression is a

critical determinant of functional protein levels. Recombi-

nant heterotrimeric GABAARs (ax,by,gz) containing an a1

subunit demonstrate increased augmentation by type-I

benzodiazepine site modulators such as zolpidem compared

with GABAARs containing other a subunits (Pritchett et al.

1989a). Zinc blockade is in¯uenced by a, g and d subunits.

Recombinant GABAARs consisting of only a- and b

subunits are potently blocked by zinc, whereas addition of

a g subunit reduces zinc sensitivity (Draguhn et al. 1990;

Smart et al. 1991). Replacement of a g subunit with a d

subunit confers increased zinc sensitivity (Saxena and

Macdonald 1994). For recombinant GABAARs containing

a g subunit, a1-containing receptors are less sensitive to

zinc inhibition than those containing other a-subtypes

(White and Gurley 1995; Fisher and Macdonald 1998). As

predicted by recombinant studies, we found that the signi-

®cantly lower relative expression of a1- and g2-mRNA in

immature compared with adult DGCs was accompanied by

two-fold higher sensitivity to zinc inhibition (Fig. 4) and

. three-fold lower sensitivity to augmentation by zolpidem

(Fig. 3). Interestingly, not all changes in subunit mRNA

expression correlate in an expected way with the alterations

in pharmacology. We found a signi®cant increase in

expression of both a4- and d-mRNA in DGCs during

postnatal development (Figs 3a and 4a), which might be

predicted to result in decreased zolpidem augmentation and

increased blockade by zinc in adult neurons, opposite to

what is seen. Our previous studies of native GABAAR

structure-function relationships in DGCs, however, suggest

that the ratio of expression of subunit subtypes to one

another may be a more accurate predictor of receptor

function than absolute expression of a single subtype

(Brooks-Kayal et al. 1998a, 1999). In the current study,

increases in a4- and d-mRNA occur simultaneously with

equal or greater relative increases in the expression of the

more abundant a1- and g2-mRNAs and decreases in a5

expression, all of which will modulate zolpidem sensitivity.

Thus, it again appears that a full understanding of structure±

function relationships in native GABAARs requires exami-

nation of the relative abundance of all the different

GABAAR-subunit subtypes within individual neurons. The

functional importance of developmental changes in a4- and

d-mRNA expression may be better demonstrated by the

progressive postnatal decline in sensitivity of DGC

GABAARs to the neurosteroid tetrahydroxycorticosterone

recently reported by Cooper and Colleagues (Cooper et al.

1999; but see Mihalek et al. 1999).

Previous studies utilizing in situ hybridization have

demonstrated regional developmental changes in

GABAAR-subunit mRNA expression in dentate gyrus

(Laurie et al. 1992; Poulter et al. 1992). These studies,

however, did not address the issue of whether changes in

multiple different subunit mRNAs occurred within indivi-

dual neurons, or whether the changes were occurring in

subpopulations of cells each expressing different receptor

subtypes. In the current study, we demonstrate that multiple

receptor subunit mRNAs (10 or more) are expressed

simultaneously within individual DGCs, and that the relative

expression of many of these subunit mRNAs changes within

individual DGCs as they mature. Expression of multiple

GABAAR-subunit mRNAs in individual developing neurons

had previously been seen in hippocampal neurons maturing

in culture (Brooks-Kayal et al. 1998a). In that study,

however, the question of how changes in GABAAR-subunit

mRNA levels correlate with levels of subunit protein and

receptor function were not examined. In the present study,

we ®nd developmental changes in GABAAR-subunit mRNA

in DGCs are associated with increases in a1-subunit protein,

maximal GABA-evoked currents, and augmentation of

GABA-currents by zolpidem, as well as with decreases in

zinc sensitivity during postnatal development. Most of these

®ndings are in general agreement with work by others.

