GENERATION OF DISEASE RESISTANCE IN TOMATO USING ARABIDOPSIS ELONGATOR GENES AND THEIR TOMATO ORTHOLOGS

By

JULIANA A. PEREIRA

A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT

OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA

2017

© 2017 Juliana A. Pereira

To my lovely family

4

ACKNOWLEDGMENTS

I would like to thank my advisors, Drs. Jeff Jones and Zhonglin Mou, for the

guidance, the friendship and supportiveness in research and in life. It is extraordinary to

work with two wonderful professors whom made the learning process such a pleasant

experience. I also would like to give a big thanks to Gerald V. Minsavage, who has the

best sense of humor someone could have and the best intentions to help at any

circumstances. I would like to show appreciation to Dr. Bob Stall, who shared his

expertise with me. I would like to extend my appreciation to my committee members Dr.

Jeff Rollins, Dr. Wen-Yuan Song and Dr. Samuel Hutton, for the support and valid

suggestions. I also would like to thank Lauretta Rahmes, Jessica Ulloa, Dr. Rosemary

Loria and all the department staff for such great support. My deepest appreciation goes

to my family and aggregate members, whom even being far away, always made their

way to be present and show their support, mainly my dad that was a very enthusiastic

person and always motivated me to keep studying. I would like to thank my husband

Kevin Martin for his support, help, patience, love and for making this place my home. I

thank Mayara Murata and Stephanie Suarez for their friendship for life that started

during my Ph.D. I would like to show my appreciation to Adriana, Paola, Patricia,

Christina, Renato, Christiano, Ismi, Raquel, Nicholas, Michelle, Leandro and Rodrigo for

being awesome friends. I am also thankful for being able to work with such great lab

members at the Jones lab and the Mou lab. I am grateful to Dr. Neha Potnis, Dr.

Deepak Shantaraj, Eric A. Newberry, Mohamed Ebrahim, Mustafa Jibrin, Amanda

Strayer-Scherer, Ying-Yu, Sanju Kunwar, Xudong Zhang, Dr. Chenggang Wang and Dr.

Mingqi Zhou for the support. Special thanks to Dr. Timilsina and Serhat Kara for the

good laughs and inspiring life lessons, Dr. Julliany Golinha for the great support and

5

friendship, and Mathew Dommel for sharing the love for food. Finally, I would like to

thank the Brazilian National Counsel of Technological and Scientific Development

(CNPq) for the doctoral fellowship.

6

TABLE OF CONTENTS

page

ACKNOWLEDGMENTS .................................................................................................. 4

LIST OF TABLES ............................................................................................................ 8

LIST OF FIGURES .......................................................................................................... 9

ABSTRACT ................................................................................................................... 11

CHAPTER

1 LITERATURE REVIEW .......................................................................................... 13

Bacterial Leaf Spot of Tomatoes and Peppers ....................................................... 15 Tomato Bacterial Speck .......................................................................................... 16

Target Spot of Tomato ............................................................................................ 18 Plant Defense ......................................................................................................... 19 The Pyridine Nucleotides ........................................................................................ 22

The Arabidopsis Elongator Complex ...................................................................... 23 Genetically Engineered Crops ................................................................................ 28

Summary ................................................................................................................ 31

2 CHARACTERIZATION OF TOMATO ORTHOLOGS OF ARABIDOPSIS DEFENSE REGULATOR GENES .......................................................................... 32

Introduction ............................................................................................................. 32 Material and Methods ............................................................................................. 34

Cloning of the Tomato ELP3 and ELP4 Orthologs ........................................... 34 Transformation of the Arabidopsis elp3 and elp4 Mutants................................ 34

Selection of Single Insertion and Homozygous Lines ....................................... 35 Pathogen Infection and Bacterial Population Assay ......................................... 36 Statistical Analysis ............................................................................................ 36

Results .................................................................................................................... 36 Nucleotide and Amino Acid Sequence Alignments ........................................... 36 Arabidopsis elp3 and elp4 Mutant Complementation ....................................... 36 Disease Susceptibility Complementation ......................................................... 37

Discussion .............................................................................................................. 38

3 GENERATION OF DISEASE RESISTANCE IN TOMATO USING ARABIDOPSIS DEFENSE REGULATOR GENES ................................................. 47

Introduction ............................................................................................................. 47 Materials and Methods............................................................................................ 49

T-DNA Vector Construction and Plant Transformation ..................................... 49

7

Identification and Molecular Characterization of Single T-DNA Insertion Homozygous Lines ........................................................................................ 50

Disease Resistance Screens of the Transgenic Lines ..................................... 50

Bacterial Population Dynamics ......................................................................... 52 Stomatal Conductance Measurements ............................................................ 53 Transgene and PR Gene Expression ............................................................... 53 Statistical Analysis ............................................................................................ 54

Results .................................................................................................................... 54

Molecular and Morphological Characterization of the Transgenic Lines .......... 54 Disease Resistance Screens of the Transgenic Lines ..................................... 55 Stomata Conductance ...................................................................................... 57 Transgene and PR Gene Expression ............................................................... 58

Discussion .............................................................................................................. 59

4 GENERATION OF TRANSGENIC TOMATO PLANTS WITH THE TOMATO ORTHOLOGS OF THE ARABIDOPSIS ELONGATOR GENES ............................. 75

Introduction ............................................................................................................. 75

Material and Methods ............................................................................................. 76 Binary Vector Construction and Plant Transformation ...................................... 76 Disease Resistance Test .................................................................................. 77

Bacterial Population Dynamics ......................................................................... 77 Results .................................................................................................................... 78

Molecular and Morphological Characterization of the Transgenic Lines .......... 78 Disease Reaction Based on Disease Severity and Population Dynamics

Following Inoculation with P. syringae pv. tomato ......................................... 79

Discussion .............................................................................................................. 79

5 SUMMARY AND CONCLUSION ............................................................................ 86

LIST OF REFERENCES ............................................................................................... 88

BIOGRAPHICAL SKETCH ............................................................................................ 98

8

LIST OF TABLES

Table page 2-1 Primers used in chapter 2 ................................................................................... 46

3-1 Primers used in chapter 3 ................................................................................... 74

4-1 Primers used in chapter 4 ................................................................................... 85

9

LIST OF FIGURES

Figure page 1-1 The Arabidopsis elp3 mutant morphology and bacterial growth in elp3 and

transgenic plants overexpressing ELP4. ............................................................ 27

2-1 Amino acid sequence alignments of AtELP3 (At5g50320) and ToELP3 (LOC101246236). ............................................................................................... 40

2-2 AtELP3 and ToELP3 nucleotide sequences alignment. ..................................... 41

2-3 Amino acid sequence alignments of AtELP4 (At3g11220) and ToELP4 (LOC101253042).. .............................................................................................. 42

2-4 AtELP4 and ToELP4 nucleotide sequence alignment. ....................................... 43

2-5 Genitic complementation of the Arabidopsis elp mutant morphology. ................ 44

2-6 Genetic complementation of NAD+ responsiveness in elp3 using ToELP3........ 45

3-1 PCR analysis with specific primers to detect the AtELP3 and AtELP4 transgenes, respectively. .................................................................................... 63

3-2 Horticultural traits of the transgenic plants.. ........................................................ 64

3-3 Fruits produced on transgenic tomato plants expressing AtELP3 (E3) or AtELP4 (E4) and the control (WT). ..................................................................... 65

3-4 Disease symptoms caused by X. perforans pv. tomato on the control (WT) and the transgenic lines carrying AtELP3 (E3) or AtELP4 (E4).. ........................ 66

3-5 Disease symptoms caused by C. cassiicola on the control and transgenic lines carrying AtELP3 or AtELP4. ....................................................................... 67

3-6 Disease severity on the control (WT) and transgenic lines carrying AtELP4 (E4) and AtELP3 (E3) following infiltration of leaflets with a bacterial suspension (103 cfu/ml) of P. syringae pv. tomato. ............................................. 67

3-7 Growth of P. syringae pv. tomato in transgenic tomato plants inoculated by leaf infiltration. .................................................................................................... 68

3-8 Disease symptoms on the control (WT) and transgenic lines carrying AtELP4 (E4) and AtELP3 (E3). ........................................................................................ 69

3-9 Disease symptoms progression and rating. ........................................................ 70

3-10 Growth of P. syringae pv. tomato in transgenic tomato plants inoculated by foliar spray. ......................................................................................................... 71

10

3-11 Stomatal conductance and morphology. ............................................................ 73

3-12 Expression levels of the transgenes and PR1 in the transgenic lines. ................ 74

4-1 Morphology of the fruits produced on ToELP3 transgenic plants. ...................... 81

4-2 PCR analysis with specific primers detecting the 35S promoter. ........................ 81

4-3 Comparison of bacterial speck disease symptoms on the wild-type (WT) Moneymaker and the transgenic line ToELP3 1-2. ............................................. 82

4-4 Comparison of bacterial speck disease symptoms on the wild-type (WT) Moneymaker and the transgenic line ToELP3 2-2. ............................................. 83

4-5 Comparison of bacterial speck disease symptoms on the the wild-type (WT) Moneymaker and the transgenic line ToELP3 3-14. ........................................... 84

4-6 Growth of P. syringae pv. tomato in transgenic tomato expressing ToELP3. ..... 85

11

Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy

GENERATION OF DISEASE RESISTANCE IN TOMATO USING ARABIDOPSIS

ELONGATOR GENES AND THEIR TOMATO ORTHOLOGS

By

Juliana A. Pereira

May 2017

Chair: Zhonglin Mou Cochair: Jeffrey B. Jones Major: Plant Pathology Tomatoes are cultivated and consumed worldwide. The United States is the second

largest of tomato producer. Florida is the top state in fresh market tomato production.

Production of this crop is threatened by a number of diseases, for which control is

primarily based on chemicals and sanitary measures. It has been difficult to identify

effective and durable measures for disease management. Currently, one strategy that is

being pursued is utilizing defense-related genes from Arabidopsis thaliana and their

orthologs in other plants. Arabidopsis is a well-established model plant with its full

genome sequenced. Thus far, many defense-related genes have been cloned and

characterized in Arabidopsis, making it a suitable source of genes for engineering

disease resistance in tomato. The Arabidopsis Elongator complex plays an important

role in plant immunity, likely by contributing to transcription activation of defense genes.

As Elongator is not specifically involved in pathogen recognition and subsequent signal

transduction, it may provide durable resistance. Our results show that overexpressing

Arabidopsis Elongator genes in tomato improves resistance to Pseudomonas. The

predicted tomato Elongator genes are highly homologous to those of Arabidopsis.

12

Importantly, the tomato Elongator gene orthologs are able to complement the

morphological and defense phenotypes of the corresponding Arabidopsis Elongator

mutants, indicating that they are functional. There is a necessity for long-lasting

resistance in order to simultaneously control diseases caused by multiple pathogens.

Generating transgenic plants with increased disease resistance would be a promising

alternative to conventional methods. However, recently GMO (Genetically Modified

Organism) has had a difficult public acceptance. Since the tomato Elongator gene

orthologs are functional, they could be utilized to generate tomato plants with increased

disease resistance, using alternative technologies that are not considered transgenic,

such as cisgenesis and intragenesis. They also could be used as a genetic background

and combined with other defense-related genes in further breeding for resistance to a

broad spectrum of diseases.

13

CHAPTER 1 LITERATURE REVIEW

The ancestor of the tomato we know today is native of South America and is

believed to be the wild cherry tomato. Tomato was first introduced to Europe in the

sixteenth century. Following its introduction, it was determined to be related to the

Solanum genus and was identified as Solanum pomiferum. The plant was first named

by Galen as Lycopersicon (derivation, ‘lyco’, wolf and ‘persicum’, peach). In 1694,

tomato was considered to be part of a distinct genus other than Lycopersicon. But

Linnaeus (1753) classified tomato in the genus Solanum, under the specific name

Solanum lycopersicum. In 1768, Miller officially placed tomato in its own genus with the

name Lycopersicon esculentum (Terrell et al., 1983). However, fairly recent molecular

studies supported the Linnaeus classification, and tomatoes were grouped under the

genus Solanum again, which remains today (reviewed in Peralta and Spooner, 2006).

Tomatoes were not always popular, as they were once thought to be poisonous

(Smith, 1994). However, it has changed, and now its consumption has a mean of

approximately 12 kilograms of tomato per capita a year in the United States. Today a

great number of tomato varieties are found in the market. New tomato varieties are

constantly being improved to account for different tastes. The majority of tomatoes

produced in the United States are processed, such as canned tomato, ketchup, chili

sauce, paste, salad dressing, sauces, soups, and juice cocktails (Peralta and Spooner,

2006). The popularity of tomatoes may be due to their rich source of vitamins, such as

vitamin A and C. High intake of vitamin C has been associated with diabetes, cancer

and asthma prevention. Tomatoes also possess lycopene, which is a carotene and a

natural pigment, known for its natural antioxidant action (Peralta and Spooner, 2006). It

14

is believed that consumption of tomato benefits the heart, and lycopene has been

reported to inhibit cell proliferation and promote cancer prevention (Levy et al., 1995,

Countruman et al., 1991). Many studies associate the consumption of lycopene with

prostate cancer prevention (Rackley et al., 2006).

Tomato is a very profitable but costly crop to produce worldwide. It is a labor-

intensive crop that requires significant amount of chemical inputs to protect the crop

from a wide variety of pests and diseases. The United States is the second largest

tomato producer, which accounts for more than $2 billion gross income annually. In

Florida tomato production occurred on approximately 35,000 acres and generated close

to $455.9 million in gross sales in 2013 (Freeman et al., 2015-2016). Florida is ranked

second in tomato production and is responsible for approximately 30% of fresh market

tomato production in the U.S. (USDA 2016).

There are a number of diseases that affect tomatoes in Florida. Some major

diseases are tomato yellow leaf curl virus, Fusarium wilt, target spot, bacterial wilt and

bacterial spot. Since tomatoes are susceptible to many diseases, studies involving

identification of disease resistance genes in nonhost plants have increased dramatically

(Altpeter et al., 2016). Genes identified in these nonhost species have been used for

genetic engineering in tomato. Several Arabidopsis genes have been transformed into

tomato plants aiming for broad disease resistance. The Arabidopsis thionin gene,

Thi2.1, when constitutively expressed in tomato plants, was able to delay progression of

bacterial wilt, caused by Ralstonia solanacearum, and Fusarium wilt, caused by

Fusarium oxysporum f. sp. lycopersici (Chan et al., 2005). The Arabidopsis systemic

acquired resistance (SAR) key regulator, nonexpresser of pathogenesis-related (PR)

15

genes1 (NPR1), was overexpressed in tomatoes, leading to enhanced resistance to

bacterial wilt and Fusarium wilt (Lin et al., 2004). Overexpression of EFR, which

encodes a pattern-recognition receptor involved in Arabidopsis immune response, in

tomato and Nicotiana benthamiana conferred resistance to Pseudomonas,

Agrobacterium, Xanthomonas and Ralstonia (Lacombe et al., 2010). Tomatoes

overexpressing maize ß-glucanase (M-GLU) and a Mirabilis jalapa antimicrobial peptide

(Mj-AMP1) had enhanced resistance to Alternaria solani Sorauer, the causal agent of

early blight of tomato (Schaefer et al., 2005). The pepper Bs2 resistance gene, which

specifically recognizes avrBs2, a Xanthomonas effector that is highly conserved in all

tomato races, was successfully transferred to several varieties of tomato that are highly

susceptible, resulting in a high level of resistance to the bacterial leaf spot pathogen in

field trials (Horvath et al., 2012). However, Xanthomonas strains have been isolated,

which contain mutations in avrBs2 and recover the ability to grow on pepper and tomato

plants carrying the Bs2 gene (Swords et al., 1996; Gassman et al., 2000; Wichmann et

al., 2005). The limitations of transgenic lines carrying genes involved in specific

recognition, such as Bs2, include the pathogen’s ability to overcome the resistance,

which often limits the durability of the resistance.

