VIRUSES OF BANANA IN EAST AFRICA 

 

by 

 

Anthony Peter James 

Bachelor of Applied Science (Honours) 

Master of Plant Protection 

 

 

 

 

Centre for Tropical Crops and Biocommodities 

Faculty of Science and Technology 

 

 

A thesis submitted for the degree of Doctor of Philosophy 

Queensland University of Technology 

 

 

2011 

  

 

I  

ABSTRACT 

 

Bananas are one of the world’s most  important  food crops, providing sustenance 

and  income  for millions  of  people  in  developing  countries  and  supporting  large 

export  industries. Viruses are considered major constraints to banana production, 

germplasm multiplication  and  exchange,  and  to  genetic  improvement of banana 

through traditional breeding.  In Africa, the two most  important virus diseases are 

bunchy top, caused by Banana bunchy top virus (BBTV), and banana streak disease, 

caused by Banana streak virus  (BSV). BBTV  is a serious production constraint  in a 

number  of  countries within/bordering  East  Africa,  such  as  Burundi,  Democratic 

Republic of Congo, Malawi, Mozambique, Rwanda and Zambia, but  is not present 

in Kenya, Tanzania and Uganda. Additionally, epidemics of banana streak disease 

are occurring in Kenya and Uganda.  

The rapidly growing tissue culture (TC) industry within East Africa, aiming to 

provide planting material to banana  farmers, has stimulated discussion about the 

need  for  virus  indexing  to  certify  planting  material  as  virus‐free.  Diagnostic 

methods  for BBTV and BSV have been  reported and,  for BBTV, PCR‐based assays 

are  reliable  and  relatively  straightforward.  However  for  BSV,  high  levels  of 

serological and genetic variability and the presence of endogenous virus sequences 

within  the  banana  genome  complicate  diagnosis.  Uganda  has  been  shown  to 

contain  the  greatest  diversity  in  BSV  isolates  found  anywhere  in  the  world.  A 

broad‐spectrum diagnostic test for BSV detection, which can discriminate between 

endogenous and episomal BSV sequences,  is a priority. This PhD project aimed to 

establish  diagnostic methods  for  banana  viruses, with  a  particular  focus  on  the 

development  of  novel methods  for  BSV  detection,  and  to  use  these  diagnostic 

methods for the detection and characterisation of banana viruses in East Africa. 

A  novel  rolling‐circle  amplification  (RCA) method was  developed  for  the 

detection of BSV. Using samples of Banana streak MY virus  (BSMYV) and Banana 

streak  OL  virus  (BSOLV)  from  Australia,  this method  was  shown  to  distinguish 

between  endogenous  and  episomal  BSV  sequences  in  banana  plants.  The  RCA 

II  

assay  was  used  to  screen  a  collection  of  56  banana  samples  from  south‐west 

Uganda for BSV. RCA detected at  least five distinct BSV  isolates  in these samples, 

including BSOLV and Banana streak GF virus (BSGFV) as well as three BSV  isolates 

(Banana  streak Uganda‐I,  ‐L  and –M  virus)  for which only partial  sequences had 

been  previously  reported.  These  latter  three  BSV  had  only  been  detected  using 

immuno‐capture  (IC)‐PCR  and  thus  were  possible  endogenous  sequences.  In 

addition  to  its ability  to detect BSV,  the RCA protocol was also demonstrated  to 

detect  other  viruses  within  the  family  Caulimoviridae,  including  Sugar  cane 

bacilliform virus, and Cauliflower mosaic virus.  

Using  the novel RCA method,  three distinct BSV  isolates  from both Kenya 

and  Uganda were  identified  and  characterised.  The  complete  genome  of  these 

isolates  was  sequenced  and  annotated.  All  six  isolates  were  shown  to  have  a 

characteristic  badnavirus  genome  organisation  with  three  open  reading  frames 

(ORFs)  and  the  large  polyprotein  encoded  by  ORF  3  was  shown  to  contain 

conserved  amino  acid  motifs  for  movement,  aspartic  protease,  reverse 

transcriptase and  ribonuclease H activities. As well,  several  sequences  important 

for expression and  replication of  the  virus genome were  identified  including  the 

conserved  tRNAmet  primer  binding  site  present  in  the  intergenic  region  of  all 

badnaviruses.  Based  on  the  International  Committee  on  Taxonomy  of  Viruses 

(ICTV)  guidelines  for  species  demarcation  in  the  genus  Badnavirus,  these  six 

isolates were  proposed  as  distinct  species,  and  named  Banana  streak  UA  virus 

(BSUAV), Banana streak UI virus  (BSUIV), Banana streak UL virus  (BSULV), Banana 

streak UM virus  (BSUMV), Banana streak CA virus  (BSCAV) and Banana streak  IM 

virus (BSIMV). Using PCR with species‐specific primers designed to each  isolate, a 

genotypically diverse  collection of 12 virus‐free banana  cultivars were  tested  for 

the presence of endogenous sequences. For  five of  the BSV no amplification was 

observed  in  any  cultivar  tested,  while  for  BSIMV,  four  positive  samples  were 

identified in cultivars with a B‐genome component. 

During  field  visits  to  Kenya,  Tanzania  and  Uganda,  143  samples  were 

collected and assayed for BSV. PCR using nine sets of species‐specific primers, and 

RCA,  were  compared  for  BSV  detection.  For  five  BSV  species  with  no  known 

III  

endogenous counterpart (namely BSCAV, BSUAV, BSUIV, BSULV and BSUMV), PCR 

was used to detect 30 infections from the 143 samples. Using RCA, 96.4% of these 

samples were considered positive, with one additional sample detected using RCA 

which was  not  positive  using  PCR.  For  these  five  BSV,  PCR  and  RCA were  both 

useful  for  identifying  infected  samples,  irrespective of  the host cultivar genotype 

(Musa  A‐  or  B‐genome  components).  For  four  additional  BSV  with  known 

endogenous counterparts in the M. balbisiana genome (BSOLV, BSGFV, BSMYV and 

BSIMV),  PCR  was  shown  to  detect  75  infections  from  the  143  samples.  In  30 

samples  from  cultivars  with  an  A‐only  genome  component  there  was  96.3% 

agreement  between  PCR  positive  samples  and  detection  using  RCA,  again 

demonstrating either PCR or RCA are suitable methods for detection. However,  in 

45 samples from cultivars with some B‐genome component, the level of agreement 

between PCR positive samples and RCA positive samples was 70.5%. This suggests 

that, in cultivars with some B‐genome component, many infections were detected 

using  PCR which were  the  result  of  amplification  of  endogenous  sequences.  In 

these  latter  cases,  RCA  or  another  method  which  discriminates  between 

endogenous and episomal sequences, such as  immuno‐capture PCR,  is needed to 

diagnose episomal BSV infection. 

Field  visits were made  to Malawi  and Rwanda  to  collect  local  isolates  of 

BBTV  for  validation  of  a  PCR‐based  diagnostic  assay.  The  presence  of  BBTV  in 

samples  of  bananas  with  bunchy  top  disease  was  confirmed  in  28  out  of  39 

samples from Malawi and all nine samples collected in Rwanda, using PCR and RCA. 

For  three  isolates,  one  from  Malawi  and  two  from  Rwanda,  the  complete 

nucleotide  sequences  were  determined  and  shown  to  have  a  similar  genome 

organisation to previously published BBTV  isolates. The two  isolates from Rwanda 

had  at  least  98.1%  nucleotide  sequence  identity  between  each  of  the  six  DNA 

components, while  the similarity between  isolates  from Rwanda and Malawi was 

between 96.2% and 99.4% depending on the DNA component. At the amino acid 

level,  similarities  in  the putative proteins encoded by DNA‐R,  ‐S,  ‐M,  ‐ C and –N 

were found to range between 98.8% to 100%. In a phylogenetic analysis, the three 

East African isolates clustered together within the South Pacific subgroup of BBTV 

IV  

isolates. Nucleotide sequence comparison to  isolates of BBTV  from outside Africa 

identified India as the possible origin of East African isolates of BBTV.  

 

Keywords 

Banana, virus, BSV, Badnavirus, diagnostic,  rolling‐circle amplification, BBTV, PCR, 

East Africa 

   

V  

PUBLICATIONS 

 

Peer reviewed publications related to this PhD thesis 

1. James, A.P., Geijskes, R.J., Dale, J.L., and Harding, R.M. 2011a. Development of 

a  novel  rolling‐circle  amplification  technique  to  detect  Banana  streak  virus 

which  also  discriminates  between  integrated  and  episomal  virus  sequences. 

Plant Dis. 95:57‐62. 

2. James,  A.P.,  Geijskes,  R.J.,  Dale,  J.L.,  and  Harding,  R.M.  2011b.  Molecular 

characterisation of six badnavirus species associated with leaf streak disease of 

banana in East Africa. Ann. Appl. Biol. 158:346‐353. 

   

VI  

TABLE OF CONTENTS 

ABSTRACT .............................................................................................................. I 

PUBLICATIONS ...................................................................................................... V 

TABLE OF CONTENTS ........................................................................................... VI 

LIST OF FIGURES .................................................................................................. IX 

LIST OF TABLES ..................................................................................................... X 

LIST OF ABBREVIATIONS ...................................................................................... XI 

STATEMENT OF ORIGINAL AUTHORSHIP ............................................................ XIII 

ACKNOWLEDGEMENTS ...................................................................................... XIV 

 

CHAPTER 1 INTRODUCTION  ................................................................................. 1 

DESCRIPTION OF SCIENTIFIC PROBLEM INVESTIGATED  ................................ 1 

  OVERALL OBJECTIVES OF THE STUDY ............................................................. 2 

  SPECIFIC AIMS OF THE STUDY ......................................................................... 2 

  ACCOUNT OF SCIENTIFIC PROGRESS LINKING THE SCIENTIFIC PAPERS ......... 3 

   

CHAPTER 2 LITERATURE REVIEW  .......................................................................... 5 

  2.1 BANANAS – IMPORTANCE AND HISTORY ................................................. 5 

  2.2 BANANAS IN EAST AFRICA ........................................................................ 7 

2.3 VIRUS DISEASES OF BANANAS ................................................................ 11 

  2.3.1 DNA viruses ............................................................................. 11 

2.3.1.1 Streak disease ........................................................................... 11 

2.3.1.2 Bunchy top disease ................................................................... 23 

2.3.2 RNA viruses .............................................................................. 28 

2.3.2.1 Bract mosaic disease................................................................. 28 

2.3.2.2 Mosaic disease .......................................................................... 30 

2.3.2.3 Mild mosaic disease and BVX ................................................... 33 

2.4 VIRUS INDEXING ...................................................................................... 34 

2.4.1 Rolling‐circle amplification ..................................................... 36 

2.5 TISSUE CULTURE OF BANANA ................................................................. 36 

2.6 REFERENCES ............................................................................................ 39  

VII  

CHAPTER  3  DEVELOPMENT  OF  A  NOVEL  ROLLING‐CIRCLE  AMPLIFICATION 

TECHNIQUE  TO  DETECT  BANANA  STREAK  VIRUS WHICH  ALSO  DISCRIMINATES 

BETWEEN INTEGRATED AND EPISOMAL VIRUS SEQUENCES  ............................... 57 

ABSTRACT ...................................................................................................... 59 

  INTRODUCTION ............................................................................................. 60 

  MATERIALS AND METHODS .......................................................................... 62 

  RESULTS ......................................................................................................... 69 

  DISCUSSION ................................................................................................... 78 

  ACKNOWLEDGEMENTS ................................................................................. 81 

  REFERENCES  ................................................................................................. 82 

 

CHAPTER  4  MOLECULAR  CHARACTERISATION  OF  SIX  BADNAVIRUS  SPECIES ASSOCIATED WITH LEAF STREAK DISEASE OF BANANA IN EAST AFRICA  ............. 87 

ABSTRACT ...................................................................................................... 89 

  INTRODUCTION ............................................................................................. 90 

  MATERIALS AND METHODS .......................................................................... 92 

  RESULTS ......................................................................................................... 98 

  DISCUSSION ................................................................................................. 104 

  ACKNOWLEDGEMENTS ............................................................................... 108 

  REFERENCES ................................................................................................ 110 

 

CHAPTER 5 COMPARISON OF ROLLING‐CIRCLE AMPLIFICATION AND DIRECT‐PCR BASED METHODS FOR DIAGNOSIS OF BSV INFECTION IN EAST AFRICA ............. 115 

ABSTRACT .................................................................................................... 118 

  INTRODUCTION ........................................................................................... 119 

  MATERIALS AND METHODS ........................................................................ 121 

RESULTS ....................................................................................................... 127 

DISCUSSION ................................................................................................. 134 

  ACKNOWLEDGEMENTS ............................................................................... 138 

  REFERENCES ................................................................................................ 139 

 

   

VIII  

CHAPTER 6 MOLECULAR CHARACTERISATION OF BANANA BUNCHY TOP VIRUS  

ISOLATES FROM MALAWI AND RWANDA  ........................................................ 147 

ABSTRACT .................................................................................................... 149 

  INTRODUCTION ........................................................................................... 150 

  MATERIALS AND METHODS ........................................................................ 152 

RESULTS....................................................................................................... 156 

DISCUSSION ................................................................................................. 161 

  ACKNOWLEDGEMENTS ............................................................................... 165 

  REFERENCES ................................................................................................ 166 

 

CHAPTER 7 GENERAL DISCUSSION  ................................................................... 169 

 

 

   

IX  

LIST OF FIGURES 

Chapter 2 

Fig. 1: Symptoms of streak disease in leaf tissue ...................................................... 12 

Fig. 2: Virions of banana streak virus and genome organisation of Badnavirus genus 

members ................................................................................................................... 14 

Fig. 3: Symptoms of bunchy top disease ................................................................... 24 

Fig. 4: Nanovirus genome organisation. ................................................................... 26 

Fig. 5: Symptoms of BBrMV in cultivar Cavendish .................................................... 29 

Fig. 6: Symptoms of CMV infection in banana leaf tissue ......................................... 31 

Fig. 7: Schematic of rolling circle amplification  ........................................................ 37 

Chapter 3 

Fig. 1: Agarose gel analysis of RCA‐amplified DNA ................................................... 71 

Fig. 2: Comparison of PCR and RCA for the differential detection of episomal‐ and 

eaBSVS ....................................................................................................................... 77 

Chapter 4 

Fig.  1:  Phylogenetic  tree  using  neighbour‐joining  method  (Kimura  2‐parameter 

model with bootstrapping  (1000 replicates)) of  the RT/RNaseH region of selected 

badnaviruses ........................................................................................................... 102 

Chapter 5 

Fig. 1: Maps of Uganda, Tanzania and Kenya indicating regions surveyed ............ 123 

Chapter 6 

Fig. 1: Neighbour‐joining phylogram of BBTV DNA‐R sequences based on CLUSTAL 

W alignment ............................................................................................................ 162 

Chapter 7 

Fig.  1:  Phylogenetic  tree  using  neighbour‐joining  method  (Kimura  2‐parameter 

model  with  bootstrapping  (1000  replicates))  of  partial  RT/RNaseH  region  of 

selected badnaviruses ............................................................................................. 174 

   

X  

LIST OF TABLES 

Chapter 3 

TABLE 1 Selected plant samples used in this study  ................................................. 64 

TABLE 2 Degenerate primer sequences included in the RCA reaction mixes  ......... 66 

TABLE  3  Predicted  restriction  profiles  of  genomic  DNA  from  characterised  BSV 

species ....................................................................................................................... 67 

Chapter 4 

TABLE  1  Plant  samples  for  RCA  analysis  and  PCR  primers  used  for  detection  of 

integrated sequences ................................................................................................ 94 

TABLE 2 BSV‐indexed leaf samples used for PCR analysis ........................................ 95 

TABLE 3 Genome features of East African BSV species .......................................... 100 

TABLE  4  Pair‐wise  distance matrix  using  core  RT/RNaseH  sequences  of  selected 

badnaviruses ........................................................................................................... 105 

Chapter 5 

TABLE 1 Summary of plant samples collected in East Africa .................................. 122 

TABLE 2 PCR primers used for detection of BSV species ........................................ 125 

TABLE  3  Predicted  restriction  profiles  of  genomic  DNA  from  characterised  BSV 

using PstI and StuI ................................................................................................... 126 

TABLE 4 PCR and RCA detection of BSV species with no confirmed eBSV ............. 129 

TABLE 5 PCR and RCA detection of BSV species with confirmed eBSV .................. 133 

TABLE 6 Advantages and disadvantages of RCA and PCR for BSV detection ......... 137 

TABLE 7  Supplementary data: Plant  samples  and  analysis  for BSV using PCR  and 

RCA .......................................................................................................................... 142 

Chapter 6 

TABLE 1 Leaf samples collected in Malawi and Rwanda, and results of PCR and RCA 

assays for detection of BBTV .................................................................................. 153 

TABLE  2  Characteristics  of  DNA  components  of  BBTV  isolates  from Malawi  and 

Rwanda ................................................................................................................... 158 

TABLE 3 Sequence similarity between Malawi and Rwanda BBTV DNA components

................................................................................................................................. 160 

 

XI  

LIST OF ABBREVIATIONS 

 

°C      degrees Celsius 

μl    microlitre/s 

μM    micromolar 

aa    amino acid/s 

BLAST    basic local alignment search tool 

bp     base pair/s 

CTAB     cetyl trimethyl ammonium bromide 

DNA    deoxyribonucleic acid 

dNTP    deoxyribonucleoside triphosphate 

ds    double‐stranded 

ELISA    enzyme linked immunosorbent assay  

g      gram/s 

g       relative centrifugal force in units of gravity 

h       hour/s 

ha    hectare 

IC    immunocapture 

kbp    kilobase pair/s 

kDa     kilodalton/s 

min    minute/s 

mM       millimolar 

mol    mole 

nm    nanometre/s 

no.     number   

nt    nucleotide/s 

XII  

ORF    open reading frame 

PCR    polymerase chain reaction 

pH    ‐ log (proton concentration) 

ρmol    picomole/s 

RCA    rolling‐circle amplification 

RNA    ribonucleic acid 

RNaseH  ribonuclease H 

RT    reverse transcriptase 

RT‐PCR    reverse transcription PCR 

spp.    species 

s       second/s  

ss    single‐stranded 

t     tonne/s 

Tris     tris(hydroxymethyl)aminomethane 

UTR     untranslated region 

V       volt/s 

   

XIII  

STATEMENT OF ORIGINAL AUTHORSHIP 

 The  work  contained  in  this  thesis  has  not  been  previously  submitted  to meet 

requirements for an award at this or any other higher education institution. To the 

best  of  my  knowledge  and  belief,  the  thesis  contains  no  material  previously 

published or written by another person except where due reference is made.  

 

Signature  

 

Date 

   

XIV  

ACKNOWLEDGEMENTS 

 

There are many people I would like to thank. Firstly, I am most grateful to my wife 

Lynda  for  her  encouragement,  patience,  understanding  and  support. Along with 

our two beautiful children Alec and Jenna, your support is what made this possible. 

I would  like  to express my gratitude  to my principal  supervisor  James  for 

offering me such a great opportunity to work within the CTCB and particularly on 

the Bill and Melinda Gates  Foundation project based  in East Africa. The offer  to 

travel to and work with scientists in East Africa was too good to refuse and I have 

thoroughly enjoyed the challenges of the science, the visits to amazing countries I 

have not visited previously and the wonderful people involved in this work at both 

QUT  and  our  partner  organisations  overseas.  To  Rob,  I  am  grateful  for  your 

unending  patience  and  hard  work  on  the  writing  front.  Although  frustratingly 

pedantic  at  times,  your  efforts  have  crafted my writing  into  publication‐worthy 

prose.  I have  found great solace  in our discussions over a  few quiet ones. To my 

buddy  Jas, my  thanks  too,  for your help with all problems  technical or otherwise 

and for keeping my caffeine and sugar  levels pumped daily for the duration of all 

this I am very grateful. 

To my wonderful colleagues in virology at our partner organisations in East 

Africa  –  Charles  and  Jerome  in Uganda,  Laura  in  Kenya,  and  of  course  Julius  in 

Tanzania.  I can’t express my thanks enough  for your wonderful hospitality during 

our  visits  and  for  sharing  the  hard work with  us  during  the  project.  Every  time 

some new problem arises I simply recall the phrase ‘hakuna matata’ and laugh out 

loud  thinking about  roadside waits with  flat  tyres  that drive off on moto‐taxis, a 

few quiet Nile Specials at the end of a  long day  in the field (and some noisy ones 

later  on)  and  the  small  successes  along  the  way  that  got  the  project  finished 

(mostly) in the end. I wish all of you great happiness and hope we can continue our 

wonderful collaboration! 

To  my  colleagues  at  QUT  in  the  CTCB  –  thank  you  all  for  your  help, 

suggestions,  comforting  words,  encouragement,  shared  frustrations  and  shared 

celebrations. Especially to my good friends who have been down this road – Scotty, 

Andrew, Glenn, JY, Suze, and Mumbi – your encouragement has been uplifting and 

your patient ears have borne out my frustrations many times, thank you all! 

 

 

1  

CHAPTER 1 

 

INTRODUCTION 

 

This thesis  is being presented  in the style of  ‘Thesis by Publication’. The following 

chapters contain a detailed literature review (Chapter 2), followed by four chapters 

of results (Chapters 3 to 6) and a general conclusions chapter (Chapter 7). Each of 

the  results  chapters are presented  in  a  style  formatted  for publication, with  the 

style of the target  journal used for  formatting of each  individual chapter. For this 

reason, consistency in formatting between each of the chapters varies.  

 

Description of scientific problem investigated 

 In 2005, a collaborative project between QUT and National Agricultural Research 

Organisation  (NARO), Uganda,  funded by  the Bill  and Melinda Gates  Foundation 

(BMGF), was  initiated with  the  aim  to develop bananas with enhanced  levels of 

pro‐vitamin A and iron. Bananas (Musa spp.) are an important staple food and cash 

crop  for  people  in  East  Africa,  with  East  African  Highland  bananas  the  most 

important group of cultivars in this region. However, these bananas are low in pro‐

vitamin  A  and  iron,  and  hence  banana‐based  diets  are  low  in  these  key 

micronutrients.  The  aim  of  the  project,  therefore,  was  to  address  the  chronic 

micronutrient malnutrition problem  in Uganda through transgenic biofortification 

of  East  African  Highland  bananas.  During  the  course  of  this  project,  it  was 

recognised that a major hurdle to releasing biofortified bananas in East Africa was 

that there was no testing of bananas for viruses done anywhere in East Africa nor 

was there a capacity  for virus‐indexing. The capacity to  index bananas  for viruses 

within  the  region  is  critical  for disease  control  and  the provision of disease‐free 

planting material to farmers.  In addition, knowledge of the viruses present within 

East  Africa  and  their  distribution  is  useful  for  local  disease  control  efforts  and 

regional  quarantine  programs.  In  response  to  these  concerns,  a  supplementary 

2  

project was  funded  by  the  BMGF  to  develop  banana  virus  diagnostics,  use  the 

diagnostics  to survey Uganda and neighbouring East African countries  for viruses 

and transfer the indexing technologies to laboratories in East Africa.  

The two most important viruses of banana in East Africa are Banana bunchy 

top virus (BBTV) and Banana streak virus (BSV). Diagnostic tests for BBTV using PCR 

are  relatively  straight‐forward,  reliable,  sensitive  and  cost‐effective.  However, 

diagnostic methods  for BSV  are  inadequate because of  the  considerable  genetic 

and  serological  diversity  amongst BSV  isolates  and  the  presence  of  endogenous 

BSV  sequences  in  some  banana  cultivars  that  leads  to  false  positives.  The 

development of a diagnostic method that specifically detects the episomal form of 

BSV  in  bananas, which  can  also  detect  the wide  sequence  variability  reported, 

would significantly enhance capacity to undertake BSV indexing. 

 

Overall objectives of the study 

The overall objective of this study was to establish diagnostic methods for banana 

viruses, with  a particular  focus on  the problem of BSV detection,  and use  these 

diagnostic methods for the detection and characterisation of banana viruses in East 

Africa. 

 

Specific aims of the study 

The  specific  aims of  the project were  to  (i) develop diagnostic protocols  for  the 

detection  of  viruses  which  infect  banana  with  a  particular  focus  on  the 

development of a new diagnostic method  for detection of BSV,  (ii)  conduct  field 

surveys  in Uganda,  Kenya  and  Tanzania  to  determine  the  occurrence  of  banana 

viruses, and (iii) characterise any new viruses detected.  

 

 

 

 

3  

Account of scientific progress linking the scientific papers 

The first scientific paper (Chapter 3) describes the development of a novel method 

for the detection of BSV infection in bananas. Diagnosis of BSV infection in banana 

is difficult because there is significant sequence variability reported in BSV isolates 

and because  integrated sequences  lead  to  false positives when using approaches 

based  on  polymerase  chain  reaction  (PCR).  A  novel  rolling‐circle  amplification 

(RCA)‐based  assay which  is  sequence  non‐specific was  developed  and  shown  to 

specifically detect the episomal form of BSV DNA and avoid detection of integrated 

sequences. Further, the assay was shown to be capable of detecting at  least nine 

species of BSV in samples from Australia, Uganda and Kenya.  

  The second scientific paper describes the characterisation of six distinct BSV 

species for which only partial sequences were previously reported. Using samples 

collected in Uganda and Kenya, RCA was used to amplify the complete genomes of 

these viruses, which were subsequently cloned and sequenced. Sequence analyses 

supported the proposal of these isolates as new BSV species (designated as BSUAV, 

BSUIV,  BSULV,  BSUMV,  BSCAV  and  BSIMV).  The  occurrence  of  integrated 

sequences with  similarity  to each of  the  six BSV was also  investigated using PCR 

and species‐specific primers, and these were detected for BSIMV only.  

Despite  the  occurrence  of  integrated  sequences  specific  to  several  BSV 

species within the banana genome, there are circumstances where PCR could still 

be  considered  a  useful method  for  BSV  detection.  For  example,  no  integrated 

sequences identical to episomal BSV occur in the genome of Musa acuminata, the 

progenitor of many important banana cultivars. Additionally, for five species of BSV 

characterised  in  this  study  PCR  was  demonstrated  to  not  detect  integrated 

sequences  in  virus‐free  samples  from  cultivars with  both M.  acuminata  and M. 

balbisiana genetic backgrounds. The third scientific paper reports a comparison of 

RCA and PCR  for  the detection of BSV  in  field  samples  from East Africa. A  large 

collection  of  samples  was  obtained  during  field  visits  to  Kenya,  Tanzania  and 

Uganda as part of an effort to survey for banana viruses. Samples were assayed for 

the presence of BSV using PCR with nine sets of BSV species‐specific primers, and 

4  

by  RCA.  The  results  of  this  screening  demonstrated  that  for  five  of  the 

characterised species of BSV which do not have an integrated counterpart (BSCAV, 

BSUAV,  BSUIV,  BSULV  and  BSUMV),  either  PCR  or  RCA  are  suitable methods  to 

detect  infections.  For  four  additional  BSV  species  known  to  have  integrated 

counterparts in the M. balbisiana genome (BSIMV, BSGFV, BSMYV and BSOLV), PCR 

and RCA were equivalent methods to detect BSV infection in cultivars with a pure 

M. acuminata genetic background. However,  in cultivars with some M. balbisiana 

genome component, many more samples were positive by PCR compared to RCA, 

suggesting detection of integrated BSV sequences as demonstrated in Chapter 3. In 

these samples PCR was not considered suitable for episomal BSV detection. 

Banana bunchy top disease was first reported in Africa in Egypt in 1901, and 

since the 1950s has spread to many countries in sub‐Saharan Africa. Bunchy top is 

not present in Uganda, Kenya and Tanzania, but presents the greatest threat from 

a  virus  to  banana  production  in  these  countries.  Although  diagnosis  of  BBTV  is 

relatively straightforward using PCR, demonstration of  the ability  for a diagnostic 

test to detect  local  isolates  is paramount. Additionally, BBTV has been present  in 

Africa for more than a century, and only a small amount of sequence information is 

available  for  African  isolates.  The  fourth  results  chapter  focussed  on  the 

identification and characterisation of Banana bunchy  top virus  (BBTV)  in  the East 

African countries of Rwanda and Malawi. In Chapter 6, BBTV isolates from Malawi 

and Rwanda were  completely  sequenced  and  characterised. Analyses  confirmed 

previous  reports  which  suggested  that  African  isolates  belonged  in  the  South 

Pacific  subgroup  of  BBTV  sequences.  Samples were  provided  to  laboratories  in 

Uganda, Kenya and Tanzania to use as positive controls for BBTV indexing.  

   

5  

CHAPTER 2 

 

LITERATURE REVIEW 

2.1 Bananas – importance and history  

Bananas  are  among  the world’s most  important  food  crops.  In  terms  of 

gross  value  of  production,  bananas  are  the  developing  world’s  fourth  most 

important  crop  after  rice,  wheat  and  maize  (CGIAR,  2011),  and  constitute  an 

important staple nutrition source for millions of people in tropical and subtropical 

countries.  Bananas  are  the world’s  highest  volume  export  fruit  crop  as well  as 

highest  value  export  crop  (FAO,  2011).  Approximately  100  million  tonnes  of 

bananas are produced annually worldwide, with 15% of production traded on the 

world market. The majority of banana fruit produced globally is consumed locally. 

In  fact,  consumption  in  some  countries  may  be  as  high  as  1  kg/person/day 

(Bioversity  International, 2007).  In  tropical  countries, bananas may be harvested 

year‐round, providing a secure, staple food source high  in carbohydrates, vitamin 

C,  potassium  and  fibre,  and  free  of  fat,  cholesterol  and  sodium  (International 

Banana Association, 2007). 

Most modern cultivated bananas are derived from two wild species, Musa 

acuminata and M. balbisiana, contributing  the  ‘A’ and  ‘B’ genomes,  respectively. 

Bananas can have diploid,  triploid or  tetraploid genomes, and cultivated bananas 

include hybrids within/between the two aforementioned Musa species. Originating 

in  the Asia‐Pacific  region, M.  acuminata was  domesticated  as  early  as  8000  BC. 

With  movement  of  germplasm  westwards,  hybridisation  with  M.  balbisiana 

probably occurred  in  India where  the  latter  species originates  (Price, 1995).  The 

oldest  written  records  of  banana  cultivation  date  from  the  Indus  Valley  in 

approximately  4000  B.C.  (Trager,  1997).  Banana  germplasm  was  moved  as 

populations migrated  throughout  the Asia‐Pacific  region,  followed by movement 

westward  into  the Middle East and Africa. The original  introductions of bananas 

into sub‐Saharan Africa occurred during the first millennium AD  (Price, 1995) and 

subsequent  introductions  occurred  several  times  as  trade  developed  with  the 

6  

Middle  East  and Asia. Many  varieties of bananas unique  to  East Africa probably 

arose  through mutation  and  subsequent  selective  cultivation within  the  region, 

leading the region to be considered a secondary centre of diversity (Davies, 1995).    