Fritschy et al. (1994) demonstrated a progressive increase in

a1-subunit immunoreactivity in dentate gyrus during the

®rst few postnatal weeks in rat. Hollrigel and Soltesz (1997)

and Kapur and Macdonald (1999) have also seen decreased

maximal GABA-evoked currents, decreased augmentation

by zolpidem and increased zinc sensitivity in immature

DGCs during early postnatal development. Postnatal

developmental changes in IPSC kinetics (Draguhn and

Heinemann 1996; Hollrigel and Soltesz 1997) and modula-

tion of GABA-responses by loreclezole and furosemide

(Kapur and Macdonald 1999) have also been reported.

These parameters were not speci®cally examined in the

current study, however, it is worth noting that some of these

pharmacological features do not correlate in an obvious

fashion with the changes in subunit mRNA expression we

currently demonstrate. For example, Kapur and Macdonald

(1999) found a progressive increase in the percentage of



DGCs sensitive to loreclezole and decrease in sensitivity to

furosemide during postnatal development, which predicts a

decrease in b1- and a4-subunit expression based on

recombinant receptor studies. In the current study, however,

we demonstrate a signi®cant increase in relative expression

of both b1- and a4-subunit mRNAs in DGCs during

development. We believe such discrepancies again empha-

size that studies of recombinant receptors composed of

single-subunit subtypes (ax,by,gz) may not adequately

model all features of native GABAARs in neurons where

multiple subtypes are expressed simultaneously.

One of the most striking differences in GABAAR

pharmacology between immature and adult DGCs is the

difference in sensitivity to zinc inhibition. What might be

the purpose for the increased zinc sensitivity of GABAARs

in immature DGCs? Zinc appears essential for normal CNS

development and may play a critical role in modulating

neurogenesis (Buell et al. 1977) and neurotransmission (Xie

and Smart 1991; Xie et al. 1994) during early postnatal

development. Postnatal zinc de®ciency may result in

impaired hippocampal cellular proliferation (Buell et al.

1977) and enzymatic activity (Dreosti et al. 1981). This

study and others demonstrate that vesicular zinc con-

centrations in dentate gyrus are low early in postnatal

development and increase dramatically between the end of

the ®rst postnatal week and adulthood in rat (Fig. 5;

Crawford and Connor 1972; Zimmer and Haug 1978; Wolf

et al. 1984; Sawashita et al. 1997; Penkowa et al. 1999).

GABAAR activity also changes dramatically during early

postnatal development, when its actions change from

excitatory to inhibitory (Ben-Ari et al. 1989, 1994; LoTurco

et al. 1995). The decreasing zinc sensitivity of GABAARs as

DGCs mature may be related both to the increasing zinc

availability, as well as the changing role of zinc and

GABAAR activity over the course of postnatal development.

The presence of low quantities of vesicular zinc in dentate

gyrus during early postnatal development may also explain,

in part, why the exquisite zinc sensitivity of GABAARs on

immature DGCs does not typically result in pathological

hyperexcitability as it may in adult animals with temporal

lobe epilepsy (Brooks-Kayal et al. 1998b). The decreased

GABAAR density and increased sensitivity to zinc inhibition

in DGCs early in postnatal development may, however,

contribute to the increased susceptibility to induced seizures

seen in both immature animals and young children. Further,

as the antiepileptic drugs most commonly used in young

infants, benzodiazepines and barbiturates, both act at

GABAARs, the current ®ndings have signi®cant implica-

tions for the treatment of seizures in our youngest patients.

The pattern of GABAAR-subunit expression and pharma-

cology we demonstrate in immature DGCs is in many ways

reminiscent of that seen in DGCs from adult animals with

temporal lobe epilepsy (Brooks-Kayal et al. 1998b). Like

DGCs from immature rats, DGCs from epileptic adult rats

demonstrate decreased relative expression of a1- and

b1-mRNAs, decreased zolpidem augmentation, and

increased inhibition by zinc compared with neurons from

control adult rats. DGCs from epileptic animals, however,

also demonstrate signi®cantly increased relative expression

of a4- and d-mRNAs, while immature neurons have lower

relative expression of these subunits compared with adult

cells. Thus, although some features of GABAAR expression

and pharmacology suggest dysmaturity, epileptogenesis

appears to involve more than simple developmental

regression on a cellular level.