Bacterial Leaf Spot of Tomatoes and Peppers

Bacterial leaf spot, incited by Xanthomonas perforans, X. euvesicatoria, X.

vesicatoria, and X. gardneri, is a major disease problem in tomato production. X.

perforans is the prevalent bacterial spot pathogen in Florida (Potnis et al., 2015). The

symptoms include necrotic spots on all above ground plant parts. The host range

includes tomato and pepper (Jones et al., 1991). X. perforans has only recently been

reported to cause disease in peppers (Schwartz et al., 2015). The disease is very

16

severe and can be devastating to tomato seedlings. Once present in the crop, it is

almost impossible to control the disease and prevent major fruit loss while

environmental conditions remain favorable (Sun et al., 2002). Seeds, crop residue, and

volunteer plants are inoculum sources for the disease (Jones et al., 1986). Wind driven

rain droplets and aerosols are environmental factors, which are important in

dissemination of the pathogen. Bacterial spot is a problem in many tomato production

regions worldwide and the prevalence of the causal agent varies depending on the

location (Potnis et al., 2015). Disease control is based on chemicals and sanitary

measures, which have their limitations (Potnis et al., 2015). Streptomycin was used to

control bacterial spot in the 1950s, but it became ineffective because of the build-up of

resistant strains very quickly (Stall and Thayer, 1962). In the absence of alternative

measures, copper bactericides started to be used broadly and intensively to control

bacterial spot, due to its low cost and low phytotoxicity (Marco and Stall, 1983).

Following the extensive use of copper for disease control, copper tolerant strains

became prevalent (Marco and Stall, 1983). Although copper mixed with ethylene bis-

dithiocarbamate (EBDC) fungicides was more effective than copper alone, more

recently this combination was shown to be ineffective (Huang and Vallad, 2011; Vallad

and Huang, 2011). With the bacterial spot pathogen evolving resistance to various

chemical bactericides, it is clear that host resistance to bacterial spot is crucial for

controlling the disease. Unfortunately, there are no commercial varieties with effective

resistance.

Tomato Bacterial Speck

The bacterium, Pseudomonas syringae pv. tomato, is the causal agent of

bacterial speck of tomato. Its interaction with host and nonhost plants has been

17

intensively studied. The bacterium has high specificity for tomato, and as a result of

other members of P. syringae that infect different hosts, the term “pathovar” was

proposed. This term is used to refer to a group of strains that share similar pathological

characteristics (Dye et al., 1980). The bacterium was first identified by Okabe in 1933.

In 1944, Alstatt renamed the bacterium as Pseudomonas tomato. More recently the

bacterium has been referred to as P. syringae pv. tomato (Okabe) Young, Dye, &

Wilkie.

P. syringae pv. maculicola and P. syringae pv. tomato are suggested to be

synonymous, because they are very similar phenotypically and genetically (Gironde and

Manceau, 2012). Their host range overlaps and both are pathogenic to tomato plants,

but only strains of P. syringae pv. maculicola are pathogenic on members of

Brassicasseae. As a result of these findings, studies suggest that P. syringae pv.

tomato strain DC3000 belongs to P. syringae pv. maculicola (Gironde and Manceau,

2012). P. syringae pv. tomato and P. syringae pv. maculicola, along with several other

P. syringae pathovars, produce coronatine, which is a phytotoxin that induces leaf

chlorosis. Coronatine is also involved in stomata opening to facilitate Pseudomonads

virulence in the hosts. There is a report demonstrating that coronatine induces stomatal

reopening and bacterial propagation by inhibiting accumulation of salicylic acid (Zheng

et al., 2012). The genes responsible for coronatine production are generally present on

a large plasmid (87 kb), but can also be present on the chromosome in some bacterial

strains (Cuppels and Ainsworth, 1995).

The disease is severe and results in losses up to 75% of tomato yield, if the

pathogen is present at the beginning of production (Yunis et al., 1980). The symptoms

18

are present on all aerial parts of the plant and consist of small black or brown necrotic

lesions (specks). The spots can be surrounded by a chlorotic halo, caused by the

bacterial toxin coronatine (Jones et al., 1991). Under favorable environmental

conditions, disease progression may lead to premature defoliation (Srisink and

Sivasithamparam, 1987). The bacteria are spread by wind driven rain droplets and

aerosols and the disease is favored during wet, cool weather (15- 25◦C) (Jones et al.,

1991). Crop residue, volunteer plants, soil, weeds and seeds are inoculum sources for

the disease (Yunis et al., 1980, Jardine et al., 1988, McCarter et al., 1983). Pathogen-

free seeds and resistant varieties carrying the gene Pto have been implemented to

control the disease (Monroe and Sasser, 1980; Padley and Martin, 2003). Since the

introgression of Pto gene in tomato cultivars, there have been no reports of Pto

mediated resistance overcome by the bacterium, however, because it is a

semidominant gene, hybrids can occasionally be diseased (Padley and Martin, 2003).

Target Spot of Tomato

Target spot of tomato is caused by the fungus, Corynespora cassiicola, which is

a necrotrophic, saprophytic and endophytic fungus with high level of genetic diversity.

The disease has been reported to cause high economic losses (Pernezny et al., 2003).

The symptoms of the disease can be present in all aerial parts of the plant and consist

of necrotic lesions with light brown centers with dark margins. The coalescence of the

lesions on leaves results in large blighted areas that lead to premature defoliation

(Pernezny et al., 2003). The size of the conidia among isolates of C. cassiicola may

vary. C. cassiicola produces gray to brown colonies, which may be fuzzy. The fungal

mycelium usually grows immersed in the media and does not form a stroma. The

conidiophores are erect and occasionally branched, straight or flexed to a small extent,

19

dark brown and septate (Schlub et al., 2009). Temperatures above 20C and high

humidity favor the disease development. C. cassiicola has a wide host range and uses

common weed species as an alternative host. Besides weeds, crop residue can also

serve as inoculum source for the disease. The control strategies for this disease are

based on cultural methods, such as eradication of plant debris, crop rotation, and foliar

sprays with fungicides. The lack of resistant cultivars and biocontrol have not been

effective for disease control (Pernezny et al., 2003).

Plant Defense

Most microorganisms that interact with plants are not pathogens. A vast number

of microorganisms are beneficial, such as plant growth-promoting rhizobacteria,

mycorrhizal fungi, nitrogen-fixing bacteria, and biocontrol agents (Agrios, 1988). For

those that are plant pathogens, they are divided into two main groups: those that kill

their host and feed on dead tissue (necrotrophs) and those that keep their host alive for

the long term in order to serve as a food source (biotrophs). There are also

hemibiotrophic pathogens, which begin with a biotrophic phase and end with a

necrotrophic phase (Agrios, 1988).

Plants have evolved structural, chemical and protein-based mechanisms to

defend themselves against fungi, oomycetes, bacteria, viruses and nematodes.

Chemical and protein-based mechanisms depend on early recognition of the pathogen

during the infection process. Plants have passive protection against pathogens, such as

a waxy cuticle and anti-microbial compounds, which are able to inhibit entry into the

plant (Dangl and Jones, 2001). Surface natural openings, such as stomata, play an

important role during infection. Stomatal closure is part of the plant defense response to

20

bacteria invasion (Melotto et al., 2006). However, in some cases, this mechanism is not

enough to avoid pathogen entry. Plants are also able to recognize pathogen-associated

molecular patterns (PAMPs), such as bacterial flagellin, peptidoglycan, viral double

stranded RNA, fungal glucan and chitin, which are usually highly conserved among

groups of organisms, and activate the basal defense, which is known as PAMP-

triggered immunity (PTI). PTI is a non-specific defense mechanism that allows for

recognition of different pathogens, even non-pathogenic organisms, by the cell surface-

localized pattern-recognition receptors (PRRs). However, some pathogens can

suppress host basal defenses, by injecting virulence proteins, called effectors, into the

host cell. Plants in turn rely on their resistance (R) proteins, which can recognize

pathogen effectors, resulting in disease resistance. This is a specific defense

mechanism known as effector-triggered immunity (ETI). The recognition of pathogen

effectors by the host R proteins, in a gene-for-gene manner first described by Flor

(1971), triggers programmed cell death at the site of infection, known as a

hypersensitive response (HR), in order to stop pathogen growth at the initial infection

site. Since ETI results in programmed cell death, it is effective only against obligate

biotrophs or hemibiotrophic pathogens, but not against necrotrophs. Natural selection

can lead pathogens to acquire additional effectors, allowing them to suppress ETI and

also drive the plant to acquire new R protein specificities, triggering ETI again, which

appears as an endless battle (Jones and Dangl, 2006). Along with local programed cell

death, a systemic defense called systemic acquired resistance (SAR), can also be

triggered. Virulent or avirulent pathogens can both induce SAR. SAR is a long lasting

and broad-spectrum resistance not related to the initial type of infection. SAR is

21

associated with the accumulation of salicylic acid (SA) and PR proteins at the site of

infection and in systemic tissues, and protects the plant against a secondary infection

(reviewed by Fu and Dong, 2013). SA is not responsible for defense against all

pathogens. Jasmonic acid (JA) and ethylene (ET) are plant hormones that, among other

functions, play a role in plant defense. JA is a signaling molecule involved in pollen and

seed development, and defense against wounding, insect pests and microbial

pathogens (Creelman et al., 1997; Kunkel et al., 2002). There is a rapid accumulation of

JA and its derivatives in the plant after herbivorous insect or necrotrophic pathogen

attack (Creelman et al., 1992; Kunkel et al., 2002). The accumulation of JA triggers the

activation of a series of enzymes, transcription factors and defense genes, resulting in

the plant’s response to abiotic and biotic stress (reviewed by Turner et al., 2002). While

SA mostly induces plant defenses against biotrophic pathogens, JA and ET are

generally important hormonal regulators of induced plant defenses against necrotrophic

pathogens (Glazebrook, 2005). There is an inverse relationship between SA and JA-

dependent resistance (Koornneef et al., 2008). When one defense pathway is activated,

the other one is inhibited. NPR1 is known to play a role in the antagonistic interaction of

SA and JA (Zhou et al., 1998; Spoel et al., 2003; An and Mou 2011). The multiple

defense mechanisms allow plants to trigger the right pathway when they are challenged

by different groups of pathogens. However, even all these defense mechanisms against

different biotic pathogens and abiotic stresses may not be sufficient to confer the plant’s

ability to protect itself from pathogens. Therefore, genetic engineering can be an

effective tool to help plants trigger resistance against biotic and abiotic conditions.

22

The Pyridine Nucleotides

Besides the extensively studied main defense response pathways in plants,

small molecules can also play a role in plant-pathogen interactions. Plants are known to

synthesize a variety of secondary metabolites that are usually specific to a family or

plant species and can act as a natural pesticide or an important key in plant defense

signaling. Primary metabolites are also important since they assist on sustaining the

production of secondary metabolites, which are involved in plant immunity (Pétriacq et

al., 2013). The pyridine nucleotide, NAD (nicotinamide adenine dinucleotide), is a

primary metabolite synthesized from aspartate in plants (Katoh et al., 2006). Both NAD

and NADP (NAD phosphate) are known to be important electron carriers and to

participate in most metabolic pathways.

NAD(P) plays a role in cell signaling in plants, animals and fungi. It can

participate in intracellular signaling events or it can be an extracellular signal molecule

for several physiological and pathological responses (Zhang and Mou 2009). In animal

cells, NAD(P) is metabolized by ectoenzymes or perceived by cell surface receptors,

which activate downstream signaling pathways. In mouse, extracellular NAD(P) is

involved in aorta contraction (Judkins et al., 2006). In humans, NAD(P) activates

granulocytes, which are an essential part of the innate immune system (Bruzzone et al.,

2006; Moreschi et al., 2006). In plants, NAD and its derivatives seem to be associated

mostly with stress tolerance or defense responses (Adams-Phillips et al., 2010; Berger

et al., 2004; Djebbar et al., 2012; Dutilleul et al., 2003, 2005; Ford et al., 2010; Noctor et

al., 2006; Zhang and Mou 2009; Pétriacq et al., 2013). Overexpression of the bacterial

NAD biosynthesis gene leads to an increase of the intracellular NAD level, enhanced

defense gene expression, as well as resistance to bacterial pathogens (Pétriacq et al.,

23

2012). Mutations in an NAD biosynthesis gene compromise stomatal immunity (Macho

et al., 2012). Changing the levels of intracellular NAD alters the defense responses

mediated by salicylic acid in plants (Pétriacq et al., 2012). Application of exogenous

NAD(P) in Arabidopsis plants induces the expression of PR genes and resistance to the

bacterial pathogen P. syringae pv. maculicola ES4326 (Zhang and Mou 2009). The

defense responses induced by exogenous NAD(P) seem to be independent of the

NADPH oxidase homologs, but partially dependent on the plant defense signal

molecule SA and NPR1, the latter of which is a positive regulator of the SA signaling

pathway (Cao et al., 1997; Ryals et al., 1997). NAD(P) is able to leak into the

extracellular space after mechanical wounding and pathogen infection, which is

sufficient for induction of both PR gene expression and disease resistance (Zhang and

Mou 2009). Exogenous application of NAD(P) induces SA-dependent and independent

PR gene expression and disease resistance, indicating that the SA signaling pathway is

not the only defense response activated by exogenous NAD(P) application (Zhang and

Mou 2009). However, the mechanism of NAD(P) regulate these processes require

further investigation. In a genetic screen for mutants insensitive to exogenous NAD+,

the Arabidopsis Elongator complex was revealed, which was further demonstrated to be

involved in plant defense mechanisms (An et al., 2016).

The Arabidopsis Elongator Complex

Elongator was first described as a protein complex associated with the

hyperphosphorylated elongating form of RNA polymerase II (RNAPII) in yeast (Otero et

al., 1999; Wittschieben et al., 1999). It was later found in humans (Hawkes et al., 2002)

and plants (Nelissen et al., 2010). RNAPII is involved in transcription of protein-

encoding genes to synthetize the precursor of mRNA. The Elongator complex contains

24

six subunits, ELP1 (also called ELO2), ELP2, ELP3 (also called ELO3), ELP4 (also

called ELO1), ELP5, and ELP6. ELP1 has a nuclear localization sequence that is crucial

for Elongator complex function (Fichtner et al., 2003). ELP3 is a histone

acetyltransferase, which is important during gene regulation (Wittschiebeb et al., 1999;

Winkler et al., 2002). It has a C-terminal histone acetyltranferase (HAT) domain, which

is capable of acetylating all four histones (Winkler et al., 2002), and an N-terminal Cys-

rich motif that resembles an iron-sulfur radical S-adenosylmethionine (SAM) domain,

which was shown to be required for zygotic paternal genome demethylation (Okada et

al., 2010). ELP4, ELP5 and ELP6 assemble in a ring shaped structure, known as the

accessory sub-complex, which seems to be important for histone recognition (Lin et al.,

2012). The accessory sub-complex is a RecA-ATPase like protein, which uses the

energy from ATP hydrolysis for binding, translocating and rearranging nucleic acid.

ELP456 plays an important role in tRNA binding, which might influence translational

accuracy (Glatt et al., 2012).

Elongator has been shown to be involved in several distinct cellular processes,

such as exocytosis, histone modification, tRNA modification, -tubulin acetylation in

human neurons, zygotic paternal DNA demethylation in mice, and miRNA biogenesis in

Arabidopsis (Hawkes et al., 2002; Huang et al., 2005; Rahl et al., 2005; Creppe et al.,

2009; Okada et al., 2010, Fang et al., 2015, Ding and Mou, 2015). The Elongator

complex functions in both the nucleus and the cytoplasm. In the nucleus, it is involved in

histone acetylation and/or DNA methylation/demethylation. In the cytoplasm, the

complex is responsible for tRNA modification, which consequently regulates protein

translation (Ding and Mou, 2015). Elongator functions in response to abiotic and biotic

25

stresses, accelerating gene induction due to the change in cellular and environmental

conditions (DeFraia and Mou, 2011). The absence of any of the complex subunits

compromises its integrity and its function (Versees et al., 2010).

Although Elongator has a conserved role in transcription and translation, its

function differs among organisms (DeFraia and Mou, 2011). Yeast Elongator mutants

presented resistance to the zymocin γ-toxin subunit (a toxin secreted by yeast), delayed

activation of gene expression, defects in transcriptional silencing, slow growth and

sensitivity to abiotic agents, such as salt, caffeine, temperature, and DNA-damaging

agents (Otero et al., 1999; Jablonowski et al., 2001; Frohloff et al., 2001; Krogan and

Greenblatt, 2001). Humans deficient in Elongator complex show abnormally low

numbers of neurons in the autonomic and sensory nervous systems (Anderson et al.,

2001; Slaugenhaupt et al., 2002). Arabidopsis Elongator mutants showed

hypersensitivity to abscisic acid, resistance to oxidative stress, atypical root

development, severely abnormal auxin phenotypes, disease susceptibility, and altered

cell cycle progression (Nelissen et al., 2005, 2010; Chen et al., 2006; Zhou et al., 2009;

DeFraia et al., 2010; Xu et al., 2012, Jia et al., 2015). Silencing ELP2 in tomato plants

resulted in inhibition of leaf growth, acceleration of leaf and sepal senescence,

production of dark-green fruit with reduced gibberellic acid and auxin in leaves, and

increase of chlorophyll accumulation in pericarps (Zhu et al., 2014).