Portuguese and Spanish traders were  instrumental  in the dissemination of 

banana and plantain germplasm across  their  trading  routes. The discovery of  the 

Americas prompted the  last great stage  in banana dissemination, with movement 

into  the New World, where  bananas were  considered  the most  important  fruit 

within 100 years of their arrival (Price, 1995).  

The  International Network  for  the  Improvement  of  Banana  and  Plantain 

(INIBAP)  maintain  a  germplasm  resource  collection  in  Leuven,  Belgium.  The 

collection aims to conserve the available genetic variability in banana and plantain 

for future use, under the auspices of the Food and Agriculture Organization of the 

United Nations (FAO). The international collection currently holds 1,168 accessions 

among which 15% are wild  relatives and 75% are  landraces covering most of  the 

genetic  diversity  within  the  genus  Musa  (Bioversity  International,  2007).  A 

duplicate of the Asia‐Pacific accessions is maintained in Taiwan, with approximately 

500  accessions  in  the  collection  there.  In  recent  years,  banana  germplasm 

conservation has also generated considerable interest at a regional level. Collection 

expeditions undertaken  in  centres of origin,  including north east  India,  southern 

China, Vietnam, Philippines and  Indonesia, have  resulted  in  the establishment of 

additional germplasm resources. 

Most cultivated bananas are sterile, parthenocarpic  triploids, and  fall  into 

the Eumusa division of  the genus Musa  (family Musaceae).  Low  levels of  female 

fertility, the  inability to set seed and a narrow genetic base are all constraints on 

genetic improvement (Ortiz et al., 1995). Consumer and producer preferences also 

complicate  progress  in  releasing  improved  cultivars.  Consumers  have  a  narrow 

preference  of  fruit  presentation  and  taste,  while  producers  require  equivalent 

agronomic performance and disease resistance to current market standards. These 

difficulties explain why only a  small group of commercial cultivars  for  the export 

market have remained in production for a relatively long period.  

7  

Natural landraces are still the predominant cultivated bananas, despite the 

efforts  of  plant  breeders  over  the  past  90  years.  Some  progress  in  plant 

improvement has been made, mostly in the area of disease resistance. Breeders in 

the Caribbean and Honduras,  for example, have  incorporated  resistance  to Black 

Sigatoka  (Mycosphaerella  fijiensis)  and  Fusarium  wilt  (Fusarium  oxysporum  fsp. 

cubense)  into  cultivated  triploid  backgrounds,  with  several  agronomically 

promising  cultivars  being  produced  (Silva  et  al.,  2001). Modern  efforts  remain 

focussed  on  the  development  of  disease  resistance  through  crossing  to  wild 

relatives,  and  the  selection  of  acceptable  cultivars  from  wild  germplasm 

collections,  under  the  guise  of  two  international  groups,  Promusa  and  the 

International Musa Testing Program (Bioversity International, 2007).  

Laboratory based genetic modification offers an opportunity to circumvent 

the  traditional  roadblocks  to  genetic  improvement  by  conventional  breeding. 

Characterised  genes  from  banana,  or  other  organisms,  can  be  introduced  using 

biolistics  or  Agrobacterium‐mediated  transformation  processes  (Becker  et  al., 

2000; May et al., 1995; Sagi et al., 1995). Stably transformed plants created using 

these processes are attractive alternatives for pest and disease control in resource 

poor areas, where farmers cannot afford to purchase chemical controls 

.  

2.2 Bananas in East Africa  

East Africa (EA) is generally considered to include Kenya, Uganda, Tanzania, 

Rwanda and Burundi. The eastern  region of Democratic Republic of  the Congo  is 

also included when describing the area known as the East African Highlands (EAH). 

This region  is  located along the western border of the Rift Valley and comprises a 

system of plateaus, mountain valleys and lakes. Around 20% of the worlds banana 

production occurs in the EAH, principally for local consumption and trade (Davies, 

1995). Banana  is seen as the major food staple  in the EAH, where consumption  is 

as high as 1kg/person/day (Bioversity International, 2007).  

8  

In contrast to plantation style production in Central and South America and 

the Philippines where  large volumes of dessert bananas are produced  for export, 

banana cultivation  in EA  includes a broad range of cooking, dessert and beverage 

(i.e.  beer)  banana  varieties,  predominantly  grown  by  small  landholders  and 

subsistence  farmers.   Personal varietal preference and  cultural associations have 

driven  a  highly  diverse  collection  of  introduced  and  locally  selected  banana 

varieties collectively known as East African Highland Bananas  (EAHB). These  local 

varieties  are  still  grown  preferentially,  although  in more  recent  times  there  has 

been a slight shift towards cultivation of Cavendish type banana varieties.  

As a staple food crop in the EAH, fruit production is required year‐round. In 

the highland  regions production  is  limited  in  elevation  to  900‐1800m  above  sea 

level, with  frosts occurring at higher altitudes. The majority of production  is rain‐

fed, with  the area  receiving  reliable  rainfall, peaking  in March‐May and October‐

November. While soils are moderately fertile, supplementary nutrition  is required 

by  application  of  household  refuse, mulched  banana  trash  and  animal manure. 

Yields can vary widely between cultivars (often dependent on cultivation practices) 

and peaks around 4‐5 months after the high rainfall periods for each local region. 

Average banana yields are 6‐17  t/ha‐1  (Lufafa et al., 2002). Major  constraints on 

production historically  include  the banana weevil, Cosmopolites sordidus, present 

in all EAH growing regions, several species of nematodes and a number of diseases, 

the most important of which include Fusarium wilt, Xanthomonas wilt, bunchy top, 

leaf steak  (viral) and  the black and yellow  leaf streak  (Sigatoka) diseases  (Davies, 

1995).   

Uganda  is  East  Africa’s  largest  banana  producer, with  annual  production 

estimated at over 10 million tonnes, comprised mostly of EAH cooking  (70%) and 

beer (20%) cultivars, with the remaining 10% divided between dessert bananas and 

plantains  (Lescot and Ganry, 2010; van Asten, et al., 2010). EAH cooking bananas 

are  considered  the  most  important  staple  crop  in  the  EA  great  lakes  region 

(Bagamba  et  al.,  2010).  Historically,  bananas  have  been  produced  for  home 

consumption  under  a  low‐input  system  and  have  been  seen  as  a woman’s‐crop 

produced  for  household  food  self  sufficiency.  Changing  socio‐economic  factors 

9  

over recent decades, related to declining  income from traditional cash crops such 

as coffee and cotton and increased urbanisation of the population in Uganda, have 

seen  an  increased  demand  for  banana  production,  resulting  in  a  concomitant 

increase  in areas planted to banana, particularly  in the south west of the country 

(Bagamba et al., 2010).  

In  Kenya,  bananas  account  for  7.4%  (approx.  74  000  ha)  of  the  gross 

cropped area and 55% of  the  total area under  fruit production, with production 

approximately  1.2 million  tonnes  per  year  (Lescot  and Ganry,  2010).  In western 

Kenya,  banana  contributes  40‐50%  of  household  income  (Mwangi  et  al.,  2010). 

Historically  production  has  been  constrained  by  pests  and  diseases  (particularly 

banana  weevils,  nematodes  and  Fusarium  wilt),  non‐availability  of  disease‐free 

planting materials and poor agronomic practices (Njuguna et al., 2010). Production 

is mainly  smallholder  farming, with 80% of banana producers having an average 

production area of 0.12 ha, and only 2% of farms >1.98 ha.  

In Tanzania, annual production of banana is approximately 750 000 tonnes 

(Lescot  and  Ganry,  2010)  produced  on  about  300  000  ha  divided  amongst  five 

banana  producing  areas,  with  only  maize  and  cassava  produced  in  greater 

quantities.  Utilisation  is  mainly  local  with  approximately  60%  cooked/fresh 

consumption,  30%  brewing  and  the  remainder  divided  amongst  other  products 

(wine/dried fruit/flour) (Mgenzi et al., 2010).  

There are few reports of viruses affecting banana production in East Africa. 

Banana bunchy top virus (BBTV) has been reported from Burundi and Rwanda, but 

not  further east  (Dale, 1994, Thomas et al., 1994). However, bunchy  top  is now 

widespread across the equatorial region of the African continent and is present in a 

number of countries bordering EA  to  the west and south  including Mozambique, 

Malawi,  Zambia  and  the Democratic  Republic  of  the  Congo  (Kumar  and Hanna, 

2008) and presents the greatest risk of the virus diseases to banana production in 

the  region. Streak disease  is widespread  in Uganda  (Harper et al., 2002, 2004 & 

2005),  and  is  also present  in Kenya  (Karanja  et  al.,  2008).  It  is  likely  that  streak 

disease  is  present  in  the  other  countries  in  EA  although  its  occurrence  is 

10  

unconfirmed  at  present.  Cucumber  mosaic  virus  (CMV)  has  been  recorded  in 

banana  in Kenya (Anne Wangai, personal communication), although not from the 

other countries, however the widespread distribution of CMV in other hosts means 

that CMV is likely to be present in most banana growing areas. Bract mosaic, mild 

mosaic and Banana virus X have not been reported from EA.  

Of  the banana diseases  caused by viruses, only  streak disease,  caused by 

Banana  streak  virus  (BSV),  has  been  researched  to  a  reasonable  extent  in  EA. 

Kubiriba  et  al.  (2001a)  studied  the  distribution  of  streak  in  infected  fields  and 

showed  that  distinct  clusters  of  diseased  plants  were  found  amongst  healthy 

plants,  and  that  a  slow moving  vector was  likely  associated with  plant‐to‐plant 

transmission.  Transmission  studies  showed  that  both  Dysmicoccus  brevipes 

(pineapple  mealybug)  and  Saccharicoccus  sacchari  (sugarcane  mealybug)  could 

vector the causal virus (one of a number of BSV species which  infect banana)  in a 

semi‐persistent manner, while the banana aphid (Pentalonia nigronervosa) did not 

(Kubiriba  et  al.,  2001b).   Harper  et  al.  (2002) used  PCR  and  ELISA  to  study  field 

samples of banana showing streak‐like symptoms from 14 regions in Uganda. Fifty 

one of 59 samples collected tested positive for badnavirus infection, and PCR with 

degenerate primers proved a better detection method than ELISA. These authors 

later demonstrated approximately 16 different BSV species associated with streak 

disease  in Uganda  (Harper et al., 2005).  In Kenya, Karanja et al.  (2008)  identified 

four species of BSV from field samples collected in central/western districts. 

   

11  

 

2.3 Virus diseases of bananas 

2.3.1 DNA viruses 

2.3.1.1 Streak disease 

Introduction  

Banana streak disease was first reported in Morocco in 1974 (Lassoundiere, 

1974,  in  Lockhart,  1986)  but  an  earlier  report  from  the  Ivory  Coast,  circa  1958, 

probably  describing  the  symptoms  of  streak  disease  as  mosaic,  was  noted  by 

Lockhart and Jones (2000b). The disease has since been reported from numerous 

countries in Africa, South America and the Pacific, and probably occurs worldwide 

where  bananas  are  grown  (Lockhart  and  Jones,  2000b;  Lockhart  and Olszewski, 

1993). Symptoms of streak disease vary widely and are  influenced by the cultivar, 

virus species and environmental conditions. The most common symptoms  include 

narrow,  discontinuous  (sometimes  continuous)  chlorotic  and/or  necrotic  streaks 

which run parallel to the veins of the leaf lamina (Lockhart and Jones, 2000b) (Fig. 

1).  The  leaf  streaks  become  darker  as  the  leaves  age,  eventually  turning  dark 

brown‐black.  Interestingly,  symptoms  can  regress  with  periods  of  symptomless 

growth  occurring  before  the  disease  re‐emerges  at  later  stages  of  growth, with 

temperature considered a  factor  in disease expression  (Dahal et al., 2000). Other 

symptoms associated with streak disease include stunting, choking (constriction of 

the bunch on emergence), cigar‐leaf necrosis, internal necrosis of the pseudostem, 

and leaf/fruit distortion (Lockhart and Jones, 2000b). 

Banana streak disease can cause reduced plant growth and vigour and a reduction 

in bunch size and yield (Lockhart and Jones, 2000b). In Australia, Cavendish cultivar 

‘Williams’ showed a 7% reduction in bunch weight under disease conditions, and a 

delay  in  harvest  interval  compared  with  healthy  plants  (Daniells  et  al.,  2001). 

Additionally, a 5% reduction  in  fruit  length was observed  in diseased plants.    In a 

separate study conducted  in Nigeria, Dahal et al.  (2000)  reported  losses of up  to 

15% in some banana cultivars with banana streak.  

12

 

 

 

 

     

Fig. 1. Symptoms of streak disease in leaf tissue. A) chlorotic flecking and B) 

chlorotic and necrotic flecks.

A) 

B) 

13  

Causal agent and Taxonomy 

Banana  streak  disease  is  caused  by  a  collection  of  BSV  species  (genus 

Badnavirus,  family  Caulimoviridae).  Badnaviruses  are  characterised  by  non‐

enveloped bacilliform particles of 130‐150 nm x 30 nm (Fig. 2) and have a circular, 

non‐covalently closed, double‐stranded DNA genome of 7.4 kbp (Lockhart, 1990; 

Hull  et  al.,  2005).  All  badnaviruses  typically  contain  three  open  reading  frames 

(ORFs) on the virus‐sense coding strand (Fig. 2). ORF 1 encodes a small protein of 

unknown function which has been associated with virions (Cheng et al., 1996). ORF 

2 encodes a protein of 14 kDa with a non‐specific DNA‐ and RNA‐binding activity 

(Jacquot  et  al.,  1996).  This  protein may  function  in  virion  assembly  due  to  the 

presence  of  a  predicted  N‐terminal  coiled‐coil  domain  which  supports  self‐

interaction to form a tetramer (Leclerc et al., 1998). The large polyprotein encoded 

by ORF 3 contains domains associated with movement,  the virus capsid, aspartic 

protease,  reverse  transcriptase  (RT)  and  ribonuclease  H  (RNaseH)  functions. 

Additional conserved genomic  features  include  the presence of a short sequence 

(16‐18 nucleotides) complementary to plant transfer‐RNA methionine (which binds 

to  the  RNA‐intermediate  and  primes  plus‐strand  DNA  synthesis),  several 

discontinuities  in  the  DNA  genome  which  are  involved  in  replication,  and 

regulatory  sequences associated with expression of  the genome  (as‐1, TATA and 

PolyA signals) (Hull, 2002). 

Based on sequence  information, a number of distinct BSV sequences have 

been reported from banana. Originally  isolates were referred to as Banana streak 

virus  (BSV, Lockhart, 1986) with  isolates differentiated based on  their  location or 

their host cultivar. For example, Banana streak virus–Onne reported by Harper and 

Hull  (1998)  was  originally  collected  at  the  International  Institute  for  Tropical 

Agriculture (IITA) Onne field station in Nigeria. The sequence reported in this paper 

later came to be known as Banana streak virus strain OL (BSV‐OL), after a sequence 

identical  to  the  episomal  form  was  characterised  from

14

  

 

 

 

 

 

 

  

 

 

 

 

 

 

 

 

 

 

 

Fig. 2. (A) Electron micrograph showing virions of Banana streak virus and 

(B)  typical  genome  organisation  of  Badnavirus  genus members  showing 

the three open reading frames (ORFs) and functional domains of ORF3. 

   

A) 

B) 

15  

the nuclear genome of banana cultivar Obino l’Ewai (Geering et al., 2001) and was 

nearly identical to an isolate from Australia named BSV‐RD, or ‘Red Dacca’ after the 

host  cultivar  studied  (Geering  et  al.,  2000).  Geering  et  al.  (2000)  also  reported 

several other sequences named BSV‐Cav (for ‘Cavendish’), BSV‐Mys (for  ‘Mysore’) 

and  BSV‐GF  (for  ‘Gold  Finger’).  The  BSV‐Mys  isolate  was  later  completely 

characterised and  renamed Banana  streak Mysore virus  (BSMysV; Geering et al., 

2005b). 

Around  this  time  two  important  studies were undertaken with  regards  to 

badnavirus infection in bananas. In the first, a large field collection of bananas from 

Uganda was demonstrated, using a PCR‐based strategy, to contain widely diverse 

BSV  sequences  and  thirteen  new  isolates  were  sequentially  designated  Banana 

streak Uganda  A‐M  virus  respectively  (BSUgA‐MV;  Harper  et  al.,  2004 &  2005). 

Furthermore,  Geering  et  al.  (2005a)  reported  36  groups  of  badnavirus‐like 

sequences  present  in  the  genome  of  selected  Musa  accessions.  Evidence  was 

presented that both BSMysV and the previously described BSV‐GF had  integrated 

counterparts, as well as another partially sequenced  isolate from Australia named 

BSV‐Imové (BSImV), named again for  its host cultivar (Gayral et al., 2008; Geering 

et  al.,  2005a  &  b;  Geering  et  al.,  2011).  Endogenous  virus  sequences  were 

described as ‘Banana endogenous virus’ (BEV) with a numerical assignment (1‐33), 

with  the  episomal  counterpart  taking precedence where  identified  (eg. BSMysV, 

BSImV and BSV‐OL) (Geering et al., 2005a). More complication in naming has arisen 

with  the  publication  of  an  additional  isolate  named  Banana  streak  Acuminata 

Vietnam  virus  (BSAcVnV)  (Lheureux  et  al.,  2007)  and  an  as‐yet  unpublished 

badnavirus  isolate which  is completely  sequenced, named Banana  streak Yunnan 

virus (GenBank accession no. DQ092436). 

Classification  of  Badnavirus  species  is  based  on  a measure  of  sequence 

similarity between  isolates, with nucleotide sequences which differ by more than 

20%  within  the  conserved  reverse  transcriptase‐ribonuclease  H  (RT/RNaseH) 

coding region of ORF 3 considered distinct species  (Hull et al., 2005). For naming 

purposes  however,  the  historical  account  can  often  be  confusing,  where  no 

established  convention  exists  when  a  plant  species  plays  host  to many  similar 

16  

viruses and this is further complicated where endogenous counterparts exist, some 

of  which  are  infectious  and  others  not.    A  resolution  has  recently  been 

implemented  by  the  International  Committee  for  Taxonomy  of  Viruses  (ICTV) 

Caulimoviridae  study  group  with  a  two  letter  abbreviated  naming  system 

implemented and  the  retention of historical host/symptom descriptors  (Geering, 

2010). As  such,  the  isolates previously  recognised as Obino  l’Ewai, Mysore, Gold 

Finger  and  Acuminata  Vietnam  (the  only  banana‐infecting  badnavirus  species 

which are officially recognised by the ICTV) are presently known as Banana streak 

OL virus (BSOLV), Banana streak MY virus (BSMYV), Banana streak GF virus (BSGFV) 

and  Banana  streak  VN  virus  (BSVNV),  respectively.  This  recently  established 

naming  convention  will  be  used  throughout  the  remaining  sections  for  clarity, 

although  throughout  the  results  chapters which  follow  the usage has evolved  to 

this form over time. Where the BSV species is not explicitly stated in the literature, 

the term ‘BSV’ has been retained. 

 Integrated  virus  sequences  have  been  reported  in  a  number  of  plant 

species,  including  banana,  rice,  petunia,  potato,  tomato  and Nicotiana  spp  (see 

references  in  Geering  et  al.,  2010  and  Staginus  et  al.,  2009).  For  purposes  of 

classification, these sequences are usually identified with episomal counterparts if 

they  exist  or,  if  not,  with  the most  similar  sequence  previously  reported.  This 

allows a taxonomic placement of these sequences whether they are determined to 

be putatively functional (based on the integrity of putative ORFs) or not functional 

due  to  the  absence  of  ORFs  or  a mutation  in  putative  ORFs.  However,  several 

authors have proposed naming conventions  for  the distinction of episomal  forms 

from integrated forms (both functional and non‐functional). 

Where  an  episomal  counterpart has previously been  reported  the use of 

the prefix ‘e’ (endogenous) has been proposed (Staginus et al., 2009; Geering et al., 

2010). In cases where the integrated sequence is functional and can be expressed 

to  give  rise  to  episomal  infection  the  prefex  ‘ea’  (endogenous  activatable)  is 

suggested (Staginus et al., 2009). Where no episomal form  is recognised, Staginus 

et al. (2009) proposed that the naming system comprise the host plant initials plus 

the suffix ‘EPRS’ (endogenous pararetroviral sequence), for example ‘SotuEPRS’ for 

17  

Solanum  tuberosum  endogenous  pararetroviral  sequence.  Geering  et  al.  (2010) 

disagree  with  the  proposal  to  include  the  term  pararetrovirus  as  a  taxonomic 

descriptor  as  this  is  not  a  recognised  taxon  name.  Additionally,  these  authors 

dispute the differentiation applied to functional and non‐functional sequences, as a 

taxonomic  framework  must  cope  with  both  living  and  dead  organisms.  As  a 

functional  taxonomic  framework  exists  at  present  (under  the  ICTV  system), 

integrated  virus  sequences with  sufficient  information  should  be  treated within 

this  framework  (Geering  et  al.,  2010).    Furthermore,  these  authors  also 

recommend  against  the  use  of  the  suffix  ‘a’  or  ‘d’  for  the  designation  of 

‘activatable’  or  ‘dead’  as  proposed  by  Staginus  et  al.  (2009)  as  many  factors 

contribute  to  the expression of  such  integrated  sequences,  and  this  information 

can  be  handled  in  genus/species  descriptions  without  inclusion  in  a  naming 

convention.  

 

Characterisation  

Full‐length sequencing of a Nigerian BSV  isolate, BSOLV, confirmed earlier 

reports  based  on  partial DNA  sequences,  that  BSD was  caused  by  a  Badnavirus 

(Harper and Hull, 1998). BSOLV was most similar to Sugar cane bacilliform MO virus 

(SCBMOV) (51.6%) at the nucleotide level, however at the amino acid level BSOLV 

was most  similar  to  Commelina  yellow mottle  virus  (CoYMV).  In  Australia,  four 

isolates of BSV were cloned and sequenced from four distinct cultivars (Geering et 

al., 2000). One  isolate  (BSV‐RD) was  identical  to  the BSOLV  sequence previously 

reported by Harper and Hull  (1998). While  the  four  isolates  from Australia were 

more similar to each other than other reported badnaviruses, sequence similarity 

was only 66.4 to 78.2%, low enough to be considered distinct species. Two of these 

isolates, BSGFV and BSMYV, were later completely sequenced (GenBank accession 

no. AY493509; Geering et al., 2005b). Harper et al. (2004) reported that variability 

of  BSV  sequences  in  Ugandan  banana  was  extremely  high  based  on  DNA 

sequencing, and later classified 13 new species (Harper et al., 2005). However this 

study only reported partial sequences based on PCR‐amplification of a small region 

18  

of ORF 3 (encoding a part of the RT/RNaseH domain) and no further evidence has 

been presented to confirm the episomal origin of these amplicons.   Three further 

distinct full‐length BSV sequences, namely BSVNV (Lheureux et al., 2007), Banana 

streak Yunnan virus  (unpublished) and Banana streak  IM virus  (previously BSImV) 

have also recently been characterised (Geering et al., 2011).  

 

Integrated sequences and their expression 

Since initial reports describing the molecular characterisation of BSOLV, and 

the  subsequent  use  of  PCR  for  detection  of  the  viral  DNA,  researchers  have 

suggested  that  sequences  homologous  to  the  BSV  genome  are  present  in  the 

genome  of  bananas  (Harper  and  Hull,  1998).  This  was  supported  by  studies 

showing  that  viral  DNA  hybridized  to  genomic  DNA  of  banana  and  in‐situ 

hybridization  studies which  revealed  two distinct  integrants of BSOLV  in banana 

cultivar Obino l’Ewai (Harper et al., 1999b; Ndowora et al., 1999). The observation 

that  tissue culture plantlets of  improved hybrids expressed high  levels of banana 

streak  disease,  despite  parent  plants  being  apparently  virus  free,  prompted 

researchers  to  investigate  whether  infection  could  arise  from  integrated 

sequences.  Evidence  was  presented  to  support  this  hypothesis,  with  the  virus 

isolates  obtained  from  tissue‐cultured  plants  displaying  genetic  uniformity 

(Ndowora  et  al.,  1999),  in  stark  contrast  to  isolates  arising  from  field  infections 

which  are  generally  genetically  different  (based  on  studies  using  RFLPs).    This 

suggested  for  the  first  time  that  viral  sequences  integrated  into a plant genome 

could become activated to produce virus infection (Harper et al., 1999b; Ndowora 

et al., 1999). Characterisation of integrated BSOLV sequences showed that the viral 

sequences were  flanked  by  direct  repeats,  suggesting  a model  for  activation  by 

homologous  recombination.  Additionally,  BSOLV  was  shown  to  be  integrated 

within  a  range  of Musa  genotypes,  but  linked  to  the  B‐genome  of Musa  spp. 

(Geering et al., 2001).  

Geering et al. (2005a) characterised badnavirus sequences integrated into a 

range of Musa spp. and  identified 36 distinct groups of sequences  from 103 PCR 

19  

clones,  with  less  than  85%  similarity  between  sequence  groups.  Based  on  the 

detection of many groups of  integrated badnavirus sequences  in  the genomes of 

the two progenitor species of edible bananas Musa acuminata and M. balbisiana, 

with distinct sequence groups detected in each species, the authors concluded that 

badnaviruses  had  integrated  into  the Musa  genome  independently many  times, 

and  that  the  integration probably occurred after speciation of M. acuminata and 

M.  balbisiana.  Interestingly,  many  of  these  integrated  sequences  were  not 

conceptually translatable due to mutations within the sequences. Several of these 

sequence  groups  were  identical  to  episomal  badnavirus  sequences  previously 

identified  from  banana  and many were  similar  to  putative  episomal  sequences 

reported  in Ugandan  bananas  (Gayral  and  Iskra‐Caruana,  2009).  Since  this  time, 

studies  have  confirmed  the  presence  of  BSMYV  in  the  B‐genome  of  banana 

(Geering et al., 2005b) and the presence of BSGFV sequences which are integrated 

and  can be expressed  to give  rise  to episomal  infection  (Gayral et al., 2008). To 

date,  no  activatable,  or  ‘live’  sequences  have  been  characterised  from  the  A‐

genome. 

Dallot  et  al.  (2001)  clearly  demonstrated  that  activation  of  integrated 

sequences occurs  in the synthetic (i.e. bred) cultivar FHIA‐21 during tissue culture 

multiplication.  Activation  was  sporadic  and  was  greatest  during  the  cellular 

proliferation stage of culture  (compared to the rooting or acclimatisation stages), 

with  increased activation seen with  increased cycles of multiplication. Côte et al. 

(2010)  later demonstrated activation of  integrated BSOLV  from both natural and 

synthetic Musa hybrids, while activation of  integrated BSGFV only occurred  in the 

synthetic  hybrid  studied.   Meyer  et  al.  (2008)  were  able  to  transmit  episomal 

BSOLV, originating from integrated sequences, using several species of mealybug.  

 

Diagnostic testing 

An antiserum was first prepared for detection of  ‘BSV’ by Lockhart (1986). 

Initial  studies  in  ‘BSV’  detection  using  serological  methods  were  encouraging, 

however  a  high  level  of  serological  heterogeneity  was  later  revealed  when 

20  

screening a wider range of  isolates (Lockhart and Olszewski, 1993). One approach 

to  help  overcome  the  large  serological  variability was  to  produce  an  antiserum 

from a mixture of  isolates. An antiserum raised against 30  isolates of  ‘BSV’ and a 

serologically  related  badnavirus  which  naturally  infected  sugarcane  and  could 

infect  banana  experimentally  (historically  named  Sugar  cane  bacilliform  virus 

(ScBV)) was used with some success to detect a range of ‘BSV’ isolates. One major 

concern  with  reliability  of  this  approach  is  that  availability  of  the  antisera  will 

fluctuate  over  time  and  there  is  some  difficulty  in  reproducing  the  range  of 

detection  when  subsequent  antisera  are  prepared.  As  such,  there  is  a  greater 

attraction  in  developing  a  diagnostic  assay  based  on  the  detection  of  the  viral 

nucleic acid.  

The high level of serological variability observed in ‘BSV’ isolates is reflected 

in  the high  levels of diversity seen  in  the viral DNA. DNA probes were generated 

that  would  detect  individual  isolates  of  ‘BSV’,  but  no  cross‐hybridisation  was 

observed  amongst  probes  and  differing  virus  isolates  (Lockhart  and  Olszewski, 

1993).  This  high  level  of  genetic  variability  is  characteristic  of  badnaviruses  and 

other members of  the Caulimoviridae and  is due  to  their  replication  strategy. All 

Caulimoviridae members are pararetroviruses which replicate by producing an RNA 

intermediate from the dsDNA genome. This RNA molecule is used as template for 

translation of viral proteins, as well as template for the production of genomic DNA 

by  a  virus‐encoded  reverse  transcriptase  (RT)  (Harper  and Hull,  1998).  The  viral 

encoded RT  lacks proof‐reading  function and so errors  in  replication  lead  to high 

levels of genetic diversity.  

Development  of  PCR‐based  diagnostic  tests  for  several  badnaviruses, 

including ScBV, Taro bacilliform virus (TaBV) and Pineapple bacilliform virus (PBV), 

have  targeted conserved  regions of  the genome  in ORF 3, where  the RT/RNaseH 

domains  show  the  highest  levels  of  sequence  conservation  (Braithwaite  et  al., 

1995; Thomson et al., 1996; Yang et al., 2003). The PCR primers reported by Yang 

et al. (2003) have been used for the successful detection of a range of BSV isolates 

(Cherie Gambley, personal communication).    

21  

Harper  and  Hull  (1998)  developed  a  PCR  assay  for  BSOLV  based  on  the 

sequence  of  ORF  3.  Screening  of  banana  accessions  in  this  study  revealed  an 

unusually  high  level  of  infection  compared  to  results  with  ELISA  and  symptom 

expression,  and  it was  suggested  that  integration  of  the  virus  occurs  (discussed 

previously). Geering et al. (2000) also reported several species‐specific primer sets 

for the detection of different BSV characterised from banana in Australia, including 

BSGFV, BSV‐Cav and BSMYV. However, these primers are not suitable for detection 

of BSMYV and BSGFV  from banana cultivars with a B‐genome component due  to 

the presence of eBSMYV and eBSGFV.  

Integrated  badnavirus  sequences  pose  a  serious  challenge  to  diagnostic 

testing  in Musa  spp.  An  assay  that  will  detect  episomal  (non‐integrated)  virus 

sequences may also detect integrated sequences due to similarity in the sequences 

used to design PCR primers.   To avoid detecting  integrated sequences, diagnostic 

assays  need  to  exclude  host  plant  DNA  from  detection.  To  allow  detection  of 

episomal virus DNA only,  immuno‐capture  (IC)‐PCR  is used  (Geering et al., 2000; 

Harper et al., 1999a; Le Provost et al., 2006). A broad spectrum antiserum is used 

to  trap  virus particles  from  crude plant extracts  in PCR  tubes. Washing  removes 

unbound  materials  including  genomic  DNA  and  the  viral  particles  are  heat 

denatured, allowing PCR on DNA within  the  trapped virus particles only.  Several 

sets  of  PCR  primers,  including  degenerate  and  specific,  have  been  reported  for 

detection of BSV in banana using this procedure (Dallot et al., 2001; Harper et al., 

2002; Le Provost et al., 2006).  