The molecular and cellular events which mediate

developmental changes in GABAAR-subunit expression

are not fully understood. Several studies have demonstrated

a temporal correlation between changes in subunit composi-

tion during development and synaptogenesis (Meinecke and

Rakic 1990; Zheng et al. 1993). Dentate granule cells

undergo the processes of neurogenesis, migration and

synaptogenesis postnatally, beginning at birth and continu-

ing until adulthood (Altman and Das 1965, 1966; Gould and

Cameron 1996). This delayed and prolonged period of

synaptogenesis correlates with the relatively delayed

GABAAR development in DGCs compared with other

hippocampal cell types. Embryonic day 17 hippocampal

neurons in culture (which are devoid of granule cells)

demonstrate a mature GABAAR-subunit expression pattern

by day 21 in vitro (equivalent of approximately P17)

(Brooks-Kayal et al. 1998a). By contrast, GABAAR expres-

sion in DGCs still appears quite immature at P17±21. These

®ndings provide further evidence suggesting a possible link

between synaptogenesis and GABAAR-subunit maturation.

In conclusion, in the current study we demonstrate

signi®cant changes in the pattern of GABAAR-subunit

mRNA expression within individual DGCs over the course

of postnatal development, and ®nd that these changes

correlate with both regional changes in subunit protein level

and with alterations in GABAAR function in these same

cells. These developmental changes in GABAAR structure

and function have critical implications for our understanding

of inhibitory neurotransmitter function in early postnatal

development, developmental changes in seizure suscep-

tibility, and therapy of young patients with drugs which act

at GABAARs such as benzodiazepines and phenobarbital.

Acknowledgements

The authors thank Dr M. B. Robinson for his critical review of

the manuscript. Statistical assistance and DNA sequencing

supported by the Mental Retardation Developmental Dis-

abilities Research Center at CHOP (HD26979). This work

was supported by grants to DAC from the National Institutes of

Health (NS32403 and NS38572), and grants to ABK from

the National Institutes of Health (NS01936 and NS38595),

Epilepsy Foundation and Child Neurology Society.



References

Altman J. and Das G. D. (1965) Autoradiographic and histological

evidence of postnatal hippocampal neurogenesis in rats. J. Comp.

Neurol. 124, 319±335.

Altman J. and Das G. D. (1966) Autoradiographic and histological

evidence of postnatal neurogenesis. I. A longitudinal investigation

of the kinetics, migration and transformation of cells incorporating

tritiated thymidine in neonate rats, with special reference to

postnatal neurogenesis in some brain regions. J. Comp Neurol.

126, 337±390.

Barbin G., Pollard H., Gairsa J. and Ben-Ari Y. (1993) Involvement of

GABAA receptor in the outgrowth of cultured hippocampal

neurons. Neurosci Lett 152, 150±154.

Barnard E., Skolnick P., Olsen R., Mohler H., Sieghart W., Biggio G.,

Braestrup G., Bateson A. and Langer S. (1998) International

Union of Pharmacology. XV. Subtypes of g-aminobutyric acidA

receptors: classi®cation on the basis of subunit structure and

receptor function. Pharmacol. Rev. 50, 291±313.

Behar T. N., Li Y. X., Tran H. T., Ma W., Dunlap V., Scott C. and

Barker J. L. (1996) GABA stimulates chemotaxis and chemo-

kinesis of embryonic cortical neurons via calcium-dependent

mechanisms. J. Neurosci 16, 1808±1818.

Ben-Ari Y., Cherubini E., Corradetti R. and Gaiarsa J. (1989) Giant

synaptic potentials in immature rat CA3 hippocampal neurons.

J. Physiol. 416, 303±325.

Ben-Ari Y., Tseeb V., Raggozzino D., Khazipov R. and Gaiarsa J.

(1994) Gamma-aminobutyric acid (GABA): a fast excitatory

transmitter which may regulate the development of hippocampal

neurons in early postnatal life. Prog. Brain Res. 102, 261±273.

vonBlankenfeld G., Ymer S., Pritchett D., Sontheimer H., Ewert M.,

Seeburgh P. H. and Kettenman H. (1990) Differential benzo-

diazepine pharmacology of mammalian recombinant GABAA

receptors. Neurosci. Lett. 115, 269±273.