The Elongator complex plays a pivotal role in plant immune responses against

both bacterial and fungal pathogens. Elongator contributes to SA-mediated, JA/ET-

mediated, and the transcription factor WRKY33-activated defense responses, and is a

major player in resistance against the bacterial pathogen P. syringae and the

26

necrotrophic fungal pathogens Botrytis cinerea and Alternaria brassicicola (Defraia et

al., 2010; Wang et al., 2015).

Furthermore, Elongator not only positively regulates ETI (DeFraia et al., 2010,

2013), but also plays an important role in PTI (An et al., 2017). Mutations in Elongator

genes inhibit flg22-induced defense gene expression and compromise Arabidopsis

nonhost resistance against X. citri subsp. citri and P. syringae pv. phaseolicola

NPS3121, two economically important bacterial pathogens that cause citrus canker and

halo blight of common bean, respectively (An and Mou, 2012). Interestingly, Elongator

does not seem to be required for SAR activation, since elp2 and elp3 mutants have wild

type SAR induction (DeFraia et al., 2010, 2013).

Mechanistically, the Arabidopsis ELP2 has been shown to function in DNA

demethylation/methylation and histone acetylation in a group of defense genes,

indicating that Elongator is an epigenetic regulator of plant immunity (Wang et al.,

2013). Consistently, there is a delay and/or decrease in the induction of these defense-

related genes when ELP2 is absent. Moreover, mutations in ELP2 and several major

defense genes, including NPR1, COI1, and EIN2, seem to interact with each other in a

synergistic or additive manner (Defraia et al., 2010; Wang et al., 2015). Several NPR1,

COI1, and EIN2 target genes are also regulated by ELP2 (Defraia et al., 2010; Wang et

al., 2015), suggesting functional overlapping between ELP2 and these major defense

regulators. However, the relationship between ELP2 and these defense regulators

needs further investigation.

Corroborating reports of the crucial role for Elongator in plant immune responses,

overexpression of ELP4 in Arabidopsis plants conferred enhanced resistance against P.

27

syringae (Figure 1-1 by Ding and Mou, unpublished data). When the Arabidopsis ELP3

and ELP4 genes were overexpressed in strawberry, they were observed to confer

strong resistance against the fungal pathogens Colletotrichum acutatum, C.

gloeosporioides, Podosphaera aphanis (causal agents of anthracnose, crown rot and

powdery mildew, respectively) and the bacterial pathogen X. fragariae that causes

angular leaf spot in strawberry (Silva and Mou, unpublished data).

Figure 1-1. The Arabidopsis elp3 mutant morphology and bacterial growth in elp3 and

transgenic plants overexpressing ELP4. (A) Morphology of Arabidopsis wild type Col-0 and elp3 mutant plants. (B) Closer image of leaves of Col-0 and elp3 after inoculation with P. syringae pv. maculicola (Psm) strain ES4326. (C) Growth of the bacterial pathogen, Psm ES4326, in Col-0 and elp3. (D) Growth of the bacterial pathogen Psm ES4326 in Col-0 (wild type) and in two ELP4 overexpression lines. Cfu: colony forming unit.

Elongator also plays a critical role in exogenous NAD+-induced defense

responses in Arabidopsis (Zhang and Mou, 2008). Mutations in any of the Arabidopsis

Elongator genes compromise exogenous NAD+-induced expression of PR genes and

resistance to the bacterial pathogen Psm ES4326 (An et al., 2016).

28

All these results collectively indicate that the Elongator complex is a key regulator

of plant immune responses. It is involved in both the SA and JA/ET defense signaling

pathways and plays an important role in plant immunity against biotrophic,

hemibiotrophic, necrotrophic as well as nonhost pathogens. Thus, it is very interesting

to test whether overexpression of the Arabidopsis Elongator proteins in tomatoes could

provide long-lasting and broad-spectrum disease resistance. Additionally, functional

studies of the Elongator complex in plants are mainly limited to Arabidopsis, and the

specific biological functions of the Elongator complex in other plant species still await

investigation.

Genetically Engineered Crops

Fulfilling the ability to feed the world population with limited natural resources is a

difficult task. In addition to scarce natural resources, climate change and diminishing

arable land are limiting factors for agriculture production. Together these have resulted

in uneven food distribution, exacerbating malnutrition and starvation, which are serious

concerns faced by many countries. Crop production with improved quality, increased

yield and sustainability is imperative in order to feed a continuously growing population.

The advances in genetic engineering have provided possibilities for facing some of

these challenges in crop production. Genetic engineering for improving disease

resistance through transfer of plant defense-related genes into crops is potentially

beneficial in terms of cost, efficacy and reduction of pesticide usage (Sexton and

Zilberman, 2011). Genetically modified organisms (GMOs) can be engineered to

augment crop resistance to pathogens, allowing for greater rates of crop yield compared

to traditional methods. In India, the use of Bt (short for Bacillus turgiensis) transgenic

cotton, which is a modified crop for insect resistance, increased crop yield per acre by

29

24% and profit by 50% (Kathage and Qaim, 2012). Transgenic plants expressing the Bt

gene are able to produce a protein that kills the larvae of the insect that harm the crop

production (James et al., 1996). A genetically engineered (GE) plant resistant to several

pathogens would lead to a reduction in the use of inputs such as pesticides, effectively

decreasing damage to the environment and the cost of production (Campbell et al.,

2002).

For 30 years, Agrobacterium-mediated transformation has been extensively used

in plant genetic engineering. Currently, there are several techniques available to

genetically modify organisms. The transgenic technology is the oldest and probably the

best-known method. The first commercialized GE crop was a tomato known as Flavr

SavrTM, which reached the market in 1994. The delayed-ripening tomato had a longer

shelf life than conventional tomatoes, which was an advantage for the supermarkets

that sold it (Kramer and Redenbaugh, 1994). In 1995, maize with the Bt gene was

approved in the United States. In the same year, a soybean plant with resistance to the

herbicide, glyphosate, was commercialized for the first time. The resistance to herbicide

allowed growers to eliminate weeds without compromising the crop (James et al.,

1996). In 1997, the Bt transgenes were inserted into many other crops, including

cotton, which has dramatically reduced the use of insecticides. In 1999, the

commercialization of GE maize, soybean, sugar beet, cotton and canola became

widespread (reviewed by Altpeter et al., 2016).

Transgenic technology has offered new opportunities compared to traditional

breeding practices and provides a complement to some of their weaknesses. It allows

for alteration of the endogenous gene expression, creation of specific or broad-

30

spectrum pathogen resistance, and use of genes from other species, including those

from plant species that are not able to be crossed. It is a promising tool to introduce

desirable traits into a plant without altering its current genetic background. It can also be

combined with traditional genetics and breeding to enhance resistance to pathogens.

Besides, plant transformation has also become an essential instrument for basic

research, in particular the functional characterization of genes identified by sequencing

of whole genomes. Overexpression of poplar (Populus trichocarpa) orthologs of

Arabidopsis resistance-like abscisic acid receptors promoted abscisic acid sensitivity

and drought stress tolerance. These results suggest that the poplar orthologs positively

regulate abscisic acid responses (Yu et al., 2016). Mutations in rice plants allowed the

identification of a sucrose transporter gene (OsSWEET13) as the disease-susceptibility

gene for PthXo2, a product of transcription activator-like (TAL) effector for virulence in

X. oryzae pv. oryzae (Zhou et al., 2015). To confirm the function of Arabidopsis

Elongator complex subunit 3, ELP3 cDNA under the control of the constitutive 35S

promoter was introduced in Arabidopsis elp3 mutants via Agrobacterium. The transgene

was able to complement all the phenotypes including the enhanced susceptibility to

disease, caused by the mutation (DeFraia et al., 2013).

New technologies have arisen as a result of the public’s concerns about

environmental damage, seed contamination and health issues relating to the use of

transgenics. Cisgenic and intragenic technologies came as an alternative to transgenic

methods. Cisgenesis consists of the use of natural genes and their regulatory elements

to genetically modify organisms that can crossbreed, while intragenesis allows the

31

movement of a combination of genes and regulatory sequences belonging to plants that

can crossbreed (Schouten et al., 2006; An et al., 2013).

Summary

Generating transgenic tomato plants with improved resistance will likely enable

tomato growers to use less bactericides and fungicides, leading to a reduction in

production costs and environmental pollution as well as an increase in yield.

Arabidopsis is a very well established model system. Its whole genome has been

sequenced and many markers are available. A large number of defense-related genes

have already been cloned, characterized, and used in studies of disease resistance.

New tools and information on these defense-related genes from Arabidopsis could be

successfully used to improve agricultural crops. Stable resistance to disease is likely to

be the most economical, effective, and environmentally sustainable crop protection

strategy. There is a necessity for long lasting and broad-spectrum resistance to

simultaneously control diseases caused by multiple pathogens. In this sense, the

Elongator genes may be combined with other resistance genes for durable and broad-

spectrum resistance.

32

CHAPTER 2 CHARACTERIZATION OF TOMATO ORTHOLOGS OF ARABIDOPSIS DEFENSE

REGULATOR GENES

Introduction

Plants have evolved many strategies to defend themselves against pathogens.

Some defense mechanisms are triggered when the plant recognizes the pathogen or

pathogen-associated molecular patterns (PAMPs), resulting in PAMP-triggered

immunity (PTI). PTI is a non-specific defense mechanism that allows for recognition of

pathogenic and non-pathogenic organisms, and prevents pathogen colonization. Along

with PTI induction, an effector-triggered immunity (ETI) can also be triggered. ETI

results in programmed cell death at the site of infection, known as a hypersensitive

response (HR), in order to stop pathogen growth at the initial infection site. The

recognition of pathogenic or non-pathogenic organisms by the plant can also lead to a

systemic acquired resistance (SAR) response, which confers long-lasting protection

against a broad spectrum of pathogens (reviewed by Fu and Dong, 2013). Plant

hormones, such as jasmonic acid and ethylene, also play an important role in plant

defense (Glazebrook, 2005). Not only plant hormones, but also small molecules, such

as the pyridine nucleotide, nicotinamide adenine dinucleotide (NAD), can play a role in

plant-pathogen interactions (Zhang and Mou 2009). Exogenous NAD application can

activate defense responses in Arabidopsis (Zhang and Mou, 2008). In a genetic screen

for mutants insensitive to exogenous NAD, the Arabidopsis Elongator complex was

revealed. The Elongator complex seems to be a key regulator of plant immunity, likely

by regulating transcription activation of defense genes. The Elongator complex consists

of six subunits, including ELP1 and ELP2 (scaffolds for complex assembly), ELP3

(catalytic subunit), and an accessory complex formed by ELP4-ELP6 (Wang et al.,

33

2013). Absence of any one of the Elongator subunits in Arabidopsis compromises

exogenous NAD+-induced expression of PR genes and resistance to the bacterial

pathogen, P. syringae pv. maculicola (Psm) ES4326 (An et al., 2016). Elongator seems

to function in both the nucleus and the cytoplasm. In the nucleus, the complex is

involved in histone acetylation and/or DNA methylation/demethylation, and thus

involved in gene expression. In the cytoplasm, it is responsible for tRNA modification,

which consequently regulates protein translation (Ding and Mou, 2015). Whereas

mutations in Elongator compromise exogenous NAD+-mediated disease resistance and

enhance susceptibility to Psm ES4326, overexpression of ELP4 in Arabidopsis

increases resistance against Pseudomonas (Ding & Mou, unpublished data),

demonstrating that Elongator plays a crucial role in plant defense.

The Elongator complex has also been reported in yeast (Otero et al., 1999;

Wittschieben et al., 1999) and humans (Hawkes et al., 2002). The Elongator complex is

highly conserved in eukaryotes, but whether this complex has the same role in plant

defense responses in species other than Arabidopsis remains to be determined.

Silencing of ELP2 in tomato plants resulted in inhibition of leaf growth, acceleration of

leaf and sepal senescence, production of dark-green fruit with reduced gibberellic acid

and auxin in leaves, and increase of chlorophyll accumulation in pericarps. However,

pathogen resistance of the ELP2-silenced tomato plants was not evaluated (Zhu et al.,

2014). Characterization of tomato Elongator genes may provide usuful information for

the design of novel pathogen resistance similar to the resistance provided by the

Arabidopsis Elongator subunits. In addition, understanding a functional tomato ortholog

34

of an Arabidopsis defense related gene could help design strategies to increase the

expression of the ortholog for generating tomato disease-resistant plants.

In this study, tomato orthologs of the Arabidopsis ELP3 and ELP4 were

introduced into the Arabidopsis elp3 and elp4 mutants, respectively. Results show that

the tomato ELP3 and ELP4 genes are able to complement the corresponding

Arabidopsis mutants. These results indicate that the tomato ELP3 and ELP4 genes are

functional and could potentially be used for conferring disease resistance in tomato

plants. These results also suggest that the function of Elongator may be conserved in

tomato.

Material and Methods

Cloning of the Tomato ELP3 and ELP4 Orthologs

The tomato ELP3 (ToELP3) and ELP4 (ToELP4) genes have high levels of

identity to the Arabidopsis ELP3 and ELP4. To clone ToELP3 and ToELP4, total RNA

was isolated from tomato leaves using the TRIzol® method (Invitrogen). Primers were

designed and used to amplify the coding regions of ToELP3 and ToELP4 from total

cDNA. The PCR products were digested with restriction enzymes XhoI and SacI for

ToELP3, and SalI and SacI for ToELP4, and then ligated into the corresponding sites of

the vector pBI1.4 T, resulting in the T-DNA plasmids pBI1.4 T-35S::ToELP3 and pBI1.4

T-35S::ToELP4. The presence of the expected gene in the plasmids was verified by

DNA sequencing.

Transformation of the Arabidopsis elp3 and elp4 Mutants

Arabidopsis elp3 and elp4 mutant plants (in the Col-0 and Landsberg genetic

background, respectivily) were used for genetic transformation via Agrobacterium

tumefaciens. The plasmids pBI1.4 T-35S::ToELP3 and pBI1.4 T-35S::ToELP4 were

35

introduced into the Agrobacterium strain GV3101(pMP90) by electroporation (Shen and

Forde 1989). The resulting Agrobacteria were cultured on a platform shaker (200 rpm)

at 28℃ overnight. Agrobacterial cells were collected by centrifugation at 5,000 x g for 10

min and re-suspended in 500 ml of 5% sucrose and 0.02% Silwet-77. Arabidopsis

seeds were sown in autoclaved soil (Sunshine MVP, Sun Gro Horticulture) and

vernalized at 4°C for 3 days. Arabidopsis seedlings were transplanted and grown at

22°C under a 16-hr-light/8-hr-dark regiment. Plant transformation was performed

following the floral dip method (Clough and Bent, 1998).

T1 seeds were collected from the T0 plants. Seeds were sterilized in 70% ethanol

for 5 min and in 10% bleach for 10 min and then washed with sterile water until the

bubbles vanished. The seeds were incubated in 3% Plant Preservation Mixture - PPM

(Plant Cell Technology) at 4℃ overnight. The seed were screened on MS solid medium

(pH 5-6) with 50 μg/ml kanamycin and 100 μg/ml ampicillin. The plates were placed in

the dark for 3 days at 4℃, and then incubated at ±22°C under a 16-hr-light/8-hr-dark

regiment. Seedlings of Arabidopsis elp3 and elp4 mutants that showed vigorous growth

were transferred to soil and allowed to grow.

Selection of Single Insertion and Homozygous Lines

T2 seeds that were collected from the T1 plants were screened on MS medium

with 50 μg/ml kanamycin for lines with a single T-DNA insertion based on a 3:1

segregation ratio on kanamycin plates. T3 seeds were collected for homozygous plant

identification. Seedlings that showed vigorous growth were transferred to soil and grown

in order to collect seeds.

