Supplemental Figure 1. Specificity and Sensitivity of the m5C Antibody. (A) Dot blot assay showing that the m5C antibody recognizes an m5C-modified RNA oligo, but not an oligo containing modified m1A, m6A, hm5C, f5C or unmodified cytosine. (B) Dot blot competition assays showing specific binding of the m5C antibody to an m5C-modified oligo. Antibody binding to the m5C oligo is decreased by pre-incubation with an increasing amount of m5C modified competitor RNA, but not with unmodified RNA. (C) Dot blot competition assays showing specific binding of the m5C antibody to an m5C-modified oligo rather than oligos with other modifications. Antibody was pre-incubated with an increasing amount of 5-methylcytosine triphosphate (m5CTP), cytosine triphosphate (CTP), 4-methylcytosine triphosphate (m4CTP), 5-hydroxymethylcytosine triphosphate (hm5CTP) and 5-formylcytosine triphosphate (f5CTP). Dot blots shown in (A) to (C) are representative results of three replicates.

1

Supplemental Figure 2. Ion Chromatograms of m5C Levels in RNA from Arabidopsis. (A) Ion chromatograms of DNA m5C and RNA m5C standards as well as a negative control (a synthesized RNA fragment without m5C). (B) Ion chromatograms of m5C levels in different RNA species extracted from 9-day-old wild-type whole seedlings. (C) Ion chromatograms of m5C levels in mRNA extracted from 9-day-old wild-type whole seedlings (D9) and various tissues of Col wild-type plants, including roots (Rt), rosette leaves (RL), cauline leaves (CL), stems (St), open flowers (OF), flower buds (FB), and siliques (Sil). (D) Ion chromatograms of m5C levels in mRNA extracted from developing wild-type seedlings (3- to 15-day-old; D3 to D15). (E) Ion chromatograms of RNA m5C and DNA m5C in a mixture of mRNA extracted from different tissues (C) and wild-type seedlings at various developmental stages (D). DNA m5C is not detectable in these mRNA samples, thus excluding the possibility of DNA contamination.

2

Supplemental Figure 3. Transcriptome-Wide Mapping of m5C in Arabidopsis. (A) Pairwise scatter plots comparing log10 RPM values for individual samples. R, Pearson correlation coefficient. (B) Distribution of all m5C modified or non-modified mRNAs relative to mRNA abundance. (C) Sequence logo representations of other consensus motifs identified by MEME-ChIP. The number of occurrences of each motif relative to the total number of m5C peak summit and the corresponding P value generated by MEME-ChIP are shown under the logo.

3

Supplemental Figure 4. Examples of m5C Peaks at Different Loci. Blue or red color represents input or IP reads, respectively. The transcript structures are shown beneath, with thick and thin boxes representing exons and introns, respectively.

4

Supplemental Figure 5. LC-MS/MS Quantification of m5C Levels in mRNA Extracted from Arabidopsis Seedlings under Different Hormone or Stress Treatments. (A) m5C Levels in 9-day-old seedlings under various hormone treatments. 2,4-D, 2,4-Dichlorophenoxyacetic acid; 6-BA, 6-Benzylaminopurine. ABA, Abscisic acid; IAA, Indole-3-acetic acid; NAA, Naphthaleneacetic acid.(B) m5C Levels in 9-day-old seedlings under drought, heat (38oC) or cold (4oC) treatment.Error bars, mean ± s.d.; n = 3. Asterisks indicate significant differences between various treatments and the corresponding mock-treatments (two-tailed paired Student’s t test, P < 0.05).

5

Supplemental Figure 6. RNA (cytosine-5)-Methyltransferases (RCMTs) in Arabidopsis. (A) Phylogenetic analysis of Arabidopsis RCMTs. The RCMT sequences were aligned using MAFFT version 7 with the G-INS-i algorithm. The neighbour joining (NJ) phylogeny was performed using MEGA 7.0.14 with 1000 replicates.(B) m5C/C ratios determined by LC-MS/MS assays of mRNA purified from 9-day-old wild-type and oli2 plants. m5C/C ratio remains unchanged in oli2 mutants. Error bars, mean ± s.d.; n = 3.

6

Supplemental Figure 7. TRM4B Affects Root Development in Arabidopsis. (A) Isolation of trm4b mutants. Schematic diagram shows the T-DNA insertion sites in trm4b-3 and trm4b-4 (upper panel). Exons are represented by black boxes, while other sequences are represented by black lines. The lower panel shows RT-PCR results of TRM4B

7

expression with primers amplifying the full-length, 5’ upstream fragment and 3’ downstream fragment of TRM4B in wild-type, trm4b-3 and trm4b-4. (B) Phenotypes of 9-day-old trm4b mutants. trm4b seedlings develop short primary roots. (C) Primary root length (left panel) and lateral root number (right panel) of wild-type, trm4b and trm4b pTRM4B:TRM4B-3HA seedlings. 6-day-old or 9-day-old seedlings were examined. Error bars, mean ± s.d.; n = 15. Asterisks indicate significant differences between mutants and wild-type plants (two-tailed paired Student’s t test, P < 0.05). (D) Confocal images of 9-day-old wild-type, trm4b and trm4b pTRM4B:TRM4B-3HA primary roots stained with propidium iodide. Arrows indicate the boundary between the proximal meristem and the elongation zone of the root in the upper panels. The lower panels show the amplified regions containing the quiescent center.(E) Cortex cell number of wild-type and trm4b seedlings. Error bars, mean ± s.d.; n = 15. Asterisks indicate significant differences between mutants and wild-type plants (two-tailed paired Student’s t test, P < 0.05).Scale bars: 5 mm (B), 50 µm (D).