Bonnert T., McKernan R., Farrar S., LeBourdelles B., Heavens R.,

Smith D., Hewson L., Rigby M., Sirinathsinghji D., Brown N.,

Wafford K. and Whiting P. (1999) Theta, a novel g-aminobutyric

acid type A receptor subunit. Proc. Natl Acad. Sci. USA 96,

9891±9896.

Bovolin P., Santi M., Memorandum M., Costa E. and Grayson D.

(1992) Distinct developmental patterns of expression of rat a1,

a5, g2S and g2L g-aminobutyric acid type A receptor subunit

mRNAs in vivo and in vitro. J. Neurochem. 59, 62±72.

Brooks-Kayal A. and Pritchett D. (1993) Developmental changes in

human GABAA receptor subunit composition. Ann. Neurol. 34,

687±693.

Brooks-Kayal A., Jin H., Price M. and Dichter M. (1998a) Develop-

mental expression of GABAA receptor subunit mRNAs in Indi-

vidual hippocampal neurons in vitro and in vivo. J. Neurochem.

70, 1017±1028.

Brooks-Kayal A., Shumate M., Jin H., Rikhter T. and Coulter D.

(1998b) Selective changes in single cell GABAA receptor subunit

expression and function in temporal lobe epilepsy. Nat. Med. 4,

1166±1172.

Brooks-Kayal A. R., Shumate M. D., Jin H., Lin D. D., Rikhter T. Y.,

Holloway K. L. and Coulter D. A. (1999) Human neuronal

g-aminobutyric acidA receptors. Coordinated subunit mRNA

expression and functional correlates in individual dentate granule

cells. J. Neurosci. 19, 8312±8318.

Buell S., Fosmire G., Ollerich D. and Sandstead H. (1977) Effects of

postnatal zinc de®ciency on cerebellar and hippocampal develop-

ment in the rat. Exp. Neurol. 55, 199±210.

Bureau M. and Olsen R. (1990) Multiple distinct subunits of the

g-aminobutyric acid-A receptor protein show different ligand-

binding af®nities. Mol. Pharmacol. 37, 497±502.

Bureau M. and Olsen R. (1993) GABAA receptor subtypes. ligand

binding heterogeneity demonstrated by photoaf®nity labeling and

autoradiography. J. Neurochem. 61, 1497±1491.

Caillard O., McLean H. A., Ben-Ari Y. and Gaiarsa J. L. (1998)

Ontogenesis of presynaptic GABAB receptor mediated inhibition

in the CA3 region of the rat hippocampus. J. Neurophysiol. 79,

1341±1348.

Cohen A. S., Lin D. D. and Coulter D. A. (in press) Developmental

alterations in inhibitory synaptic function in CA1 neurons.

J. Neurophysiol. 84, 2465±2476.

Cooper E., Johnston G. and Edwards F. (1999) Effects of a naturally

occurring neurosteroid on GABAA IPSCs during development in

rat hippocampal or cerebellar slices. J. Physiol. 521, 437±449.

Crawford I. and Connor J. (1972) Zinc in maturing rat brain.

Hippocampal concentration and localization. J. Neurochem. 19,

1451±1458.

Davies P. A., Hanna M. C., Hales T. G. and Kirkness E. F. (1997) A

Novel class of GABA-A receptor subunit confers insensitivity to

anaesthetic agents. Nature 385, 820±823.

Donnelly J. and MacDonald R. (1996) Loreclezole enhances apparent

desensitization of recombinant GABAA receptor currents. Neuro-

pharmacology 35, 1233±1241.

Draguhn A. and Heinemann U. (1996) Different mechanisms regulate

IPSC kinetics in early postnatal and juvenile hippocampal granule

cells. J. Neurophysiol. 76, 3983±3993.

Draguhn A., Verdorn T., Ewert M., Seeburg P. and Sakmann B. (1990)

Functional and molecular distinction between recombinant

GABAA receptor subtypes by zinc. Neuron 5, 781±788.