36

Pathogen Infection and Bacterial Population Assay

Leaves of homozygous T-DNA insertion lines were inoculated by infiltration of a

suspension of Psm ES4326, adjusted to 105 cfu/ml, with a 1 mL needleless syringe as

described previously (DeFraia et al., 2013). Leaves were sampled 3 days after

inoculation. Eight leaf discs were obtained from distinct leaves, using a cork-borer. Leaf

disks were placed into tubes containing 500 µl of 10mM MgCl2 and ground. The

resulting suspensions were subjected to ten-fold dilutions 4 times. All dilutions were

plated on Tryptic Soy Agar (TSA) media amended with 25 μg/ml spectinomycin and

then incubated at 28℃ for 2 days. Colonies that grew on the plates were counted and

the bacterial population was calculated per cm2 of leaf tissue.

Statistical Analysis

Data were analyzed by fitting a generalized linear mixed model using the

statistical software SAS, and means were separated by Fisher’s Protected LSD test (α =

0.05).

Results

Nucleotide and Amino Acid Sequence Alignments

Arabidopsis ELP3 amino acid and nucleotide sequences exhibited 92% and 80%

identity, respectively, with ToELP3 (Figure 2-1 and 2-2). Arabidopsis ELP4 nucleotide

sequence exhibited 69% identity to its tomato ortholog, and the amino acid sequences

were 61% identical (Figure 2-3 and 2-4).

Arabidopsis elp3 and elp4 Mutant Complementation

To assess the functionality of ToELP3 and ToELP4, two independent binary

plasmids, pBI1.4 T-35S::ToELP3 and pBI1.4 T-35S::ToELP4, were constructed.

ToELP3 and ToELP4 coding regions were driven by a CaMV 35S promoter and a

37

kanamycin resistance gene was used for selecting for positive transformants. The T-

DNA regions of the plasmids were introduced into the Arabidopsis elp3 and elp4

mutants via Agrobacterium-mediated transformation following the floral dip method

(Clough and Bent 1998). Arabidopsis T1 seeds were collected from the transformed

plants and screened in media containing kanamycin for two generations. Two ToELP3

homozygous lines and three ToELP4 homozygous lines were obtained.

Morphologically, the elp mutant leaves were serrated, curly, and a lighter shade of

green than the wild type, whereas the transgenic elp3 and elp4 expressing ToELP3 and

ToELP4, respectively, showed wild type morphology, indicating that both ToELP3 and

ToELP4 are functional (Figure 2-5A and 2-5B).

Disease Susceptibility Complementation

To test if disease susceptibly phenotype of elp mutants was also complemented,

we inoculated wild type Col-0, the elp3 mutant, and elp3 plants expressing ToELP3 with

Psm ES4326 (optical density at 600nm [OD600] = 0.0001). Due to plant condition the

same test could not be conducted with elp4 mutants. While the elp3 mutant was highly

susceptible to Psm ES4326, resistance to Psm ES4326 was completely restored in elp3

expressing ToELP3 (Figure 2-6A). We also investigated exogenous NAD+

responsiveness in the Arabidopsis transgenic lines expressing ToELP3. We treated wild

type Col-0, elp3, and elp3 plants expressing ToELP3 with 1 mM NAD+ and analyzed

NAD+-induced resistance to Psm ES4326 (optical density at 600nm [OD600] = 0.001).

The plants were also treated with 10 mM MgCl2 as a Mock-tretead control. Exogenous

NAD+ induced resistance against Psm ES4326 in the wild type Col-0, whereas the

induction was significantly inhibited in the elp3 mutant plants (Figure 2-6B). Importantly,

NAD+-induced Psm ES4326 resistance was completely restored in the Arabidopsis elp3

38

mutant carrying the ToELP3 transgene (Figure 2-6B and 2-6C). These results

demonstrate that ToELP3 functions similarly to the Arabidopsis ELP3, suggesting that

the Elongator subunit ELP3 may have conserved function in tomato.

Discussion

The Arabidopsis Elongator complex is known as a key regulator of plant

immunity, likely by regulating transcription activation of defense genes. This complex

has been reported in yeast (Otero et al., 1999; Wittschieben et al., 1999), humans

(Hawkes et al., 2002), and plants (Nelissen et al., 2010). Elongator appears to be highly

conserved among different plant species, which raises the question if they have the

same role in defense responses in plants other than Arabidopsis. Tomato orthologs of

the Arabidopsis ELP3 and ELP4, when inserted in Arabidopsis mutants, were able to

restore wild type morphology to the mutants. Furthermore, resistance to Psm ES4326

was completely restored in elp3 mutant plants expressing ToELP3. These results

indicate that ToELP3 and ToELP4 are functional.

Exogenous NAD+-induced defense responses have previously been reported in

Arabidopsis (Zhang and Mou, 2009). NAD+-induced resistance to Psm ES4326 is

inhibited in Arabidopsis elp mutants (An et al., 2016). Since ToELP3 completely

restores NAD+-induced resistance in the elp3 mutant, Elongator might also play an

important role in exogenous NAD+-induced defense responses in tomato.

The functional complementation shown in this work indicates that the function of

the Elongator complex may be conserved in tomato. Indeed, silencing of the Elongator

gene ELP2 in tomato plants resulted in inhibition of leaf growth, acceleration of leaf and

sepal senescence, production of dark-green fruit with reduced gibberellic acid and auxin

in leaves, and an increase in chlorophyll accumulation in pericarps (Zhu et al., 2014).

39

These results, together with those obtained in this study, suggest that the Elongator

complex is essential not only for plant fitness, but also for immunity in tomatoes.

Although it has been shown that Elongator influences the activation of thousands of

genes in Arabidopsis and Saccharomyces cerevisiae (Wang et al., 2013; Krogan and

Greenblatt, 2001), how Elongator functions in tomato needs further investigation.

Our results bring insights into the function of Elongator in tomato, which expands

the knowledge that was limited to Arabidopsis. Since Elongator plays a pivotal role in

plant immune responses against pathogens, ToELP3 and ToELP4 are potential

candidates for engineering pathogen resistance in tomatoes.

40

Figure 2-1. Amino acid sequence alignments of AtELP3 (At5g50320) and ToELP3

(LOC101246236). The alignment was performed using MUSCLE (3.8). Conserved amino acids are marked with asterisks.

41

Figure 2-2. AtELP3 and ToELP3 nucleotide sequences alignment. The alignment was

conducted using MUSCLE (3.8). Conserved bases are marked with asterisks.

42

Figure 2-3. Amino acid sequence alignments of AtELP4 (At3g11220) and ToELP4

(LOC101253042). The alignment was performed using MUSCLE (3.8). Conserved amino acids are marked with asterisks.

43

Figure 2-4. AtELP4 and ToELP4 nucleotide sequence alignment. The alignment was

done using MUSCLE (3.8). Conserved nucleotides are marked with asterisks.

44

Figure 2-5. Genitic complementation of the Arabidopsis elp mutant morphology. (A)

Morphology comparison of Arabidopsis wild type (WT), Atelp3 mutant and transgenic Atelp3 mutant plants expressing the tomato ELP3 ortholog (Comp (ToELP3)). (B) Morphology comparison of Arabidopsis wild type (WT), elp4 mutant (AtElp4) and a transgenic elp4 plant expressing the tomato ELP4 ortholog (Comp (ToELP4))

45

Figure 2-6. Genetic complementation of NAD+ responsiveness in elp3 using ToELP3.

(A) Psm ES4326 growth in wild type (WT), Atelp3, and Atelp3 plants expressing ToELP3 (Com (ToELP3)). Four-week-old plants were inoculated with Psm ES4326 (optical density at 600nm [OD600] = 0.0001). Data represent the mean of eight independent samples with standard deviation. The different letters show that Psm ES4326 grew significantly more in Atelp3 than in the wild type and elp3 expressing ToELP3 (Fisher’s Protected LSD test, α = 0.05); (B) Exogenous NAD+-induced resistance to Psm ES4326 (optical density at 600nm [OD600] = 0.001) in four-week-old wild type, Atelp3, and Atelp3 expressing ToELP3. Black bars represent Mock-treated control. Data represent the means of eight independent samples with standard deviation. The different letters show that, even with exogenous NAD+ treatment, Psm ES4326 grew significantly more in Atelp3 mutants than in the wild type and Atelp3 expressing ToELP3 (Fisher’s Protected LSD test, α = 0.05); (C) Disease symptoms caused by Psm ES4326 on leaves of four-weeks-old wild type, Atelp3, and Atelp3 plants expressing ToELP3 treated with (+) and without (-) NAD+. Photos were taken 3 days after inoculation.

46

Table 2-1. Primers used in chapter 2

Primers Sequences (5’ to 3’)

XhoI-ToELP3 F CCGCTCGAGATGGCGGCGGCGGCGGTAGC SacI-ToELP3 R CGAGCTCTACACAAGGTTTTTTACCATGTAAG SalI-ToELP4 F ACGCGTCGACATGGCTTCAAGTAGCCGCG SacI-ToELP4 R CGAGCTCTAGAAGTCGAGGTTCCCGG

47

CHAPTER 3 GENERATION OF DISEASE RESISTANCE IN TOMATO USING ARABIDOPSIS

DEFENSE REGULATOR GENES

Introduction

Tomatoes are members of the Solanaceae family and originated in South

America. Tomato fruit was once believed to be poisonous, but its popularity increased

along the years. Nowadays, tomatoes are cultivated and consumed worldwide. The

United States is the second largest tomato producer, and Florida is the number one

state in fresh market tomato production. Tomato production is threatened by a great

number of diseases, including bacterial leaf spot, target spot and bacterial speck.

Bacterial leaf spot is caused by four Xanthomanas spp. and can be devastating to

tomato seedlings. Once established in the crop, the disease is very difficult to control

(Potnis et al., 2015). The fungus, Corynespora cassiicola, causes target spot in tomato

plants. The disease is severe and can cause drastic, premature defoliation (Pernezny et

al., 2003). Tomato crops are constantly threatened by another bacterial disease called

bacterial speck, which is incited by Pseudomonas syringae pv. tomato. The disease

symptoms are very similar to those caused by Xanthomonas spp. Bacterial speck can

cause up to 75% losses in yield, if present in the beginning of the production (Yunis et

al., 1980). Control of all these diseases is primarily based on application of bactericides,

fungicides and sanitary measures, which clearly have not been effective strategies.

Currently, one strategy that is being pursued is to utilize resistance genes from

Arabidopsis and their orthologs in other plants. Arabidopsis is very well established as a

model system, with the complete genome sequenced. Furthermore, many disease

resistance genes have been cloned and characterized, making Arabidopsis a very

suitable source of defense-related genes for engineering resistance in tomato. The

48

Arabidopsis Elongator complex plays an important role in plant immunity, likely by

regulating transcription activation of defense genes. It consists of six subunits, including

ELP1 and ELP2 (scaffolds for complex assembly), ELP3 (catalytic subunit), and an

accessory complex formed by ELP4-ELP6 (Wang et al., 2013). Constitutive

overexpression of the subunits ELP3 and ELP4 in strawberry conferred resistance to

fungal and bacterial diseases (Silva and Mou, unpublished data). Additionally,

enhanced resistance against Pseudomonas spp. was obtained by overexpressing ELP4

in Arabidopsis plants (Ding and Mou, unpublished data). Therefore, Elongator genes

are great candidates for engineering durable resistance in tomato. Genetic engineering

is not a novel technique in tomato crops and Arabidopsis has been used previously as a

source of defense genes for transforming tomato plants. Overexpression of the

Arabidopsis thionin gene, Thi2.1, conferred enhanced resistance against Ralstonia

solanacearum and Fusarium oxysporum (Chan et al., 2005). Tomatoes carrying a key

regulator of systemic acquired resistance (SAR) in Arabidopsis, nonexpressor of

pathogenesis-related (PR) genes1 (NPR1), displayed enhanced resistance to bacterial

wilt and Fusarium wilt (Lin et al., 2004). The disease resistance genes are not limited to

Arabidopsis. The overexpression of the pepper Bs2 resistance gene conferred

enhanced disease resistance in tomato genotypes that are highly susceptible to

Xanthomonas in field trials (Horvath et al., 2012).

Genetically modified (GM) tomato plants with improved resistance to pathogens

would allow for decreased use of bactericides and fungicides, which would result in

reduced production costs and environmental pollution. Genetic engineering technology

has offered new opportunities to tomato breeders and provides a complement to

49

traditional breeding practices. It allows for alteration in endogenous gene expression,

creation of specific or broad-spectrum pathogen resistance, and improvement of

responses to abiotic stresses by using genes from other species with minimum genetic

changes in the recipient tomato plant genome.

We assessed disease resistance of Moneymaker tomato cultivar overexpressing

the Arabidopsis ELP3 (AtELP3) and ELP4 (AtELP4) genes. Our study demonstrates

that the subunits of the Arabidopsis Elongator complex are also positive regulators of

tomato plant immunity. Transgenic homozygous lines overexpressing AtELP4 were

more resistant to the pathogen P. syringae pv. tomato than the non-transformed control.

These results indicate that Arabidopsis Elongator complex genes are viable candidates

for engineering durable resistance in tomato and, very likely, other crops.

Materials and Methods

T-DNA Vector Construction and Plant Transformation

The AtELP3 and AtELP4 coding sequences were isolated from Arabidopsis

thaliana ecotype Col-0 cDNA by polymerase chain reaction (PCR) using specific

primers and were cloned under the control of the 35S promoter of Cauliflower Mosaic

Virus as previously described (Loebenstein et al., 2010). The transgenes were then

cloned into the binary vector pK7WG2D,1, which carries Kanamycin resistance genes,

and was used later for bacterial and plant transformation selection. The binary plasmids

were sent to the University of Nebraska-Lincoln Plant Transformation Facility for genetic

transformation. The tomato cultivar Moneymaker was transformed using the widely

used Agrobacterium-mediated transformation approach (Lin et al., 2004).

50

Identification and Molecular Characterization of Single T-DNA Insertion Homozygous Lines

When transgenic tomato seedlings arrived from the transformation facility,

genomic DNA was extracted from leaves using a protocol modified from Fulton et al.,

(1995). PCR was performed with specific primers to amplify the transgene. Wild-type

Moneymaker plants were used as a control. The T2 transgenic plants were subjected to

genomic DNA extraction and PCR with specific primers to analyze T-DNA insertion

copy numbers based on the expected ratio of 3:1 for a single T-DNA insertion. The

plants that showed resistance and the expected ratio for a single T-DNA insertion were

selected and kept for seed collection after self-pollination. The T3 transgenic lines were

also subjected to genomic DNA extraction and PCR with specific primers to select

homozygous plants for individual transgenic lines.

Disease Resistance Screens of the Transgenic Lines

The selection of diseases was based on its importance and impact on tomato

production. The bacterial diseases selected were bacterial leaf spot caused by

Xanthomonas perforans and bacterial speck caused by Pseudomonas syringae pv.

tomato. The fungal disease selected was target spot caused by Corynespora cassiicola.

Wild-type Moneymaker tomato plants were always included in the evaluations as a

control. Tomato seeds collected from T1 plants were placed in 5 cm pots with potting

mixture and kept in a greenhouse at 28°C. Most of the evaluations were conducted on

T3 and T4 transgenic lines, however, T1 transgenic lines were inoculated with

Xanthomonas perforans.

For bacterial leaf spot disease resistance screen, two types of inoculation were

conducted. The first type of inoculation was leaf infiltration. A suspension of X.

51

perforans strain GEV485 (race T4), adjusted to 103 cfu/ml, was infiltrated with a syringe

into leaflets of 4-week old tomato plants. A total of 6 plants per line were tested and wild

type Moneymaker was included as the control. Inoculated plants were maintained in the

greenhouse at 28ºC. The symptoms were evaluated 7-12 days after inoculation. The

disease assessment consisted of rating scores: 0 indicates no symptom development;

score 1 indicates few slightly visible lesions; score 2 indicates a significant number of

discernible lesions; score 3 indicates a higher amount of discernible necrotic and

chlorotic lesions; score 4 indicates extensive necrotic and chlorotic lesions and

extensive dead tissue. The experiment was repeated at least 3 times. The second type

of inoculation was foliar spray. A suspension of X. perforans GEV485 (race T4),

adjusted to 108 cfu/ml, was sprayed on 4-week old tomato plants. The plants were then

covered with clear polyethylene bags and a rubber band was placed around the bottom,

in order to increase the humidity. The bags were removed after 40 h. A total of 6 plants

per line were tested and wild type Moneymaker was included as the control. The

symptoms were evaluated 7-12 days after inoculation, using the same rating score

described above. This experiment was also repeated at least 3 times.