Unfortunately,  IC‐PCR  is  complicated  by  the  non‐specific  binding  of  host 

plant DNA to the capture vessel (Iskra‐Caruana et al., 2009; Le Provost et al., 2006), 

so  the method  was  improved  further  by  the  addition  of  PCR  primers  for  host 

genome DNA  in  a multiplex  IC‐PCR  format  (Le  Provost  et  al.,  2006).  IC‐PCR was 

shown  to be significantly more  sensitive  for BSV detection  than  immuno‐sorbent 

electron  microscopy  (ISEM)  or  triple‐antibody  sandwich  ELISA  (TAS‐ELISA) 

(Agindotan et al., 2006). Unfortunately, this assay format is still confounded by the 

high serological variability and serum supply problems associated with ELISA.  

22  

 

Epidemiology of BSV 

Transmission  of  BSV  occurs  both  vegetatively  (in  suckers  taken  from 

infected  mother  plants  and  through  tissue‐culture  propagation  of  infected 

explants)  and  by  several  mealybug  (Hemiptera:  Coccoidea:  Pseudococcidae) 

species, but not mechanically (Lockhart and Jones, 2000b). Mealybug species which 

have  been  confirmed  as  vectors  include  the  citrus mealybug,  Planococcus  citri 

Russo  (Lockhart and Olszewski, 1993), Pseudococcus comstiki Kuwana  (Su, 1998), 

both  the pineapple mealybug Dysmicoccus brevipes Cockerell and  the  sugarcane 

mealybug Sacchirococcus sacchari Cockerell  (Kubiriba et al., 2001b), and  the vine 

mealybug Planococcus ficus Signoret (Meyer et al., 2008). Additionally,  isolates of 

‘ScBV’ can be  transmitted  from sugarcane  to banana by  the sugarcane mealybug 

(Lockhart and Olszewski, 1993).  

The  in‐field  spread  of  BSV  by  vectors  is  relatively  slow  with  most 

transmission occurring vegetatively via the movement of infected planting material 

during  propagation.  As  supply  of  planting  material  increasingly  involves  tissue 

culture,  there  is  an  opportunity  to  spread  ‘BSV’  (and  the  other  banana  viruses 

discussed) by propagating diseased mother plants. Tissue culture has been shown 

to naturally eliminate up  to 52% of  ‘BSV’  infections, and  this can be  increased  to 

90% using cryopreservation and chemical treatments (Helliot et al., 2002; Helliot et 

al., 2003).  These methods may be desirable to recover elite planting material from 

infection, but virus free source plants are essential for the supply of clean planting 

material.  In  the  case  of  several  BSV  species  there  are  complications  with  the 

development of an effective assay  for source plant screening  that will not  falsely 

detect  integrated forms of the virus. In addition, plantlets will need to be assayed 

following  tissue  culture  to  ensure  that  virus  infection has not  resulted  from  the 

activation of  integrated sequences  in the banana genome, particularly  in the case 

of those cultivars containing the B genome. 

 

23  

2.3.1.2 Bunchy top disease 

Introduction  

Banana bunchy  top disease  is  the most  important viral disease of banana 

(Dale, 1987). Bunchy top was first recorded in Fiji in 1879 and has since spread to a 

number of  countries  in  the  south Pacific, Asia and Africa  (Magee, 1927; Thomas 

and  Iskra‐Caruana,  2000;  Geering  2009a).  Symptoms  of  bunchy  top  include  a 

narrow,  upright  appearance  of  the  plant  apex  and  dark  green  streaks  on  the 

petioles, midribs  and  leaf  veins  (Fig.  3).  Infected  plants  produce  no  fruit,  or  a 

reduced bunch with no market value. Bunchy top is caused by Banana bunchy top 

virus  (BBTV)  (Harding  et  al.,  1991;  Thomas  and  Dietzgen,  1991).  The  virus  is 

characterised  by  isometric  virions  of  18‐20  nm  (Fig.  3)  with  a  ssDNA  genome 

consisting  of  at  least  six  components  (Burns  et  al.,  1995).  Plant  to  plant 

transmission is by the black banana aphid, Pentalonia nigronervosa (Magee, 1927) 

(Fig. 3) in a persistent manner, although the virus does not replicate  in the vector 

(Hafner  et  al.,  1995).  Vegetative  transmission  occurs  through  rhizomes,  suckers 

and tissue cultured plants and  is the major  factor  for  long distance movement of 

the virus (Thomas et al., 1994).  

 

Causal agent and Taxonomy 

BBTV is the type member of the genus Babuvirus in the family Nanoviridae. 

Viruses  in  this  group  contain  at  least  six  circular,  single‐stranded  (ss)  DNA 

molecules all encoding at least one protein (Gronenborn, 2004; Vetten et al., 2005) 

(Fig.  4).  Each  DNA  component  has  two  common  regions;  a  common  stem‐loop 

region (CR‐SL) of 69 nucleotides that  is 62% conserved between viral components 

and a major common region (CR‐M) located 5’ to the CR‐SL, of 92 nucleotides, with 

76% conservation between components (Burns et al., 1995). Beetham et al. (1997) 

showed  that  BBTV  DNA‐R  encodes  two  ORFs  and  showed  that  both  ORFs  are

24

 

        

 

 

Fig 3. Symptoms of bunchy  top disease  including  (A) dark green streaking 

on  petiole;  B)  yellowing  of  the  margins  of  leaf  lamina;  and  C)  upright 

growth habit  and  stunting  symptoms.   Virions of BBTV  are  shown  in  (D); 

while the aphid vector of BBTV is shown in (E). 

 

A

C) 

B

D

E) 

25  

transcribed. The major ORF of BBTV DNA‐R (labelled DNA‐1  in Fig. 4) encodes the 

viral  replication  initiation protein, also  known as  the master Rep  (Harding et al., 

1993; Horser et al., 2001), while DNA‐S, ‐M, ‐C and ‐N (labelled DNA‐3, ‐4, ‐X1 and ‐

5  in Fig. 4) encode the viral coat protein (Wanitchakorn et al., 1997),  intracellular 

movement protein, retinoblastoma  like binding protein (Clink) and nuclear shuttle 

protein  (Wanitchakorn et al., 2000a), respectively. No  function has been ascribed 

to  DNA‐U3  at  present,  or  the  small  internal  gene  of  DNA‐R.  Additional  Rep‐

encoding  components,  named  satellite DNAs,  are  also  known  to  occur  in  BBTV‐

infected bananas. These satellite DNAs also encode Rep proteins, but in contrast to 

the  master  Rep  protein  which  can  initiate  replication  of  all  other  genomic 

component,  these  Reps  are  only  capable  of  self‐replication  (Gronenborn,  2004). 

Interestingly,  satellite  DNAs  are  only  associated  with  Asian  isolates  of  BBTV 

(discussed below) (Bell et al., 2002; Horser et al., 2001). 

Studies  of  geographic  isolates  of  BBTV  have  identified  two  distinct 

subgroups  based  on  sequence  analysis  of  DNA‐R  (Karan  et  al.,  1994),  ‐S 

(Wanitchakorn  et  al.,  2000b)  and  ‐N  (Karan  et  al.,  1997).  The  ‘South  Pacific’ 

subgroup  includes  isolates  from  Australia,  Burundi,  Egypt,  Fiji,  India,  Tonga  and 

Western Samoa, while the ‘Asian’ subgroup includes isolates from the Philippines, 

Taiwan  and  Vietnam.  Sequence  variation  of  DNA‐R  within  isolates  of  each 

subgroup  ranged  from  1.9%  (South  Pacific)  to  3.0%  (Asian),  while  variation 

between  isolates of  the  two  subgroups was as high  as 10%  (Karan  et al., 1994). 

Greater  variability was  also  observed  in  sequences  of DNA‐N  in Asian  subgroup 

members  (9.9%)  compared  to  South‐Pacific  subgroup  members  (3.2%),  with 

sequences  of  this  DNA  component  showing  greater  variability  overall  (14.5%) 

compared with  DNA‐R  sequences  (Karan  et  al.,  1997).  Using  coat  protein  gene 

sequences  (DNA‐S ORF), up  to 13% nucleotide variability was observed between 

isolates  of  the  two  subgroups,  with  sequence  variability  within  the  three

26

 

 

 

 

Fig.  4.  Nanovirus  genome  organisation.  Individual  DNAs  are  grouped 

according  to encoded proteins. M‐Rep: master Rep protein; CP:  capsid 

protein;  Clink:  cell  cycle  link  protein;  MP:  movement  protein.  X1‐X4: 

proteins  of  unknown  function;  grouping  is  according  to  sequence 

similarity. Genome component designations used for each virus are given 

below  each  DNA.  A  dash  (‐)  behind  a  virus  name  denotes  that  a 

corresponding  DNA  has  not  been  identified  from  this  virus.  Arrows 

represent  open  reading  frames;  (><):  inverted  repeat  sequence  at  the 

replication  origins  (ori);  (*):  TATA‐boxes;  (~):  polyadenylation  signals 

(figure from Gronenborn, 2004). 

 

27  

Asian  subgroup  isolates  again  greater  than  the  South  Pacific  subgroup  isolates 

studied (Wanitchakorn et al., 2000b). 

Further  isolates  have  been  sequenced  since  these  reports,  although  in 

many cases the sequences of any or all of the viral DNAs are not complete. In spite 

of  this,  additional  South  Pacific  subgroup  isolates  have  been  reported  from 

Cameroon  (Oben  et al., 2009), Hawaii  (Xie  and Hu, 1995), Pakistan  (Amin  et al., 

2008)  and Angola  (Kumar  et al.,  2008) while Asian  subgroup  isolates have been 

reported  from  Indonesia  (Furuya  et  al.,  2004)  and  Japan  (Furuya  et  al.,  2005). 

Additional  unpublished  sequences  present  in GenBank  include Myanmar  (South 

Pacific subgroup) and China (Asian subgroup).  

 

Diagnostic testing 

Geering  and  Thomas  (1996)  compared  four  serological  tests  for  the 

detection  of  BBTV.  A  triple  antibody  sandwich  ELISA  using  BBTV  monoclonal 

antibodies  was  shown  to  be  the  most  effective  of  the methods  trialled  when 

labour,  cost  and  sensitivity  were  considered.  PCR‐based  methods  have 

subsequently been developed for detection of BBTV. Using primers targeting DNA‐

R, BBTV could be detected in virus infected banana leaves, tissue cultured plantlets 

and viruliferous aphids  (Shamloul et al., 1999). Similarly, primers  to DNA‐R were 

combined with primers to a housekeeping gene to detect BBTV isolates from major 

banana  growing  regions  of  Pakistan  (Mansoor  et  al.,  2005).  DNA‐R  appears  to 

represent  a  suitable  target  for  PCR  diagnosis  and  sequence  information  for  a 

number of  isolates  is now available  in GenBank allowing primers  to be designed 

which  can  identify  virus  isolates  from  both  molecular  subgroups.  Sequence 

information for other BBTV DNAs are also available  in public databases, making  it 

feasible to develop PCR‐based diagnostics for all of the virus‐specific DNAs.  

 

 

28  

Epidemiology 

Infected planting material and aphids are both important means of in‐field 

spread  of  bunchy  top  (Magee,  1927).  Epidemics  can  be  attributed  to  several 

combining factors, which  include the presence of  large numbers of aphid vectors, 

planting  of  diseased  vegetative materials  providing  an  inoculum  source  and  the 

failure of  farmers  to  identify  and  remove diseased plants  in  a  timely  fashion.  In 

Australia, bunchy  top has been  controlled  through  strict programs of quarantine 

restrictions  on  plant movement,  inspection  and  removal  of  infected  plants  and 

resupply  of  virus‐free  planting material. Where  these measures  are  able  to  be 

implemented and enforced, successful control of bunchy top can be accomplished, 

although eradication is not usually considered feasible.  

Thomas et al. (1995) showed that BBTV could be transmitted through tissue 

culture and reported that virus‐infected and healthy plants  in tissue culture were 

difficult  to  distinguish  by  visual means.  However,  transmission was  inconsistent 

and in some cases BBTV was not detected from tissue culture banana plants for up 

to 16 months of monitoring. Similarly, Drew et al. (1992) demonstrated that 27% of 

explants  of  cultivar  Cavendish were  freed  from  virus  symptoms  following  tissue 

culture. These studies suggest that tissue culture could be a useful means to rescue 

BBTV‐infected plants of high value, although a prolonged period of virus  indexing 

and observation is required to confirm that explants are virus‐free. 

2.3.2 RNA viruses 

2.3.2.1 Bract mosaic disease 

Banana bract mosaic disease  is characterised by streaking on the bracts of 

the banana  inflorescence,  spindle‐shaped  streaks on  the petiole and mottling on 

the pseudostem of  infected plants  (Thomas et al., 2000)  (Fig. 5). Mosaic patterns 

on the bracts are diagnostic for this disease. Losses in the field as high as 40% have 

been  reported  (Ploetz,  1994).  The  causal  agent  is  Banana  bract  mosaic  virus 

(BBrMV) (Bateson and Dale, 1995; Thomas et al., 1997), which has  been reported 

from the Philippines, India, Sri Lanka, Thailand, Vietnam and Samoa (Rodoni et al.,  

29

 

       

 

Fig. 5. Symptoms of BBrMV in cultivar Cavendish. (A) Light 

white mosaic in the lamina of the youngest emerging leaf; 

(B)  &  (C)  typical  dark  red  streaks  in  the  bracts  of  the 

inflorescence  (marked  by  arrows);  and  (D)  electron 

micrograph of purified BBrMV  (from  Iskra‐Caruana  et al., 

2008).

D

C

B

A

30  

1997 & 1999; Sharman et al., 2000a; Thomas et al., 1997) where the virus naturally 

infects  both  banana  and  abaca  (M.  textilis).  BBrMV  is  transmitted  vegetatively, 

mechanically  from  banana  to  banana,  and  is  vectored  by  several  aphid  species, 

including P. nigronervosa (Thomas et al., 2000).  

Isolates of BBrMV show low sequence variability in the coat protein‐coding 

and  3’  untranslated  (UTR)  regions, with  levels  of  0.3‐5.6%  and  0.3‐4.3%  at  the 

nucleotide  and  amino  acid  level,  respectively  (Rodoni  et  al.,  1999).  The  limited 

distribution, combined with vegetative transmission, makes this virus an important 

quarantine concern for banana germplasm exchange. ELISA, RT‐PCR and  IC‐RTPCR 

have been used for detection of BBrMV (Iskra‐Caruana et al., 2008; Rodoni et al., 

1999; Sharman et al., 2000b) with RT‐PCR the most sensitive method.  

A multiplex  IC‐PCR method  that  detects BBTV, CMV  and BBrMV has  also 

been developed  (Sharman et al., 2000b). This assay was used to confirm the PCR 

results reported by Rodoni et al. (1999) although in the multiplex format a second 

reverse primer was required to detect all six BBrMV  isolates tested. However, the 

multiplex RT‐PCR  format was plagued with difficulties  regarding primer  selection 

and cross reaction to the other viruses of interest, making this a difficult format to 

work with.   

 

2.3.2.2 Mosaic disease 

Mosaic  disease  in  banana  is  caused  by  strains  of  Cucumber mosaic  virus 

(CMV) and is characterised by symptoms including infectious chlorosis, mosaic and 

heart  rot.  First  reported  as  a pathogen of banana  in NSW  in 1929, CMV  is now 

recognised  in most  banana  growing  regions  of  the  world  (Lockhart  and  Jones, 

2000a; Niblett  et  al.,  1994).  Symptom  expression  is  strain  dependent  and  relies 

also on host cultivar and growing conditions. Mosaic and chlorotic streaking along 

the veins of  the  leaves  (Fig. 6),  leading  to necrosis, are common. Fruit may show 

disease symptoms and bunches may be bear malformed  fruit or no  fruit.  In very 

severe cases plants may die.  

31  

 

 

 

 

 

 

 

Fig. 6. Symptoms of CMV infection on banana leaf tissue.  

   

32  

Although  common,  mosaic  does  not  have  a  major  impact  on  banana 

production  and  simple  cultural  practices  are  usually  sufficient  to  control  the 

disease.  These  include  selection  of  virus  free  planting  material,  avoidance  of 

intercropping with susceptible alternative hosts (especially cucurbits) and removal 

of weeds that act as a reservoir for CMV. The roguing of infected banana plants is 

practiced although little evidence is available to suggest that CMV can spread from 

banana  to  banana  by  aphid  transmission. Most  infections  are  thought  to  arise 

through  short  probes  from  various  aphid  species  while moving  from  alternate 

hosts  into banana  (Jeger et al., 1995). CMV  transmission  can also occur  through 

meristem  tissue  culture,  although  in  one  study  approximately  68%  of  plants 

regenerated from infected mother plants were found to be virus‐free (Surga‐Rivas, 

1988). 

CMV has a host range of over 1000 plant species, the  largest of any plant 

virus, and is vectored by at least 60 aphid species including the banana aphid. Virus 

isolates  are  grouped  into  two  major  subgroups  (named  1  and  2)  based  on 

differences  in  serological  and  molecular  characters  (Eiras  et  al.,  2004). 

Approximately  75%  similarity  exists  between  the  genome  of  subgroup  1  and 

subgroup 2 members. CMV  is the type member of the genus Cucumovirus (family 

Bromoviridae), has 29 nm  icosahedral particles and a genome consisting of  three 

segments  of  linear  positive  sense  ssRNA  with  a  total  length  of  8621  nucleotides 

(Fauquet  et  al.,  2005).  The  genome  encodes  five  proteins  involved  in  particle 

formation, replication, post‐transcriptional gene silencing, aphid transmission, and 

cell‐to‐cell  and  long‐distance  movement.  The  virus  is  present  in  high  levels  in 

infected plants making diagnostic  testing  relatively  straightforward. A number of 

diagnostic methods have been reported for detection of CMV  in banana including 

DNA probes (Kiranmai et al., 1998), ELISA and RT‐PCR (Hu et al., 1995; Singh et al., 

1995). Strains from various hosts have been detected using a single primer set.  

 

33  

2.3.2.3 Mild mosaic disease and BVX 

Banana mild mosaic  virus  (BanMMV)  and  Banana  virus  X  (BVX)  are  two 

recently  characterised  banana  viruses  belonging  to  the  Flexiviridae  family. 

BanMMV was  first  reported  in 2001  (Gambley  and  Thomas,  2001)  following  the 

discovery of  flexuous  virus particles  in banana  accessions  that  failed  to  react  to 

general potyvirus  antisera or potyvirus degenerate PCR primers. BanMMV has  a 

single‐stranded RNA genome of 7352 nucleotides with five ORFs and is most similar 

to fovea‐ and carla‐viruses, based on phylogenetic analysis (Gambley and Thomas, 

2001).  

A study on the diversity of BanMMV  in a worldwide germplasm collection 

identified  68  infected  banana  accessions. Analysis  of  154  sequences  of  the  viral 

RNA dependent RNA polymerase  (RdRp)  from  these plants  showed a mean pair‐

wise  nucleotide  sequence  divergence  of  20.4%,  and  that mixed  infections  occur 

naturally,  suggesting  a  vector  is  able  to  transmit  the  virus  from  plant  to  plant 

(Teycheney et al., 2005a). During this study the authors  identified a novel nucleic 

acid  sequence  in  bananas  the  sequence  of  which  differed  significantly  from 

BanMMV. Sequence analysis of a 2917 nucleotides region of the 3’ end of the viral 

RNA revealed a new virus species (Teycheney et al., 2005b). The virus was named 

‘Banana virus X’ and was shown to be only distantly related to other members  in 

the Flexiviridae. 

The Flexiviridae  is a relatively recently created virus  taxon  (Fauquet et al., 

2005). All members have  flexuous particles, a monopartite positive  sense  ssRNA 

genome with a 3’ polyA tail and up to six ORFs. Eight genera are currently identified 

based on differences  in genome organisation. Distinct species have  less than 72% 

identical  nucleotides  or  80%  identical  amino  acids  between  their  entire  coat 

protein  or  replication  protein  genes.  A  number  of  unclassified  members  are 

included in the family, including BanMMV, and Teycheney et al. (2005b) proposed 

that BVX is an additional member of this family.  

BanMMV  causes  mild  chlorotic  mosaic  and  streak  symptoms  on  highly 

susceptible cultivars, but otherwise infection is asymptomatic. BVX has no ascribed 

34  

symptoms  and  has  only  been  detected  in  a  handful  of  individual  plants.    Both 

viruses are vegetatively transmitted and may be problematic to banana germplasm 

transfer  and  potentially  in  banana  micropropagation.  RT‐PCR,  using  a  method 

called polyvalent degenerate oligonucleotide RT‐PCR  (PDO‐RT‐PCR), was  recently 

reported for detection of both viruses (Teycheney et al., 2007).  

 

2.4 Virus Indexing 

Historically,  little  thought was probably  given  to  selection of disease  free 

germplasm  for movement  into  new  areas.  Before  the modern  science  of  plant 

pathology was established in the mid 19th century, very little was understood about 

the cause of plant disease. Because of this it was commonplace to move pests and 

diseases  of  plants when  germplasm was  transferred,  particularly  in  the  case  of 

vegetatively  propagated  crops,  like  bananas.  In modern  times,  the  exchange  of 

banana germplasm  is commonplace  in order to facilitate efforts  in plant breeding 

and research activities. Guidelines for the movement of banana germplasm are  in 

place to ensure that only disease free plants are exchanged (Diekman and Putter, 

1996). Plants  selected  for  transfer  should be  free  from visible  signs of pests and 

diseases,  and  preferably  obtained  from  disease  indexed  banana  germplasm 

collections. Tissue cultured plants should be used where possible, and these should 

be virus indexed at an approved virus indexing centre (VIC).   

Virus  indexing  is the process of establishing the presence of a known virus 

in a plant, particularly in the absence of disease symptoms.  The key parameters for 

choice  of  a  diagnostic  technique  are  specificity,  sensitivity,  cost  and  speed. 

Historically,  the  predominant  methods  used  for  virus  indexing  were  electron 

microscopy  and host plant  assays, both  time‐consuming methods  that were not 

suitable  for  large  scale  indexing  programs.  In  regards  to  cost,  sensitivity  and 

throughput,  ELISA  is  the most  historically  important  development  in  plant  virus 

indexing to date (Lopez et al., 2003). ELISA  is a highly routine format to assay  for 

plant  viruses  and  commercial  kits  for  a  number  of  important  viruses  are widely 

available. More recently, PCR has been applied to detection of plant viruses. While 

35  

the sensitivity and speed are major improvements over ELISA, traditionally PCR has 

been more expensive. In addition, the method suffers from a lack of robustness in 

some  instances, with carryover of product leading to false positives and  inhibitors 

in  plant  extracts  leading  to  false  negatives.  Still,  PCR  is  the most  widely  used 

molecular  method  for  virus  indexing  and  protocols  for  many  important  plant 

viruses have been reported (Lopez et al., 2003 & 2009).    

PCR  requires some prior knowledge of  the virus genomic  sequence. From 

this  information,  primers  (oligonucleotides  of  around  18‐24  bp)  are  designed  to 

specifically amplify the genome of the virus of interest. In the case of viruses with 

an  RNA  genome,  an  initial  reverse  transcription  step,  using  the  enzyme  reverse 

transcriptase,  is necessary prior  to  the PCR. With  the available  sequence data  in 

online databases,  it  is possible to design primers with several  levels of detection. 

Variable regions in the genome can be used to design species/strain specific assays, 

while conserved regions can be targeted to detect groups of viruses (Shaad, et al., 

2003). Degenerate PCR primers allow groups of viruses to be detected, or to detect 

new viruses based on  sequence  information  for  related, previously characterised 

viruses (Foissac et al., 2005; Yang et al., 2003).  

The use of ‘housekeeping’ primers, targeting an endogenous plant gene co‐

extracted with the target, allows confidence  in results where no virus  is detected 

(Iskandar et al., 2004; Kim et al., 2003; Nicot et al., 2005). Housekeeping assays 

may be in a multiplex format with the virus specific assay (as an ‘internal’ control), 

or a separate test on the same extract. If the housekeeping assay fails, then nucleic 

acid extraction from the plant needs to be repeated. Major savings  in the cost of 

PCR are made by multiplexing several virus assays in one reaction, with up to nine 

viruses able  to be detected  in a single assay  (Gambino and Gribaudo, 2006). This 

method can, however, be complicated by competition between primers and non‐

target interactions of primer and template (Sharman et al., 2000b).    

Major advances  in PCR were achieved with  the development of  real‐time 

(rt) PCR. By  removing  the need  for gel electrophoresis and  staining,  results were 

obtained faster and there was no requirement for the extremely toxic DNA stain, 

36  

ethidium  bromide.  Additionally,  rtPCR  allows  a  quantitative  measure  of  the 

amount of the target virus to be made. Although such information is not essential 

for indexing, where a yes/no result will suffice, it may provide useful information in 

other  research areas. While a number of different  formats of  rtPCR are available 

(reviewed  in Zhang and Fang, 2006)  they  involve greater setup costs and  time  in 

development than conventional PCR formats, and have higher ongoing costs.   

 

2.4.1 Rolling‐circle amplification 

Rolling‐circle  amplification  (RCA)  (Fig.  7),  using  bacteriophage  Phi29 DNA 

polymerase,  is  a  sequence‐independent  protocol  which  has  been  used  for  the 

amplification  and  characterisation  of  circular DNA molecules,  including  plasmids 

(Dean et al., 2001; Reagin et al., 2003) and several groups of DNA‐viruses infecting 

humans,  animals  and  plants  (reviewed  in  Johne  et  al.,  2009).  To  date,  the 

application of  RCA  technology  to  plant‐infecting  viruses  has  been  limited  to  the 

small,  single‐stranded DNA genomes of viruses  in  the  families Geminiviridae and 

Nanoviridae.  RCA  has  been  used  for  the  detection  and  cloning  of  full‐length 

genomes of geminiviruses (Haible et al., 2006; Inoue‐Nagata et al., 2004; Shepherd 

et al., 2008)  and RCA products have been used as  a  convenient way  to develop 

infectious  clones  of  both  nanoviruses  and  geminiviruses  (Grigoras  et  al.,  2009; 

Knierim and Maiss, 2007; Wu et al., 2008). 

 

2.5 Tissue culture of banana 

Tissue culture  (TC) plantlets are  the  internationally accepted  form  for  the 

movement  of  banana  germplasm  (Diekmann  and  Putter,  1996).  Additionally, 

commercial  scale  banana  plantings  are  now  routinely  established  in  many 

countries using TC plants to ensure planting material  is disease free. Healthy field 

plants are selected and used for the in‐vitro propagation of clones, with indexing to 

confirm virus freedom in areas where they are known to occur.  South Africa’s Du 

Roi  laboratory produces over six million virus  indexed TC banana plants annually, 

37

 Fig. 7. Schematic of rolling circle amplification. Random hexamer primers anneal to 

the circular template DNA at multiple sites. Phi29 DNA polymerase extends each of 

these primers. When the DNA polymerase reaches a downstream extended primer, 

strand  displacement  synthesis  occurs.  The  displaced  strand  is  rendered  single‐

stranded  and  available  to  be  primed  by  more  hexamer  primer.  The  process 

continues, resulting in exponential, isothermal amplification. 

38  

exporting  70%  of  these  to  growers  in  Africa,  the Middle  East,  and  South  and 

Central America (Du Roi, 2007).  

In East Africa, a number of laboratories have been established to provide TC 

banana  plants  for  commercial  planting  including  Kenya  Agricultural  Research 

Institute  (KARI)  and  Jomo  Kenyatta  University  of  Agriculture  and  Technology 

(JKUAT), both  in Kenya.  JKUAT can produce approximately one million TC banana 

plants per annum. A number of other  laboratories have also been established  in 

Kenya and Uganda  for production of TC banana, although at present all produce 

bananas  without  indexing  for  the  presence  of  viruses  (Florence  Wambugu, 

personal communication). The consequences of this are the high potential for virus 

infected TC banana plants to be disseminated to growers.  

 

39  

2.6 References  

Agindotan, B., Winter,  S.,  Lesemann, D., Uwaifo, A., Mignouna,  J., Hughes,  J.  and 

Thottappilly, G.  (2006). Diversity of banana streak‐inducing viruses  in Nigeria 

and Ghana: Twice as many sources detected by  immunoelectron microscopy 

(IEM) than by TAS‐ELISA or IC‐PCR. Afr. J. Biotechnol. 5:1194–1203. 

Amin,  I.,  Qazi,  J.,  Mansoor,  S.,  Ilyas,  M.  and  Briddon,  R.W.  (2008).  Molecular 

characterisation  of  Banana  bunchy  top  virus  (BBTV)  from  Pakistan.  Virus 

Genes 36:191–198. 

Bagamba,  F.,  Burger,  K.  and  Tushemereirwe,  W.K.  (2010).  Banana  (Musa  spp.) 

production characteristics and performance  in Uganda.  In Proc. IC on Banana 

& Plantain  in Africa pp187–198. Edited by T. Dubois, S. Hauser, C. Staver, D. 

Coyne. Acta Hort. 879, ISHS. 

Bateson, M.F.  and  Dale,  J.L.  (1995).  Banana  bract mosaic  virus:  Characterisation 

using potyvirus specific degenerate primers. Arch. Virol. 140: 515–527. 

Becker, D.K., Dugdale, B., Smith, M.K., Harding, R.M. and Dale,  J.L.  (2000). Genetic 

transformation of Cavendish banana  (Musa spp. AAA group) cv  ‘Grand Nain’ 

via microprojectile bombardment. Plant Cell Rep. 19:229–234. 

Beetham, P. R., Hafner, G. J., Harding, R. M. and Dale, J. L. (1997). Two mRNAs are 

transcribed from banana bunchy top virus DNA‐1. J. Gen. Virol. 78:229–236. 

Bell, K.E., Dale,  J.L., Ha, C.V., Vu, M.T.  and Revill,  P.A.  (2002).  Characterisation of 

Rep‐encoding  components  associated with banana bunchy  top nanovirus  in 

Vietnam. Arch. Virol. 147:695–707. 

Bioversity  International  (2007).  Why  bananas  matter.  Accessed  18/04/2007. 

http://bananas.bioversityinternational.org/. 

Braithwaite,  K.S.,  Egeskov,  N.M.  and  Smith,  G.R.  (1995).  Detection  of  sugarcane 

bacilliform virus using the polymerase chain reaction. Plant Dis. 79:792–796. 

40  

Burns,  T.  M.,  Harding,  R.M.  and  Dale,  J.L.  (1995).  The  genome  organization  of 

banana  bunchy  top  virus:  analysis  of  six  ssDNA  components.  J.  Gen.  Virol. 

76:1471–1482. 