Dreosti I., Manuel S., Buckley R., Fraser F. and Record I. (1981) The

effect of late prenatal and/or early postnatal zinc de®ciency on the

development and some biochemical aspects of the cerebellum and

hippocampus in rats. Life Sci. 28, 2133±2141.

Dupuy S. T. and Houser C. R. (1996) Prominent expression of two

forms of glutamate decarboxylase in the embryonic and early

postnatal rat hippocampal formation. J. Neurosci 16, 6919±6932.

Eberwine J., Yeh H., Miyashiro K., Cao Y., Nair S., Finnel R., Zettel M.

and Coleman P. (1992) Analysis of gene expression in single live

neurons. Proc. Natl Acad. Sci. USA 89, 3010±3014.

Fisher J. and Macdonald R. (1998) The role of an a subtype M2±M3

His in regulating inhibition of GABAA receptor current by zinc

and other divalent cations. J. Neurosci 18, 2944±2953.

Fritschy J.-M., Paysan J., Enna A. and Mohler H. (1994) Switch in the

expresson of rat GABAA-receptor subtypes during postnatal

development. An immunohistochemical study. J. Neurosci. 14,

5302±5324.

Fritschy J.-M., Meskenaite V., Weinmann O., Honer M., Benke D. and

Mohler H. (1999) GABAB-receptor splice variants GB1a and

GB1b in rat brain. developmental regulation, cellular distribution

and extrasynaptic localization. Eur. J. Neurosci 11, 761±768.

Gambarana C., Beattie C., Rodriguez Z. and Siegel R. (1991) Region-

speci®c expression of messenger RNAs encoding GABAA

receptor subunits in the developing rat brain. Neuroscience 45,

423±432.

Gentet L. J., Stuart G. J. and Clements J. D. (2000) Direct measurement

of speci®c membrane capacitance in neurons. Biophys. J. 79,

314±320.

Gibbs J. W., Berkow G. and Coulter D. A. (1996) GABAA receptor

function in developing rat thalamic reticular neurons. Whole-cell

recordings of GABA-mediated currents and modulation by

benzodiazepines. J. Neurophysiol. 76, 2568±2579.

Gibbs J., Shumate M. and Coulter D. (1997) Differential epilepsy-

associated alterations in postsynaptic GABAA receptor function

in dentate granule and CA1 neurons. J. Neurophysiol. 77,

1924±1938.



Gould E. and Cameron H. (1996) Regulation of neuronal birth,

migration and death in the rat dentate gyrus. Dev. Neurosci. 18,

22±35.

Hollrigel G. S. and Soltesz I. (1997) Slow kinetics of miniature IPSCs

during early postnatal development in granule cells of the dentate

gyrus. J. Neurosci. 17, 5119±5128.

Kapur J. and Macdonald R. L. (1999) Postnatal development of

hippocampal dentate granule cell g-aminobutyric acidA receptor

pharmacological properties. Mol. Pharmacol. 55, 444±452.

Laurie D., Wisden W. and Seeburg P. (1992) The distribution of

thirteen GABAA receptor subunit mRNAs in the rat brain. III.

Embryonic and postnatal development. J. Neurosci. 12, 4151±4172.

Liu J., Morrow A. L., Devaud L., Grayson D. R. and Lauder J. M.

(1997) GABAA receptors mediate trophic effects of GABA on

embryonic brainstem monoamine neurons in vitro. J. Neurosci.

17, 2420±2428.

LoTurco J. J., Owens D. F., Heath M. J., Davis M. B. and Kriegstein

A. R. (1995) GABA and glutamate depolarize cortical progenitor

cells and inhibit DNA synthesis. Neuron 15, 1287±1298.

Luddens H. and Wisden W. (1991) Function and pharmacology of

multiple GABAA receptor subunits. Trends Pharmacol. Sci. 12,

49±51.

McDonald B., Amato A., Connolly C., Benke D., Moss S. and Smart T.

(1998) Adjacent phosphorylation sites on GABAA receptor beta

subunits determine regulation by cAMP dependent protein kinase.