For target spot disease resistance screen, four known infective isolates were

used. All of which were isolated from tomato. Plugs from a previous culture were placed

on full strength PDA for 7-10 days. The mycelia were removed and the plates were

placed face-up under 24 h constant fluorescent light for 5-7 days. Spores were

harvested with water and Tween 20 (1 drop/100ml) and the suspension was adjusted to

105 spores/ml. Four-week-old tomato plants were sprayed with the suspension and

immediately covered with bags and rubber band, to increase the humidity, for 40 h. A

52

total of 6 plants per line were tested and wild type Moneymaker was included as the

control. The disease symptoms were evaluated 3 days after inoculation. The disease

assessment consisted of rating scores, the same as described above for bacterial spot.

For bacterial speck disease resistance screen, as for X. perforans inoculation,

two inoculation methods were used. A bacterial suspension of P. syringae pv. tomato

strain J4, adjusted to 103 cfu/ml, was infiltrated with a syringe into leaflets of 4-week old

tomato plants. A total of 6 plants per line were tested and wild type Moneymaker was

included as the control. Inoculated plants were incubated in the growth chamber and

maintained at 22ºC (12 hour dark and 12 hour light regiment). The symptoms were

evaluated 3-21 days after inoculation, using the same rating scores as described for

bacterial spot. This experiment was repeated at least 3 times. To evaluate the same

disease with a different inoculation protocol, a suspension of P. syringae pv. tomato

strain J4, adjusted to 108 cfu/ml, was sprayed on 4-week old tomato plants. The plants

were then immediately covered with bags and rubber band, to increase the humidity, for

40 h. A total of 6 plants per line were tested and wild type Moneymaker was included as

the control. Inoculated plants were incubated in the growth chamber and maintained at

22ºC (12 hour dark and 12 hour light regiment). The disease symptoms were evaluated

6 days after inoculation. The disease assessment consisted of rating scores, the same

as described for bacterial spot. This experiment was repeated at least 5 times.

Bacterial Population Dynamics

The population dynamics of P. synringae pv. tomato strain J4 in tomato plants

was monitored. Tomato plants were inoculated by leaf infiltration or foliar spray and

maintained as described above. Leaves were sampled every 48 hr. Three 1-cm2 leaf

discs were obtained from leaflets using a cork-borer. For the leaf infiltration method, the

53

discs were removed from the infiltrated area of leaf. For the spray inoculation method,

the leaves were detached from the same location in every plant and the leaf disks were

cut from the same area in the leaf. Leaf disks were placed into glass tubes and ground

into 1 mL of sterile water. The resulting suspensions were diluted by making 5 ten-fold

dilutions. Dilutions 3-5 were plated on nutrient agar (NA) media and then incubated at

28ºC for 2 days. Colonies that grew on the plates were counted and the bacterial

population was calculated per cm2 of leaf tissue.

Stomatal Conductance Measurements

Stomatal conductance measurements were taken with a portable porometer (LI-

1600; Li-COR), calibrated by the manufacturer. The principal of Li-Cor or a common

porometer is that the time required to force a certain volume of air through the plant leaf

is inversely proportional to leaf stomatal conductance (Rebetzke et al., 2000).

AtELP4 transgenic plants derived from transgenic 61-5 and Moneymaker plants

were sprayed with a P. syringae pv. tomato bacterial suspension, adjusted to 108 cfu/ml.

Stomatal measurements were taken before inoculation and every 30 min after

inoculation. Ten fully expanded leaves per plant were used for all measurements at

each time point, with readings from the abaxial side of the leaves.

Transgene and PR Gene Expression

Transgene expression was analyzed in T4 transgenic lines. Total RNA was

extracted from tomato transgenic plants using Trizol reagent (Invitrogen) and treated

with RNAse-free DNAse I (Thermo Fisher). First strand complementary DNA was

synthetized using 10 µg of total RNA with oligo (dT) primer and Moloney murine

leukemia virus reverse transcriptase (Invitrogen). Primers were designed based on the

available sequence at GenBank. Real-time quantitative PCR (qPCR) was performed

54

using ABsolute SYBR Green PCR master mix (Thermo Fisher). The relative mRNA

levels of the transgene and PR genes were expressed in relation to the tomato actin

gene, and calculated using the 2-∆CT method (Livak and Schmittgen 2001; Sehringer et

al., 2005).

Statistical Analysis

Data were analyzed by fitting a generalized linear mixed model using the

statistical software SAS, and means were separated by Fisher’s Protected LSD test (α =

0.05).

Results

Molecular and Morphological Characterization of the Transgenic Lines

We received 80 transgenic tomato plants containing AtELP3 or AtELP4 from the

University of Nebraska-Lincoln Plant Transformation Facility. All transgenic plants were

analyzed by PCR, using specific primers that amplify AtELP3 and AtELP4, to confirm

the integration of the transgene into the genome of the transgenic plants. The T-DNA

insertions were also confirmed by sequencing. Out of 80 transgenic plants, 71

transgenic plants presented bands on agarose gel and contained the full length of

AtELP3 or AtELP4. The T-DNA insertions were not detected in wild type Moneymaker

plants. The transgenic lines with T-DNA insertion were kept for seed production (Figure

3-1).

A genomic PCR assay was further used to analyze the transgene segregation

ratio in T2, and to determine homozygosity in the T3 generation. Five homozygous lines

were selected for AtELP3 and four homozygous lines for AtELP4. All the transgenic

lines formed flowers and fruits. There were no significant differences in plant height

among transgenic plants or between transgenic plants and Moneymaker plants (p-value

55

0.6050) (Figure 3-2A). Differences in fruit weight were observed both among transgenic

plants (p-value 0.0001) and between transgenic plants and the wild type Moneymaker

(Figure 3-2B). The homozygous transgenic line, 61-5, carrying AtELP4, had slightly

larger fruits than other transgenic lines and the wild type; and 44-2 carrying AtELP3 had

the smallest. The smallest fruit were very similar to the ones produced by the cherry

tomato variety, so there is the possibility of seed contamination during transgenic

development. The overall morphology and development of the transgenic plants and

fruits were very similar to the wild type under standard greenhouse conditions (Figure 3-

2C and 3-3), suggesting that AtELP3 and AtELP4 may not affect tomato plant

development.

Disease Resistance Screens of the Transgenic Lines

To evaluate whether constitutive overexpression of AtELP3 or AtELP4 in tomato

plants is able to activate defense responses, we evaluated resistance of the transgenic

lines to three different diseases that affect tomato crops. Two diseases caused by

bacteria and one caused by a fungus were selected for this evaluation. The transgenic

homozygous lines were subjected to disease screens, and responses were assessed

according to the severity of disease symptoms, to determine whether AtELP3 and

AtELP4 transgenic lines displayed increased levels of resistance.

The bacterial leaf spot disease symptoms, characterized by necrotic lesions,

were observed 7 days after inoculation on all transgenic plants and the control. The

disease symptoms displayed by the transgenic homozygous lines carrying AtELP3 or

AtELP4 did not differ from those of the wild type for either inoculation method (leaf

infiltration and foliar spray) (Figure 3-4A and 3-4B). In two greenhouse experiments,

56

none of the transgenics containing AtELP3 or AtELP4 showed noticeable resistance

against Xanthomonas.

The target spot disease symptoms, characterized by necrotic lesions with light

brown centers with dark margins, were observed 3 days after inoculation on all

transgenic plants and the control plants. The disease symptoms displayed by the

transgenic homozygous lines carrying either AtELP3 or AtELP4 did not differ from those

of the wild type (Figure 3-5). Thus, AtELP3 or AtELP4 were not able to induce

resistance in tomato against Corynespora under standard greenhouse conditions.

The bacterial speck disease symptoms, characterized by small, black or brown

necrotic lesions surrounded by a chlorotic halo, were observed 3 days after inoculation

on all plants for both inoculation methods (leaf infiltration and foliar spray). The disease

symptoms and bacterial ttiters displayed by the control and the transgenic lines were

very similar when P. syringae pv. tomato was infiltrated with a syringe into the leaflets

(Figure 3-6 and 3-7), but symptoms differed drastically when the bacterial suspension

was sprayed (Figure 3-8). When the plants were spray inoculated with bacterial

suspension, AtELP4 transgenic homozygous lines 61-5 and 23-1 showed low and

moderate disease severity, respectively, compared to the control and other transgenic

lines (Figure 3-8). AtELP3 transgenic lines displayed symptoms very similar to the

control. AtELP4 transgenic line 61-5 displayed low disease severity when compared to

control and other transgenic lines, even 21 days after inoculation (Figure 3-9). AtELP4

transgenic lines 61-5 and 23-1 also presented better disease reaction scores when

compared to the AtELP3 transgenic lines and the control (Figure 3-9B). However,

differences in disease symptoms were not observed when the bacterial suspension was

57

infiltrated with a syringe into the plant leaflets (Figure 3-6). The results were very similar

when the experiments were repeated multiple times. We further analyzed bacterial

growth (colony forming unit – CFU) in the infected plant tissues to confirm enhanced

resistance displayed by the transgenic lines when spray inoculation method was

employed. As expected, bacterial growth in the infiltrated plant tissue did not show a

significant difference for any of the lines carrying AtELP4 or AtELP3, when compared to

the control (Figure 3-7). However, after spray inoculation, two AtELP4 transgenic lines

(61-5 and 23-1) had significantly lower bacterial titers compared to the control and other

transgenic lines (Figure 3-10A), corroborating the disease symptoms and scores rating

(Figure 3-8 and 3-9B). The AtELP3 transgenic line, 51-9, displayed lower bacteria

growth when compared to the control (Figure 3-9B), but higher than the AtELP4

transgenic lines 61-5 and 23-1. The transgenic line 61-5 displayed the lowest bacteria

growth per ml as well as lower disease symptoms scores compared to other AtELP4

and AtELP3 transgenic lines and the control (Figure 3-8 and 3-9A). Transgenic line 23-1

displayed lower bacterial populations per ml when compared to the control, but higher

populations compared to 61-5 (Figure 3-9A). These results indicate that the

homozygous AtELP4 transgenic lines 61-5 and 23-1 were more resistant to

Pseudomonas than other AtELP4 and AtELP3 transgenic lines and the control. Overall,

AtELP4 transgenic lines responded better when challenged with Pseudomonas

compared to AtELP3 transgenic lines and the wild type control tomato. These

experiments were repeated at least five times with similar results.

Stomata Conductance

To investigate whether the difference in disease symptoms and bacterial growth

between inoculation methods was due to differences in stomatal conductance, we used

58

an instrument named Li-Cor (Bioscience) to measure the conductance. Overall, there

was no significant difference in stomatal conductance between the AtELP4 transgenic

line 61-5 and the control at most of the time points, before or following spray inoculation

with P. syringae pv. tomato (Figure 3-11A). Stomata morphology was also assessed

under optical microscope; however, no differences were observed (Figure 3-11B).

Transgene and PR Gene Expression

AtELP3 and AtELP4 transgene expression in the homozygous T4 tomato lines

were analyzed by qPCR using specific primers. AtELP3 and AtELP4 were expressed at

varied levels among homozygous transgenic lines (Figure 3-12A and 3-12B), but at very

low levels in the wild type plants. Based on the AtELP3 transcript levels detected by

qPCR, the transgenic lines could be classified into transgene expresser groups: one

high transgene expresser (Line 51-9), two medium transgene expressers (Lines 60-5

and 56-9), and two low transgene expressers (Lines 44-2 and 51-2). The two low

expressers presented similar levels of transcripts when compared to the wild type

(Figure 3-12A). The higher AtELP3 transgene expresser line 51-9 displayed lower

bacteria growth, suggesting that moderate resistance to Pseudomonas might be

correlated to the level of AtELP3 transgene expression. The results obtained were

similar when the experiment was repeated. Based on the AtELP4 transcript levels

detected by qPCR, the AtELP4 transgenic lines could also be classified into transgene

expresser groups: one high transgene expresser (Line 28-6), two medium transgene

expressers (Lines 61-5 and 23-1), and one low transgene expressers (Line 37-3). The

low expresser presented similar levels of transcripts when compared to the wild type

(Figure 3-12B). Enhanced resistance to Pseudomonas in the AtELP4 homozygous

transgenic lines seems not to correlate with transgene expression levels. For instance,

59

the high transgene expresser line 28-6 did not display resistance to Pseudomonas, but

rather the medium transgene expressers 61-5 and 23-1 displayed enhanced disease

resistance. Similar results were obtained when the experiment was repeated.

Since AtELP4 transgenic lines displayed enhanced resistance to Pseudomonas

compared with AtELP3 transgenic lines, we investigated whether AtELP4 leads to

stronger induction of defense genes after pathogen inoculation. We assessed

expression of tomato PATHOGENESIS-RELATED1 (PR1) gene after spray inoculation

with Pseudomonas in the AtELP4 homozygous transgenic lines by qPCR with specific

primers. PR1 gene expression increased 24 h after inoculation in wild type, as expected

(Figure 3-12C). PR1 genes expression seems to correlate with the level of AtELP4

transgene expression for the transgenic lines 61-5, 23-1 and 37-3, but not for the

transgenic line 28-6, which displayed high transgene expression, but low PR1 gene

expression. In addition, PR1 gene expression seems not to increase in the most

resistant and the moderate resistant transgenic lines, 61-5 and 23-1, respectively, 24 h

after spray inoculation with Pseudomonas.

Discussion

This work focused on an imminent issue within tomato production, specifically

bacterial speck, caused by P. syringae pv. tomato. This is an important disease in the

US, which is one of the world's biggest tomato producers. Because tomatoes are

susceptible to a broad spectrum of diseases, the amount of chemical inputs required to

protect them from pests and diseases add significantly to the cost of production.

We investigated the potential of Arabidopsis defense-related genes for

improvement of disease resistance against Pseudomonas in tomato. The Arabidopsis

Elongator genes were chosen as the candidates for tomato transformation, as their

60

effectiveness in mediating resistance to bacterial diseases has previously been

demonstrated in Arabidopsis (DeFraia et al., 2013; An et al., 2016) and strawberry

(Silva and Mou, unpublished data). Additionally, given that the Elongator genes have

not been shown to be involved in gene-for-gene interactions or specific recognition of

the pathogen, the possibility of the pathogen’s ability to overcome the resistance is

unlikely, which is critical for generating durable resistance in crop plants.

The aim of this work was to investigate the disease susceptibility of selected

AtELP3 and AtELP4 homozygous tomato lines under standard greenhouse conditions.

Most publications on transgenic trials report data on heterozygous lines. Here, we

generated nine homozygous single-insertion transgenic lines with normal horticultural

traits. Although Arabidopsis Elongator mutants usually display abnormal phenotypes

(Nelissen et al., 2003), overexpression of AtELP3 and AtELP4 in tomato did not cause

any abnormality. Overall, all transgenic lines displayed morphological and

developmental traits similar to the wild type, excepting the line 44-2. Since our aim was

to use Arabidopsis Elongator genes for generating tomato plants with long-lasting

disease resistance, we performed disease resistance screens to determine the degree

of resistance promoted by the Elongator genes. Two AtELP4 transgenic lines (61-5 and

23-1) displayed varied levels of resistance to bacterial speck under standard

greenhouse conditions. In both lines, the bacterial populations were significantly lower

over a 21 day period than those in the control. Consistently, the disease symptoms on

the transgenic lines were also dramatically alleviated. These results suggest that

overexpression of AtELP4 in tomato is able to enhance resistance to P. syringae pv.

tomato. Our results support the effectiveness of Arabidopsis Elongator genes in

61

enhancement of resistance against bacterial disease in plants, as previously described

in transgenic Arabidopsis and strawberry (Ding, Silva and Mou, unpublished data).

Interestingly, increased disease resistance was not observed when the bacteria

solution was infiltrated into the apoplast of the transgenic lines. This suggested that

AtELP4 might improve stomatal immunity in tomato. It is well known that P. syringae

pathovars produce coronatine, which promotes stomatal reopening and bacterial growth

in plant tissues (Zheng et al., 2012). We therefore investigated if stomatal morphology

and conductance are affected in the most resistant transgenic line 61-5. Surprisingly, no

clear differences in stomatal morphology and conductance were detected between 61-5

and the control. Further investigation is clearly warranted to understand the

mechanisms underlying the observed resistance in the AtELP4 transgenic lines.