CGIAR.  (2011).  Research  and  Impact:  Areas  of  research  ‐  Banana.  Accessed 

22/09/2011. www.cgiar.org/impact/research/banana.html. 

Cheng, C.P., Lockhart, B.E.L. and Olszewski, N.E. (1996). The ORFI and  II proteins of 

Commelina yellow mottle virus are virion‐associated.  J. Gen. Virol. 223:263–

271. 

Côte, F.X., Galzi, S., Folliot, M., Lamagnère, Y., Teycheney, P‐Y. and Iskra‐Caruana, M‐

L. (2010). Micropropagation by tissue culture triggers differential expression of 

infectious endogenous banana streak virus sequences (eBSV) present in the B 

genome  of  natural  and  synthetic  interspecific  banana  plantains. Mol.  Plant 

Pathol. 11:137–144. 

Dahal, G., Ortiz, R., Tenkouano, A., Hughes, J. d’A., Thottappilly, G., Vuylsteke, D. and 

Lockhart,  B.E.L.  (2000).  Relationship  between  natural  occurrence  of  banana 

streak  badnavirus  and  symptom  expression,  relative  concentration  of  viral 

antigen, and yield  characteristics of  some micropropagated Musa  spp. Plant 

Pathol. 49:68–79.  

Dale, J.L. (1987). Banana bunchy top: An economically important tropical plant virus 

disease. Adv. Virus Res. 33:301–325. 

Dale,  J.L.  (1994).  Banana  bunchy  top.  In  Compendium  of  tropical  fruit  diseases 

pp17–18. Edited by R.C. Ploetz, G.A. Zentmyer, W.T. Nishijima, K.G. Rohrbach 

and H.D. Ohr. APS. 

Dallot, S., Acuna, P., Rivera, C., Ramirez, P., Côte, F., Lockhart, B.E.L. and Caruana, 

M.L.  (2001).  Evidence  that  the  proliferation  stage  of  micropropagation 

procedure  is determinant  in the expression of Banana streak virus  integrated 

into the genome of FHIA 21 hybrid (Musa AAAB). Arch. Virol. 146:2179–2190. 

41  

Daniells,  J.W., Geering, A.D.W., Bryde, N.J. and Thomas,  J.E.  (2001). The effect of 

Banana  streak  virus  on  the  growth  and  yield  of dessert bananas  in  tropical 

Australia. Ann. Appl. Biol. 139:51–60. 

Davies, G. (1995). Banana and plantain in the East African highlands. In Banana and 

Plantains pp493–508. Edited by S. Gowen. Chapman & Hall.  

Dean, F.B., Nelson, J.R., Giesler, T.L. and Lasken, R.S. (2001). Rapid amplification of 

plasmid  and  phage  DNA  using  Phi29  DNA  polymerase  and multiply‐primed 

rolling‐circle amplification. Genome Res. 11:1095–1099. 

Diekmann, M. and Putter, C.A.J. (1996). FAO/IPGRI Technical Guidelines for the Safe 

Movement of Germplasm. No. 15. Musa. 2nd edition. FAO/IPGRI, Rome. 

Drew,  R.  A.,  Smith,  M.  K.  and  Andersen,  D.  W.  (1992).  Field  evaluation  of 

micropropagated bananas derived from plants containing banana bunchy top 

virus. Plant Cell, Tiss. Organ Cult. 28:203–205. 

Du  Roi  (2007).  Du  Roi  Laboratory  Home  Page.  Accessed  25/04/2007. 

http://www.duroilab.co.za/. 

Eiras, M., Boari, A.J., Colariccio, A., Chaves, A.L.R.,  Briones, M.R.S., Figueira, A.R. and 

Harakava.  R.  (2004).  Characterization  of  isolates  of  the  Cucumovirus 

Cucumber mosaic virus present in Brazil. J. of Plant Pathology 86:61–69. 

FAO.  2011.  The  World  Banana  Forum  (WBF):  Working  together  for  sustainable 

banana  production  and  trade.  Introductory  note.  Accessed  23/02/2011 

www.fao.org/economic/worldbananaforum. 

Fauquet, C.M., Mayo, M.A., Maniloff, J., Desselberger, U. and Ball, L.A. (2005). Virus 

Taxonomy:  Eighth  Report  of  the  International  Committee  on  Taxonomy  of 

Viruses. Elseiver Academic Press.  

Foissac, X., Svanella‐Dumas, L., Gentit, P., Dulucq, M‐J., Marais, A. and Candresse, T. 

(2005).  Polyvalent  degenerate  oligonucleotide  reverse  transcription 

42  

polymerase  chain  reaction:  a  polyvalent  detection  and  characterization  tool 

for trichoviruses, capilloviruses and foveaviruses. Phytopathology 95:617–625. 

Furuya, N., Kawano, S. and Natsuaki, K.T. (2005). Characterisation and genetic status 

of banana bunchy top virus isolated from Okinawa, Japan. J. Gen. Plant Pathol. 

71:68–73. 

Furuya, N.,  Somowiyarjo,  S. and Natsuaki, K.T.  (2004).   Virus detection  from  local 

banana  cultivars  and  the  first molecular  characterisation  of  banana  bunchy 

top virus in Indonesia. Jour. Agri. Sci. Tokyo Univ. of Agric. 49:75–81. 

Gambino,  G.  and  Gribaudo,  I.  (2006).  Simultaneous  detection  of  nine  grapevine 

viruses  by  multiplex  reverse  transcription‐polymerase  chain  reaction  with 

coamplification of a plant RNA as  internal control. Phytopathology 96:1223–

1229. 

Gambley, C. F. and Thomas, J. E. (2001). Molecular characterisation of Banana mild 

mosaic  virus,  a  new  filamentous  virus  in Musa  spp.  Arch.  Virol.  146:1369–

1379. 

Gayral, P. and Iskra‐Caruana, M.L. (2009). Phylogeny of Banana streak virus reveals 

recent and repetitive endogenization in the genome of its banana host (Musa 

sp.). J. Mol. Evol. 69:65–80. 

Gayral,  P.,  Noa‐Carrazana,  J‐C.,  Lescot,  M.,  Lheureux,  F.,  Lockhart,  B.E.L., 

Matsumoto, T., Piffanelli, P. and  Iskra‐Caruana, M‐L.  (2008). A single Banana 

streak virus integration event in the banana genome as the origin of infectious 

endogenous pararetrovirus. J. Virol. 82:6697–6710. 

Geering,  A.D.W.  (2009a).  Viral  Pathogens  of  Banana:  Outstanding Questions  and 

Options  for  Control.    In  Proc.  IS  on  Banana  Crop  Prot.,  Sust.  Prod. &  Impr. 

Livelihoods pp39‐50. Edited by D. Jones and I. Van den Bergh. ISHS. 

Geering, A.D.W.  (2009b). The distribution of badnavirus‐infected Musa germplasm 

from the international transit centre, Katholieke Universiteit Leuven, Belgium. 

43  

In  Proc.  IS  on  Banana  Crop  Prot.,  Sust.  Prod. &  Impr.  Livelihoods  pp85‐88. 

Edited by D. Jones and I. Van den Bergh. ISHS. 

Geering,  A.D.W.  (2010).  Five  new  species  and  four  nomenclature  changes  in  the 

genus  Badnavirus.  [online]  ICTV  Taxonomy  Proposals  ‐  Plant.  Available  at 

http://talk.ictvonline.org/files/proposals/taxonomy_proposals_plant1/m/plan

t01/2216.asp [Accessed 14 December 2010].  

Geering, A.W.D and Thomas, J.E.  (1996). A comparison of four serological tests for 

the  detection  of  banana  bunchy  top  virus  in  banana.  Aust.  J.  Agric.  Res. 

47:403–412. 

Geering, A.D.W., McMichael, L.A., Dietzgen, R.G. and Thomas,  J.E.  (2000). Genetic 

diversity among Banana  streak virus  isolates  from Australia. Phytopathology 

90:921–927. 

Geering, A.D.W., Olszewski, N.E., Dahal, G., Thomas, J.E. and Lockhart, B.E.L. (2001). 

Analysis  of  the  distribution  and  structure  of  integrated  banana  streak  virus 

DNA in a range of Musa cultivars. Mol. Plant Pathol. 2:207–213. 

Geering, A.D.W., Olszewski, N.E., Harper, G., Lockhart, B.E., Hull, R. and Thomas, J.E. 

(2005a). Banana contains a diverse array of endogenous badnaviruses. J. Gen. 

Virol. 86:511–520. 

Geering, A.D.W., Parry, J.N. and Thomas, J.E. (2011). Complete genome sequence of 

a novel badnavirus, banana streak IM virus. Arch. Virol. 156:733–737. 

Geering, A.D.W., Pooggin, M., Olszewski, N.E., Lockhart, B.E.L. and Hohn, T. (2005b). 

Characterization of Banana streak mysore virus and evidence  that  its DNA  is 

integrated in the B genome of cultivated Musa. Arch. Virol. 150:787–796. 

Geering, A.W.D., Scharaschkin, T. and Teycheney, P.Y. (2010). The classification and 

nomenclature of endogenous viruses of the family Caulimoviridae. Arch. Virol. 

155:123–131. 

44  

Grigoras, I., Timchenko, T., Katul, L., Grande‐Pérez, A., Vetten, H‐J. and Gronenborn, 

B. (2009). Reconstitution of authentic nanovirus from multiple cloned DNAs. J. 

Virol. 83:10778–10787. 

Gronenborn,  B.  (2004).  Nanoviruses:  genome  organisation  and  protein  function. 

Vet. Microbiol. 98:103–109. 

Hafner, G.J.,  Harding,  R.M.  and  Dale,  J.L.  (1995). Movement  and  transmission  of 

banana  bunchy  top  virus  DNA  component  one  in  bananas.  J.    Gen.  Virol. 

76:2279–2285. 

Haible, D., Kober, S. and Jeske, H. (2006). Rolling‐circle amplification revolutionizes 

diagnosis and genomics of geminiviruses. J. Virol. Methods 135:9–16. 

Harding, R.M., Burns, T.M. and Dale, J.L. (1991). Virus‐like particles associated with 

banana bunchy  top disease contain small single‐stranded DNA.  J. Gen. Virol. 

72:225–230. 

Harding,  R.M.,  Burns,  T.M.,  Hafner,  G.,  Dietzgen,  R.G.  and  Dale,  J.L.  (1993). 

Nucleotide  sequence  of  one  component  of  the  banana  bunchy  top  virus 

genome contains a putative replicase gene. J. Gen. Virol. 74:323–328. 

Harper, G., Ganesh, D., Thottappilly, G. and Hull, R. (1999a). Detection of episomal 

Banana streak virus by IC‐PCR. J. Virol. Methods 79:1–8. 

Harper, G. and Hull, R. (1998). Cloning and sequence analysis of banana streak virus 

DNA. Virus Genes 17:271–278. 

Harper, G., Hart, D., Moult, S. and Hull, R. (2002). Detection of Banana streak virus in 

field samples of banana from Uganda. Ann. Appl. Biol. 141:247–257. 

Harper, G., Hart, D., Moult, S. and Hull, R. (2004).  Banana streak virus is very diverse 

in Uganda. Virus Res. 100:51–56. 

45  

Harper,  G.,  Hart,  D., Moult,  S.,  Hull,  R.,  Geering,  A.  and  Thomas,  J.  (2005).  The 

diversity  of  Banana  streak  virus  isolates  in  Uganda.  Arch.  Virol.  150:2407–

2420. 

Harper, G., Osuji, J., Heslop‐Harrison, J.S. and Hull, R. (1999b). Integration of banana 

streak  badnavirus  into  the  Musa  genome:  molecular  and  cytogenetic 

evidence. Virology, 255:207–213. 

Helliot, B., Panis, B., Frison, E., De Clercq, E., Swennen, R., Lepoivre, P. and Neytsd, J. 

(2003). The acyclic nucleoside phosphonate analogues, adefovir, tenofovir and 

PMEDAP, efficiently eliminate banana streak virus  from banana  (Musa spp.). 

Antiviral Res. 59:121–126. 

Helliot, B.,  Panis, B.,  Poumay,  Y.,  Swennen, R.,  Lepoivre,  P.  and  Frison,  E.  (2002). 

Cryopreservation  for  the elimination of cucumber mosaic and Banana streak 

viruses from Banana (Musa spp.). Plant Cell Rep. 20:1117–1122. 

Horser, C.L., Harding, R.M. and Dale, J.L. (2001). Banana bunchy top nanovirus DNA‐

1  encodes  the  “master”  replication  initiation  protein.  J. Gen. Virol.  82:459–

464. 

Hu, J.S., Li, H.P., Barry, K., Wang, M. and Jordan, R. (1995). Comparison of dot blot, 

ELISA, and RTPCR assays for detection of two cucumber mosaic virus  isolates 

infecting banana in Hawaii. Plant Dis. 79:902–906. 

Hull, R. (2002). Plant Virology 4th Ed. Academic Press.  

Hull,  R.,  Geering,  A.,  Harper,  G.,  Lockhart,  B.E.  and  Schoelz,  J.E.  (2005).  Family 

Caulimoviridae.  In  Virus  Taxonomy:  Eighth  Report  of  the  International 

Committee on Taxonomy of Viruses pp.385–396. Edited by C.M. Fauquet, M.A. 

Mayo, J. Maniloff, U. Desselberger and L.A. Ball. Elsevier.  

Inoue‐Nagata, A.K., Albuquerque, L.C., Rocha, W.B. and Nagata, T. (2004). A simple 

method  for  cloning  the  complete  begomovirus  genome  using  the 

bacteriophage φ29 DNA polymerase. J. Virol. Methods 116:209–211.  

46  

International  Banana  Association  (2007).    Banana  facts:  nutrition.  Accessed 

18/04/2007. http://www.eatmorebananas.com/facts/nutrition.htm. 

Iskandar, H.M., Simpson, R.S., Casu, R.E., Bonnett, G.D., Maclean, D.J. and Manners, 

J.M.  (2004).  Comparison  of  reference  genes  for  quantitative  real‐time 

polymerase  chain  reaction  analysis  of  gene  expression  in  sugarcane.  Plant 

Mol. Biol. Reptr. 22:325–337. 

Iskra‐Caruana, M.L., Galzi, S. and Laboureau, N. (2008). A reliable IC one‐step RT‐PCR 

method  for  the  detection  of  BBrMV  to  ensure  safe  exchange  of  Musa 

germplasm. J. Virol. Methods 153:223–231.  

Iskra‐Caruana, M.L., Gayral, P., Galzi, S. and Laboureau, N.  (2009). How  to control 

and prevent  the  spread of banana  streak disease when  the origin  could be 

viral sequences integrated in the banana genome? In Proc. IS on Banana Crop 

Prot., Sust. Prod. &  Impr. Livelihoods pp77–84. Edited by D. Jones and  I. Van 

den Bergh. ISHS.  

Jacquot, E., Hagen, L.S., Jacquemond, M. and Yot, P. (1996). The open reading frame 

2 product of Cacao swollen shoot badnavirus is a nucleic acid‐binding protein. 

Virology 225:191–195. 

Jeger, M.J., Eden‐Green, S., Thresh, J.M., Johanson, A., Waller, J.M. and Brown, A.E. 

(1995).  Banana  diseases.  In  Banana  and  Plantains  pp317–381.  Edited  by  S. 

Gowen. Chapman & Hall. 

Johne, R., Müller, H., Rector, A., van Ranst, M. and Stevens, H. (2009). Rolling‐circle 

amplification of viral DNA genomes using phi29 polymerase. Trends Microbiol. 

17:205–211.  

Karan, M., Harding, R.M. and Dale,  J.L.  (1994). Evidence  for  two groups of banana 

bunchy top virus isolates.  J. Gen. Virol. 75:3541‐3546. 

47  

Karan, M., Harding, R.M.  and Dale,  J.L.  (1997). Association of banana bunchy  top 

virus  DNA  components  2  to  6  with  bunchy  top  disease.  Molecular  Plant 

Pathology On‐line: [http://www.bspp.org.uk/mppol/] 1997/0624karan]. 

Karanja, L., Wangai, A., Harper, G. and Pathak, R.S. (2008). Molecular  identification 

of Banana streak virus isolates in Kenya. J. Phytopath. 156:678–686. 

Kim, B.R., Nam, H.Y.,  Kim,  S.U., Kim,  S.I.  and  Chang,  Y.J.  (2003). Normalization of 

reverse  transcription  quantitative‐PCR  with  housekeeping  genes  in  rice. 

Biotechnol. Lett. 25:1869–1872. 

Kiranmai, G., Satyanaranaya, T. and Sreenivasulu, P.  (1998). Molecular cloning and 

detection  of  cucumber  mosaic  cucumovirus  causing  infectious  chlorosis 

disease of banana using DNA probes. Curr. Sci. 74:356–359.  

Knierim,  D  and  Maiss,  E.  (2007).  Application  of  Phi29  DNA  polymerase  in 

identification  and  full‐length  clone  inoculation  of  tomato  yellow  leaf  curl 

Thailand virus and tobacco leaf curl Thailand virus. Arch. Virol. 152:941–954. 

Kubiriba,  J., Legg,  J.P., Tushemereirwe, W. and Adipala, E.  (2001a). Disease spread 

patterns of Banana streak virus  in  farmers’  fields  in Uganda. Ann. Appl. Biol. 

139:31–36. 

Kubiriba,  J.,  Legg  J.P.,  Tushemereirwe,  W.  and  Adipala,  E.  (2001b).  Vector 

transmission of Banana streak virus in the screenhouse in Uganda. Ann. Appl. 

Biol. 139:37–43. 

Kumar,  L  and  Hanna,  R.  (2008).  Banana  bunchy  top  virus  in  sub‐Saharan  Africa: 

established or emerging problem? p95–96.  In Banana and Plantain  in Africa: 

Harnessing  international  partnerships  to  increase  research  impact.  Eds.:  T. 

Dubois, S. Hauser, C. Staver, D. Coyne. ISHS. 

Kumar, P.L., Ayodele, M., Oben, T.T., Mahungu, N.M., Beed, F., Coyne, D., Londa, L., 

Mutunda, M.P.  Kiala,  D.  and Maruthi, M.N.  (2008).  First  report  of  banana 

48  

bunchy  top  virus  in  banana  and  plantain  (Musa  spp.)  in  Angola.  Plant 

Pathology. 58:402. 

Lassoundiere,  A.  (1974).  La mosaique  dite  “a  tirets”  du  bananier  ‘Poyo’  en  Cote 

d’Ivore. Fruits 29:349–357. 

Leclerc, D., Burri, L., Kajava, A.V., Mougeot, J.L., Hess, D., Lustig, A., Kleeman, G. and 

Hohn,  T.  (1998).  The  open  reading  frame  III  product  of  Cauliflower mosaic 

virus  forms  a  tetramer  through  a  N‐terminal  coiled‐coil.  J.  Biol.  Chem. 

237:29015–29021. 

Le  Provost, G.,  Iskra‐Caruana, M., Acina,  I.  and  Teycheney,  P‐Y.  (2006).  Improved 

detection of episomal Banana streak viruses by multiplex immunocapture PCR.  

J. Virol. Methods 137:7–13. 

Lescot,  T.  and Ganry,  J.  (2010).  Plantain  (Musa  spp.)  cultivation  in Africa:  a  brief 

summary  of  developments  over  the  previous  two  decades.  In  Proc.  IC  on 

Banana  &  Plantain  in  Africa  p445–456.  Edited  by  T.  Dubois,  S.  Hauser,  C. 

Staver, D. Coyne. Acta Hort. 879, ISHS. 

Lheureux,  F.,  Laboureau,  N., Muller,  E.,  Lockhart,  B.E.L.  and  Iskra‐Caruana, M.L. 

(2007). Molecular characterisation of banana streak acuminata Vietnam virus 

isolated from Musa acuminata siamea (banana cultivar). Arch Virol. 152:1409–

1416.  

Lockhart, B. E. L.  (1986). Purification and serology of a bacilliform virus associated 

with banana streak disease. Phytopathology 76:995–999. 

Lockhart, B.E.L.  (1990).  Evidence  for a double‐stranded  circular DNA  genome  in  a 

second group of plant viruses. Phytopathology 80:127–130. 

Lockhart,  B.E.L.  and  Jones,  D.R.  (2000a).  Banana mosaic.  In  Diseases  of  banana, 

abaca and enset pp256–263. Edited by D.R. Jones. CABI. 

Lockhart, B.E.L. and Jones, D.R. (2000b). Banana streak. In Diseases of banana, abaca 

and enset pp263–274. Edited by D.R. Jones. CABI. 

49  

Lockhart B.E.L. and Olszewski N.E. (1993). Serological and genomic heterogeneity of 

banana  streak  badnavirus:  Implications  for  virus  detection  in  Musa 

germplasm.  In: Breeding Banana and Plantain  for Resistance to Diseases and 

Pests pp105–113. Edited by J. Ganry. CIRAD/INIBAP.  

Lopez, M.M., Bertolini, E., Olmos, A., Caruso, P., Gorris, M.T., Llop, P., Penyalver, R. 

and  Cambra, M.  (2003).  Innovative  tools  for  detection  of  plant  pathogenic 

viruses and bacteria. Int. Microbiol. 6:233–243. 

Lopez, M.M.,  Llop,  P., Olmos,  A., Marco‐Noales,  E.,  Cambra, M.  and  Bertolini,  E. 

(2009). Are molecular tools solving the challenges posed by detection of plant 

pathogenic bacteria and viruses? Curr. Issues Mol. Biol. 11:13–46.  

Lufafa, A., Tenywa, M.M.,  Isabirye, M., Majaliwa M.J.G. and Woomer, P.L.  (2002). 

Prediction of soil erosion in a Lake Victoria basin catchment using a GIS‐based 

Universal Soil Loss model. Agr. Syst. 76:883–894. 

Magee, C.J.P. (1927). Investigation on the bunchy top disease of the banana. Council 

for scientific and industrial research. Bulletin No. 30. Melbourne. 

Mansoor, S., Qazi,  J., Amin,  I., Khati, A., Khan,  I.A., Raza, S., Zafar, Y. and Briddon, 

R.W. (2005). A PCR‐based method, with  internal control, for the detection of 

Banana bunchy top virus in banana. Mol. Biotech. 30:167–169. 

May, G.D., Afza, R., Mason, H.S., Wiecko, A., Novak,  F.J.  and Arntzen, C.J.  (1995).  

Generation of transgenic banana (Musa acuminata) plants via Agrobacterium‐

mediated transformation.  Bio‐Technology 13:486–492. 

Meyer,  J. B., Kasdorf, G. G. F., Nel, L. H. and Pietersen, G.  (2008). Transmission of 

activated  episomal  Banana  streak  OL  (badna)virus  (BSOLV)  to  cv. Williams 

banana (Musa sp.) by three mealybug species. Plant Dis. 92:1158–1163. 

Mgenzi, S.R.B., Mshaghuley,  I.M., Staver, C. and Nkuba, J.M. (2010). Banana (Musa 

spp.)  processing  businesses:  support  environment  and  role  in  poverty 

50  

reduction in rural Tanzania. In Proc. IC on Banana & Plantain in Africa pp249–

256.  Edited by T. Dubois, S. Hauser, C. Staver, D. Coyne. Acta Hort. 879, ISHS. 

Mwangi,  T., Otipa, M., Wangai, A., Karanja,  L., Nyaboga,  E., Mwaura,  S., Bett, B., 

Irungu,  J.,  Odoyo,  E.,  Muchira,  D.  and Muchira,  C.  (2010).  Indexing  tissue 

culture banana (Musa spp.) seedlings for banana streak virus with the aim of 

establishing a clean mother block.  In Proc.  IC on Banana & Plantain  in Africa 

pp357–360. Edited by T. Dubois, S. Hauser, C. Staver, D. Coyne. Acta Hort. 879, 

ISHS. 

Ndowora, T., Dahal, G., LaFleur, D., Harper, G., Hull, R., Olszewski, N.E. and Lockhart, 

B.  (1999).  Evidence  that  badnavirus  infection  in  Musa  can  originate  from 

integrated pararetroviral sequences. Virology 255:214–220. 

Niblett, C.L., Pappu, S.S., Bird,  J. and Lastra, R.  (1995).  Infectious chlorosis, mosaic 

and  heart  rot.  In  Compendium of  tropical  fruit diseases  pp18‐19.  Edited  by 

R.C. Ploetz, G.A. Zentmyer, W.T. Nishijima, K.G. Rohrbach and H.D. Ohr. APS. 

Nicot,  N.,  Hausman,  J‐F.,  Hoffmann,  L.  and  Evers,  D.  (2005).  Housekeeping  gene 

selection  for  real‐time  RT‐PCR  normalization  in  potato  during  biotic  and 

abiotic stress. J. Exp. Bot. 56:2907–2914. 

Njuguna, M.M., Wambugu,  F.M.,  Acharya,  S.S.  and Mackey, M.A.  (2010).  Socio‐

economic impact of tissue culture banana (Musa spp.) in Kenya through whole 

value  chain  approach.  In  Proc.  IC  on  Banana &  Plantain  in  Africa  pp77–86.  

Edited by T. Dubois, S. Hauser, C. Staver, D. Coyne. Acta Hort. 879, ISHS. 

Oben,  T.T.,  Hanna,  R.,  Ngeve,  J.,  Alabi,  O.J.,  Naidu,  R.A.  and  Kumar,  P.L.  (2009). 

Occurrence  of  banana  bunchy  top  disease  caused  by  Bananan  bunchy  top 

virus on banana and plantain (Musa sp.) in Cameroon. Plant Dis. 93:1076. 

Ortiz, R., Ferris, R.S.B. and Vuylsteke, D.R. (1995). Banana and plantain breeding. In 

Banana and Plantains pp110–146. Edited by S. Gowen. Chapman & Hall.  

51  

Ploetz, R.C.  (1994). Bract Mosaic.  In  Compendium of  tropical  fruit  diseases  pp20. 

Edited by R.C. Ploetz, G.A. Zentmyer, W.T. Nishijima, K.G. Rohrbach and H.D. 

Ohr. APS. 

Price, N.S. (1995). The origin and development of banana and plantain cultivation. In 

Banana and Plantains pp1‐14. Edited by S. Gowen. Chapman & Hall. 

Reagin,  M.J.,  Giesler,  T.L.,  Merla,  A.L.,  Resetar‐Gerke,  J.M.,  Kapolka,  K.M.  and 

Mamone,  J.A.  (2003).  TempliPhi:  A  sequencing  template  preparation 

procedure that eliminates overnight cultures and DNA purification. J. Biomol. 

Tech. 14:143–148.  

Rodoni,  B.C.,  Ahlawat,  Y.S.,  Varma,  A.,  Dale,  J.L.,  and  Harding,  R.M.  (1997). 

Identification and characterization of banana bract mosaic virus in India. Plant 

Dis. 81:669–672. 

Rodoni, B.C., Dale, J.L. and Harding, R.M. (1999). Characterization and expression of 

the  coat  protein‐coding  region  of  banana  bract  mosaic  potyvirus, 

development of diagnostic assays and detection of the virus in banana plants 

from five countries in southeast Asia. Arch. Virol. 144:1725–1737. 

Sagi,  L.,  Panis, B., Remy,  S.,  Schoofs, H., De  Smet,  K.,  Swennen, R.  and  Cammue, 

B.P.A. (1995). Genetic transformation of banana and plantain (Musa spp.) via 

particle bombardment. Bio‐Technology 13:481–485. 

Schaad, N.W., Frederick, R.D., Shaw,  J., Schneider, W.L., Hickson, R., Petrillo, M.D. 

and Luster, D.G.  (2003). Advances  in molecular‐based diagnostics  in meeting 

crop biosecurity and phytosanitary issues. Ann. Rev. Phytopathol.  41:305–24. 

Shamloul,  A.M.,  Hadidi,  A., Madkour, M.A.  and Makkouk,  K.M.  (1999).  Sensitive 

detection of Banana bunchy  top and  faba bean necrotic yellow viruses  from 

infected  leaves,  in‐vitro  tissue  cultures  and  viruliferous  aphids  using 

polymerase chain reaction. Can. J. Plant. Pathol. 21:326–337. 

52  

Sharman, M., Gambley, C.F., Oloteo, E.O., Abgona, R.V.J. and Thomas, J.E. (2000a). 

First  record  of  natural  infection  of  abaca  (Musa  textilis) with  banana  bract 

mosaic potyvirus in the Philippines.  Australasian Plant Pathol. 29:69. 

 Sharman, M., Thomas, J.E. and Dietzgen, R.G. (2000b). Development of a multiplex 

immunocapture  PCR  with  colourimetric  detection  for  viruses  of  banana.  J. 

Virol. Methods 89:75–88. 

Shepherd, D.N., Martin, D.P.,  Lefeuvre, P., Monjane, A.L., Owor, B.E., Rybicki, E.P. 

and Varsani, A.  (2008). A protocol  for  the  rapid  isolation of  full  geminivirus 

genomes from dried plant tissue. J. Virol. Methods 149:97–102.  

Silva,  S.O.,  Souza, M.T.,  Alves,  E.J.,  Silveira,  J.R.S.  and  Lima, M.B.  (2001).  Banana 

breeding  program  at  Embrapa.  Cop  Breeding  and  Applied  Biotechnology 

1:399–436.  

Singh, Z., Jones, R.A.C. and Jones, M.G.K. (1995). Identification of cucumber mosaic 

virus subgroup 1  isolates  from banana plants affected by  infectious chlorosis 

disease using RTPCR. Plant Dis. 79:713–716. 

Staginnus, C.,  Iskra‐Caruana, M‐L., Lockhart, B., Hohn, T. and Richert‐Poggeler, K.R. 

(2009).  Suggestions  for  a  nomenclature  of  endogenous  pararetroviral 

sequences in plants. Arch. Virol. 154:1189–1193. 

Su,  H.J.  1998.  First  occurrence  of  Banana  streak  badnavirus  and  studies  on  its 

vectorship  in  Taiwan.  In:  Banana  streak  virus:  A  Unique  Virus–Musa 

Interaction?  Proc.  Workshop  Promusa  Virology  Working  Group  pp20–25. 

Edited by E.A. Frison and S.L. Sharrock, INIBAP. 

Surga‐Rivas,  J.G.  (1988).  Production  of  plants  of  two  banana  cultivars  free  from 

cucumber  mosaic  virus  by  culture  of  apical  meristems  isolated  in‐vitro. 

Fitopatologia Venezolana 1:69–72. 

53  

Teycheney,  P‐Y., Acina,  I.,  Lockhart,  B.E.L.  and  Candresse,  T.  (2007). Detection  of 

Banana  mild  mosaic  virus  and  Banana  virus  X  by  polyvalent  degenerate 

oligonucleotide RT‐PCR (PDO‐RT‐PCR). J. Virol. Methods 142:41–49. 

Teycheney, P‐Y., Laboureau, N., Iskra‐Caruana, M‐L. and Candresse, T. (2005a). High 

genetic  variability  and  evidence  for  plant‐to‐plant  transfer  of  Banana mild 

mosaic virus. J. Gen. Virol. 86:3179–3187. 