Nat. Neurosci. 1, 23±28.

MacDonald R. and Olsen R. (1994) GABAA receptor channels. Annu.

Rev. Neurosci. 17, 569±602.

Mathews G. C., Bolos-Sy A. M., Holland K. D., Isenberg K. E., Covey

D. F., Ferrendelli J. A. and Rothman S. M. (1994) Developmental

alteration in GABAA receptor structure and physiological proper-

ties in cultured cerebellar granule neurons. Neuron 13, 149±158.

Meinecke D. and Rakic P. (1990) Developmental expression of GABA

and the subunits of the GABAA receptor complex in an inhibitory

synaptic circuit in the rat cerebellum. Dev. Brain Res. 55, 73±86.

Mihalek R. M., Banerjee P. K., Korpi E. R., Quinlan J. J., Firestone

L. L., Mi Z.-P., Lagenaur C., Tretter V., Sieghart W.,

Anagnostaras S. G., Sage J. R., Fanselow M. S., Guidotti A.,

Spigelman I., Li Z., DeLorey T. M., Olsen R. W. and Homanics

G. E. (1999) Attenuated sensitivity to neuroactive steroids in

g-aminobutyrate type A receptor delta subunit knockout mice.

Proc. Natl Acad. Sci. USA 96, 12905±12910.

Oh K., Lee C., Gibbs J. and Coulter D. (1995) Postnatal development of

GABAA receptor function in somatosensory thalamus and cortex.

whole-cell voltage-clamp recordings in acutely isolated rat

neurons. J. Neurosci 15, 1341±1351.

Owens D., Boyce L., Davis M. and Kriegstein A. (1996) Excitatory

GABA responses in embryonic and neonatal cortical slices

demonstrated by gramicidin perforated-patch recordings and

calcium imaging. J. Neurosci. 16, 6414±6423.

Paxinos G. and Watson C. (1986) The Rat Brain in Stereotaxic

Coordinates. Academic Press, Sydney.

Penkowa M., Nielson H., Hidalgo J., Bernth N. and Moos T. (1999)

Distribution of metallothionein I 1 II and vesicular zinc in the

developing central nervous system. Correlative study in the rat.

J. Comp. Neurol. 412, 303±318.

Poulter M. O., Barker J. L., O'Carroll A.-M., Lolait S. J. and Mahan

L. C. (1992) Differential and transient expression of GABAA

receptor a-subunit mRNAs in the developing rat CNS. J. Neurosci.

12, 2888±2900.

Pritchett D. B. and Seeburg P. H. (1990) g-Aminobutyric acidA receptor

a5 subunit creates novel type II benzodiazepine receptor

pharmacology. J. Neurochem. 54, 1802±1804.

Pritchett D., Luddens H. and Seeburg P. (1989a) Type I and type II

GABAA-benzodiazepine receptor produced in transfected cells.

Science 245, 1389±1392.

Pritchett D., Sontheimer H., Shivers B., Ymer S., Kellenmann H.,

Scho®eld P. and Seeburg P. (1989b) Importance of a novel

GABAA receptor subunit for benzodiazepine pharmacology.

Nature 338, 582±585.

Puia G., Vicini S., Seeburg P. H. and Costa E. (1991) In¯uence of

recombinant g-aminobutyric acidA receptor subunit compositions

on the action of allosteric modulators of g-aminobutyric acid-

gated Cl- currents. Mol. Pharmacol. 39, 691±696.

Rivera C., Voipio J., Payne J., Ruusuvuori E., Lahtinen H., Lamsa K.,

Pirvola U., Saarma M. and Kaila K. (1999) The K1/Cl2

co-transporter KCC2 renders GABA hyperpolarizing during

neuronal maturation. Nature 397, 251±255.

Rovira C. and Ben-Ari Y. (1991) Benzodiazepines do not potentiate

GABA responses in neonatal hippocampal neurons. Neurosci.

Lett. 130, 157±161.