Despite the transgene is driven by the same constitutive promoter, transgene

expression levels in independent transgenic lines varied considerably, as has been

observed previously in tomato transgenic plants (Lin et al., 2004). The expression levels

of the transgene and the PR1 gene did not correlate with disease resistance against

Pseudomonas. The lack of correlation between disease resistance and transgene

expression levels was previously reported in transgenic tomatoes carrying the

Arabidopsis NPR1 gene (Lin et al., 2004) and transgenic strawberry expressing AtELP3

and AtELP4 (Silva and Mou, unpublished data).

The Elongator complex consists of six subunits and mutations in any of the

subunits compromise the complex’s function (Glatt et al., 2012). This raises the

question as to why overexpression of only one subunit would be enough to confer

resistance. Apparently, the absence of any subunit affects the function of the whole

62

complex; however, each subunit might have an independent role. It has been reported

that only mutations in the Elongator core subcomplex, but not in the accessory

subcomplex, lead to abscisic acid hypersensitivity and stomatal closure (Zhou et al.,

2009). Thus, independent roles for each subunit might be a possibility. Further studies

are necessary to understand the underlying molecular mechanisms.

In summary, we show that overexpression of AtELP4 in tomato provided

resistance to the bacterial pathogen P. syringae pv. tomato, but not to X. perforans or

the fungal pathogen C. cassiicola under standard greenhouse conditions. Field

performance of the transgenic lines against these pathogens will need to be evaluated.

Nevertheless, the transgenic tomato lines generated in this work could potentially be

used for breeding resistance to P. syringae pv. tomato. Additionally, AtELP4 may be

combined with other defense-related genes in further breeding for disease resistance.

63

Figure 3-1. PCR analysis with specific primers to detect the AtELP3 and AtELP4

transgenes, respectively. SNT1: AtELP3; SNT2: AtELP4.

64

Figure 3-2. Horticultural traits of the transgenic plants. (A) Plant height and (B) fruit weight. Data represent the average of 6 replicates with SD. Different letters above the bars indicate significant differences (Fisher’s Protected LSD test, α=0.05). (C) Developmental phenotypes of the homozygous transgenic tomato lines expressing AtELP3 (E3) or AtELP4 (E4) and the control (WT).

65

Figure 3-3. Fruits produced on transgenic tomato plants expressing AtELP3 (E3) or AtELP4 (E4) and the control (WT).

66

Figure 3-4. Disease symptoms caused by X. perforans pv. tomato on the control (WT)

and the transgenic lines carrying AtELP3 (E3) or AtELP4 (E4). Photos were taken 7 days after inoculation by leaf infiltration (A) and foliar spray (B).

67

Figure 3-5. Disease symptoms caused by C. cassiicola on the control and transgenic lines carrying AtELP3 or AtELP4. Symptoms on plants were photographed 3 days after inoculation.

Figure 3-6. Disease severity on the control (WT) and transgenic lines carrying AtELP4 (E4) and AtELP3 (E3) following infiltration of leaflets with a bacterial suspension (103 cfu/ml) of P. syringae pv. tomato. Photos were taken 7 days after inoculation.

68

Figure 3-7. Growth of P. syringae pv. tomato in transgenic tomato plants inoculated by leaf infiltration. (A) Bacterial populations were quantified by measuring colony forming units (CFU) following infiltration with a bacterial suspension (103 cfu/ml) of P. syringae pv. tomato in the control (WT) and the transgenic lines carrying AtELP4. Data represent the mean of three biological replicates with standard deviation. Different letters above the bars indicate significantly differences by Fisher’s Protected LSD test (α=0.05). (B) Bacterial populations were quantified by measuring CFU following infiltration with a bacterial suspension (103 cfu/ml) of P. syringae pv. tomato in the control (WT) and the transgenic lines carrying AtELP3. Data represent the mean of three biological replicates with standard deviation. Different letters above the bars indicate significantly differences by Fisher’s Protected LSD test (α=0.05).

69

Figure 3-8. Disease symptoms on the control (WT) and transgenic lines carrying AtELP4 (E4) and AtELP3 (E3). The plants were sprayed with a suspension (108 cfu/ml) of P. syringae pv. tomato and covered with plastic bag. Photos were taken 6 days after inoculation.

70

Figure 3-9. Disease symptoms progression and rating. (A) Bacterial speck disease

progression on control (WT) and the most resistant transgenic line 61-5 carrying AtELP4 following spray inoculation of leaflets. (B) Bacterial speck disease assessment on all the lines following spray inoculation of leaflets. (C) Bacterial speck disease assessment. The rating scores consisted of: 0 = no symptoms; 1 = few slightly visible lesions; 2 = significant number of discernible lesions; 3 = higher amount of discernible necrotic and chlorotic lesions; 4 = extensive necrotic and chlorotic lesions and extensive dead tissue.

71

Figure 3-10. Growth of P. syringae pv. tomato in transgenic tomato plants inoculated by foliar spray. (A) Colony forming unit (CFU) in the control (WT) and the transgenic lines carrying AtELP4. Data represent the mean of 3 biological replicates with standard deviation. Different letters above the bars indicate significant differences by Fisher’s Protected LSD test (α=0.05). (B) CFU in the control (WT) and the transgenic lines carrying AtELP3. Data represent the mean of 3 biological replicates with standard deviation. Different letters above the bars indicate significant differences by Fisher’s Protected LSD test (α=0.05).

72

73

Figure 3-11. Stomatal conductance and morphology. (A) Stomatal conductance (mol m-

2s-1) in the AtELP4 transgenic line 61-5 and the control (WT). The assessment was done every 30 min after spray inoculation with P. syringae pv. tomato. Data represent the mean of five biological replicates with standard deviation. Different letters above the bars indicate significant differences by Fisher’s Protected LSD test (α = 0.05). (B) Stomatal morphology of the AtELP4 transgenic line 61-5 and the control (WT). Photos were taken using an optical microscope.

74

Figure 3-12. Expression levels of the transgenes and PR1 in the transgenic lines. (A) Expression levels of AtELP3 in AtELP3 transgenic lines. (B) Expression levels of AtELP4 in AtELP4 transgenic lines. (C) PR1 gene induction in several AtELP4 transgenic lines. Gene expression was estimated by qPCR. The tomato actin gene was used as the internal control. In (C), plants were inoculated by foliar spray with a suspension of P. syringae pv. tomato (108 cfu/ml). Data represent the mean of 3 biological replicates with standard deviation. Different letters above the bars indicate significant differences by Fisher’s Protected LSD test (α = 0.05).

Table 3-1. Primers used in chapter 3

Primers Sequences (5’ to 3’)

35SF ACCACGTCTTCAAAGCAAGTG AtELP3R GCGGTCGACTCAAAGAAGATGCTTCACCATGTAAG AtELP4F AAGAGGATAAGCCTACTGCG AtELP4R TCCGGATTTGGATGAGCAGC ToActinR TCGGTGAGGATATTCATCAGGTT ToActinF TTGCCGCATGCCATTCT qAtELP3R ACACTGGATATGAGCCTACC qAtELP3F ACTCAGCAGGCAGTGACATG qAtELP4R CTTTGGATGATGCAGGATGC qAtELP4F ATGGAAGATCCTGAAGCACC qToPR1R AGTTGCCTACAGGATCGT qToPR1F CGCTACCAACCAATGTGTTG

75

CHAPTER 4 GENERATION OF TRANSGENIC TOMATO PLANTS WITH THE TOMATO

ORTHOLOGS OF THE ARABIDOPSIS ELONGATOR GENES

Introduction

Genetic engineering can be an effective alternative to conventional methods to

increase a plant’s ability to protect itself from pathogen infection. From the growers’

perspective, fulfilling the food demand of the world population with limited natural

resources is a hard task. Growers face many challenges in maintaining productivity

under fluctuating circumstances, such as climate changes, reduction of area for

agriculture and increase of food demand. Advances in science provided the possibility

of facing these challenges by means of genetic engineering. Genetic engineering for

disease-resistance through transfer of plant defense-related genes into crops is

potentially beneficial in terms of cost, efficacy and reduction of pesticide usage. In India,

the use of genetically modified cotton for disease resistance increased crop yield per

acre by 24% and profit by 50% (Kathage and Qaim, 2012). Planting genetically

engineered crops in 2005 has led to an increased production of 8.3 billion pounds, while

crop production costs decreased by 1.4 billion US dollars and pesticide use dropped by

69.7 million pounds. In turn, growers had their net return improved by $2.0 billion in

2005 (Sankula, 2006).

Tomato is a very profitable but costly crop to produce worldwide. This cost is due

to the labor and chemical inputs required to protect tomato from a wide variety of pests

and diseases. Generation of transgenic tomato plants with resistance to pathogens is a

promising alternative to conventional disease management methods. However, GMO

(genetically modified organism) has faced difficulties in public acceptance. GMOs are

also frequently associated with environmental damage, because of the concern about

76

seed contamination and health issues due to the presence of “foreign” DNA in food.

Besides, the estimation of the total cost for authorization of a new transgenic crop is

around one hundred thirty-five million US dollars (Clive, 2012), which is a barrier for

making them available in the market. These limitations have forced scientists to

promote alternative technologies, such as cisgenesis and intragenesis. While

cisgenesis consists of genetic modifications using natural genes with their regulatory

elements that belong exclusively to plants that can crossbreed, intragenesis allows

transfer of new combinations of genes and regulatory sequences belonging to plants

that are sexually compatible (Schouten et al., 2006; An et al., 2013). These methods are

favorable alternatives for better acceptance in the market. ToELP3 and ToELP4, the

tomato orthologs of AtELP3 and AtELP4, respectively, are biologically active and may

be used in cisgenesis and/or intragenesis to improve disease resistance in tomato. Here

we tested if overexpression of ToELP3 or ToELP4 improves disease resistance in

tomato.

Material and Methods

Binary Vector Construction and Plant Transformation

Total RNA was isolated from Moneymaker tomato leaves using the TRIzol®

method (Invitrogen). Gene-specific primers were used to amplify the coding regions of

ToELP3 and ToELP4 from total cDNA. The PCR products were digested with restriction

enzymes XhoI and SacI for ToELP3, and SalI and SacI for ToELP4, and ligated into the

corresponding sites of the vector pBI1.4 T, resulting in the T-DNA plasmids pBI1.4 T-

35S::ToELP3 and pBI1.4 T-35S::ToELP4.

Agrobacterium-mediated transformation was performed on tomato cotyledon

explants of 8-day-old seedlings as described by Fillatti et al., (1987). Kanamycin at 50

77

g/L in medium was used to select transfomants during tissue culture. The tomato

variety used for transformation was Moneymaker. All the transformed plants were

subjected to PCR with specific primers to confirm transformants.

Disease Resistance Test

The bacterial disease, bacterial speck, caused by Pseudomonas syringae pv.

tomato was selected based on results obtained from transgenic lines carrying the

Arabidopsis Elongator genes. Tomato seeds collected from T1 plants were placed in 5-

cm diameter pots containing potting soil and kept in greenhouse at 28°C. Most of the

evaluations were conducted on T2 transgenic lines.

For resistance test, a suspension of P. syringae pv. tomato strain J4, adjusted to

108 cfu/ml, was sprayed on 4-week-old tomato plants. The plants were immediately

placed in bags for 37 h with a rubber band to maintain humidity. Wild-type Moneymaker

was included as the control. The disease symptoms were evaluated 6 days after

inoculation, using the score rating system described above.

Bacterial Population Dynamics

After foliar spray inoculation, the plants were immediately covered with clear

polyethylene bags and a rubber band was placed around the bottom of the bag to

maintain high humidity for 37 h. Inoculated plants were incubated in a growth chamber

and maintained at 22ºC (12 hour dark and 12 hour light period). Leaves were sampled 6

days after inoculation. Three leaf discs of 1 cm2 each were obtained from leaflets using

a cork-borer. The leaves were detached from the same place in every plant and the leaf

discs were cut from the same area. Leaf disks were placed into glass tubes and ground

in 1 mL of sterile water. The resulting suspensions were diluted by making five 10-fold

dilutions. The last 3 dilutions were plated on nutrient agar media and then incubated at

78

28ºC for 2 days. Colonies that grew on the plates were counted and the bacterial

population was calculated in per cm2 of leaf tissue.

Results

Molecular and Morphological Characterization of the Transgenic Lines

To constitutively overexpress ToELP3 and ToELP4 genes in tomato plants, two

independent binary plasmids were constructed. The ToELP3 and ToELP4 coding

regions were put under the control of the CaMV 35S promoter and kanamycin

resistance was used to screen transformants. Explants carrying ToELP4 were delayed

in callus formation and did not remain at the end of the tissue culture process. The

reason for the unsuccessful transformation of ToELP4 is unknown.

Three independent T1 lines carrying ToELP3 were generated and named

ToELP3 1, ToELP3 2, and ToELP3 3. All lines were kept under standard greenhouse

conditions for seed production. Plants of line ToELP3 2 develop thicker leaves

compared with the other two lines and the wild type. The transgenic plants displayed

horticultural traits different to those of the wild-type. All transgenic lines formed flowers

and fruits. The fruits were similar in size to the wild-type, but half of the transgenic fruits

contained no seeds or aborted seeds (Figure 4-1). For this reason, the number of T2

plants from each transgenic line was limited. A total of 26 T2 plants were obtained: 9

from ToELP3 1, 2 from ToELP3 2, and 15 from ToELP3 3. All transgenic plants were

analyzed by PCR, using specific primers that amplify part of the 35S promoter, to

confirm the integration of the transgene into the genome of the transgenic plants (Figure

4-2). Water and genomic DNA samples from Moneymaker tomato as well as

Arabidopsis were used as the negative controls and DNA from the AtELP3 transgenic

79

line 51-9 described in Chapter 3 was used as the positive control,since it carry the 35S

promoter gene.

Disease Reaction Based on Disease Severity and Population Dynamics Following Inoculation with P. syringae pv. tomato

We evaluated resistance of the transgenic lines to P. syringae pv. tomato. The 26

T2 plants from the three independent transgenic lines and three wild-type plants were

subjected to P. syringae pv. tomato infection to determine whether ToELP3 transgenic

lines possess increased levels of resistance.

Bacterial speck disease symptoms, characterized by small, black or brown

necrotic lesions surrounded by a chlorotic halo, were observed in all plants 3 days after

inoculation. While the three wild-type control plants exhibited the most severe disease

symptoms, the disease severity on the 26 T2 plants varied significantly. Some (8)

ToELP3 lines displayed less severe symptoms when compared with wild-type (Figure 4-

3, 4-4, 4-5). When the bacterial titers (colony forming unit – CFU) in the infected plant

tissues were determined 6 days after inoculation, some (11) of the transgenic plants

displayed a significantly lower bacterial titer than the control, while titers in the other 15

plants were not significantly different from WT (Figure 4-6). This preliminary result

suggests that ToELP3 may enhance resistance to P. syringae pv. tomato when

overexpressed in tomato. However, this experiment must be repeated in order to obtain

more convincing results.

Discussion

Genetic engineering is an effective and sustainable alternative to face modern

challenges in agriculture. However, the public is increasingly concerned about the

association between genetically engineered food and human health. The recently

80

developed cisgenic and intragenic technologies appear to have better public

acceptance. These technologies rely on the use of sequences belonging to plants that

can crossbreed, which avoids the use of “foreign” DNA in the crop (Schouten et al.,

2006; An et al., 2013). Since ToELP3 and ToELP4 are biologically functional, they

could be used to improve tomato disease resistance via cisgenic and/or intragenic

approaches.

In this study, we investigated whether ToELP3 and ToELP4 are suitable

candidate genes for improvement of disease resistance against Pseudomonas in

tomato. The Arabidopsis Elongator genes have been shown to enhance disease

resistance in Arabidopsis (DeFraia et al., 2013; An et al., 2016), strawberry (Silva and

Mou, unpublished data), and tomato (Chapter 3). Our preliminary results show that

overexpression of ToELP3 in tomato may also increase resistance to the bacterial

pathogen P. syringae pv. tomato. However, since only three independent transgenic

lines expressing ToELP3 were generated and a small number of T2 plants were tested,

we need to generate more independent transgenic lines and characterize these lines

through multiple generations to confirm these preliminary results.