8

Supplemental Figure 8. Examination of the m5C Methyltransferase Activity of TRM4B. (A) Expression of recombinant GST-TRM4B protein. Arrows indicate the expression of the GST and GST-TRM4B recombinant protein (left panel). The purified recombinant GST-TRM4B protein was detected by the anti-GST antibody (right panel). (B) m5C methylation assay followed by dot blot analysis shows that the GST-TRM4B recombinant protein has the m5C methyltransferase activity. RNA containing the m5C motifs (RNA) or without cytosine (RNA w/o C) served as the input, and was incubated with GST or GST-TRM4B. m5C levels of RNA input and RNA purified from incubation with GST protein or GST-TRM4B were measured by dot blot analysis.

9

Supplemental Figure 9. Distribution Patterns of m5C Peaks in trm4b-4 Are Unchanged.

Supplemental Figure 9. Gene Ontology (GO) Biological Processes Enrichment Analysis of Genes Bearing m5C Peaks in Wild-Type but Not in trm4b-4 Seedlings. Statistical analysis was performed using the DAVID tool. P < 0.05.

10

Supplemental Figure 10. Association Patterns of SHY2 and IAA16 within Fractions with Different Translational Status Are Not Changed in trm4b-4 Roots.(A) Polysome profile of 9-day-old wild-type and trm4b-4 roots. Twelve fractions were collected for each genotype.(B and C) Quantitative real-time PCR analysis of the association patterns of SHY2 (B) and IAA16 (C) within fractions bearing various translation status in wild-type and trm4b-4 roots. DAP from spike-in RNA was amplified as an internal control. SHY2 and IAA16 expression is undetectable in fractions 1 and 2.

11

Supplemental Figure 11. Measurement of hm5C in Arabidopsis. (A) Quantification of hm5C percentage relative to cytosine (m5C/C ratio) by LC-MS/MS assays in total RNA and mRNA extracted from 9-day-old wild-type whole seedlings, and various tissues of wild-type plants, including rosette leaves (RL), cauline leaves (CL), stems (St), flower buds (FB), 9-day-old whole seedlings (D9), open flowers (OF), roots (Rt), and siliques (Sil). Error bars, mean ± s.d.; n = 3.(B) Ion chromatograms of hm5C levels in mRNA extracted from 9-day-old wild-type whole seedlings (D9) and various tissues of Col wild-type plants.

12

Supplemental Table 1. Genomic Loci, Enrichment Scores and Associated Genes for Each m5C Peak in Wild-Type Seedlings. (Excel file)

Supplemental Table 2. Genomic Loci, Enrichment Scores and Associated Genes for Each m5C Peak in trm4b-4 Seedlings. (Excel file)

Supplemental Table 3. Differentially Expressed Genes in trm4b-4 versus Wild-Type Seedlings. (Excel file)

13

Supplemental Table 4. List of Primers Used in This Study.

Primers pairs used for m5C-RIP-qPCR Gene name Primers

AT5G62000 GGGAGTTTTGTTGCATGGTTTCCCCAACAACTGCTTCTTC

AT2G01420 TCGTGTCATCACACTTGTCGAGCAGGGCTGAATAAAATGG

AT1G49760 TGACGACAAGGAGTGGTTTGCTGCAGCCTCCTTCAAACTT

AT3G54220 AGACATGTCGTGGAACAGCATTCTCCCTCCAGCTCTCAAA

AT3G59420 CGTTCCAATGCTGTTGTCACCATCCATCTGAAATCGAAGC

AT3G18990 AACGTTTTGGCTGCATTGATAGCTCCGCGAGATGATGA

AT5G44280 TTCCTCGTCCTCCTCTGCAGATGAGGAAGTGAAACACGAC

AT3G28030 GATTCACCTATAGCCAATGAGTCTTCCTCTTCCTCGTCCTCT

AT5G55300 TCTCTTCCAAATGCCACTCACGGGAGAATTTCTGGAATGA

AT2G01910 AGAAAAGCTTGCAGCTGTGACTCTTCTCAATTTGCGCCTTT

SHY2 ACATCACCAATGAGCATCCATGTTCAAATTCTCTGTGGGAGA

IAA16 AAGCATCCAGTCGCCATCTGGCAACTATGGACCACAAGG

TUB2 ATCCGTGAAGAGTACCCAGATAAGAACCATGCACTCATCAGC

Primers pairs used for gene expression analysis (quantitative real-time PCR)Gene name Primers

SHY2 AGGCTCAGATTGTTGGATGGGATTCCTTGACCCTCATGCT

IAA16 CCGTGGCTTATGTGAAGGTTATTTTGCTTAAGGCGTTGGA

DAP CCCACAGTGATGATGTCGAGGCTGCTTCAGCTGCTTCTTC

Primers pairs used for plasmid construction Constructs Primers

pTRM4B ACCCAATCATCGTCACATCATCTTCCTCCTCTTCCCATTTTTCGTAGCT

TRM4B CDS ATGGGAAGAGGAGGAAGACATAGTCTCCATAGCTAGTGGAC

pTRM4B+CDS TGGATCCGGTACCGAATTCATGGGAAGAGGAGGAAGACATGAGTGCGGCCGCGAATTCTTAGTCTCCATAGCTAGTGGAC

14