Teycheney,  P‐Y.,  Marais,  A.,  Svanella‐Dumas,  L.  and  Candresse,  T.  (2005b). 

Molecular  characterization of banana  virus X  (BVX),  a novel member of  the 

Flexiviridae. Arch. Virol. 150:1715–1727. 

Thomas, J.E. and Dietzgen, R.G. (1991) Purification, characterization and serological 

detection  of  virus‐like  particles  associated with  banana  bunchy  top  virus  in 

Australia. J. Gen. Virol. 72:217–224. 

Thomas, J. E., Geering, A. D. W., Gambley, C. F., Kessling, A. F. and White, M. (1997). 

Purification, properties, and diagnosis of banana bract mosaic potyvirus and 

its distinction from abaca mosaic potyvirus. Phytopathology 87:698–705. 

Thomas, J.E., Iskra‐Caruana, M‐L. and Jones, D.R. (1994). Musa Disease Fact Sheet N° 

4: Banana Bunchy Top Disease. INIBAP. 

Thomas,  J.E.  and  Iskra‐Caruana, M.L.  (2000).  Bunchy  top.  In  Diseases  of  banana, 

abaca and enset pp241–253. Edited by D.R. Jones. CABI. 

Thomas,  J.E.,  Iskra‐Caruana,  M.L.,  Magnaye,  L.V.  and  Jones,  D.R.  (2000).  Bract 

mosaic.  In Diseases  of banana,  abaca  and  enset  pp253–256.  Edited  by D.R. 

Jones. CABI.  

Thomas,  J.E.,  Smith,  M.K.,  Kessling,  A.F.  and  Hamill,  S.D.  (1995).  Inconsistent 

transmission of Banana bunchy top virus in micropropagated bananas and  its 

implication for germplasm screening. Aust. J. Agric. Res. 46:663–671. 

54  

Thomson,  K.G., Dietzgen, R.G.,  Thomas,  J.E.  and  Teakle, D.S.  (1996). Detection of 

pineapple  bacilliform  virus  using  the  polymerase  chain  reaction.  Ann.  Appl. 

Biol. 129:57–59. 

Trager,  J.  (1997).  The  Food  Chronology:  A  food  lovers  companion  of  events  and 

anecdotes from prehistory to present. Owl Books.  

van Asten, P.J.A., Florent, D. and Apio, M.S.  (2010). Opportunities and constraints 

for dried dessert banana (Musa spp.) export in Uganda. In Proc. IC on Banana 

& Plantain  in Africa pp105–112.   Edited by T. Dubois, S. Hauser, C. Staver, D. 

Coyne. Acta Hort. 879, ISHS. 

Vetten, H. J., Chu, P. W. G., Dale, J. L. & 7 other authors (2005). Nanoviridae. In Virus 

Taxonomy:  Eighth  Report  of  the  International  Committee  on  Taxonomy  of 

Viruses,  pp.  343–352.  Edited  by  C.M.  Fauquet, M.A. Mayo,  J. Maniloff,  U. 

Desselberger & L.A. Ball. Elsevier Academic Press. 

Wanitchakorn, R., Harding, R.M. and Dale, J.L. (1997). Banana bunchy top virus DNA‐

3 encodes the viral coat protein. Arch. Virol. 142:1673–1680. 

Wanitchakorn,  R.,  Hafner,  G.J.,  Harding,  R.M.  and  Dale,  J.L.  (2000a).  Functional 

analysis of proteins encoded by banana bunchy top virus DNA‐4 to ‐6. J. Gen. 

Virol. 81:299–306. 

Wanitchakorn, R., Harding, R.M. and Dale,  J.L.  (2000b). Sequence variability  in  the 

coat protein gene of  two groups of banana bunchy  top  isolates. Arch. Virol. 

145:593‐602. 

Wu, C‐Y., Lai, Y‐C., Lin, N‐S., Hsu, Y‐H., Tsai, H‐T., Liao,  J‐Y. and Hu, C‐C.  (2008). A 

simplified method of constructing infectious clones of begomovirus employing 

limited restriction enzyme digestion of products of rolling‐circle amplification. 

J. Virol. Methods. 147:355–359. 

Xie, W.S. and Hu, J.S. (1995). Molecular cloning, sequence analysis, and detection of 

banana bunchy top virus in Hawaii. Phytopathology 85:339–347. 

55  

Yang,  I.C., Hafner, G.J., Revill, P.A., Dale,  J.L. and Harding, R.M.  (2003).     Sequence 

diversity  of  South  Pacific  isolates  of  Taro  bacilliform  virus  and  the 

development of a PCR‐based diagnostic test. Arch. Virol. 148:1957–1968. 

Zhang.  T.  and  Fang,  H.H.P.  (2006).  Applications  of  real‐time  polymerase  chain 

reaction for quantification of microorganisms in environmental samples. Appl. 

Microbial Biotechnol. 70:281–289. 

   

56  

   

57  

 

 CHAPTER 3 

 

DEVELOPMENT OF A NOVEL ROLLING‐CIRCLE AMPLIFICATION TECHNIQUE TO 

DETECT BANANA STREAK VIRUS WHICH ALSO DISCRIMINATES BETWEEN 

INTEGRATED AND EPISOMAL VIRUS SEQUENCES 

 

 

A. P. James, R. J. Geijskes, J. L. Dale and R. M. Harding 

 

 

Centre for Tropical Crops and Biocommodities, Queensland University of 

Technology, GPO Box 2434, Brisbane, Qld, 4001, Australia. 

 

 

 

 

 

 

 

 

Plant Disease 95: 57‐62 

   

58  

STATEMENT OF AUTHORSHIP 

 

Anthony  James  (principal author): Contributed  to project concepts, executed  the 

work  (collected  samples,  designed  and  conducted  laboratory  experiments, 

analysed and interpreted results) and prepared initial manuscript. 

Signed………………………………………………     Date………………………………………………… 

Jason Geijskes: Supervised execution of  the work,  critically  interpreted data and 

contributed to final manuscript. 

Signed………………………………………………     Date………………………………………………… 

James Dale: Conceived project idea, collected samples, supervised execution of the 

work, critically interpreted data and contributed to final manuscript. 

Signed………………………………………………     Date………………………………………………… 

Rob Harding: Conceived project  idea, supervised execution of  the work, critically 

interpreted data and contributed to final manuscript. 

Signed………………………………………………     Date………………………………………………… 

halla

Due to copyright restrictions this article is not available here. Please consult the hardcopy thesis available from QUT Library or view the author's pre-print at: http://eprints.qut.edu.au/39057/

87  

 

CHAPTER 4 

 

MOLECULAR CHARACTERISATION OF SIX BADNAVIRUS SPECIES ASSOCIATED 

WITH LEAF STREAK DISEASE OF BANANA IN EAST AFRICA 

 

 

 

A. P. James, R. J. Geijskes, J. L. Dale and R. M. Harding 

 

 

 

Centre for Tropical Crops and Biocommodities, Queensland University of 

Technology, GPO Box 2434, Brisbane, Qld, 4001, Australia. 

 

 

 

 

 

 

 

 

 

Annals of Applied Biology 158: 346‐353 

   

88  

STATEMENT OF AUTHORSHIP 

 

Anthony  James  (principal author): Contributed  to project concepts, executed  the 

work  (collected  samples,  designed  and  conducted  laboratory  experiments, 

analysed and interpreted results) and prepared initial manuscript. 

Signed………………………………………………………………..Date…………………………………………… 

Jason Geijskes: Supervised execution of  the work,  critically  interpreted data and 

contributed to final manuscript. 

Signed………………………………………………………………..Date…………………………………………… 

James Dale: Conceived project idea, collected samples, supervised execution of the 

work, critically interpreted data and contributed to final manuscript. 

Signed………………………………………………………………..Date…………………………………………… 

Rob Harding: Conceived project  idea, supervised execution of  the work, critically 

interpreted data and contributed to final manuscript. 

Signed………………………………………………………………..Date…………………………………………… 

89  

ABSTRACT 

Banana leaf streak disease, caused by several species of Banana streak virus (BSV), 

is widespread  in East Africa. We  surveyed  for  this disease  in Uganda and Kenya, 

and used rolling‐circle amplification (RCA) to detect the presence of BSV in banana. 

Six distinct badnavirus sequences, three from Uganda and three from Kenya, were 

amplified for which only partial sequences were previously available. The complete 

genomes were  sequenced and  characterised. The  size and organisation of all  six 

sequences was characteristic of other badnaviruses, including conserved functional 

domains present in the putative polyprotein encoded by open reading frame (ORF) 

3.  Based  on  nucleotide  sequence  analysis  within  the  reverse 

transcriptase/ribonuclease H‐coding  region of open  reading  frame 3, we propose 

that  these  sequences  be  recognised  as  six  new  species  and  be  designated  as 

Banana  streak UA virus, Banana  streak UI virus, Banana  streak UL virus, Banana 

streak UM virus, Banana streak CA virus and Banana streak IM virus. Using PCR and 

species‐specific  primers  to  test  for  the  presence  of  integrated  sequences,  we 

demonstrated  that sequences with high similarity  to BSIMV only were present  in 

several banana cultivars which had tested negative for episomal BSV sequences.  

90  

INTRODUCTION 

Bananas  (Musa spp) are hosts to several badnaviruses collectively named banana 

streak virus  (BSV, genus Badnavirus,  family Caulimoviridae). BSV  infection causes 

leaf streak disease which is characterised by distinct chlorotic and necrotic flecking 

on leaves, as well as a range of other symptoms including distortion of leaves and 

petioles,  stem  cracking, abnormal bunch development and death of  the growing 

point  (Dahal  et al., 2000). Although  found  in most banana  growing  regions,  leaf 

streak is the most frequently observed viral disease of banana in the Americas and 

most of Africa  (Geering, 2009; and references therein). The disease  is particularly 

widespread  in both Uganda  (Harper et al., 2004, 2005) and Kenya  (Karanja et al., 

2008). 

Badnaviruses  are  plant  pararetroviruses with  non‐enveloped,  bacilliform‐

shaped  virions  of  approximately  30  x  130‐150  nm,  and  circular  double‐stranded 

DNA genomes of 7‐8 kbp (Hull et al., 2005). All badnaviruses typically encode three 

open  reading  frames  (ORFs)  on  the  virus‐sense  coding  strand. ORF  1  encodes  a 

small protein of unknown function which has been associated with virions (Cheng 

et al., 1996). ORF 2 encodes a protein of 14  kDa with a non‐specific DNA‐ and 

RNA‐binding  activity  (Jacquot  et  al.,  1996).  This  protein may  function  in  virion 

assembly due to the presence of a predicted N‐terminal coiled‐coil domain which 

supports self‐interaction to form a tetramer (Leclerc, 1998). The large polyprotein 

encoded by ORF 3 contains domains associated with movement, the virus capsid, 

aspartic  protease,  reverse  transcriptase  (RT)  and  ribonuclease  H  (RNaseH) 

functions.  

91  

Three  distinct  species  of  BSV,  namely  Banana  streak  OL  virus  (BSOLV), 

Banana streak GF virus  (BSGFV) and Banana streak MY virus  (BSMYV), previously 

Banana streak Mysore virus, are now  recognised by  the  International Committee 

on the Taxonomy of Viruses (ICTV) (Geering, 2010), while a fourth species, Banana 

streak VN  virus  (BSVNV, previously Banana  streak acuminata Vietnam  virus) has 

also recently been proposed based on  full‐length sequence analyses (Lheureux et 

al.,  2007). However, many  other BSV  species  are  thought  to  exist  based  on  the 

analyses  of  numerous  reported  partial  sequences. Geering  et  al.,  (2000;  2005A) 

reported  partial  sequences  of  two  BSV  isolates  from  Australia  (named  Banana 

streak Cavendish  virus  (BSV‐Cav)  and Banana  streak  Imové  virus  (BSImV)), while 

Harper  et  al.,  (2005)  reported  the presence  of  13  distinct  BSV  sequence  groups 

from Uganda,  named  consecutively  as Banana  streak Uganda A  virus  to Banana 

streak Uganda M virus. Further, a complete but as yet unpublished BSV sequence, 

named  Banana  streak  acuminata  Yunnan  virus,  has  been  deposited  in  the NCBI 

database (GenBank accession no. DQ092436). This isolate is phylogenetically most 

closely related to BSVNV (Gayral and Iskra‐Caruana, 2009).   

Several  episomal  BSV  sequences,  namely  BSOLV,  BSMYV,  BSGFV  and 

BSIMV,  have  been  shown  to  have  integrated  counterparts,  termed  endogenous 

BSV  (eBSV),  in the Musa genome  (Harper et al., 1999; Geering et al., 2005A & B; 

Gayral  et  al.,  2008).  Under  certain  stress  conditions,  these  sequences  can  be 

activated  to cause episomal  infections  (Ndowora et al., 1999; Dallot et al., 2001; 

Côte et al., 2010). Although many other endogenous badnavirus sequences occur 

in  the banana genome,  these have no known episomal counterparts and are not 

92  

known  to  give  rise  to  episomal  infections  (Geering  et  al.,  2005A).  While 

endogenous badnaviruses occur  in genetic backgrounds which  include both Musa 

acuminata (A‐genome) and M. balbisiana (B‐genome) and their hybrids, eBSVs are 

only known to occur in some Musa accessions which contain a B‐genome. 

As part of a Grand Challenges  in Global Health  initiative funded by the Bill 

and Melinda Gates Foundation, we have been developing a diagnostic capacity for 

banana viruses in East Africa with a specific focus on BSV. Diagnostic tests for BSV 

have  been  complicated  by  the  extensive  genetic  and  serological  diversity  that 

exists amongst BSV isolates and the presence of integrated BSV sequences in some 

banana  cultivars  which  leads  to  false  positives.  Recently,  however,  we  have 

developed a rolling‐circle amplification  (RCA)‐based assay that specifically detects 

episomal, and not  integrated, BSV  sequences  (James et al., 2011). To determine 

the prevalence of BSV  in East Africa, we conducted disease surveys of bananas  in 

Uganda and Kenya and tested samples by RCA. In this paper, we report for the first 

time  the  complete  nucleotide  sequence  and  molecular  characterisation  of  six 

distinct BSV species from these two countries. 

 

MATERIALS AND METHODS 

Virus nomenclature 

For consistency throughout the remainder of this manuscript, we have elected to 

use  the  nomenclature  suggested  by  Geering  (2010)  to  describe  BSV  species. 

Banana  streak  Imové  virus  (BSImV; Geering  et  al.,  2005A) will  be  referred  to  as 

Banana streak IM virus (BSIMV); Banana streak Cavendish virus (BSV‐Cav; Geering 

93  

et al., 2000) will be referred to as Banana streak CA virus (BSCAV); Banana streak 

Uganda A virus (BSUgAV; Harper et al., 2005) will be referred to as Banana streak 

UA virus  (BSUAV); Banana streak Uganda  I virus  (BSUgIV; Harper et al., 2005) will 

be  referred  to  as Banana  streak UI  virus  (BSUIV); Banana  streak Uganda  L  virus 

(BSUgLV; Harper et al., 2005) will be referred to as Banana streak UL virus (BSULV); 

and Banana streak Uganda M virus (BSUgMV; Harper et al., 2005) will be referred 

to as Banana streak UM virus (BSUMV).  

 

Plant samples and amplification of viral DNA  

Leaf  samples  were  collected  from  banana  plants  displaying  the  chlorotic  and 

necrotic  flecking symptoms typically associated with  leaf streak disease (Table 1). 

Three samples  (Ug1, Ug8 & Ug12) were collected  in south‐west Uganda during a 

survey  conducted  in April  2008,  and were  previously  shown  to  contain  BSV‐like 

sequences with homology to BSUIV, BSULV and BSUMV, respectively (James et al., 

2011). One sample (Ke171) was collected in western Kenya during a survey in April 

2009,  while  the  remaining  two  samples  (Ke8  &  Ke10) were  obtained  from  the 

Kenyan  Agricultural  Research  Institute  research  station  at  Njoro,  Kenya.  Total 

nucleic  acid  (TNA)  extracts  were  prepared  and  virus  DNA  amplified  using  the 

Illustra TempliPhi 100 Amplification Kit  (GE Healthcare, Buckinghamshire, United 

Kingdom) as described previously (James et al., 2011).  

Leaf  samples  were  also  obtained  from  12  genotypically  diverse  Musa 

cultivars  (Table  2)  growing  in  tissue  culture  at  DEEDI,  Agri‐Science Queensland, 

Nambour, Australia. These plants had previously been certified as BSV negative  

94  

Table 1 Plant samples for RCA analysis and PCR primers used for detection of integrated sequences 

Sample  Primer 1 (5´ ‐ 3´)  Primer 2 ( 5´ ‐ 3´)  Amplicon size (bp) 

Annealing temp (°C) 

Region of genome amplified  

Ug1  GAACTGACAGTAGCGCAATCG GACTTGGCTTGCCTGAGTATCG 943 60 6282‐7224Ug8  GAATCCTCAAAGGTACCCC  CATGAGGTCAAGCATATGC  619  50  435‐1053 Ug12  GACGAGCTGCAAGCTCTCAGG TGTGCCTATTCTGAGGTTGG  467 50 973‐1439Ke8  CTCAGCGGCAAGATTAGGAAGG  TCCCCATTGGTCGTCATTGC  517  60  6513‐7029 Ke10  GCTAGGAAGAAAAGTCTGGG TGCAAGTCTACTTACACAGC  475 50 7417‐122Ke171  AGGATTGGATGTGAAGTTTGAGC  ACCAATAATGCAAGGGACGC  783  57  6425‐7207 

95  

Table 2 BSV‐indexed leaf samples used for PCR analysis

Cultivar  Genotype Virus specific PCR test

  BSUAV BSUIV BSULV  BSUMV BSCAV BSIMV

Calcutta 4  AA ‐ ‐ ‐ ‐  ‐ ‐Pisang Oli    AA    ‐  ‐  ‐  ‐  ‐  ‐ Yangambi km5    AAA    ‐  ‐  ‐  ‐  ‐  ‐ NC‐301  AAA ‐ ‐ ‐ ‐  ‐ ‐FHIA‐17    AAAA    ‐  ‐  ‐  ‐  ‐  ‐ Da Jiao  ABB ‐ ‐ ‐ ‐  ‐ ‐Ainu    AAB    ‐  ‐  ‐  ‐  ‐  + SH‐3460.10  AAAB ‐ ‐ ‐ ‐  ‐ ‐FHIA‐03    AABB    ‐  ‐  ‐  ‐  ‐  + Balonkawe  ABB ‐ ‐ ‐ ‐  ‐ +Goly Goly Pot Pot    ABB    ‐  ‐  ‐  ‐  ‐  + Lal Velchi    BB    ‐  ‐  ‐  ‐  ‐  ‐ 

96  

using  immuno‐sorbent electron microscopy (ISEM, Geering et al., 2000) as well as 

by RCA (James et al., 2011).  

 

Cloning and sequencing of virus DNA  

RCA‐amplified virus DNA was digested using either StuI or PstI and products were 

separated  by  agarose  gel  electrophoresis.  DNA  was  subsequently  cloned  into 

pUC19 and sequenced as described previously (James et al., 2011). In all cases, at 

least three independent clones were sequenced in both directions to determine a 

consensus  sequence.  Putative  identification  of  cloned  fragments  was  made  by 

comparison  to  sequences  in NCBI  database  (http://www.ncbi.nlm.nih.gov)  using 

the  Basic  local  alignment  search  tool  (BLAST)  programs.  According  to  the  ICTV 

criteria  (Hull  et  al.,  2005)  for  species  demarcation within  the  genus  Badnavirus, 

sequence differences within  the RT/RNaseH‐coding  region of more  than 20% are 

considered  distinct  badnavirus  species.  Sequence  comparisons were  based  on  a 

529  bp  region  of  the  RT/RNaseH‐coding  region  delimited  by  the  BadnaFP/RP 

primers reported in Yang et al. (2003). In cases where BSV isolates were identified 

for which  full‐length  sequences had not been previously  reported,  the  complete 

sequence  was  obtained  by  primer‐walking.  The  sequence  spanning  putative 

restriction  sites was  confirmed  by  sequencing  of  PCR  products  generated  using 

sequence‐specific primers for each putative site present  in each virus  isolate. PCR 

mixes  (20  µL)  contained  10  µl  2x  GoTaq  Green  Master  Mix  (Promega  Corp, 

Madison, WI), 5 ρmol of each primer, 1 µl of nucleic acid extract and water to final 

volume.  PCR  cycling  conditions  were  an  initial  denaturation  of  94°C  for  2 min 

97  

followed by 35 cycles of 94°C for 20 s, 50°C for 20 s, and 72°C for 30 s, with a final 

extension  at  72°C  for  2 min.  Reactions  products were  electrophoresed  through 

1.5% agarose gels, stained using 0.25x SYBR® Safe DNA Gel Stain (Invitrogen Corp, 

Carlsbad,  CA)  and  DNA  fragments  visualised  on  a  Safe  imager  blue‐light 

transilluminator.  Amplified  fragments  were  cloned  into  pGEM‐T  easy  (Promega 

Corp, Madison, WI)  and  three  clones  were  sequenced  in  both  directions  using 

universal M13 primers. 

 

PCR for detection of integrated sequences 

PCR primers for detection of each virus were designed from sequences obtained in 

this study  (Table 1), with  the exception of BSCAV,  for which previously published 

primers were used (Geering et al., 2000). PCR was carried out as described above, 

with annealing temperatures of 50°C, 57°C or 60°C (Table 1).  

 

Phylogenetic analysis  

Full‐length sequences were assembled in VectorNTI Advance v.11 (Invitrogen Corp, 

Carlsbad, CA), which was subsequently used for the identification of putative ORFs 

and other  conserved genomic  features of badnaviruses, as well as  translation of 

putative ORFs  for analysis of  conserved domains present  in badnavirus proteins. 

Conserved  features of genome sequences were  identified as previously described 

(Geering  et  al.,  2010;  Lheureux  et  al.,  2007).  For  phylogenetic  analysis  and 

sequence  comparison  to  published  badnavirus  sequences,  RT/RNaseH  core 

98  

sequences were  identified using the method of Geering et al., (2010). RT/RNaseH 

sequences were aligned using  the CLUSTAL W algorithm  in MEGA 4.0  (Tamura et 

al.,  2007).  Phylogenetic  trees  were  constructed  using  the  neighbour‐joining 

method,  following pair‐wise  sequence comparison using  the Kimura 2‐parameter 

model in MEGA 4.0 (Kimura, 1980). 

 

RESULTS 

Cloning and sequencing 

Nucleic acid was extracted from the three Ugandan  leaf samples (Ug 1, 8 and 12) 

and three Kenyan  leaf samples  (Ke8, 10 and 171) and was subjected to RCA. The 

products  were  digested  with  StuI  (or  PstI  in  the  case  of  sample  Ke171)  and 

analysed  by  agarose  gel  electrophoresis. A  single  band  of 7.5  kbp,  presumably 

representing  full‐length  BSV  genomic  DNA,  was  observed  in  the  Ug1,  Ke8  and 

Ke171 extracts, while two bands (5.5 and 1.8 kbp), three bands (3.7, 2.2 and 1.6 

kbp) and four bands (7.5, 4.4, 2.1 and 1 kbp) were observed in the Ug8, Ug12 and 

Ke10 extracts, respectively.  

When  the  restriction  fragment/s  from  Ug1,  Ug12,  Ke8  and  Ke171  were 

cloned and analysed, contiguous full‐length sequences were obtained. Analysis of 

the RT/RNaseH‐coding  region of  these  sequences  revealed 82‐86%, 90‐95%, 94% 

and 94‐95% similarity to BSULV, BSUMV, BSUAV and BSCAV  isolates, respectively. 

Analysis of  the 3’ and 5’  terminal  sequences of  the 7.5 kbp band derived  from 

Ke10 revealed it was identical to that of Ke8. When the remaining three restriction 

99  

fragments  from  this  isolate were  cloned  and  analysed,  a  contiguous  full‐length 

sequence was obtained. The sequence of the RT/RNaseH‐coding region showed 97‐

99% similarity to BSIMV.  

Although analysis of the 5.5 kbp StuI‐digested fragment from Ug8 yielded 

a consensus sequence, the sequences obtained from the 1.8 kbp fragment varied 

in  length.  To  resolve  this  problem  and  obtain  the  complete  sequence,  the  RCA 

product derived from Ug8 was digested with PstI to yield a major fragment of 7 

kbp.  The  entire  sequence  of  the  Ug8  isolate  was  subsequently  obtained  from 

alignment of  sequences obtained  from  the  StuI‐  and  PstI‐derived  fragments  and 

from PCR‐derived sequences used  to confirm  the presence of  the PstI  restriction 

site.  Analysis  of  the  RT/RNaseH‐coding  sequences  of  Ug8  revealed  92‐98% 

similarity to BSUIV.  

 

Sequence analysis 

A summary of the characteristics of the complete genomes of each of the six BSV 

species  is  presented  in  Table  3.  The  complete  genomic  sequences  of  BSUAV 

(sample  Ke8,  Genbank  accession  number  HQ593107),  BSUIV  (Ug8,  accession 

number HQ593108),  BSULV  (Ug1,  accession  number HQ593109),  BSUMV  (Ug12, 

accession  number  HQ593110),  BSIMV  (Ke10,  accession  number  HQ593112)  and 

BSCAV  (Ke171, accession number HQ593111) comprised 7519, 7458, 7401, 7532, 

7769  and  7408  bp,  respectively.  For  consistency  with  previous  conventions, 

numbering of each of  the genomes begins with  the 5’ nucleotide of  the putative 

tRNAmet priming site. Each of the six genomes contained three ORFs and, with the 

100  

 

Table 3 Genome features of East African BSV species  

      ORF1 ORF2   ORF3 Transcriptional elements

Badnavirus species length total 

 length  start‐stop 

protein size 

length  start‐stop protein size 

 length  start‐stop 

protein size 

TATA  <gap>  polyA 

  (nt)    (nt)  (codon use)  (kDa) (nt)  (codon use)  (kDa)    (nt)  (codon use)  (kDa)   

                           

Banana streak UA virus   7519    534  483‐1016  20.9  390  1013‐1402  14.3    5637  1402‐7038  216  ctcTATATAAgga <56>  aataag 

(BSUAV)        (atg‐tga)      (atg‐taa)        (atg‐taa)     

                                 

Banana streak UI virus   7458    561  502‐1062  21.6  336  1059‐1394  12.3    5514  1395‐6908  211  ctcTATATAAgga <66>  aataaa 

(BSUIV)        (atg‐tga)      (atg‐taa)        (atg‐taa)     

                                 

Banana streak UL virus  7401    561  532‐1092  21.8  339  1089‐1427  12.3    5502  1430‐6931  211  ctcTATATAAgga <64>  gataag 

(BSULV)        (atg‐tga)      (atg‐taa)        (atg‐tga)     

                                 

Banana streak UM virus  7532    564  622‐1185  21.7  312  1182‐1493  11.7    5547  1497‐7043  213  ggcTATATATAggt <45>  aataaa 

(BSUMV)        (atg‐tga)      (atg‐tag)        (atg‐taa)     

                                 

Banana streak IM virus  7769    531  668‐1198  20.9  393  1195‐1587  14.3    5613  1590‐7202  215  atcTATAA‐‐gag <74>  aataaa 

(BSIMV)        (ctg‐tga)      (atg‐taa)        (atg‐taa)     

                                 

Banana streak CA virus  7408    531  515‐1045  21.1  405  1042‐1446  14.7    5511  1446‐6956  212  ctcTATAAATAgga <55>  aataag 

(BSCAV)        (atg‐tga)      (atg‐taa)        (atg‐taa) 

101  

exception of BSIMV ORF1, a conventional ATG initiation codon was present for all 

ORFs.  A  non‐conventional  CTG  initiation  codon  was  predicted  for  BSIMV  ORF1 

based on sequence comparisons with both BSMYV and BSVNV. The predicted size 

of proteins encoded by the putative ORFs identified for each sequence is included 

in Table 3. The size of  the  intergenic  region  in all six virus genomes  ranged  from 

963 nt  (BSUAV)  to 1234 nt  (BSIMV) and  contained a  region with between 16‐18 

nucleotides complementary to the consensus sequence of plant tRNAmet. Putative 

TATA  boxes  and  polyadenylation  signals,  were  also  identified  in  the  intergenic 

region of all  sequences, 5’ of  the putative  tRNAmet primer binding  site  (Table 3). 

Analysis of  the putative protein encoded by ORF 3 of each  species  revealed  the 

presence  of  several  motifs  that  are  highly  conserved  in  badnavirus  proteins 

including movement, RNA‐binding  (zinc‐finger motif), aspartyl proteinase, reverse 

transcriptase and RNaseH. 

Phylogenetic  analysis  of  the  RT/RNaseH  region  from  full‐length  known 

episomal  badnavirus  sequences  showed  that  the  three  Ugandan  BSVs  (BSUIV, 

BSULV &  BSUMV)  clustered  together  and  that  these  viruses were more  closely 

related  to  the  sugarcane‐infecting  badnaviruses  than  to  other  banana‐infecting 

badnaviruses  (Fig.  1).  Two  Kenyan  BSVs,  BSUAV  and  BSCAV, were  shown  to  be 

closely related and these formed a separate cluster with BSOLV (Fig. 1). The Kenyan 

BSIMV did not cluster according to provenance but  instead was found to be most 

closely  related  to BSVNV. Pair‐wise nucleotide  similarities within  the RT/RNaseH‐

coding  region  of  full‐length  sequences  derived  from  the  six  BSV  sequences 

reported  in  this  study  together with  their  phylogenetically most  closely‐related 

102  

          

 

 

 

 

                      

   

BSCAV

BSUAV

BSOLV

BSMYV

KTSV

BSIMV 

BSVNV

BSGFV 

ComYMV 

 CSSV

CiYMV

DBSNV 

TaBV

BCVBV 

SCBIMV

SCBMOV 

BSUIV

BSULV

BSUMV

RTBV

 CaMV

100

97

94

97

79

62

68

71

100

92

98

100

100

0.05 

103  

 

 

 

 

 

Figure 1  Phylogenetic  tree using neighbour‐joining method  (Kimura  2‐parameter 

model with bootstrapping  (1000 replicates)) of  the RT/RNaseH region of selected 

badnaviruses.  Rice  tungro  bacilliform  virus  (RTBV;  genus  Tungrovirus)  and 

Cauliflower mosaic virus  (CaMV; genus Caulimovirus) were used as out‐groups  to 

the  genus  Badnavirus. GenBank  accession  numbers  are:  Banana  streak OL  virus 

(BSOLV;  GenBank  accession  NC_003381),  Banana  streak  MY  virus  (BSMYV; 

GenBank  accession  NC_006955),  Kalanchoe  top‐spotting  virus  (KTSV;  GenBank 

accession  NC_004540),  Banana  streak  VN  virus  (BSVNV;  Genbank  accession 

AY750155),  Banana  streak  GF  virus  (BSGFV;  GenBank  accession  NC_007002), 

Commelina yellow mottle virus (ComYMV; GenBank accession NC_001343), Cacao 

swollen  shoot  virus  (CSSV; GenBank  accession NC_001574),  Citrus  yellow mosaic 

virus (CiYMV; GenBank accession NC_003382), Dioscorea bacilliform SN virus (DBV; 

GenBank  accession DQ822073),  Taro  bacilliform  virus  (TaBV; Genbank  accession 

AF357836), Bougainvillea chlorotic vein banding virus (BCVBV; GenBank accession 

EU034539),  Sugarcane  bacilliform  IM  virus  (SCBIMV;  GenBank  accession 

NC_003031),  Sugarcane  bacilliform  MO  virus  (SCBMOV;  GenBank  accession 

NC_008017),  RTBV  (GenBank  accession  NC_001914),  and  CaMV  (GenBank 

accession NC_001497).  Species whose  genome was  fully  sequenced  for  the  first 

time are shown in bold. 