In summary, although further experiments are needed, ToELP3 seems to be able

to confer enhanced disease resistance when overexpressed in tomato. Thus, ToELP3

could potentially be a good candidate gene for cisgenesis and/or intragenesis that have

been designed to increase public acceptance in the market.

81

Figure 4-1. Morphology of the fruits produced on ToELP3 transgenic plants. (A) Fruits

produced on transgenic tomato plants expressing ToELP3 and the control (WT). (B) The cross section of a transgenic fruit carrying aborted seeds.

Figure 4-2. PCR analysis with specific primers detecting the 35S promoter. WT: the

wild-type Moneymaker control; Col: Arabidopsis ecotype Columbia; pos. control: 35S::AtELP3 line 51-9.

82

Figure 4-3. Comparison of bacterial speck disease symptoms on the wild-type (WT)

Moneymaker and the transgenic line ToELP3 1-2. Photos taken 6 days after spray inoculation with a bacterial suspension (108 cfu/ml) of P. syringae pv. tomato.

83

Figure 4-4. Comparison of bacterial speck disease symptoms on the wild-type (WT) Moneymaker and the transgenic line ToELP3 2-2. Photos taken 6 days after foliar spray inoculation with a bacterial suspension (108 cfu/ml) of P. syringae pv. tomato.

84

Figure 4-5. Comparison of bacterial speck disease symptoms on the the wild-type (WT)

Moneymaker and the transgenic line ToELP3 3-14. Photos taken 6 days after spray inoculation with a bacterial suspension (108 cfu/ml) of P. syringae pv. tomato.

85

Figure 4-6. Growth of P. syringae pv. tomato in transgenic tomato expressing ToELP3.

Bacterial populations in the control (WT) and the ToELP3 transgenic plants were quantified by quantifying colony forming units (CFU) following spray inoculation with a bacterial suspension (108 cfu/ml) of P. syringae pv. tomato. Data represent the mean of three biological replicates with standard deviation. Different letters above the bars indicate significantly differences by Fisher’s Protected LSD test (α=0.05).

Table 4-1. Primers used in chapter 4

Primers Sequences (5’ to 3’)

35SF GCTCCTACAAATGCCATCA 35SR GATAGTGATTGTTGCGTCA

86

CHAPTER 5 SUMMARY AND CONCLUSION

This work addresses eminent issues in tomato production. Tomato is an

important crop worldwide and the US is one of the world's largest producers of tomato.

This work also addresses issues in the broad topic of the role played by the Arabidopsis

genes in tomato in response to pathogens. Tomato is produced and consumed all over

the world. But it is a costly crop, due to the labor and the amount of chemical inputs

required to protect tomato from pests and diseases.

This work aimed to provide insights that will likely lead to long-range

improvement and sustainability of tomato crops with durable disease resistance. Stable

resistance to diseases, even though difficult to find, is the most economical, effective,

and environmentally sustainable crop protection strategy in most cropping systems.

Owing to the lack of effective methods to control diseases in tomato, it is clear that

genetic engineering is a crucial strategy in the attempt to protect crop production.

Generation of transgenic tomato with long-lasting disease resistance is a promising

alternative to conventional methods of breeding.

In this study, we attempted to overexpress the Arabidopsis AtELP3 and AtELP4

genes in tomato to improve disease resistance. We found that overexpression of

AtELP4 in tomato resulted in enhanced resistance to Pseudomonas syringae pv.

tomato. Furthermore, we showed that ToELP3 and ToELP4, the tomato orthologs of

AtELP3 and AtELP4, respectively, complemented the morphological and defense

phenotypes of the Arabidopsis elp3 and elp4 mutants, respectively. Additionally, our

preliminary results show that overexpression of ToELP3 in tomato likely conferred

enhanced resistance when the transgenic plants were challenged with P. syringae pv.

87

tomato. These results indicate that ToELP3 and ToELP4 are functional and could

potentially be used in cisgenesis and/or intragenesis to improve tomato disease

resistance. Additionally, since research on Elongator primarily has been conducted in

Arabidopsis, this work should provide more information for better understanding the

function of the Elongator complex in plants.

88

LIST OF REFERENCES

Adams-Phillips, L., Briggs, A. G., and Bent, A. F. 2010. Disruption of poly(ADP-ribosyl)ation mechanisms alters responses of Arabidopsis to biotic stress. Plant Physiol 152:267-280.

Agrios, G. N. 1988. Plant Pathology. 3rd ed. Elsevier Science, Oxford.

Altpeter, F., Springer, N. M., Bartley, L. E., Blechl, A. E., Brutnell, T. P., Citovsky, V., Conrad, L. J., Gelvin, S. B., Jackson, D. P., Kausch, A. P., Lemaux, P. G., Medford, J. I., Orozco-Cardenas, M. L., Tricoli, D. M., Van Eck, J., Voytas, D. F., Walbot, V., Wang, K., Zhang, Z. J., and Stewart, C. N., Jr. 2016. Advancing crop transformation in the era of genome editing. Plant Cell 28:1510-1520.

An, C., Ding, Y., Zhang, X., Wang, C., and Mou, Z. 2016. Elongator plays a positive role in exogenous NAD-induced defense responses in Arabidopsis. Mol Plant Microbe Interact 29:396-404.

An, C., and Mou, Z. 2011. Salicylic acid and its function in plant immunity. J Integr Plant Biol 53:412-428.

An, C., and Mou, Z. 2012. Non-host defense response in a novel Arabidopsis-Xanthomonas citri subsp. citri pathosystem. PLoS One 7:e31130.

An, C., Orbović, V., and Mou, Z. 2013. An efficient intragenic vector for generating intragenic and cisgenic plants in citrus. American Journal of Plant Sciences 04:2131-2137.

Anderson, S. L., Coli, R., Daly, I. W., Kichula, E. A., Rork, M. J., Volpi, S. A., Ekstein, J., and Rubin, B. Y. 2001. Familial dysautonomia is caused by mutations of the IKAP gene. Am J Hum Genet. 68:753-758.

Bruzzone, S., Moreschi, I., Guida, L., Usai, C., Zocchi, E., and De Flora, A. 2006. Extracellular NAD+ regulates intracellular calcium levels and induces activation of human granulocytes. Biochem J. 393:697-704.

Campbell, M. A., Fitzgerald, H. A., and Ronald, P. C. 2002. Engineering pathogen resistance in crop plants. Transgenic Res. 11:599-613.

Cao, H., Glazebrook, J., Clarke, J. D., Volko, S., and Dong, X. 1997. The Arabidopsis NPR1 gene that controls systemic acquired resistance encodes a novel protein containing ankyrin repeats. Cell 88:57-63.

Chan, Y. L., Prasad, V., Sanjaya, Chen, K. H., Liu, P. C., Chan, M. T., and Cheng, C. P. 2005. Transgenic tomato plants expressing an Arabidopsis thionin (Thi2.1) driven by fruit-inactive promoter battle against phytopathogenic attack. Planta 221:386-393.

89

Chen, Z., Zhang, H., Jablonowski, D., Zhou, X., Ren, X., Hong, X., Schaffrath, R., Zhu, J. K., and Gong, Z. 2006. Mutations in ABO1/ELO2, a subunit of holo-Elongator, increase abscisic acid sensitivity and drought tolerance in Arabidopsis thaliana. Mol. Cell. Biol. 26:6902-6912.

Clough, S. J., and Bent, A. F. 1998. Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J. 16:735-743.

Creelman, R. A., and Mullet, J. E. 1997. Oligosaccharins, brassinolides, and jasmonates: nontraditional regulators of plant growth, development, and gene expression. Plant Cell 9:1211-1223.

Creppe, C., Malinouskaya, L., Volvert, M. L., Gillard, M., Close, P., Malaise, O., Laguesse, S., Cornez, I., Rahmouni, S., Ormenese, S., Belachew, S., Malgrange, B., Chapelle, J. P., Siebenlist, U., Moonen, G., Chariot, A., and Nguyen, L. 2009. Elongator controls the migration and differentiation of cortical neurons through acetylation of alpha-tubulin. Cell 136:551-564.

Cuppels, D. A., and Ainsworth, T. 1995. Molecular and Physiological characterization of Pseudomonas syringae pv. tomato and Pseudomonas syringae pv. maculicola strains that produce the phytotoxin coronatine. Appl. Environ. Microbiol. 61:3530-3536.

Dangl, J. L., and Jones, J. D. 2001. Plant pathogens and integrated defence responses to infection. Nature 411:826-833.

DeFraia, C. T., and Mou, Z. 2011. The role of the Elongator complex in plants. Plant Signal Behav. 6:19-22.

DeFraia, C. T., Wang, Y., Yao, J., and Mou, Z. 2013. Elongator subunit 3 positively regulates plant immunity through its histone acetyltransferase and radical S -adenosylmethionine domains. BMC Plant Biology 13:102.

DeFraia, C. T., Zhang, X., and Mou, Z. 2010. Elongator subunit 2 is an accelerator of immune responses in Arabidopsis thaliana. Plant J. 64:511-523.

Ding, Y., and Mou, Z. 2015. Elongator and its epigenetic role in plant development and responses to abiotic and biotic stresses. Front. Plant Sci. 6:296.

Djebbar, R., Rzigui, T., Petriacq, P., Mauve, C., Priault, P., Fresneau, C., De Paepe, M., Florez-Sarasa, I., Benhassaine-Kesri, G., Streb, P., Gakiere, B., Cornic, G., and De Paepe, R. 2012. Respiratory complex I deficiency induces drought tolerance by impacting leaf stomatal and hydraulic conductances. Planta 235:603-614.

Dutilleul, C., Lelarge, C., Prioul, J. L., De Paepe, R., Foyer, C. H., and Noctor, G. 2005. Mitochondria-driven changes in leaf NAD status exert a crucial influence on the control of nitrate assimilation and the integration of carbon and nitrogen metabolism. Plant Physiol. 139:64-78.

90

Dutilleul, C., Garmier, M., Noctor, G., Mathieu, C., Chetrit, P., Foyer, C. H., and de Paepe, R. 2003. Leaf mitochondria modulate whole cell redox homeostasis, set antioxidant capacity, and determine stress resistance through altered signaling and diurnal regulation. Plant Cell 15:1212-1226.

Dye, D. W., Bradbury, J. F., Goto, M., Hayward, A. C., Lelliott, R. A., and Schroth, M. N. 1980. International standards for naming pathovars of phytopathogenic bacteria and a list of pathovar names and pathotype strains. Review of Plant Pathology 59:153-168.

Fang, X., Cui, Y., Li, Y., and Qi, Y. 2015. Transcription and processing of primary microRNAs are coupled by Elongator complex in Arabidopsis. Nat. Plants 1:15075.

Fichtner, L., Jablonowski, D., Schierhorn, A., Kitamoto, H. K., Stark, M. J., and Schaffrath, R. 2003. Elongator's toxin-target (TOT) function is nuclear localization sequence dependent and suppressed by post-translational modification. Mol. Microbiol. 49:1297-1307.

Freeman, J. H., Dittmar, P. J., and Vallad, G. E. 2015-2017. Vegetable Production Handbook for Florida.

Frohloff, F., Fichtner, L., Jablonowski, D., Breunig, K. D., and Schaffrath, R. 2001. Saccharomyces cerevisiae Elongator mutations confer resistance to the Kluyveromyces lactis zymocin. EMBO J. 20:1993-2003.

Fu, Z. Q., and Dong, X. 2013. Systemic acquired resistance: turning local infection into global defense. Annu. Rev. Plant Biol. 64:839-863.

Fulton, T. M., Chunwongse, J., and Tanksley, S. D. 1995. Microprep protocol for extraction of DNA from tomato and other herbaceous plants. Plant Molecular Biology Report 13:207-209.

Gassmann, W., Dahlbeck, D., Chesnokova, O., Minsavage, G. V., Jones, J. B., and Staskawicz, B. J. 2000. Molecular evolution of virulence in natural field strains of Xanthomonas campestris pv. vesicatoria. J. Bacteriol. 182:7053-7059.

Gironde, S., and Manceau, C. 2012. Housekeeping gene sequencing and multilocus variable-number tandem-repeat analysis to identify subpopulations within Pseudomonas syringae pv. maculicola and Pseudomonas syringae pv. tomato that correlate with host specificity. Appl. Environ. Microbiol. 78:3266-3279.

Glatt, S., Séraphin, B., and Müller, C. W. 2012. Elongator: transcriptional or translational regulator? Transcription 3: 273-276.

Glazebrook, J. 2005. Contrasting mechanisms of defense against biotrophic and necrotrophic pathogens. Annu. Rev. Phytopathol. 43:205-227.

91

Hawkes, N. A., Otero, G., Winkler, G. S., Marshall, N., Dahmus, M. E., Krappmann, D., Scheidereit, C., Thomas, C. L., Schiavo, G., Erdjument-Bromage, H., Tempst, P., and Svejstrup, J. Q. 2002. Purification and characterization of the human elongator complex. J. Biol. Chem. 277:3047-3052.

Helena, M., Oliveira, M. C. F. C., and Santa Marta, J. M. C. P. 1986. Pseudomonas syringae pv. tomato (Okabe, 1933) Young, Dye & Wilkie, 1978. A new bacterial disease of tomato in Portugal. Pages 303-310 in: Acta Horticulturae International Society for Horticultural Science (ISHS), Leuven, Belgium.

Horvath, D. M., Stall, R. E., Jones, J. B., Pauly, M. H., Vallad, G. E., Dahlbeck, D., Staskawicz, B. J., and Scott, J. W. 2012. Transgenic resistance confers effective field level control of bacterial spot disease in tomato. PLoS One 7:e42036.

Huang, B., Johansson, M. J., and Bystrom, A. S. 2005. An early step in wobble uridine tRNA modification requires the Elongator complex. Rna 11:424-436.

Huang, C. H., and Vallad, G. E. 2011. Evaluation of Actigard for management of bacterial spot of tomato. Plant Disease Management Reports 5:V066.

Jablonowski, D., Frohloff, F., Fichtner, L., Stark, M. J., and Schaffrath, R. 2001. Kluyveromyces lactis zymocin mode of action is linked to RNA polymerase II function via Elongator. Mol. Microbiol. 42:1095-1105.

James, C., and Krattiger, A. F. 1996. Global review of the field testing and commercialization of transgenic plants, 1986 to 1995: The First Decade of Crop Biotechnology. ISAAA Briefs No. 1. ISAAA: Ithaca, NY.:31.

Jardine, D. J., Stephens, C. T., and Fulbright, D. W. 1988. Potential sources of initial inoculum for bacterial speck in early planted tomato crops in Michigan: debris and volunteers from previous crops. Plant Disease 72:246-249.

Jia, Y., Tian, H., Li, H., Yu, Q., Wang, L., Friml, J., and Ding, Z. 2015. The Arabidopsis thaliana elongator complex subunit 2 epigenetically affects root development. J. Exp. Bot. 66:4631-4642.

Jones, J. B., Jones, J. P., Stall, R. E., and Zitter, T. A. 1991. Compendium of Tomato Diseases. second ed. APS Press, Saint Paul, MN.

Jones, J. B., Pohronezy, K. L., Stall, R. E., and Jones, J. P. 1986. Survival of Xanthomonas campestris pv. vesicatoria in Florida on tomato crop residue, weeds, seeds, and volunteer tomato plants. Phytopathology 76:430-434.

Jones, J. D., and Dangl, J. L. 2006. The plant immune system. Nature 444:323-329.

Judkins, C. P., Sobey, C. G., Dang, T. T., Miller, A. A., Dusting, G. J., and Drummond, G. R. 2006. NADPH-induced contractions of mouse aorta do not involve NADPH oxidase: a role for P2X receptors. J. Pharmacol. Exp. Ther. 317:644-650.

92

Kathage, J., and Qaim, M. 2012. Economic impacts and impact dynamics of Bt (Bacillus thuringiensis) cotton in India. PNAS 109:11652-11656.

Katoh, A., Uenohara, K., Akita, M., and Hashimoto, T. 2006. Early Steps in the biosynthesis of NAD in Arabidopsis start with aspartate and occur in the plastid. Plant. Physiol. 141:851-857.

Koornneef, A., Leon-Reyes, A., Ritsema, T., Verhage, A., Den Otter, F. C., Van Loon, L. C., and Pieterse, C. M. 2008. Kinetics of salicylate-mediated suppression of jasmonate signaling reveal a role for redox modulation. Plant. Physiol. 147:1358-1368.