Rovira C. and Ben-Ari Y. (1993) Developmental study of benzo-

diazepine effects on monosynaptic GABAA-mediated IPSPs of rat

hippocampal neurons. Neurophysiology 70, 1076±1085.

Sawashita J., Takeda A. and Okada S. (1997) Change of zinc

distribution in rat brain with increasing age. Dev. Brain Res.

102, 295±298.

Saxena N. and Macdonald R. (1994) Assembly of GABA receptor

subunits. role of the delta subunit. J. Neurosci. 14, 7077±7086.

Sigel E., Baur R., Trube G., Mohler H. and Malherbe P. (1990) The

effect of subunit composition of rat brain GABAA receptors on

channel function. Neuron 5, 703±711.

Sloviter R. (1982) A. simpli®ed Timm stain procedure compatible with

formaldehyde ®xation and routine paraf®n embedding of rat brain.

Brain Res. Bull. 8, 771±774.

Smart T., Moss S., Xie X. and Huganir R. (1991) GABAA receptors are

differentially sensitive to zinc. dependence on subunit composi-

tion. Br. J. Pharmacol. 103, 1837±1839.

Turgeon S. M. and Albin R. L. (1994) Postnatal ontogeny of GABAB

binding in rat brain. Neuroscience 62, 601±613.

VanGelder R., vonZastrow M., Yool A., Dement W., Barchas J. and

Eberwine J. (1990) Ampli®ed RNA. synthesized from limited

quantities of heterogeneous cDNA. Proc. Natl Acad. Sci. USA 87,

1663±1667.

Verdoorn T., Draguhn A., Ymer S., Seeburg P. H. and Sakmann B.

(1990) Functional properties of recombinant rat GABAA receptors

depend upon subunit composition. Neuron 4, 919±928.

Vicini S. (1991) Pharmacologic signi®cance of the structural hetero-

geneity of the GABAA receptor-chloride ion channel complex.

Neuropsychopharmacology 4, 9±15.

White G. and Gurley D. (1995) a subunits in¯uence zinc block of g2

containing GABAA receptor currents. Neuroreport 6, 461±464.

Whiting P., McAllister G., Vassilatis D., Bonnert T. P., Heavens R. P.,

Smith D. W., Hewson L., O'Donnell R., Rigby M. R.,

Sirinathsinghji D. J., Marshall G., Thompson S. A., Wafford K.

A. and Vasilatis D. (1997) Neuronally restricted RNA splicing

regulates the expression on a novel GABA receptor subunit

conferring atypical functional properties. J. Neurosci. 17, 5027±

5037.

Wolf G., Schutte M. and Romhild W. (1984) Uptake and subcellular

distribution of 65zinc in brain structures during the postnatal

development of the rat. Neurosci Lett 51, 277±280.

Xie X. and Smart T. (1991) A physiological role for endogenous zinc

in rat hippocampal synaptic neurotransmission. Nature 349,

521±524.

Xie X., Hider R. and Smart T. (1994) Modulation of GABA-mediated

synaptic transmission by endogenous zinc in the immature

hippocampus in vitro. J. Physiol. 478, 75±86.



Zhang H.-H., Sato M. and Tohyama M. (1991) Different postnatal

development pro®les of neurons containing distinct GABAA

receptor b subunit mRNAs (b1, b2, and b3) in the rat forebrain.

J. Comp. Neurol. 308, 586±613.

Zhang L., Spigelman I. and Carlen P. (1991) Development of GABA-

mediated, chloride-dependent inhibition in CA1 pyramidal

neurons of immature rat hippocampal slices. J. Physiol. 444,

25±49.

Zheng T., Santi M., Bovolin P., Marlier L. and Grayson D. (1993)

Developmental expression of the a6 GABAA receptor subunit

mRNA occurs only after cerebellar granule cell migration. Dev.

Brain Res. 75, 91±103.

Zimmer J. and Haug F. (1978) Laminar differentiation of the

hippocampus, fascia dentata and subiculum in developing rats,

observed with the Timm sulphide silver method. J. Comp. Neurol.

179, 581±618.



γ-aminobutyric acida receptor subunit expression predicts functional changes in hippocampal dentate...

Documents