104  

counterparts revealed at least a 20% nucleotide difference between the BSVs reported here 

and other recognised badnaviruses (Table 4).  

 

Detection of integrated sequences 

To investigate the possible presence of integrated DNA of the six new BSV species in banana 

genomic DNA, nucleic acid was extracted from a diverse collection of banana cultivars (Table 

2) which had previously been certified as negative for episomal BSV sequences by  ISEM and 

RCA.  The  nucleic  acid  extracts were  subsequently  used  in  PCR with  primers  designed  to 

specifically amplify a selected fragment of each of the six BSVs. Whereas no amplicons were 

detected  in extracts  from any of the 12 banana cultivars tested  for BSUAV, BSUIV, BSULV, 

BSUMV or BSCAV, amplicons of  the expected size were detected  in extracts derived  from 

the four banana cultivars Ainu, FHIA‐3, Balonkawe and Goly Goly Pot Pot tested for BSIMV 

(Table 2).   These  results  indicated  that,  for BSUAV, BSUIV, BSULV, BSUMV or BSCAV,  the 

sequences delimited by  these primers were not present  as either episomal or  integrated 

DNA  in  any  of  the  12  cultivars  tested.  In  contrast,  the  genomic  DNA  of  four  of  the  12 

cultivars tested appeared to contain an integrated BSIMV sequence.  

 

DISCUSSION 

We  have  completely  sequenced  the  genomes of  six BSV  isolates  collected  in  East 

Africa,  for  which  only  partial  sequences  have  been  previously  available.  All  six

105  

 

 

 

 

 

 

 

 

 

 

 

aPercent difference shown was calculated using the Kimura 2‐parameter model following ClustalW alignment in MEGA 4.0. 

Table 4 Pair‐wise distance matrix using core RT/RNaseH sequences of selected badnavirusesa

  BSCAV  BSUAV BSOLV BSGFV BSUIV BSULV BSUMV SCBIMV  SCBMOV BSMYV BSIMV BSVNV KTSV

BSCAV    23.2 26.1 38.3 45.8 43.1 47.1 50.8  47.9 38.9 33.5 34.8 37.4BSUAV      30.6 40.0 45.6 46.3 48.6 51.2  52.8 37.3 35.7 34.4 37.0BSOLV      43.4 44.4 48.2 46.4 53.6  50.8 38.0 28.0 38.2 34.6BSGFV      50.3 47.8 47.9 58.1  53.9 45.2 42.1 40.2 41.9BSUIV      23.2 27.9 38.1  34.2 47.8 52.7 49.9 50.4BSULV      26.1 39.2  35.6 48.2 50.3 51.2 53.0BSUMV      42.3  35.8 48.8 48.9 47.6 50.4SCBIMV      25.0 59.0 57.4 60.3 60.0SCBMOV      52.7 54.5 54.2 56.3BSMYV      43.3 38.6 39.5BSIMV      27.0 37.8BSVNV      36.8KTSV     

106  

sequences  had  a  typical  badnavirus  genome  organisation  and  contained  the 

conserved  motifs  characteristically  found  in  the  putative  ORF  3  polyprotein  of 

badnaviruses. Based on the criteria for recognition of distinct species in the genus 

Badnavirus  (a  difference  in  the  nucleotide  sequence  of  the  RT/RNaseH‐coding 

region of more than 20% (Hull et al., 2005)), we propose that the six isolates should 

be  recognised  as  new  BSV  species  and  be  designated  as  BSUAV,  BSUIV,  BSULV, 

BSUMV,  BSIMV  and  BSCAV  based  on  a  recent  amendment  to  the  naming 

convention  for badnaviruses  (Geering, 2010). The  results  from  this study confirm 

the  presence,  in  Uganda,  of  three  of  the  13  putative  BSV  species  reported 

previously  (Harper  et  al.,  2005).  Further,  this  is  the  first  report  of  BSCAV  from 

Kenya, and confirms a previous report of BSUAV and BSIMV in Kenya using IC‐PCR 

(Karanja  et  al.,  2008).  Importantly,  the  detection  of  BSUAV,  BSUIV,  BSULV  and 

BSUMV  in this study  is based on episomal DNA amplified by RCA, and not  IC‐PCR 

which may detect  integrated sequences  (Le Provost et al., 2006,  Iskra‐Caruana et 

al., 2009), as in previous studies. 

Previous  phylogenetic  analyses  of  full‐length  and  partial  sequences  have 

consistently  identified  three  distinct  clades  of  banana‐infecting  badnaviruses 

(Harper et al., 2005; Bousalem et al., 2008; Gayral and  Iskra‐Caruana, 2009). The 

isolates reported  in this study grouped within two of the three clades, consistent 

with previous reports. BSUIV, BSULV and BSUMV grouped within clade 3 which also 

includes badnavirus species characterised from sugarcane while BSUAV, BSCAV and 

BSIMV grouped within clade 1, which contained only badnavirus species originating 

from  banana.  Interestingly,  however,  the  sequence  of  our  BSCAV  isolate  also 

107  

showed  93‐96%  homology  at  the  nucleotide  level  to  six  unpublished  Sugarcane 

bacilliform  virus  (ScBV)  isolates  in  the GenBank database. As  such,  ScBV  isolates 

now appear to group within two different clades (clades 1 and 3), suggesting that 

the movement of badnaviruses across the host‐plant boundary between sugarcane 

and banana has likely occurred on more than one occasion.  

Several  authors  (Bousalem  et  al.,  2008;  Gayral  and  Iskra‐Caruana,  2009) 

have reported a close phylogenetic relationship between BSULV and the proposed 

BSUgKV  identified by Harper et al (2005). A comparison of the RT/RNaseH‐coding 

sequence  of  our  BSULV  isolate  to  other  badnavirus  sequences  revealed  82% 

homology to four sequences described as BSUgKV (Harper et al., 2005). This finding 

suggests that BSULV and BSUgKV are a single species.  

The  sequences  of  several  BSV  species  are  known  to  occur within  the M. 

balbisiana  genome,  the  presence  of  which  has  provided  a  challenge  for  the 

diagnosis  of  episomal  BSV  infection  using  PCR‐based  methodologies.  As  a 

preliminary  study  to  determine  whether  sequences  related  to  the  six  viruses 

reported in this study had integrated counterparts, 12 banana genotypes known to 

be free of episomal BSV were tested for each of the six viruses by PCR using virus‐

specific primers. None  of  the  samples  tested positive  for BSUAV, BSUIV, BSULV, 

BSUMV or BSCAV, while four plants, all containing B‐genomes, tested positive for 

BSIMV. The detection of  integrated BSIMV sequences in banana accessions with a 

M. balbisiana genome component  is consistent with previous reports  (Geering et 

al.,  2005A,  Gayral  et  al.,  2010).  Further,  when  the  sequences  of  the  core 

RT/RNaseH‐coding region of the six BSV species described in this manuscript were 

108  

used  to  search  for  homologous  endogenous  sequences  (both  endogenous 

badnavirus and Musa genomic BAC  sequences)  in GenBank, BSIMV  showed 99% 

homology  to  several endogenous badnavirus  sequences and 94% homology  to a 

Musa  balbisiana  BAC  sequence  (GenBank  accession  AP009334).  In  contrast,  the 

remaining  five  species did not produce a  significant match  (i.e. 80%  similarity or 

greater)  to  either  endogenous  badnavirus  or Musa  BAC  sequences. While  our 

findings do not conclusively exclude the presence of integrated sequences for each 

of the other five BSV species in the genotypes tested, the results suggest that PCR 

might be  a  suitable  tool  for diagnosis of  these  species  in bananas with  selected 

genetic backgrounds.  

Diagnosis  of  BSV  using  the  non‐sequence  specific  RCA  assay  should 

dramatically  improve the scope of detection of heterogeneous mixture of viruses 

comprising the BSV complex. Further, the full‐length sequences presented here will 

improve the opportunity to diagnose BSV  infections using restriction‐digest based 

RCA  assays.  Additional work  is  still  required,  however,  to  confirm  the  episomal 

nature of  the additional Ugandan BSV  isolates  reported by Harper et al.,  (2005). 

Biological  information pertaining  to  the BSV species reported  in  this work will be 

useful  to  understand  the  BSV‐banana  system  with more  clarity,  and  allow  the 

development of improved diagnostic tests. 

 

ACKNOWLEDGEMENTS  

This  research  was  funded  by  the  Bill  and  Melinda  Gates  Foundation  Grand 

Challenges in Global Health Program. We are grateful to our colleagues Dr. Charles 

109  

Changa and Dr. Jerome Kubiriba at the National Agricultural Research Organisation 

(NARO), Uganda, as well as Dr. Laura Karanja at the Kenyan Agricultural Research 

Institute (KARI), Njoro, Kenya, for assisting with field collections and leaf samples of 

banana. 

 

   

110  

REFERENCES 

Bousalem, M., Douzery,  E.J.P.,  Seal,  S.E.  (2008)  Taxonomy, molecular  phylogeny 

and  evolution  of  plant  reverse  transcribing  viruses  (family  Caulimoviridae) 

inferred  from  full‐length  genome  and  reverse  transcriptase  sequences.  

Archives of Virology, 153, 1085‐1102. 

Cheng,  C.P.,  Lockhart,  B.E.L., Olszewski, N.E.  (1996)  The ORFI  and  II  proteins  of 

Commelina  yellow  mottle  virus  are  virion‐associated.  Journal  of  General 

Virology, 223, 263‐271. 

Côte, F.X., Galzi, S., Folliot, M., Lamagnére, Y., Teycheney, P‐Y., Iskra‐Caruana, M‐L. 

(2010) Micropropagation by tissue culture triggers differential expression of 

infectious endogenous Banana streak virus sequences (eBSV) present in the B 

genome  of  natural  and  synthetic  interspecific  banana  plantains. Molecular 

Plant Pathology, 11, 137‐144.  

Dahal,  G.,  Hughes,  J.,  Gauhl,  F.,  Pasberg‐Gauhl,  C.,  Nokoe,  K.S.  (2000) 

Symptomatology  and  development  of  banana  streak,  a  disease  caused  by 

banana streak badnavirus, under natural conditions  in  Ibadan, Nigeria. Acta 

Horticulturae (ISHS), 540, 361‐375. 

Dallot, S., Acuña, P., Rivera, C., Ramírez, P., Côte, F., Lockhart, B.E.L., Caruana, M.L. 

(2001) Evidence  that  the proliferation stage of micropropagation procedure 

is determinant  in  the expression of banana  streak virus  integrated  into  the 

genome of the FHIA 21 hybrid (Musa AAAB). Archives of Virology, 146, 2179‐

2190. 

Gayral,  P.,  Blondin,  L.,  Guidolin,  O.,  Carreel,  F.,  Hippolyte,  I.,  Perrier,  X.,  Iskra‐

Caruana, M‐L.,  (2010) Evolution of endogenous sequences of Banana streak 

virus:  What  can  we  learn  from  banana  (Musa  sp.)  evolution?  Journal  of 

Virology, 84, 7346 – 7359. 

Gayral,  P.,  Iskra‐Caruana, M.L.  (2009)  Phylogeny  of  Banana  streak  virus  reveals 

recent and repetitive endogenization in the genome of its banana host (Musa 

sp.). Journal of Molecular Evolution, 69, 65‐80. 

111  

Gayral,  P.,  Noa‐Carrazana,  J‐C.,  Lescot,  M.,  Lheureux,  F.,  Lockhart,  B.E.L., 

Matsumoto,  T.,  Piffanelli,  P.,  Iskra‐Caruana,  M‐L.  (2008)  A  single  Banana 

streak  virus  integration  event  in  the  banana  genome  as  the  origin  of 

infectious endogenous pararetrovirus. Journal of Virology, 82, 6697‐6710. 

Geering, A.D.W.  (2009) The distribution of badnavirus‐infected Musa  germplasm 

from  the  international  transit  centre,  Katholieke  Universiteit  Leuven, 

Belgium.  In  International  Symposium  on  Recent  Advances  in  Banana  Crop 

Protection for Sustainable Production and Improved Livelihoods, pp85‐88. Eds 

D. Jones and I. Van den Bergh. ISHS. 

Geering, A.D.W.  (2010)  Five  new  species  and  four  nomenclature  changes  in  the 

genus  Badnavirus.  [online]  ICTV  Taxonomy  Proposals  ‐  Plant.  Available  at 

http://talk.ictvonline.org/files/proposals/taxonomy_proposals_plant1/m/pla

nt01/2216.asp [Accessed 14 December 2010].  

Geering,  A.W.D.,  McMichael,  L.A.,  Dietzgen,  R.G.,  Thomas,  J.E.  (2000)  Genetic 

diversity among banana streak virus isolates from Australia. Phytopathology, 

90, 921‐927.  

Geering, A.D.W., Olszewski, N.E., Harper, G., Lockhart, B.E.L., Hull, R., Thomas, J.E. 

(2005A)  Banana  contains  a  diverse  array  of  endogenous  badnaviruses. 

Journal of General Virology, 86, 511‐520. 

Geering, A. D. W.,  Pooggin, M.M., Olszewski, N.E.,  Lockhart,  B.E.L.,  Thomas,  J.E. 

(2005B) Characterisation of banana streak Mysore virus and evidence that its 

DNA  is  integrated  in the B genome of cultivated Musa. Archives of Virology, 

150, 787‐796. 

Geering,  A.W.D.,  Scharaschkin,  T.,  Teycheney,  P.Y.  (2010)  The  classification  and 

nomenclature of endogenous viruses of  the  family Caulimoviridae. Archives 

of Virology, 155, 123‐131. 

Harper, G., Hart, D., Moult, S., Hull, R. (2004) Banana streak virus is very diverse in 

Uganda. Virus Research, 100, 51‐56. 

112  

Harper, G., Hart, D., Moult, S., Hull, R., Geering, A., Thomas, J. (2005) The diversity 

of banana  streak  virus  isolates  in Uganda. Archives of Virology, 150, 2407‐

2420. 

Harper, G., Osuji,  J.O., Heslop‐Harrison,  J.S., Hull, R.  (1999)  Integration of banana 

streak  badnavirus  into  the  Musa  genome:  molecular  and  cytogenetic 

evidence. Virology, 255, 207‐213. 

Hull,  R.,  Geering,  A.,  Harper,  G.,  Lockhart,  B.E.,  Schoelz,  J.E.  (2005)  Family 

Caulimoviridae.  In  Virus  Taxonomy:  Eighth  Report  of  the  International 

Committee  on  Taxonomy  of  Viruses  p.  385‐396.  Eds  C.M.  Fauquet,  M.A. 

Mayo, J. Maniloff, U. Desselberger and L.A. Ball. London: Elsevier.  

Iskra‐Caruana, M.L., Gayral, P., Galzi, S., Laboureau, N. (2009)  How to control and 

prevent  the spread of banana streak disease when  the origin could be viral 

sequences integrated in the banana genome? In International Symposium on 

Recent Advances  in Banana Crop Protection  for Sustainable Production and 

Improved Livelihoods, pp77‐84. Eds D. Jones and I. Van den Bergh. ISHS. 

Jacquot, E., Hagen, L.S., Jacquemond, M., Yot, P. (1996) The open reading frame 2 

product of Cacao swollen shoot badnavirus  is a nucleic acid‐binding protein. 

Virology, 225, 191‐195. 

James, A.P., Geijskes, R.J., Dale, J.L., Harding, R.M. (2011) Development of a novel 

rolling‐circle amplification technique to detect banana streak virus which also 

discriminates  between  integrated  and  episomal  virus  sequences.  Plant 

Disease, 95, 57‐62. 

Karanja, L., Wangai, A., Harper, G., Pathak, R.S.  (2008) Molecular  identification of 

Banana  streak virus  isolates  in Kenya.  Journal of Phytopathology, 156, 678‐

686. 

Kimura,  M.  (1980)  A  simple  method  for  estimating  evolutionary  rate  of  base 

substitutions  through comparative  studies of nucleotide sequences.  Journal 

of Molecular Evolution, 16, 111‐120. 

113  

Le  Provost,  G.,  Iskra‐Caruana, M‐L.,  Acina,  I.,  Teycheney,  P‐Y.  (2006)  Improved 

detection  of  episomal  Banana  streak  viruses  by multiplex  immunocapture 

PCR.  Journal of Virological Methods, 137, 7–13. 

Leclerc, D., Burri, L., Kajava, A.V., Mougeot,  J.L., Hess, D., Lustig, A., Kleeman, G., 

Hohn,  T.  (1998)  The  open  reading  frame  III  product  of  Cauliflower mosaic 

virus  forms  a  tetramer  through  a  N‐terminal  coiled‐coil.  The  Journal  of 

Biological Chemistry, 237, 29015‐29021. 

Lheureux, F., Laboureau, N., Muller, E., Lockhart, B.E.L., Iskra‐Caruana, M.L. (2007) 

Molecular  characterisation  of  banana  streak  acuminata  Vietnam  virus 

isolated from Musa acuminata siamea (banana cultivar). Archives of Virology, 

152, 1409‐1416.  

Ndowora, T., Dahal, G., LaFleur, D., Harper, H., Hull, R., Olszewski, N.E., Lockhart, B. 

(1999)  Evidence  that  badnavirus  infection  in  Musa  can  originate  from 

integrated pararetroviral sequences. Virology, 255, 214‐220.  

Tamura, K., Dudley,  J., Nei, M., Kumar, S.  (2007) MEGA4: Molecular Evolutionary 

Genetics  Analysis  (MEGA)  software  version  4.0.  Molecular  Biology  and 

Evolution, 24, 1596‐1599. 

Yang, I.C., Hafner, G.J., Revill, P.A., Dale, J.L., and Harding, R.M. (2003)    Sequence 

diversity  of  South  Pacific  isolates  of  taro  bacilliform  virus  and  the 

development of a PCR‐based diagnostic test. Archives of Virology, 148, 1957–

1968. 

   

114  

   

115  

CHAPTER 5 

 

COMPARISON OF ROLLING‐CIRCLE AMPLIFICATION AND DIRECT‐PCR BASED 

METHODS FOR DIAGNOSIS OF BSV INFECTION IN EAST AFRICA 

 

A. P. James1, L. Karanja2, J. Kubiriba3, C. M. Changa3, J. A. Mugini4, R. J. Geijskes1, 

W. K. Tushemereirwe3, J. L. Dale1 and R. M. Harding1 

 

 

 

1Centre for Tropical Crops and Biocommodities, Queensland University of 

Technology, P.O. Box 2434, Brisbane, Queensland, 4001, Australia 

2Kenya Agricultural Research Institute, Njoro, P.O. Njoro, Kenya 

3National Agricultural Research Laboratories, Kawanda, National Agricultural 

Research Organisation, P.O. Box 7065, Kampala, Uganda 

4Mikocheni Agricultural Research Institute, P.O. Box 6226, Dar Es Salaam, Tanzania 

 

 

 

 

 

 

[Formatted for submission to Journal of Virological Methods] 

   

116  

STATEMENT OF AUTHORSHIP 

Anthony  James  (principal author): Contributed  to project concepts, executed  the 

work  (collected  samples,  designed  and  conducted  laboratory  experiments, 

analysed and interpreted results) and prepared initial manuscript. 

Signed………………………………………………………………..Date………………………………………… 

Laura Karanja: Collected samples, conducted laboratory experiments, analysed and 

interpreted results, critically interpreted data and contributed to final manuscript. 

Signed………………………………………………………………..Date………………………………………… 

Jerome Kubiriba: Collected samples, conducted  laboratory experiments, analysed 

and  interpreted  results,  critically  interpreted  data  and  contributed  to  final 

manuscript. 

Signed………………………………………………………………..Date………………………………………… 

Charles Changa: Collected  samples,  conducted  laboratory  experiments,  analysed 

and  interpreted  results,  critically  interpreted  data  and  contributed  to  final 

manuscript. 

Signed………………………………………………………………..Date………………………………………… 

Julius Mugini: Collected samples, conducted laboratory experiments, analysed and 

interpreted results, critically interpreted data and contributed to final manuscript. 

Signed………………………………………………………………..Date………………………………………… 

 

117  

 

Jason Geijskes: Supervised execution of  the work,  critically  interpreted data and 

contributed to final manuscript. 

Signed………………………………………………………………..Date…………………………………………… 

Wilberforce Tushemereirwe: Conceived project  idea, supervised execution of the 

work, critically interpreted data and contributed to final manuscript. 

Signed………………………………………………………………..Date…………………………………………… 

James Dale: Conceived project idea, collected samples, supervised execution of the 

work, critically interpreted data and contributed to final manuscript. 

Signed………………………………………………………………..Date…………………………………………… 

Rob Harding: Conceived project  idea, supervised execution of  the work, critically 

interpreted data and contributed to final manuscript. 

Signed………………………………………………………………..Date……………………………………………

118  

Abstract 

BSV  diagnosis  is  complicated  by  significant  serological  and  genomic  variability 

between  isolates  and  the presence of  endogenous  virus  sequences  in  the Musa 

genome. We tested samples of banana from Uganda, Kenya and Tanzania for BSV 

and  compared  the  results obtained using PCR with  species‐specific primers,  and 

rolling‐circle amplification.  For BSV with no known endogenous counterpart, both 

PCR  and RCA were  suitable methods  for BSV detection,  irrespective  of  the  host 

cultivar  genotype.  For  four  BSV with  endogenous  counterparts,  namely  Banana 

streak OL virus (BSOLV), Banana streak MY virus (BSMYV), Banana streak GF virus 

(BSGFV)  and  Banana  streak  IM  virus  (BSIMV),  PCR  and  RCA  were  suitable  in 

cultivars with a pure Musa acuminata genetic background. However,  in bananas 

with  a M. balbisiana  (B‐genome)  genetic background, many more  samples were 

positive  using  PCR  compared  to  RCA,  suggestive  of  positive  results  due  to 

integrated BSV sequences and not episomal virus infection. In these cases, RCA was 

needed  to  diagnose  BSV  infection.  For  generic  BSV  indexing,  RCA  is  the  most 

suitable method as it is able to detect a broad range of BSV species while avoiding 

detection of integrated sequences. However, the faster and cheaper PCR serves as 

a  suitable  alternative  for  BSV  diagnostics  in  specific  combinations  of  host  plant 

cultivar and BSV species.   

119  

Introduction 

Bananas (Musa spp. (L)) are an important crop worldwide and are the largest fresh 

fruit crop traded internationally in terms of both volume and value (FAO, 2011). In 

many developing  countries,  including Uganda, Kenya and Tanzania, bananas also 

serve as an important staple food and cash crop. Sustainable production, however, 

is hindered by a range of different pathogens of which viruses are considered some 

of the most important.  

Banana  streak disease  (BSD), caused by a complex of Banana  streak virus 

(BSV)  species  in  the genus Badnavirus,  family Caulimoviridae, has been  reported 

from most banana‐producing countries in Africa, Latin America‐Caribbean and the 

Asia‐Pacific region (Lockhart and Jones, 2000). Although yield losses of 6‐15% have 

been  associated with  BSD  (Dahal  et  al.,  2000;  Daniells  et  al.,  2001),  of  greater 

significance  is  the  effect  of  BSV  on  Musa  breeding  programmes  and  the 

international  exchange of Musa  germplasm  (Geering,  2009;  Iskra‐Caruana  et  al., 

2010).  

There  are  currently  four  characterised  BSV which  are  considered  distinct 

species, namely Banana streak OL virus (BSOLV), Banana streak GF virus (BSGFV), 

Banana streak MY virus  (BSMYV) and Banana streak VN virus  (BSVNV, previously 

Banana streak acuminata Vietnam virus)  (Geering, 2010). However, six additional 

distinct BSV species have recently been proposed based on analyses of full‐length 

sequences (Geering et al., 2011; James et al., 2011b).  Harper et al. (2005) reported 

an  additional  nine  distinct  groups  of  BSV  partial  sequences  from  bananas  in 

Uganda, suggesting further diversity of BSV exists in this region. 

The  banana‐BSV  pathosystem  is  complicated  by  the  presence  of 

endogenous badnavirus sequences present in the Musa genome (Iskra‐Caruana et 

al., 2010). The complete genome of several BSV,  including BSOLV, BSGFV, BSMYV 

and Banana streak IM virus (BSIMV), are present in Musa accessions with a genetic 

background  that  includes a Musa balbisiana  (B)‐genome.  Further,  the  integrated 

sequences  of  these  four  species, which  are  referred  to  as  endogenous  Banana 

streak OL  virus  (eBSOLV), eBSMYV, eBSGFV and eBSIMV,  can be activated under 

120  

stress conditions (eg. tissue culture) to cause episomal infections (Côte et al., 2010; 

Dallot et al., 2001; Gayral et al., 2010; Geering et al., 2011; Ndowora et al., 1999). 

In  addition  to  these  four  integrants,  Geering  et  al.  (2005a)  identified  partial 

sequences of 33 distinct badnavirus sequence groups  in bananas free of episomal 

virus, which shared  less  than 85% nucleotide  identity  to each other and many of 

which were non‐functional.  

Reliable  diagnosis  of  BSV  is  complicated  by  the  high  genomic  sequence 

variability of  individual  isolates and the presence of eBSV sequences within some 

Musa genomes. For example, the use of PCR to detect BSOLV, BSMYV and BSGFV in 

Musa accessions with a B‐genome can result in false positives due to amplification 

of eBSVs (Harper et al., 1999; James et al., 2011a; Le Provost et al., 2006). Although 

PCR‐based methods which  aim  to  avoid  detection  of  eBSVs,  such  as    immuno‐

capture PCR  (IC‐PCR), have been  reported  (Harper et al., 1999; Le Provost et al., 

2006;  Iskra‐Caruana  et  al.,  2009),    these  methods  suffer  from  the  inability  of 

antiserum to capture all BSV isolates (Harper et al., 2002), the use of BSV species‐

specific primer sets which are unlikely to detect the entirety of the BSV sequence 

diversity and  the presence of contaminating, carry‐over nucleic acid  remaining  in 

capture  tubes  leading  to  false positives  (Le Provost et al., 2006;  Iskra‐Caruana et 

al., 2009). Further, despite attempts to improve the breadth of detection by using 

degenerate  primers  a  loss  in  sensitivity  of  detection  and  a  failure  to  detect  all 

isolates was reported (Iskra‐Caruana et al., 2009).  

Recently,  we  developed  a  sequence‐independent  BSV  detection method 

based on  rolling‐circle amplification  (RCA) which was shown  to detect a  range of 

episomal  BSV  species  and  not  detect  eBSVs  (James  et  al.,  2011a).  Despite  the 

development  of  this  improved  diagnostic  protocol,  the  expense  of  the  RCA  test 

may preclude its widespread utility, particularly in resource‐poor African countries. 

As such,  in particular host cultivar‐virus species combinations, PCR may  remain a 

sensitive, specific and  less‐costly option for diagnosing  infection. The feasibility of 

such an approach was recently demonstrated in a study involving the identification 

and characterisation of BSV  in East Africa  (James et al., 2011b).  In  this study,  six 

BSV were characterised and it was shown, using virus‐free samples, that PCR could 

121  

be  reliably  used  to detect  five  of  these proposed BSV  species.  Furthermore,  for 

three of the six BSV, namely Banana streak UI virus (BSUIV), Banana streak UL virus 

(BSULV) and Banana streak UM virus  (BSUMV), no similar endogenous sequences 

are  known  to occur  in  banana  (Geering  et  al.,  2005a; Gayral  and  Iskra‐Caruana, 

2009),  thus  reinforcing  the  notion  that  a  direct  PCR  approach  may  provide  a 

sensitive, low cost approach to diagnosis in some instances.  

To further investigate the most appropriate and reliable diagnostic tests for 

BSV detection, we assessed both RCA and PCR for their ability to detect BSV in field 

samples of banana from Uganda, Kenya and Tanzania.  In this paper, we show that 

for  several  species  of  BSV,  direct  PCR  is  a  suitable method  to  screen  for  virus 

infection,  irrespective  of  the  host  cultivar  genotype  while,  as  previously 

demonstrated, detection of those species of BSV with endogenous counterparts in 

cultivars with a B‐genome component  requires a method such as RCA which can 

distinguish  between  integrated  and  episomal  virus  DNA.  The  advantages  and 

limitations of PCR and RCA as molecular tests for BSV detection are also discussed. 

 

Materials and Methods 

Plant samples  

Leaf  samples used  for  this  study were  collected  from banana plants during  field 

visits  in  Uganda  (April  2008  and  February  2010),  Tanzania  (October  2008)  and 

Kenya  (March 2009)  (Table 1 and Fig. 1). Fresh  leaf tissue  (10 cm2) was cut  into 

small pieces  (0.5  cm2) and  stored dried over  silica gel until analysis. The  identity 

and  genotype  of  banana  cultivars  (see  supplementary  Table  6) was  determined 

based  on  morphological  characteristics  by  local  agricultural  services  staff  and 

through discussion with farmers/agricultural officers at each site. Verification was 

also  attempted  using  the  Musa  genome  information  service  (MGIS)  website 

(http://www.crop‐diversity.org/banana/#AccessionSearch).  As  a  positive  control 

for BSV detection, a BSMYV‐infected banana plant was used (James et al., 2011a).  

 

122  

  

Table 1 Summary of plant samples collected in East Africa 

Country  District  No. of field sites No. of samples

Uganda  Rakai  2  8   Masaka  2  7   Ntungamo  1  5   Kyangara  1 5  Kamunyiga  1  4   Ibanda  3  11   Bushenyi  2  9   Rwimi  1 3  Bulera  1  4   Mbarara  1  20 Tanzania  Kyela  11  10   Rungwe  13 16Kenya  Nyamira  1  2   Kisii  7  15   Vihiga  3  3   Ibonda  1 3  Kakamega  6  10   Mumias  3  3   Bungoma West  4  4   Bungoma  1 1

123  

 

 

 

 

Fig. 1 Maps of A) Uganda, B) Tanzania and C) Kenya indicating regions surveyed. Open circles indicate the location of districts in each country 

where field visits were made. Numbers within circles indicate the number of samples collected in each district.   

 

124  

PCR and RT‐PCR assays 

Total nucleic acid  (TNA) was extracted  from dried  leaf  tissue as described by  James et al. 