Kramer, M. G., and Redenbaugh, K. 1994. Commercialization of a tomato with an antisense polygalacturonase gene: FLAVR SAVR(TM) tomato story. Euphytica 79:293-297.

Krogan, N. J., and Greenblatt, J. F. 2001. Characterization of a six-subunit holo-elongator complex required for the regulated expression of a group of genes in Saccharomyces cerevisiae. Mol. Cell Biol. 21:8203-8212.

Kunkel, B. N., and Brooks, D. M. 2002. Cross talk between signaling pathways in pathogen defense. Curr. Opin. Plant Biol. 5:325-331.

Lacombe, S., Rougon-Cardoso, A., Sherwood, E., Peeters, N., Dahlbeck, D., van Esse, H. P., Smoker, M., Rallapalli, G., Thomma, B. P., Staskawicz, B., Jones, J. D., and Zipfel, C. 2010. Interfamily transfer of a plant pattern-recognition receptor confers broad-spectrum bacterial resistance. Nat. Biotechnol.. 28:365-369.

Levy, J., Bosin, E., Feldman, B., Giat, Y., Miinster, A., Danilenko, M., and Sharoni, Y. 1995. Lycopene is a more potent inhibitor of human cancer cell proliferation than

either α‐carotene or β‐carotene. Nutrition and Cancer 24:257-266.

Lin, W. C., Lu, C. F., Wu, J. W., Cheng, M. L., Lin, Y. M., Yang, N. S., Black, L., Green, S. K., Wang, J. F., and Cheng, C. P. 2004. Transgenic tomato plants expressing the Arabidopsis NPR1 gene display enhanced resistance to a spectrum of fungal and bacterial diseases. Transgenic Res. 13:567-581.

Lin, Z., Zhao, W., Diao, W., Xie, X., Wang, Z., Zhang, J., Shen, Y., and Long, J. 2012. Crystal structure of elongator subcomplex Elp4-6. J. Biol. Chem. 287:21501-21508.

Macho, A. P., Boutrot, F., Rathjen, J. P., and Zipfel, C. 2012. Aspartate oxidase plays an important role in Arabidopsis stomatal immunity. Plant Physiology 159:1845-1856.

Marco, G. M., and Stall, R. E. 1983. Control of bacterial spot of pepper initiated by strains of Xanthomonas campestris pv. vesicatoria that differ in sensitivity to copper. Plant Disease 67:779-781.

93

Melotto, M., Underwood, W., Koczan, J., Nomura, K., and He, S. Y. 2006. Plant stomata function in innate immunity against bacterial invasion. Cell 126:969-980.

Monroe, J. G., and Sasser, M. 1980. Prevention-the key to controlling bacterial spot and bacterial speck of tomato. Plant Disease 64:831-834.

Moreschi, I., Bruzzone, S., Nicholas, R. A., Fruscione, F., Sturla, L., Benvenuto, F., Usai, C., Meis, S., Kassack, M. U., Zocchi, E., and De Flora, A. 2006. Extracellular NAD+ is an agonist of the human P2Y11 purinergic receptor in human granulocytes. J. Biol. Chem. 281:31419-31429.

Nelissen, H., De Groeve, S., Fleury, D., Neyt, P., Bruno, L., Bitonti, M. B., Vandenbussche, F., Van der Straeten, D., Yamaguchi, T., Tsukaya, H., Witters, E., De Jaeger, G., Houben, A., and Van Lijsebettens, M. 2010. Plant Elongator regulates auxin-related genes during RNA polymerase II transcription elongation. Proc. Natl. Acad. Sci. 107:1678-1683.

Nelissen, H., Fleury, D., Bruno, L., Robles, P., De Veylder, L., Traas, J., Micol, J. L., Van Montagu, M., Inze, D., and Van Lijsebettens, M. 2005. The elongata mutants identify a functional Elongator complex in plants with a role in cell proliferation during organ growth. Proc. Natl. Acad. Sci. 102:7754-7759.

Noctor, G., Queval, G., and Gakiere, B. 2006. NAD(P) synthesis and pyridine nucleotide cycling in plants and their potential importance in stress conditions. J. Exp. Bot. 57:1603-1620.

Okada, Y., Yamagata, K., Hong, K., Wakayama, T., and Zhang, Y. 2010. A role for the elongator complex in zygotic paternal genome demethylation. Nature 463:554-558.

Otero, G., Fellows, J., Li, Y., de Bizemont, T., Dirac, A. M., Gustafsson, C. M., Erdjument-Bromage, H., Tempst, P., and Svejstrup, J. Q. 1999. Elongator, a multisubunit component of a novel RNA polymerase II holoenzyme for transcriptional elongation. Mol. Cell 3:109-118.

Pauli, S., Rothnie, H. M., Chen, G., He, X., and Hohn, T. 2004. The Cauliflower mosaic virus 35S promoter extends into the transcribed region. J. Virol. 78:12120-12128.

Paur, I., Lilleby, W., Bøhn, S. K., Hulander, E., Klein, W., Vlatkovic, L., Axcrona, K., Bolstad, N., Bjøro, T., Laake, P., Taskén, K. A., Svindland, A., Eri, L. M., Brennhovd, B., Carlsen, M. H., Fosså, S. D., Smeland, S. S., Karlsen, A. S., and Blomhoff, R. 2016. Tomato-based randomized controlled trial in prostate cancer patients: effect on PSA. Clin. Nutr. pii: S0261-5614:30147-9.

Pedley, K. F., and Martin, G. B. 2003. Molecular basis of Pto-mediated resistance to bacterial speck disease in tomato. Annu. Rev. Phytopathol. 41:215-243.

94

Peralta, I. E. 2006. History, Origin and early cultivation of tomato (Solanaceae) history, origin and early cultivation of tomato (Solanaceae). Pages 1-25 in: Genetic Improvement of Solanaceous Crops. vol. 2. M. K. Razdan and A. K. Mattoo, eds. CRC Press, Boca Raton, Florida.

Pernezny, K., Stoffella, P., Collins, J., Carroll, A., and Beany, A. 2002. Control of target spot of tomato with fungicides, systemic acquired resistance activators, and a biocontrol agent. Plant Protection Science 38:81-88.

Petriacq, P., de Bont, L., Hager, J., Didierlaurent, L., Mauve, C., Guerard, F., Noctor, G., Pelletier, S., Renou, J. P., Tcherkez, G., and Gakiere, B. 2012. Inducible NAD overproduction in Arabidopsis alters metabolic pools and gene expression correlated with increased salicylate content and resistance to Pst-AvrRpm1. Plant J. 70:650-665.

Petriacq, P., de Bont, L., Tcherkez, G., and Gakiere, B. 2013. NAD: not just a pawn on the board of plant-pathogen interactions. Plant Signal Behav. 8:e22477.

Potnis, N., Timilsina, S., Strayer, A., Shantharaj, D., Barak, J. D., Paret, M. L., Vallad, G. E., and Jones, J. B. 2015. Bacterial spot of tomato and pepper: diverse Xanthomonas species with a wide variety of virulence factors posing a worldwide challenge. Mol. Plant. Pathol. 16:907-920.

Rahl, P. B., Chen, C. Z., and Collins, R. N. 2005. Elp1p, the yeast homolog of the FD disease syndrome protein, negatively regulates exocytosis independently of transcriptional elongation. Mol. Cell 17:841-853.

Rebetzke, G. J., Read, J. J., Barbour, M. M., Condon, A. G., and Rawson, H. M. 2000. A hand-held porometer for rapid assessment of leaf conductance in wheat. Crop Science 40:277-280.

Ryals, J. A., Neuenschwander, U. H., Willits, M. G., Molina, A., Steiner, H. Y., and Hunt, M. D. 1996. Systemic Acquired Resistance. Plant Cell 8:1809-1819.

Schaefer, S. C., Gasic, K., Cammue, B., Broekaert, W., van Damme, E. J., Peumans, W. J., and Korban, S. S. 2005. Enhanced resistance to early blight in transgenic tomato lines expressing heterologous plant defense genes. Planta 222:858-866.

Schlub, R.L., Smith, L. J., Datnoff, L. E., and Pernezny, K. 2009. An overview of target spot of tomato caused by Corynespora cassiicola. Proc. IInd Intl. Symposium on Tomato Diseases :25-28.

Schouten, H. J., Krens, F. A., and Jacobsen, E. 2006. Do cisgenic plants warrant less stringent oversight? Nat. Biotechnol. 24:753.

95

Schwartz, A. R., Potnis, N., Timilsina, S., Wilson, M., Patane, J., Martins, J., Jr., Minsavage, G. V., Dahlbeck, D., Akhunova, A., Almeida, N., Vallad, G. E., Barak, J. D., White, F. F., Miller, S. A., Ritchie, D., Goss, E., Bart, R. S., Setubal, J. C., Jones, J. B., and Staskawicz, B. J. 2015. Phylogenomics of Xanthomonas field strains infecting pepper and tomato reveals diversity in effector repertoires and identifies determinants of host specificity. Front. Microbiol. 6:535.

Sexton, S., and Zilberman, D. 2011. How agricultural biotechnology boosts food supply and accommodates biofuels. National Bureau of Economic Research Working Paper Series 16699:1-20.

Shen, W. J., and Forde, B. G. 1989. Efficient transformation of Agrobacterium spp. by high voltage electroporation. Nucleic Acids Res. 17:8385.

Slaugenhaupt, S. A., and Gusella, J. F. 2002. Familial dysautonomia. Curr. Opin. Genet. Dev. 12:307-311.

Smith, A. F. 1994. The tomato in America: early history, culture, and cookery. University of South Caroline Press, Columbia, South Caroline.

Spoel, S. H., Koornneef, A., Claessens, S. M., Korzelius, J. P., Van Pelt, J. A., Mueller, M. J., Buchala, A. J., Metraux, J. P., Brown, R., Kazan, K., Van Loon, L. C., Dong, X., and Pieterse, C. M. 2003. NPR1 modulates cross-talk between salicylate- and jasmonate-dependent defense pathways through a novel function in the cytosol. Plant Cell 15:760-770.

Srisink, S., and Sivasithamparam, K. 1987. Epiphytic populations of Pseudomonas syringae pv. tomato on tomato seedlings in a nursery [bacterial speck]. Plant Protection Quarterly 2:158.

Stall, R. E., and Thayer, P. L. 1962. Streptomycin resistance of the bacterial spot pathogen and control with streptomycin. Plant Disease Reporter 46:389-392.

Sun, X., Nielsen, M. C., and Miller, J. W. 2002. Bacterial spot of tomato and pepper. in: Plant Pathology Circular N 129 Florida Department of Agriculture and Conservation Services.

Swords, K. M., Dahlbeck, D., Kearney, B., Roy, M., and Staskawicz, B. J. 1996. Spontaneous and induced mutations in a single open reading frame alter both virulence and avirulence in Xanthomonas campestris pv. vesicatoria avrBs2. J. Bacteriol. 178:4661-4669.

Terrell, E. E., Broome, C. R., and Reveal, J. L. 1983. Proposal to Conserve the Name of the Tomato as Lycopersicon esculentum P. Miller and Reject the Combination Lycopersicon lycopersicum (L.) Karsten (Solanaceae). 32:310-314.

Turner, J. G., Ellis, C., and Devoto, A. 2002. The jasmonate signal pathway. Plant Cell 14:s153-s164.

96

USDA. 2016. Vegetable and Pulses: Tomatoes.

Vallad, G. E., and Huang, C. H. 2011. Evaluation of Quintec for management of bacterial spot of tomato. Plant Disease Management Reports 5:V061.

Versees, W., De Groeve, S., and Van Lijsebettens, M. 2010. Elongator, a conserved multitasking complex? Mol. Microbiol. 76:1065-1069.

Wang, C., Ding, Y., Yao, J., Zhang, Y., Sun, Y., Colee, J., and Mou, Z. 2015. Arabidopsis Elongator subunit 2 positively contributes to resistance to the necrotrophic fungal pathogens Botrytis cinerea and Alternaria brassicicola. Plant J. 83:1019-1033.

Wang, Y., An, C., Zhang, X., Yao, J., Zhang, Y., Sun, Y., Yu, F., Amador, D. M., and Mou, Z. 2013. The Arabidopsis elongator complex subunit2 epigenetically regulates plant immune responses. Plant Cell 25:762-776.

Wichmann, G., Ritchie, D., Kousik, C. S., and Bergelson, J. 2005. Reduced genetic variation occurs among genes of the highly clonal plant pathogen Xanthomonas axonopodis pv. vesicatoria, including the effector gene avrBs2. Appl. Environ. Microbiol. 71:2418-2432.

Winkler, G. S., Kristjuhan, A., Erdjument-Bromage, H., Tempst, P., and Svejstrup, J. Q. 2002. Elongator is a histone H3 and H4 acetyltransferase important for normal histone acetylation levels in vivo. Proc. Natl. Acad. Sci. 99:3517-3522.

Wittschieben, B. O., Otero, G., de Bizemont, T., Fellows, J., Erdjument-Bromage, H., Ohba, R., Li, Y., Allis, C. D., Tempst, P., and Svejstrup, J. Q. 1999. A novel histone acetyltransferase is an integral subunit of elongating RNA polymerase II holoenzyme. Mol. Cell 4:123-128.

Xu, D., Huang, W., Li, Y., Wang, H., Huang, H., and Cui, X. 2012. Elongator complex is critical for cell cycle progression and leaf patterning in Arabidopsis. Plant J. 69:792-808.

Yu, J., Yang, L., Liu, X., Tang, R., Wang, Y., Ge, H., Wu, M., Zhang, J., Zhao, F., Luan, S., and Lan, W. 2016. Overexpression of Poplar pyrabactin resistance-like abscisic acid receptors promotes abscisic acid sensitivity and drought resistance in transgenic Arabidopsis. PLoS One 11:e0168040.

Yunis, H., Bashan, Y., Okon, Y., and Henis, Y. 1980. Weather dependence, yield losses, and control of bacterial speck of tomato caused by Pseudomonas tomato. Plant Disease 64:937-939.

Zhang, X., and Mou, Z. 2008. Function of extracellular pyridine nucleotides in plant defense signaling. Plant Signal. Behav. 3:1143-1145.

97

Zheng, X. Y., Spivey, N. W., Zeng, W., Liu, P. P., Fu, Z. Q., Klessig, D. F., He, S. Y., and Dong, X. 2012. Coronatine promotes Pseudomonas syringae virulence in plants by activating a signaling cascade that inhibits salicylic acid accumulation. Cell Host Microbe 11:587-596.

Zhou, J., Peng, Z., Long, J., Sosso, D., Liu, B., Eom, J. S., Huang, S., Liu, S., Vera Cruz, C., Frommer, W. B., White, F. F., and Yang, B. 2015. Gene targeting by the TAL effector PthXo2 reveals cryptic resistance gene for bacterial blight of rice. Plant J. 82:632-643.

Zhou, N., Tootle, T. L., Tsui, F., Klessig, D. F., and Glazebrook, J. 1998. PAD4 functions upstream from salicylic acid to control defense responses in Arabidopsis. Plant Cell 10:1021-1030.

Zhou, X., Hua, D., Chen, Z., Zhou, Z., and Gong, Z. 2009. Elongator mediates ABA responses, oxidative stress resistance and anthocyanin biosynthesis in Arabidopsis. Plant J. 60:79-90.

Zhu, M., Li, Y., Chen, G., Ren, L., Xie, Q., Zhao, Z., and Hu, Z. 2015. Silencing SlELP2L, a tomato Elongator complex protein 2-like gene, inhibits leaf growth, accelerates leaf, sepal senescence, and produces dark-green fruit. Sci. Rep. 5:7693.

98

BIOGRAPHICAL SKETCH

Juliana A. Pereira grew up in Conchal, a small city in the country side of São

Paulo state, Brazil. She pursued her bachelor`s degree in biology at Fundação

Hermínio Ometto – Uniararas in Araras, São Paulo, Brazil; and her master`s degree in

agricultural microbiology at Luiz de Queiroz College of Agriculture (ESALQ) – University

of São Paulo, in Piracicaba, São Paulo, Brazil. The first time leaving the country was to

join the Department of Plant Pathology at University of Florida in 2013. Under the

supervision and guidance of Dr. Jeff Jones and Dr. Zhonglin Mou, she conducted her

research mainly in transgenic tomato expressing Arabidopsis or tomato defense-related

genes. She received her Ph.D. degree in plant pathology from the University of Florida

in May 2017.