(2011a).  Virus‐specific  PCR  assays were  carried  out  for  the  detection  of  BSMYV,  BSOLV, 

BSGFV, BSIMV, Banana  streak CA  virus  (BSCAV), Banana  streak UA  virus  (BSUAV), BSUIV, 

BSULV and BSUMV using species‐specific primers (Table 2). As an extraction control, a PCR 

assay was  initially done on TNA extracts using primers  specific  for  the banana actin gene  

(James  et  al.,  2011a)  or  18S  ribosomal  RNA  gene  using  primers  Musa18Sf  (5’ 

CATCACAGGATTTCGGTCCT  3’)  and  Musa18Sr  (5’  AGACAAATCGCTCCACCAAC  3’)  which 

amplify a 500 bp product. PCR mixes (20 µL) contained 10 µL 2x GoTaq Green Master Mix 

(Promega Corp, Madison, WI), 5 ρmol of each primer, 1 µL of nucleic acid extract (diluted to 

10 ng/µL) and water to final volume. PCR cycling conditions were an initial denaturation of 

94°C for 2 min followed by 35 cycles of 94°C for 20 s, annealing for 20 s and 72°C for 30 s, 

with a final extension at 72°C for 2 min. Primer annealing temperatures were 57°C (Actin) or 

50°C (18S rRNA) while those for BSV were as listed in Table 2. 

Reaction products were electrophoresed  through 1.5% agarose gels,  stained using 

0.25x  SYBR®  Safe  DNA  Gel  Stain  (Invitrogen  Corp,  Carlsbad,  CA)  and  DNA  fragments 

visualised on a Safe imager blue‐light transilluminator. 

 

Rolling‐circle amplification (RCA)   

RCA was performed using the protocol described in James et al. (2011a). RCA reactions were 

digested with the restriction enzymes StuI or PstI and the products visualised on 1% agarose 

gels.  RFLP‐based  identification  of  BSV  from  RCA  digests was  based  on  the  characteristic 

patterns listed in Table 3.  

 

125  

Table 2  PCR primers used for detection of BSV speciesa 

BSV  Primer 1 (coding strand 5´ ‐ 3´) Primer 2 (complementary strand 5´ ‐ 3´) 

Amplicon size (bp) 

Annealing temp (°C) 

BSOLV  ATCTGAAGGTGTGTTGATCAATGC GCTCACTCCGCATCTTATCAGTC 522  57 BSGFV  ACGAACTATCACGACTTGTTCAAGC TCGGTGGAATAGTCCTGAGTCTTC  476  57BSMYV  TAAAAGCACAGCTCAGAACAAACC CTCCGTGATTTCTTCGTGGTC 589  57BSCAV  AGGATTGGATGTGAAGTTTGAGC ACCAATAATGCAAGGGACGC 782  57BSULV  GAACTGACAGTAGCGCAATCG GACTTGGCTTGCCTGAGTATCG 943  60BSUIV  GAATCCTCAAAGGTACCCC CATGAGGTCAAGCATATGC 619  50BSUMV  GACGAGCTGCAAGCTCTCAGG TGTGCCTATTCTGAGGTTGG 467  50BSUAV  CTCAGCGGCAAGATTAGGAAGG TCCCCATTGGTCGTCATTGC 517  60BSIMV  GCTAGGAAGAAAAGTCTGGG TGCAAGTCTACTTACACAGC 475  50a  Primer sequences derived from Geering et al. (2000) and James et al. (2011b)

126  

 

Table 3  Predicted restriction profiles of genomic DNA from characterised BSV using PstI and StuI 

Restriction enzyme 

Predicted sizes (bp) of restriction fragments 

BSMYV  BSOLV  BSGFV BSIMV BSCAV BSUAV BSUIV BSULV BSUMV 

PstI 

6881, 769 

2635, 2442, 2312 

7218, 45 

7769 Does not cut 

4490, 3029 

6989, 407, 62 

4746, 2655 

5005, 2527 

StuI  7650  3111, 2436, 1842 

6034, 1229 

4389, 2407, 973 

7408 7519 5532, 1936 

7401 3726, 2239, 1567 

127  

Results  

A total of 143 samples were collected (Table 1) and tested for BSV using PCR and 

RCA (see supplementary Table 6). Of these, 95 were recorded as having only an A‐

genome  component,  while  46  were  recorded  as  possessing  some  B‐genome 

component, with two samples (Ug233/234) collected from genotypes not derived 

from either Musa acuminata or M. balbisiana.  

Using  the nine  sets of BSV  species‐specific primers, 44  samples were not 

considered positive for any BSV tested by PCR. Of these, 43 samples were recorded 

as  having  no  B‐genome  component.  One  sample  containing  a  B‐genome 

component was PCR negative  for all nine primer  sets  (Ke166); given  this cultivar 

was recorded as Sukali Ndizi (AAB genome) and all other samples from this cultivar 

(n=14) were PCR positive it is likely this sample was misidentified. 

 

Detection of BSV with no known endogenous equivalents 

Of the nine BSV species assayed using PCR, five (BSCAV, BSUAV, BSUIV, BSULV and 

BSUMV) do not have a confirmed endogenous equivalent. When the 143 samples 

were  tested  for  these  five  viruses  by  PCR,  two  plants  with  AAA  genotypes 

(Ke171/172) were positive for BSCAV. Both of these samples, and no others, were 

confirmed  to  contain  BSCAV  by  RCA/sequencing. When  tested  for  BSUAV,  four 

samples were PCR positive, including three (Ke155/156/177) from cultivars with an 

A‐only  genotype,  and  one  (Ke169)  from  cultivar  Sukali  Ndizi  (AAB  genotype). 

RCA/sequencing confirmed BSUAV in the three A‐only cultivar samples but sample 

Ke169 was considered RCA negative.  

Six  samples,  all  from  cultivars  with  AAA  genotypes,  tested  positive  for 

BSUIV by PCR. Five of these six samples also tested positive for BSV by RCA, with 

the  virus  status  of  one  sample  (Ug42)  inconclusive.  Two  of  the  RCA  positive 

samples  (Ug8/11)  had  the  predicted  BSUIV  digest  pattern  (Table  3)  and  the 

presence  of  this  virus  was  confirmed  by  sequencing.  Although  the  restriction 

profiles of the RCA products from the remaining three samples were not typical of 

128  

BSUIV, both BSULV and BSUMV were detected  in samples Ug5 and Ug12  (by PCR 

and RCA/RFLP),  respectively, while Ug15  had  a  full‐length RCA  product  and was 

also PCR positive for BSOLV.  

  PCR  screening  of  the  143  samples  identified  BSULV  in  five  samples 

(Ug1/2/5/7/10), all of which possessed AAA genotypes. Four of these five samples 

were confirmed to contain BSULV by RCA using RFLP analysis and/or sequencing, 

while the virus status in sample Ug7 was inconclusive.  

  When  the 143  samples were  screened  for BSUMV using PCR, 15 positive 

samples  were  identified  all  of  which  were  AAA  genotypes.    All  samples  were 

confirmed  to be  infected with BSUMV by RCA based on  the distinct RFLP profile 

predicted for this virus (Table 3). One additional sample (Ug28; AAB genome) also 

tested positive for BSUMV by RCA. 

Of the 30 samples which where PCR positive for one or more of the five BSV 

with no  integrated counterparts, 96.7%  (or 29 samples) were  from cultivars with 

no  B‐genome  component  (Table  4).  One  sample  (Ug28)  with  a  B‐genome 

component was RCA positive for BSUMV, despite not testing positive by PCR, giving 

a  total of 31  samples  testing positive by both PCR and RCA. When  the  results of 

BSV detection by PCR  and RCA were  compared,  there was  inconsistency  in only 

two  samples  (Ke169  and  Ug28).  Interestingly,  sample  Ke169 was  asymptomatic 

(PCR  positive/RCA  negative),  while  Ug28  had  a  mild  mosaic  symptom  (PCR 

negative/RCA  positive).  RCA  confirmed  a  positive  diagnosis  by  PCR  in  96.4%  of 

samples (Table 4), with at least one BSV species identified by PCR confirmed using 

RCA, except sample Ug15 where sequencing was not completed. 

129  

 

Table 4 PCR and RCA detection of BSV species with no confirmed eBSV

BSV sp.  No. of samples positive by PCR  No. of PCR positive samples also positive by RCA    (% of PCR positive samples)a 

Country where detected 

No. of sites where detected 

  A‐only genome  (% of total positives) 

Some B‐genome(%of total positives)

Total

   BSCAV  2 (100%)  0  2  2 (100%)  Kenya  1              BSUAV  3 (75%)  1 (25%)  4  3 (75%)        Kenya  3              BSUIV  6 (100%)  0 6 2 (40%)         

5 (83.3%) Uganda 3

   BSULV  5 (100%)  0  5  4 (100%)  Uganda  1    BSUMV  15 (100%)  0  15  15b (100%)  Uganda  6    TOTAL  29 (96.7%)  1 (3.3%)  30c  27b (96.4%)  n/a  n/a a Percent detection does not include samples where the result was “inconclusive”. Text formatted in italics indicates all samples 

considered RCA positive from the specific subset of PCR positive samples, despite the specific BSV not identified based on results of 

RFLP analysis or sequencing.  b One additional RCA positive sample was not detected using PCR c Multiple infections detected in two samples 

130  

Detection of BSV with known endogenous equivalents 

Four of the nine BSV species assayed using PCR, namely BSIMV, BSGFV, BSOLV and 

BSMYV,  have  integrated  counterparts  (eBSV)  in  bananas  with  a  B‐genome 

component. When  the  143  samples were  tested  for  these  four  viruses  by  PCR, 

BSIMV  was  detected  in  eight  samples.  Six  of  these  were  in  cultivars  which 

contained  a  B‐genome, while  the  remaining  two  samples  (Ug29/42) were  from 

bananas with AAA genotypes. When the two A‐only genome samples were tested 

by RCA, BSIMV was not clearly  identified  in either sample following RFLP analysis. 

However sample Ug29 was shown  to be  infected with BSUMV  (by RCA/RFLP and 

PCR) while the virus status of sample Ug42 was inconclusive. Of the six B‐genome 

containing  samples  tested by RCA,  the presence  of both BSIMV  and BSGFV was 

confirmed  in  Ug250  by  sequencing,  BSGFV  only  was  identified  in  Ug244  by 

sequencing, while  sample Ug32  had  an RFLP  profile  consistent with BSIMV.  The 

remaining three samples (Ug51/241 and Tz134) were considered RCA negative. 

BSMYV  was  detected  in  44/143  samples  using  PCR,  only  one  of  which 

(Ke176) was an A‐only genome cultivar. BSOLV and BSGFV were also detected  in 

this sample by PCR, and the presence of both BSMYV and BSGFV was confirmed by 

RCA/sequencing. In the remaining 43 samples from cultivars which contained a B‐

genome component, eight samples were  found to be solely  infected with BSMYV 

using  PCR  and,  in  all  cases,  this  result  was  confirmed  by  RCA/sequencing  The 

remaining 35 samples tested PCR positive  for at  least one other BSV with 34, 20, 

five  and  one  samples  testing  positive  for  BSOLV,  BSGFV,  BSIMV  and  BSUAV, 

respectively. When these 35 samples were tested by RCA, BSV was detected in 22 

samples, with one failed reaction (Tz114) and the remaining 12 samples considered 

RCA negative. Interestingly, BSMYV was not identified by either RFLP or sequencing 

in  any  of  these  22  B‐genome  samples,  despite  dual  infections  confirmed  in  six 

samples and single infections confirmed by RFLP and/or sequencing in 15 samples 

(with sample Ug32 not sequenced).  

A  total of 27/143  samples  tested positive  for BSGFV by PCR, of which  six 

were in cultivars with an A‐only genome. Of these six samples, five were also PCR 

131  

positive  for  BSOLV  and  one  of  these  five  (Ke176) was  also  positive  for  BSMYV. 

When  tested by RCA,  the presence of BSGFV was confirmed  in all six samples by 

sequencing, while BSMYV was  identified  in sample Ke176. Based on RFLP profiles 

and  sequencing, BSOLV was only  identified  in  two of  the  six  samples. Of  the 21 

samples containing a B‐genome component that were PCR positive for BSGFV, 20 

were also PCR positive  for both BSOLV and BSMYV, suggesting  that multiple PCR 

positives are common to field samples from both A and B‐genome cultivars using 

these three primer sets. However,  in contrast to A‐only genome cultivars, only 13 

B‐genome  samples  with  BSGFV  were  confirmed  using  RCA  (by  RFLP  and/or 

sequencing), with the remaining eight samples either negative by RCA (six samples) 

or RCA positive  for BSOLV only  (Ug243/245). No  samples  (either A or B genome 

groups) which tested negative  for BSGFV by PCR were positive  for BSGFV by RCA 

analysis. 

PCR screening for BSOLV  identified 63 positive samples (27 with an A‐only 

genotype and 36 with  some B‐genome  component). When  the 27  samples  from 

the  cultivars  with  A‐only  genotypes  were  tested  by  RCA,  24  were  considered 

positive for BSV with BSOLV identified in eight of these by RFLP (seven samples) or 

sequencing (one sample). Of the three samples which were not considered positive 

by RCA, one  failed  (Tz112), one was RCA negative  (Ug9) and  the digest results  in 

one sample were  inconclusive (Ug30). In contrast to PCR results for BSGFV, of the 

27 A‐only samples which were BSOLV positive, only five were also PCR‐positive for 

BSGFV and  the same single co‐positive BSMYV sample  (Ke176) was  identified. Of 

the 36 B‐genome samples which were PCR positive  for BSOLV, 34 were also PCR 

positive  for BSMYV and 19 were PCR positive  for BSGFV.  Interestingly, of  the 16 

samples which tested PCR positive for BSOLV but not BSGFV, 15 were of the apple 

banana cultivar  (Sukali Ndizi). Of these 16 samples, 15 were also PCR positive  for 

BSMYV. When  the  36  samples were  tested  using  RCA,  21 were  considered  BSV 

positive,  with  BSOLV  identified  in  12  samples  by  RFLP.  Of  the  15  samples  not 

considered  BSV  positive,  14  were  considered  RCA  negative  while  one  reaction 

failed (Tz114).  

132  

PCR diagnosis identified 75 samples which were positive for one or more of 

the  four  BSV  species  with  integrated  counterparts.  Of  these,  60%  were  from 

cultivars with some B‐genome component (Table 5). Interestingly, PCR detection of 

BSMYV was  almost  exclusively  in  B‐genome  cultivars  (97.8%), with  detection  of 

BSGFV  (77.8%),  BSIMV  (75%),  and  BSOLV  (57.1%)  all  considerably  higher  in  B‐

genome cultivars compared with BSV with no endogenous equivalent (Table 4 & 5). 

RCA based  screening  identified 57 positives out of  the 75  (or 76%) which  tested 

positive by PCR, although two samples  (Tz112/114)  failed and the results  for two 

samples (Ug30/42) were  inconclusive. The remaining 14 samples were considered 

negative  by  RCA. Of  the  30  samples  from  A‐genome  cultivars,  only  one  sample 

(Ug9) was considered positive by PCR but not by RCA. This detection rate of 96.3% 

(Table 5)  is consistent with  those samples  infected with BSV only known  to have 

episomal  forms.  Similarly,  a  single  sample  (Tz119)  was  RCA/RFLP  positive  for 

BSOLV,  but  PCR  negative,  maintaining  consistency  in  “misses”  between  assay 

formats. In contrast, in samples from cultivars with a B‐genome, only 70.5% of PCR 

positive samples were diagnosed positive using RCA (Table 5). 

Furthermore,  in A‐genome samples positive for one or more of these four 

species 11 had dual  infections and a single sample contained three viruses, based 

on PCR analysis.  In contrast, when B‐genome samples were tested by PCR, 2 had 

quadruple infections, 22 had triple infections and 12 had dual infections, with only 

nine samples a single infection. This high level of detection of multiple infections in 

B‐genome cultivar samples probably reflects the detection of eBSV in some, if not 

all, of these samples when using PCR. 

 

Samples with unidentified BSV 

Based on field observations (see supplementary Table 6), 15 samples which tested 

negative  by  PCR  displayed  characteristic  streak  symptoms.  Four  of  these 

(Ug33/34/38/Ke164)  had  full‐length  digest  profiles  in  RCA  (none  of which were 

133  

Table 5 PCR and RCA detection of BSV species with confirmed eBSV 

BSV sp.  No. of samples positive by PCR No. of PCR positive samples also positive by RCA   (% of PCR positive samples)a, b 

Country where detectedc

No. of districts where detectedc 

 A‐only genome (% of total positives)

Some B‐genome (% of total positives) Total

A‐only genome 

Some B‐genome Total

           BSIMV  2 (25%)  6 (75%) 8 0

1 (100%)a 2 (33.3%)3 (50%) 

2 (33.3%)4 (57%)a 

Uganda 3

   BSGFV  6 (22.2%)  21 (77.8%)  27  6 (100%)  13 (62%)  19 (70%)  Kenya 

Uganda 4 3 

                 BSMYV  1 (2.2%)  43 (97.8%)  44  1 (100%)  8 (19%) 

30 (71.4%) 9 (21%) 31 (72%) 

Kenya Uganda 

5 1 

                 BSOLV  27 (42.9%)  36 (57.1%) 63 8 (32%)

24 (96%) 12(34.3%)21 (60%) 

20/60 (33.3%) 45/60 (75%) 

KenyaTanzania Uganda 

22 4 

                 TOTAL  30 (40%)  45 (60%) 75 26d (96.3%)  31 (70.5%) 57 (76%) n/a n/aaPercent detection does not include samples where the result was “inconclusive”.  b Text formatted in italics indicates all samples considered RCA positive from the specific subset of PCR positive samples, despite the 

specific BSV not identified based on results of RFLP analysis or sequencing.  cConfirmed by RFLP or sequencing in B‐genome samples dOne additional RCA positive sample was not detected using PCR 

134  

cloned), while  for  three  samples  (Ug37/39/40)  the  RCA  digest was  inconclusive. 

However,  the  remaining  eight  samples  with  streak  symptoms  were  all  RCA 

negative. One remaining sample (Ug44), with abnormal bunch symptoms, was also 

considered RCA positive with a distinct RFLP pattern.  

 

Discussion 

In  this  study, we  collected  leaf  samples  from  bananas  from  several  districts  in 

Uganda, Tanzania and Kenya and  tested  them  for  the presence of BSV using PCR 

and RCA. Symptoms of streak disease were widespread in south‐west Uganda and 

western Kenya, consistent with previous studies (Harper et al., 2004, 2005; Karanja 

et al., 2008). In Tanzania, BSD was also observed at several locations although the 

incidence was considerably lower than that seen in Uganda and Kenya. 

For  five  of  the  nine  BSV  studied,  no  known  eBSV  are  reported.  When 

screening for these five BSV, PCR and RCA were equally efficacious at detecting BSV 

(Table  4).  In  some  cases,  multiple  infections  comprising  these  five  BSV  were 

identified using PCR but not by RCA  (samples Ug5/12). Similarly, PCR  identified a 

further  eight  samples with multiple  infections  comprising  one  of  these  five  BSV 

with one of  the  four BSV having an  integrated counterpart.  In contrast, RCA only 

identified one of these samples (Ug17) to contain a dual  infection based on RFLP. 

In  light  of  these  results,  PCR  could  be  considered  a  better method  to  diagnose 

infection.  

The remaining four BSV studied (BSIMV, BSOLV, BSGFV and BSMYV) all have 

characterised  eBSV  present  in  bananas with  a  B‐genome  component, which  are 

identical  to  episomal  sequences  which  infect  banana  (Geering  et  al.,  2001  & 

2005a/b; Gayral et al., 2008;  Iskra‐Caruana et al., 2010). Diagnosis of  these  four 

BSV species using PCR is complicated by eBSV sequences which give rise to positive 

results which do not reflect the presence of episomal virus infection (Harper et al., 

1999;  James  et  al.,  2011a;  Le  Provost  et  al.,  2006). When  samples  from  A‐only 

genome cultivars were tested for BSIMV, BSOLV, BSGFV and BSMYV by PCR, there 

135  

was 96.3% agreement  in the detection of infected samples between PCR and RCA 

(Table  5).  However,  in  samples  collected  from  cultivars  with  some  B‐genome 

component, only 70.5% of samples which tested positive for one or more of these 

four  BSV  using  PCR  were  also  considered  positive  using  RCA.  This  level  of 

agreement is considerably lower than that for these four BSV in A‐only cultivars, or 

for  the  five  BSV  without  integrated  counterparts  in  bananas  of  any  genetic 

background, where  consistency  in detection  levels between PCR and RCA was  in 

the order of 96% (Table 4/5).  

In  the  present  study,  a  distinct  cultivar  preference  of  BSV  detection was 

evident. For the five viruses with no identified eBSV, 96.7% of PCR positive samples 

were  from  cultivars with an A‐only genotype and all but one of  these were also 

positive using RCA  (Table 4).  Four of  the  five BSV  in  this  group were exclusively 

detected in A‐only genome cultivars. Whether this is a reflection on farmer cultivar 

preference  in East Africa, or  indicative of  the  slow nature of  field  spread of BSV 

remains to be confirmed. In contrast, 40% of PCR positive samples for the four BSV 

with integrated counterparts were from A‐only genome cultivars, again all but one 

were positive by RCA. Of the nine BSV studied, BSOLV was the most prevalent virus 

detected  with  27  PCR‐positive  in  A‐only  genome  samples  and  12  confirmed 

positive  in B‐genome samples. The next most prevalent BSV species’ were BSGFV 

(19  confirmed),  BSUMV  (15  confirmed),  BSMYV  (10  confirmed)  and  smaller 

numbers of the other species.  

In  a  number  of  samples  collected  from  all  three  countries,  symptoms  of 

streak disease were recorded but either no virus was detected using either PCR or 

RCA (Ug36, Tz129/130, Ke153/160/161/168/174), or samples were considered RCA 

positive  and  PCR  negative  but  for which  cloning was  unsuccessful  (Ug33/34/38, 

Ke164).  These  samples  represent  an  interesting  finding  and  suggest  that  further 

BSV species might be present  in the  field  in East Africa, such as BSVNV or one of 

the nine additional Ugandan isolates reported by Harper et al. (2005).  

For several samples, the presence of multiple bands or faint bands in RFLP 

analyses of RCA products hindered the  interpretation.   Although repeat testing  is 

136  

necessary  in  these cases  in order  to make a diagnosis,  this  is not always possible 

when small samples are collected at distant field sites on surveys. Optimisation of 

reaction  parameters,  including  template  quality  and  quantity,  as  well  as 

modifications to the reagents present  in the reaction mixture  (degenerate primer 

mixture/random hexamer primers) may improve the robustness of the RCA assay. 

Alternatively,  the choice of  restriction enzyme may prove critical  in  reducing  the 

number  of  fragments  produced  in  digests.  Failure  of  RCA  to  detect  BSV  in 

asymptomatic  samples where  PCR was  successful may  reflect  the  difference  in 

sensitivity  of  the  two methods,  or  the  detection  of  eBSV  in  cultivars with  a  B‐

genome.  

Both  PCR  and  RCA  are  useful  techniques  for  BSV  detection,  each  with 

distinct advantages and  limitations  (Table 6). The choice of test, however, should 

be informed by the intended purpose of the testing. In virus‐indexing schemes, for 

example,  where  virus  detection,  and  not  characterisation,  is  of  paramount 

importance,  RCA  should  be  the  preferred  choice  based  on  the  broad  range  of 

detection,  ability  to  specifically  amplify  episomal  DNA,  and  capacity  to  detect 

uncharacterised BSV species (James et al., 2011a). In contrast, in situations such as 

disease surveys, the identification of all BSVs present in a sample is required. For A‐

genome  cultivars or BSV  species without  integrated  equivalents,  PCR  can  satisfy 

this  requirement  quickly  and  cost‐effectively.  In  all  other  cases,  it  would  be 

necessary to use RCA to identify and characterise BSV either by their distinct RFLP 

patterns, or by cloning and sequencing of digest fragments. 

 

Acknowledgements 

This  research  was  funded  by  the  Bill  and  Melinda  Gates  Foundation  Grand 

Challenges in Global Health Program. We are grateful to project staff that assisted 

with field visits as well as farmers in all three countries for their permission to visit 

and collect samples. 

   

137  

Table 6 Advantages and disadvantages of RCA and PCR for BSV detection 

  Advantages  Disadvantages  

RCA   Broad spectrum Avoids integrated sequences Uncharacterised BSV  

Cost Inconclusive results  

PCR  Cost Identification  

Narrow spectrum Detects integrated sequences Sequence variants Uncharacterised BSV  

138  

References  

Côte, F.X., Galzi, S., Folliot, M., Lamagnère, Y., Teycheney, P‐Y., Iskra‐Caruana, M‐L. 

2010. Micropropagation by tissue culture triggers differential expression of 

infectious endogenous Banana streak virus sequences (eBSV) present in the 

B  genome  of  natural  and  synthetic  interspecific  banana  plantains. Mol. 

Plant Pathol. 11, 137–144. 

Dahal, G., Ortiz, R., Tenkouano, A., Hughes, J. d’A., Thottappilly, G., Vuylsteke, D., 

Lockhart, B.E.L. 2000. Relationship between natural occurrence of banana 

streak badnavirus and symptom expression, relative concentration of viral 

antigen, and yield characteristics of some micropropagated Musa spp. Plant 

Pathol. 49, 68–79.  

Dallot, S., Acuña, P., Rivera, C., Ramírez, P., Côte, F., Lockhart, B.E.L., Caruana, M‐L. 

2001. Evidence that the proliferation stage of micropropagation procedure 

is determinant in the expression of Banana streak virus integrated into the 

genome of the FHIA 21 hybrid (Musa AAAB). Arch. Virol. 146, 2179–2190. 

Daniells,  J.W., Geering, A.D.W., Bryde, N.J., and Thomas,  J.E. 2001. The effect of 

Banana streak virus on the growth and yield of dessert bananas in tropical 

Australia. Ann. Appl. Biol. 139, 51–60. 

FAO.  2011.  The World  Banana  Forum  (WBF): Working  together  for  sustainable 

banana  production  and  trade.  Introductory  note.  Accessed  23/2/2011 

www.fao.org/economic/worldbananaforum. 

Gayral,  P.,  Blondin,  L.,  Guidolin,  O.,  Carreel,  F.,  Hippolyte,  I.,  Perrier,  X.,  Iskra‐

Caruana, M‐L 2010. Evolution of endogenous sequences of Banana streak 

virus: What  can we  learn  from banana  (Musa  sp.) evolution?  J. Virol. 84, 

7346–7359. 

Gayral,  P.,  Iskra‐Caruana,  M‐L.  2009.  Phylogeny  of  Banana  streak  virus  reveals 

recent and repetitive endogenization in the genome of its banana host (Musa 

sp.). J. Mol. Evol. 69, 65–80. 

139  

Gayral,  P.,  Noa‐Carrazana,  J‐C.,  Lescot,  M.,  Lheureux,  F.,  Lockhart,  B.E.L., 

Matsumoto,  T.,  Piffanelli,  P.,  Iskra‐Caruana, M‐L.  2008.  A  single  Banana 

streak  virus  integration  event  in  the  banana  genome  as  the  origin  of 

infectious endogenous pararetrovirus. J.Virol. 82, 6697–6710. 

Geering,  A.D.W.  2009.  The  distribution  of  badnavirus‐infected Musa  germplasm 

from  the  international  transit  centre,  Katholieke  Universiteit  Leuven, 

Belgium.  In  International  Symposium on Recent Advances  in Banana Crop 

Protection  for  Sustainable Production and  Improved  Livelihoods, pp85–88. 

Eds D. Jones and I. Van den Bergh: ISHS. 

Geering  A.D.W.  2010.  Five  new  species  and  four  nomenclature  changes  in  the 

genus  Badnavirus.  [online]  ICTV  Taxonomy  Proposals  –  Plant.  URL 

http://talk. 

ictvonline.org/files/proposals/taxonomy_proposals_plant1/m/plant01/221

6.asp [accessed 14 December 2010]. 

Geering, A.W.D., McMichael, L.A., Dietzgen, R.G., and Thomas,  J.E. 2000. Genetic 

diversity among Banana streak virus isolates from Australia. Phytopathology 

90, 921–927.  

Geering,  A.D.W.,  Olszewski,  N.E.,  Dahal,  G.,  Thomas,  J.E.,  Lockhart,  B.E.L.  2001. 

Analysis of the distribution and structure of integrated Banana streak virus 

DNA in a range of Musa cultivars. Mol. Plant Pathol. 2, 207–213. 

Geering, A.D.W., Olszewski, N.E., Harper, G., Lockhart, B.E.L., Hull, R., Thomas, J.E. 

2005a.  Banana  contains  a  diverse  array  of  endogenous  badnaviruses.  J. 

Gen. Virol. 86, 511–520. 

Geering, A.D.W.,  Parry,  J.N.,  Thomas,  J.E.  2011. Complete  genome  sequence of  a 

novel badnavirus, banana streak IM virus. Arch. Virol. 156, 733–737. 

Geering, A. D. W.,  Pooggin, M.M., Olszewski, N.E.,  Lockhart,  B.E.L.,  Thomas,  J.E. 

2005b. Characterisation of banana  streak Mysore virus and evidence  that 

140  

its DNA is  integrated  in the B genome of cultivated Musa. Arch. Virol. 150, 

787–796. 

Harper, G., Ganesh, D., Thottappilly, G., Hull, R. 1999. Detection of episomal Banana 

streak virus by IC‐PCR. J. Virol. Methods 79, 1–8. 

Harper, G., Hart, D., Moult, S., Hull, R. 2002. Detection of Banana streak virus in field 

samples of banana from Uganda. Ann. Appl. Biol. 141, 247–257. 

Harper, G., Hart, D., Moult, S., Hull, R. 2004. Banana streak virus  is very diverse  in 

Uganda. Virus Res. 100, 51–56. 

Harper, G., Hart, D., Moult, S., Hull, R., Geering, A., Thomas, J. 2005. The diversity 

of Banana streak virus isolates in Uganda. Arch. Virol. 150, 2407–2420. 

Iskra‐Caruana, M.L., Gayral, P., Galzi, S., Laboureau, N. 2009. How  to control and 

prevent the spread of banana streak disease when the origin could be viral 

sequences  integrated  in  the banana genome?  In  International Symposium 

on Recent Advances  in Banana Crop Protection  for Sustainable Production 

and  Improved  Livelihoods, pp. 77–84. Eds D.  Jones and  I. Van den Bergh: 

ISHS. 

Iskra‐Caruana, M‐L., Baurens, F‐C., Gayral, P., Chabannes, M. 2010. A four‐partner 

plant‐virus  interaction:  Enemies  can  also  come  from  within.  MPMI  23, 

1394–1402. 

James, A.P., Geijskes, R.J., Dale, J.L., Harding, R.M. 2011a. Development of a novel 

rolling‐circle  amplification  technique  to  detect Banana  streak  virus which 

also discriminates between integrated and episomal virus sequences. Plant 

Dis. 95, 57–62. 

James,  A.P.,  Geijskes,  R.J.,  Dale,  J.L.,  Harding,  R.M.  2011b.  Molecular 

characterisation  of  six  badnavirus  species  associated  with  leaf  streak 

disease of banana in East Africa. Ann. Appl. Biol. 158, 346–353. 

141  

Karanja,  L., Wangai,  A., Harper, G.,  Pathak,  R.S.  2008. Molecular  identification  of 

Banana streak virus isolates in Kenya. J. Phytopathol. 156, 678–686. 

Le  Provost,  G.,  Iskra‐Caruana,  M‐L.,  Acina,  I.,  Teycheney,  P‐Y.  2006.  Improved 

detection of episomal Banana  streak viruses by multiplex  immunocapture 

PCR. J. Virol. Methods 137, 7–13. 

Lockhart, B.E.L., Jones, D.R. 2000. Banana streak. In Diseases of banana, abaca and 

enset, pp. 263–274. Ed D.R. Jones. CABI: United Kingdom. 

Ndowora, T., Dahal, G., LaFleur, D., Harper, H., Hull, R., Olszewski, N.E., Lockhart, B. 

1999.  Evidence  that  badnavirus  infection  in  Musa  can  originate  from 

integrated pararetroviral sequences. Virology 255, 214–220.  

142  

Supplementary data ‐ Table 7Plant samples and analysis for BSV using PCR and RCA. Sample  District  Cultivar Genome 

typeaSymptoms BSV PCR assaysb RCAc,d Sequence 

ID

    MY OL GF CA IM  UA UI UL UM

Uganda, April 2008 Ug1  Rakai  Kibuzi  AAA (EAHB) Streak ‐ ‐ ‐ ‐ ‐  ‐ ‐ + ‐ UL ULUg2  Rakai  Kibuzi  AAA (EAHB) Streak ‐ ‐ ‐ ‐ ‐  ‐ ‐ + ‐ UL ULUg5  Rakai  Mbwazirume AAA (EAHB) Streak ‐ ‐ ‐ ‐ ‐  ‐ + + ‐ ULUg7  Rakai  Nakinyika AAA (EAHB) Streak ‐ ‐ ‐ ‐ ‐  ‐ + ‐ ?Ug8  Rakai  Kisansa AAA (EAHB) Streak ‐ ‐ ‐ ‐ ‐  ‐ + ‐ ‐ UI UIUg9  Rakai  Kisansa AAA (EAHB) Asymptomatic ‐ + ‐ ‐ ‐  ‐ ‐ ‐ ‐ ‐Ug10  Rakai  Kisansa AAA (EAHB) Streak ‐ + ‐ ‐ ‐  ‐ ‐ + ‐ UL ULUg11  Rakai  Nakitembe AAA (EAHB) Streak ‐ ‐ ‐ ‐ ‐  ‐ + ‐ ‐ UI UIUg12  Masaka  Mbwazirume AAA (EAHB) Streak ‐ ‐ ‐ ‐ ‐  ‐ + ‐ + UM UMUg13  Masaka  Mbwazirume AAA (EAHB) Streak ‐ ‐ ‐ ‐ ‐  ‐ ‐ ‐ + UM UMUg14  Masaka  Sukali Ndizi AAB Streak + + ‐ ‐ ‐  ‐ ‐ ‐ ‐ OL OLUg15  Masaka  Nakinyika AAA (EAHB) Streak ‐ + ‐ ‐ ‐  ‐ + ‐ ‐ FLUg16  Masaka  Gonja  AAB Streak + + + ‐ ‐  ‐ ‐ ‐ ‐ GF GFUg17  Masaka  Kibuzi  AAA (EAHB) Streak ‐ + ‐ ‐ ‐  ‐ ‐ ‐ + OL/UMUg18  Masaka  Uncertain 

Plantain AAB Streak + + + ‐ ‐  ‐ ‐ ‐ ‐ GF

Ug19  Ntungamo  Enyeru AAA (EAHB) Streak ‐ ‐ ‐ ‐ ‐  ‐ ‐ ‐ + UMUg20  Ntungamo  Mbwazirume AAA (EAHB) Streak ‐ ‐ ‐ ‐   ‐ ‐ ‐ + UMUg21  Ntungamo  Mbwazirume AAA (EAHB) Streak ‐ ‐ ‐ ‐ ‐  ‐ ‐ ‐ + UMUg22  Ntungamo  Kibuzi  AAA (EAHB) Streak ‐ ‐ ‐ ‐ ‐  ‐ ‐ ‐ + UMUg23  Ntungamo  Enzirabushera AAA (EAHB) Mild flecks ‐ ‐ ‐ ‐ ‐  ‐ ‐ ‐ ‐ ‐Ug24  Kyangara  Entaragaze AAA (EAHB) Streak ‐ + ‐ ‐ ‐  ‐ ‐ ‐ + UMUg25  Kyangara  Enyeru  AAA (EAHB)  Streak  ‐  ‐  ‐  ‐  ‐  ‐  ‐  ‐  +  UM   Ug26  Kyangara  Enyeru AAA (EAHB) Streak ‐ ‐ ‐ ‐ ‐  ‐ ‐ ‐ + UMUg27  Kyangara  Embire AAA (EAHB) Streak ‐ ‐ ‐ ‐ ‐  ‐ ‐ ‐ + UMUg28  Kyangara  Sukali Ndizi AAB Mild mosaic + + ‐ ‐ ‐  ‐ ‐ ‐ ‐ UMUg29  Kamunyiga  Enyeru AAA (EAHB) Streak ‐ ‐ ‐ ‐ +  ‐ ‐ ‐ + UMUg30  Kamunyiga  Kibuzi  AAA (EAHB)  Streak  ‐  +  ‐  ‐  ‐  ‐  ‐  ‐  ‐  ?   Ug31  Kamunyiga  Enyeru AAA (EAHB) Streak ‐ ‐ ‐ ‐ ‐  ‐ ‐ ‐ + UMUg32  Kamunyiga  Sukali Ndizi  AAB  Streak  +  +  ‐  ‐  +  ‐  ‐  ‐  ‐  +   Ug33  Ibanda  Enjuma AAA (EAHB) Streak ‐ ‐ ‐ ‐ ‐  ‐ ‐ ‐ ‐ FLUg34  Ibanda  Enkonga AAA (EAHB) Streak ‐ ‐ ‐ ‐ ‐  ‐ ‐ ‐ ‐ FLUg35  Ibanda  Sukali Ndizi AAB Streak + + ‐ ‐ ‐  ‐ ‐ ‐ ‐ ‐Ug36  Ibanda  Enjuma AAA (EAHB) Streak ‐ ‐ ‐ ‐ ‐  ‐ ‐ ‐ ‐ ‐Ug37  Ibanda  Embururu  AAA (EAHB)  Streak  ‐  ‐  ‐  ‐  ‐  ‐  ‐  ‐  ‐  ?   Ug38  Ibanda  Enjuma AAA (EAHB) Streak ‐ ‐ ‐ ‐ ‐  ‐ ‐ ‐ ‐ FLUg39  Ibanda  Gros Michel  AAA  Streak  ‐  ‐  ‐  ‐  ‐  ‐  ‐  ‐  ‐  ?   Ug40  Ibanda  Kibuzi  AAA (EAHB) Streak ‐ ‐ ‐ ‐ ‐  ‐ ‐ ‐ ‐ ?Ug41  Ibanda  Enjuma AAA (EAHB) Streak ‐ ‐ ‐ ‐ ‐  ‐ ‐ ‐ + UMUg42  Ibanda  Cavendish  AAA  Streak  ‐  ‐  ‐  ‐  +  ‐  +  ‐  ‐  ?   

143  

Ug43  Ibanda  FHIA‐17 AAAA Mild flecks ‐ ‐ ‐ ‐ ‐  ‐ ‐ ‐ ‐ ?Ug44  Bushenyi  Enyeru AAA (EAHB) Abnormal 

bunch‐ ‐ ‐ ‐ ‐  ‐ ‐ ‐ ‐ +

Ug45  Bushenyi  Entaziduka AAA (EAHB) Asymptomatic ‐ ‐ ‐ ‐ ‐  ‐ ‐ ‐ ‐ ‐Ug46  Bushenyi  Enyambururu AAA (EAHB) Streak ‐ + + ‐ ‐  ‐ ‐ ‐ ‐ FL GFUg47  Bushenyi  Endyabwali AAA (EAHB) Streak ‐ + + ‐ ‐  ‐ ‐ ‐ ‐ OL/FL GFUg48  Bushenyi  Kisubi  AB Asymptomatic + + + ‐ ‐  ‐ ‐ ‐ ‐ ‐Ug49  Bushenyi  Enyeru AAA (EAHB) Streak ‐ + + ‐ ‐  ‐ ‐ ‐ ‐ OL/FL GFUg50  Bushenyi  Enkara AAA (EAHB) Streak ‐ + ‐ ‐ ‐  ‐ ‐ ‐ ‐ +Ug51  Bushenyi  Sukali Ndizi AAB Streak + + ‐ ‐ +  ‐ ‐ ‐ ‐ ‐Ug52  Bushenyi  Enjagata AAA (EAHB) Streak ‐ + + ‐ ‐  ‐ ‐ ‐ ‐ + GFUg53  Rwimi  Nakyetengu AAA (EAHB) Streak ‐ + ‐ ‐ ‐  ‐ ‐ ‐ ‐ FLUg54  Rwimi  Nakyetengu AAA (EAHB) Streak ‐ + ‐ ‐ ‐  ‐ ‐ ‐ ‐ FLUg55  Rwimi  Mutule AAA (EAHB) Streak ‐ ‐ ‐ ‐ ‐  ‐ ‐ ‐ + UMUg57  Bulera  Kibuzi  AAA (EAHB) Streak ‐ + ‐ ‐ ‐  ‐ ‐ ‐ ‐ FLUg58  Bulera  Mbwazirume AAA (EAHB) Streak ‐ + ‐ ‐ ‐  ‐ ‐ ‐ ‐ FLUg59  Bulera  Mbwazirume AAA (EAHB) Streak ‐ + ‐ ‐ ‐  ‐ ‐ ‐ ‐ FLUg60  Bulera  Sukali Ndizi AAB Streak + + ‐ ‐ ‐  ‐ ‐ ‐ ‐ FLTanzania, October 2008     Tz105  Kyela  Cavendish AAA Streak ‐ + ‐ ‐ ‐  ‐ ‐ ‐ ‐ OLTz106  Kyela  Cavendish AAA Streak ‐ + ‐ ‐ ‐  ‐ ‐ ‐ ‐ +Tz107  Kyela  Cavendish AAA Leaf chlorosis ‐ ‐ ‐ ‐ ‐  ‐ ‐ ‐ ‐ ‐Tz108  Kyela  Cavendish AAA Streak ‐ + ‐ ‐ ‐  ‐ ‐ ‐ ‐ +Tz111  Kyela  Mzuzu  AAB Streak + + + ‐ ‐  ‐ ‐ ‐ ‐ ‐Tz112  Kyela  Cavendish AAA Streak ‐ + ‐ ‐ ‐  ‐ ‐ ‐ ‐ failedTz113  Kyela  Cavendish  AAA  Asymptomatic  ‐  ‐  ‐  ‐  ‐  ‐  ‐  ‐  ‐  failed   Tz114  Kyela  Zambia AAB Leaf chlorosis + + ‐ ‐ ‐  ‐ ‐ ‐ ‐ failedTz117  Kyela  Sukali Ndizi AAB Leaf chlorosis + + ‐ ‐ ‐  ‐ ‐ ‐ ‐ ‐Tz118  Kyela  Cavendish AAA Streak ‐ + ‐ ‐ ‐  ‐ ‐ ‐ ‐ FLTz119  Rungwe  Cavendish AAA Asymptomatic ‐ ‐ ‐ ‐ ‐  ‐ ‐ ‐ ‐ OLTz120  Rungwe  Cavendish  AAA  Asymptomatic  ‐  ‐  ‐  ‐  ‐  ‐  ‐  ‐  ‐  ‐   Tz121  Rungwe  Grand Naine AAA Asymptomatic ‐ ‐ ‐ ‐ ‐  ‐ ‐ ‐ ‐ ‐Tz122  Rungwe  Grand Naine  AAA  Asymptomatic  ‐  ‐  ‐  ‐  ‐  ‐  ‐  ‐  ‐  ‐   Tz123  Rungwe  Chinese 

Cavendish AAA Asymptomatic ‐ ‐ ‐ ‐ ‐  ‐ ‐ ‐ ‐ failed

Tz124  Rungwe  Chinese Cavendish

AAA  Asymptomatic  ‐  ‐  ‐  ‐  ‐  ‐  ‐  ‐  ‐  ‐   

Tz125  Rungwe  Sukali Ndizi  AAB  Streak  +  +  ‐  ‐  ‐  ‐  ‐  ‐  ‐  OL   Tz126  Rungwe  FHIA‐23 AAAA Asymptomatic ‐ ‐ ‐ ‐ ‐  ‐ ‐ ‐ ‐ ‐Tz127  Rungwe  FHIA‐17  AAAA  Asymptomatic  ‐  ‐  ‐  ‐  ‐  ‐  ‐  ‐  ‐  ‐   Tz128  Rungwe  Yangambi Km5 AAA Asymptomatic ‐ ‐ ‐ ‐ ‐  ‐ ‐ ‐ ‐ ?Tz129  Rungwe  Cavendish AAA Streak ‐ ‐ ‐ ‐ ‐  ‐ ‐ ‐ ‐ ‐Tz130  Rungwe  Cavendish  AAA  Streak  ‐  ‐  ‐  ‐  ‐  ‐  ‐  ‐  ‐  ‐   Tz131  Rungwe  Sukali Ndizi AAB Leaf chlorosis + + ‐ ‐ ‐  ‐ ‐ ‐ ‐ ‐Tz134  Rungwe  Mitalula  AAB  Mild 

mosaic/mottle+  +  +  ‐  +  ‐  ‐  ‐  ‐  ‐   

Tz136  Rungwe  Uganda  AAA (EAHB)  Streak or  ‐  ‐  ‐  ‐  ‐  ‐  ‐  ‐  ‐  ‐   

144  

SigatokaTz137  Rungwe  Mzuzu AAB Chlorotic flecks + + + ‐ ‐  ‐ ‐ ‐ ‐ ‐Kenya, April 2009 Ke146  Nyamira  Sukali Ndizi AAB Streak + + + ‐ ‐  ‐ ‐ ‐ ‐ FL GFKe147  Nyamira  Uganda Green AAA (EAHB) Veinal chlorosis ‐ ‐ ‐ ‐ ‐  ‐ ‐ ‐ ‐ ‐Ke148  Kisii  Sukali Ndizi AAB Streak + + + ‐ ‐  ‐ ‐ ‐ ‐ FL GFKe149  Kisii  Mysore AAB Streak + ‐ ‐ ‐ ‐  ‐ ‐ ‐ ‐ MY MYKe150  Kisii  Mysore AAB Streak + ‐ ‐ ‐ ‐  ‐ ‐ ‐ ‐ MY MYKe151  Kisii  Muraru AA Die‐back ‐ ‐ ‐ ‐ ‐  ‐ ‐ ‐ ‐ ‐Ke152  Kisii  Kaburut AAA (EAHB) Mild mosaic ‐ ‐ ‐ ‐ ‐  ‐ ‐ ‐ ‐ ‐Ke153  Kisii  Jamaga AAA Streak ‐ ‐ ‐ ‐ ‐  ‐ ‐ ‐ ‐ ‐Ke154  Kisii  Lisulya AAA (EAHB) Streak ‐ + ‐ ‐ ‐  ‐ ‐ ‐ ‐ + OLKe155  Kisii  Uganda green AAA (EAHB) Streak ‐ ‐ ‐ ‐ ‐  + ‐ ‐ ‐ + UAKe156  Kisii  PAZ‐Giant AAA Streak ‐ + ‐ ‐ ‐  + ‐ ‐ ‐ + UAKe158  Kisii  Chinese 

Cavendish AAA Asymptomatic ‐ ‐ ‐ ‐ ‐  ‐ ‐ ‐ ‐ ‐

Ke159  Kisii  Sukali Ndizi AAB Streak ‐ + ‐ ‐ ‐  ‐ ‐ ‐ ‐ OLKe160  Kisii  Uganda green AAA (EAHB) Streak ‐ ‐ ‐ ‐ ‐  ‐ ‐ ‐ ‐ ‐Ke161  Kisii  Uganda green  AAA (EAHB)  Streak  ‐  ‐  ‐  ‐  ‐  ‐  ‐  ‐  ‐  ‐   Ke162  Kisii  Valary AAA Asymptomatic ‐ ‐ ‐ ‐ ‐  ‐ ‐ ‐ ‐ ‐Ke163  Kisii  Uganda green AAA (EAHB) Streak ‐ + ‐ ‐ ‐  ‐ ‐ ‐ ‐ OLKe164  Vihiga  Uganda green AAA (EAHB) Streak ‐ ‐ ‐ ‐ ‐  ‐ ‐ ‐ ‐ FLKe165  Vihiga  Cavendish AAA Chlorotic 

blotches‐ ‐ ‐ ‐ ‐  ‐ ‐ ‐ ‐ ‐

Ke166  Vihiga  Sukali Ndizi AAB Chlorotic blotches 

‐ ‐ ‐ ‐ ‐  ‐ ‐ ‐ ‐ ‐

Ke167  Ibonda  Sukali Ndizi AAB Streak + ‐ ‐ ‐ ‐  ‐ ‐ ‐ ‐ MY MYKe168  Kakamega  Uganda green AAA (EAHB) Streak ‐ ‐ ‐ ‐  ‐ ‐ ‐ ‐ ‐Ke169  Kakamega  Sukali Ndizi AAB Asymptomatic + + ‐ ‐ ‐  + ‐ ‐ ‐ ‐Ke170  Kakamega  Shisikame AAA (EAHB) Mosaic ‐ ‐ ‐ ‐ ‐  ‐ ‐ ‐ ‐ ‐Ke171  Kakamega  Uncertain EAHB  AAA (EAHB)   Streak  ‐  ‐  ‐  +  ‐  ‐  ‐  ‐  ‐  FL  CA Ke172  Kakamega  Esianamuni AAA (EAHB) Streak ‐ ‐ ‐ + ‐  ‐ ‐ ‐ ‐ FL CAKe173  Kakamega  Mysore  AAB  Streak  +  ‐  ‐  ‐  ‐  ‐  ‐  ‐  ‐  MY  MY Ke174  Kakamega  Yangambi Km5 AAA Streak ‐ ‐ ‐ ‐ ‐  ‐ ‐ ‐ ‐ ‐Ke175  Kakamega  Sianamule ABB Streak + ‐ ‐ ‐ ‐  ‐ ‐ ‐ ‐ MY MYKe176  Kakamega  Cavendish AAA Streak + + + ‐ ‐  ‐ ‐ ‐ ‐ MY MY&GFKe177  Kakamega  Uganda Red AAA (EAHB) Streak ‐ ‐ ‐ ‐ ‐  + ‐ ‐ ‐ FL UAKe178  Kakamega  Sukali Ndizi  AAB  Streak  +  +  ‐  ‐  ‐  ‐  ‐  ‐  ‐  OL  OL Ke179  Kakamega  Sukali Ndizi AAB Streak + + ‐ ‐ ‐  ‐ ‐ ‐ ‐ OLKe180  Mumias  Sukali Ndizi  AAB  Streak  +  +  +  ‐  ‐  ‐  ‐  ‐  ‐  FL  GF Ke181  Mumias  Sukali Ndizi AAB Streak + + + ‐ ‐  ‐ ‐ ‐ ‐ FL GFKe182  Mumias  Sukali Ndizi AAB Streak + ‐ ‐ ‐ ‐  ‐ ‐ ‐ ‐ MY MYKe183  Bungoma 

West Sukali Ndizi  AAB  Mild mottle  +  +  ‐  ‐  ‐  ‐  ‐  ‐  ‐  ‐   

Ke184  Bungoma West 

Sukali Ndizi  AAB  Streak  +  ‐  ‐  ‐  ‐  ‐  ‐  ‐  ‐  MY  MY 

Ke185  Bungoma  Uganda Green  AAA (EAHB)  Asymptomatic  ‐  ‐  ‐  ‐  ‐  ‐  ‐  ‐  ‐  ‐   

145  

West Ke186  Bungoma 

West Sukali Ndizi AAB Mild mottle + + ‐ ‐ ‐  ‐ ‐ ‐ ‐ ‐

Ke187  Bungoma  Uncertain EAHB AAA (EAHB) Mild mottle ‐ ‐ ‐ ‐ ‐  ‐ ‐ ‐ ‐ ‐Uganda February 2010  Ug233  Mbarara  Musa 

shizocarpa n/a Leaf chlorosis ‐ ‐ ‐ ‐ ‐  ‐ ‐ ‐ ‐ ‐

Ug234  Mbarara  Musa textilis n/a Asymptomatic ‐ ‐ ‐ ‐ ‐  ‐ ‐ ‐ ‐ ‐Ug235  Mbarara  Suu  AAA Leaf 

malformation‐ ‐ ‐ ‐ ‐  ‐ ‐ ‐ ‐ ‐

Ug236  Mbarara  To'o  AA Mosaic or streak

‐ ‐ ‐ ‐ ‐  ‐ ‐ ‐ ‐ ‐

Ug237  Mbarara  Monyet (M. acum. zebrina) 

AA Mild chlorotic flecking 

‐ + ‐ ‐ ‐  ‐ ‐ ‐ ‐ OL

Ug238  Mbarara  Dwarf Cavendish 

AAA Streak ‐ + ‐ ‐ ‐  ‐ ‐ ‐ ‐ OL

Ug239  Mbarara  TMPx 548‐4 unsuree Streak + + + ‐ ‐  ‐ ‐ ‐ ‐ OL&FL GFUg240  Mbarara  Red Gonja AAB Streak + + + ‐ ‐  ‐ ‐ ‐ ‐ OL&FL GFUg241  Mbarara  Namwa Khom  ABB  Mild flecks  ‐  +  +  ‐  +  ‐  ‐  ‐  ‐  ‐   Ug242  Mbarara  FHIA2  AAAB Streak + + + ‐ ‐  ‐ ‐ ‐ ‐ OL&FL GFUg243  Mbarara  TMPx 7002 AAAB Mild flecks + + + ‐ ‐  ‐ ‐ ‐ ‐ OLUg244  Mbarara  TMPx 548‐9 AAAB Streak + + + ‐ +  ‐ ‐ ‐ ‐ FL GFUg245  Mbarara  TMBx 5295‐1 AAB Streak + + + ‐ ‐  ‐ ‐ ‐ ‐ OLUg246  Mbarara  Gros Michel AAA Streak   ‐ ‐ + ‐ ‐  ‐ ‐ ‐ ‐ FL GFUg247  Mbarara  TMPx 5511‐2 AAAB Streak   + + + ‐ ‐  ‐ ‐ ‐ ‐ OL&FL GFUg248  Mbarara  SH 2796‐5  unsuree  Streak    +  +  +  ‐  ‐  ‐  ‐  ‐  ‐  OL&FL  GF Ug249  Mbarara  Mysore AAB Streak   + ‐ ‐ ‐ ‐  ‐ ‐ ‐ ‐ FL MYUg250  Mbarara  Muracho AAB Mild flecks + ‐ + ‐ +  ‐ ‐ ‐ ‐ FL IM&GFUg251  Mbarara  Obino l'Ewai AAB Asymptomatic + + + ‐ ‐  ‐ ‐ ‐ ‐ ‐Ug252  Mbarara  Kirun  AA Leaf 

malformation/ mild flecks

‐ ‐ ‐ ‐ ‐  ‐ ‐ ‐ ‐ ‐

a EAHB indicates East African Highland Banana Musa subgroup. b Grey shaded boxes indicate likely results due to detection of eBSV. c Where a distinct digest pattern was observed which  is associated with a particular BSV species this  is recorded using the abbreviations  in footnote 4. Additionally, full‐length digest results are denoted by ‘FL’ and a number of samples were considered positive (‘+’) where neither a full‐length digest fragment was present, and the observed profile was not associated with any predicted profile. Negative results (i.e an absence of bands  in digests) are denoted by  ‘‐’. For samples recorded with  ‘?’ either faint bands were observed in digests, or too many fragments were observed for a clear result to be determined.  d Badnavirus names are abbreviated as follows: Banana streak UL virus = UL, Banana streak UI virus = UI, Banana streak UM virus = UM, Banana streak OL virus = OL, Banana streak GF virus = GF, Banana streak MY virus = MY, Banana streak UA virus = UA, Banana streak CA virus = CA and Banana streak IM virus = IM. e Both Ug239 and Ug248 are hybrid banana cultivars with one parent containing a B‐genome component; as such, these samples are considered to contain a B‐genome. 

146  

   

147  

CHAPTER 6 

 

MOLECULAR CHARACTERISATION OF BANANA BUNCHY TOP VIRUS  

ISOLATES FROM MALAWI AND RWANDA 

 

 

A.P. James1, R.J. Geijskes1, M. Soko2, J.A. Mugini3, J.L. Dale1 & R.M. Harding1 

 

 

 

1Centre for Tropical Crops and Biocommodities, Queensland University of 

Technology, P.O. Box 2434, Brisbane, Queensland, Australia. 4001 

2Bvumbe Agricultural Research Station, P.O. Box 5748, Limbe, Malawi. 

3Mikocheni Agricultural Research Institute, P.O. Box 6226, Dar Es Salaam, Tanzania. 

 

 

 

 

 

 

 

[Formatted for submission to Annals of Applied Biology] 

   

148  

STATEMENT OF AUTHORSHIP 

 

Anthony  James  (principal author): Contributed  to project concepts, executed  the 

work  (collected  samples,  designed  and  conducted  laboratory  experiments, 

analysed and interpreted results) and prepared initial manuscript. 

Signed………………………………………………………………..Date…………………………………………… 

Jason Geijskes: Supervised execution of  the work,  critically  interpreted data and 

contributed to final manuscript. 

Signed………………………………………………………………..Date…………………………………………… 

Mishek  Soko:  Collected  samples,  supervised  execution  of  the  work,  critically 

interpreted data and contributed to final manuscript. 

Signed………………………………………………………………..Date…………………………………………… 

Julius  Mugini:  Collected  samples,  supervised  execution  of  the  work,  critically 

interpreted data and contributed to final manuscript. 

Signed………………………………………………………………..Date…………………………………………… 

James Dale: Conceived project idea, collected samples, supervised execution of the 

work, critically interpreted data and contributed to final manuscript. 

Signed………………………………………………………………..Date…………………………………………… 

Rob Harding: Conceived project  idea, supervised execution of  the work, critically 

interpreted data and contributed to final manuscript. 

Signed………………………………………………………………..Date……………………………………………

149  

Abstract 

Field samples of banana bunchy top disease were collected from bananas growing 

in Malawi and Rwanda. The presence of BBTV was confirmed using PCR with virus‐

specific  primers  and  by  rolling‐circle  amplification.  The  six  virus‐specific  DNA 

components  from one  isolate  from Malawi  and  two  isolates  from Rwanda were 

completely sequenced. The BBTV  isolates  from Malawi and Rwanda had a similar 

genome organisation to previously published BBTV sequences including conserved 

features such as the major common region (CR‐M), stem‐loop common region (CR‐

SL)  and  iterons.  The  two  isolates  from  Rwanda  had  at  least  98.1%  nucleotide 

sequence  identity between each of  the six DNA components, while  the similarity 

between  isolates  from  Rwanda  and  Malawi  was  between  96.2%  and  99.4% 

depending  on  the  DNA  component.  At  the  amino  acid  level,  similarities  in  the 

putative  proteins  encoded  by  DNA‐R,  ‐S,  ‐M,  ‐  C  and  –N  were  found  to  range 

between  98.8%  and  100%.  Phylogenetic  analysis  using DNA‐R  and  ‐S  supported 

placement  of  these  sequences  in  the  South  Pacific  subgroup  of  BBTV  isolates. 

Sequence comparisons using full‐length DNA‐R sequences identified Indian isolates 

as the most similar to East African BBTV isolates. 

 

 

   

150  

Introduction 

Bunchy top is the most important virus disease of bananas worldwide. The disease 

occurs in most banana‐growing areas of the Asia‐Pacific region as well as a number 

of countries in Africa (Thomas and Iskra‐Caruana, 2000), but has not been reported 

in  the  Latin  American‐Carribean  region  where  there  is  a  large  export‐oriented 

banana industry. The first report of bunchy top in Africa was in Egypt (Fahmy, 1924 

in Magee 1927) with  subsequent  reports  from Burundi, Central African Republic, 

Republic of Congo, Democratic Republic of Congo, Gabon, Malawi and Rwanda (see 

Thomas and Iskra‐Caruana, 2000). More recently, bunchy top has been reported in 

Angola,  Cameroon,  Equatorial  Guinea, Mozambique  and  Zambia  (Kumar  et  al., 

2009; Kumar and Hanna, 2008; Oben et al., 2009). 

  Characteristic symptoms of bunchy top include a rosetting effect caused by 

narrowing of the leaf lamina and shortening of the petioles giving a distinct upright 

appearance of the plant apex. Leaves develop a chlorotic, wavy margin while dark 

green  discontinuous  streaks  (known  as  the  morse‐code  pattern)  occur  on  the 

petioles,  midribs  and  leaf  veins  (Magee,  1927).  The  disease  often  leads  to  a 

complete loss in production since infected plants generally produce no fruit due to 

the severe stunting and choking of the pseudostem.  

Bunchy  top  is  caused  by  Banana  bunchy  top  virus  (Harding  et  al.,  1991; 

Thomas  and  Dietzgen,  1991),  the  type member  of  the  genus  Babuvirus  in  the 

family Nanoviridae. The virus is characterised by isometric virions of 18‐20 nm with 

a circular, single‐stranded  (ss) DNA genome consisting of at  least six components 

(Burns  et  al.,  1995)  named DNA‐R,  ‐U3,  ‐S,  ‐M,  ‐C  and  ‐N  (Vetten  et  al.,  2005). 

Plant‐to‐plant  transmission occurs via  the banana aphid, Pentalonia nigronervosa 

(Magee,  1927)  in  a  persistent,  non‐propagative  manner,  while  long  distance 

movement  of  the  virus  occurs  by  vegetative  transmission  through  rhizomes, 

suckers and  tissue‐cultured plants  (Thomas et al., 1994).  In Australia, bunchy  top 

has  been  effectively  controlled  through  a  variety  of  phytosanitary  measures 

including  regular  inspections  of  plantations  for  disease  and  removal  of  infected 

plants  which  act  as  virus  reservoirs.  These  measures,  combined  with  strict 

151  

quarantine  control over plant movement  and  regulations on  the use of disease‐

free planting material, have been used successfully  to manage disease outbreaks 

(Magee, 1967). Despite proving an effective strategy in Australia, the control of the 

disease  in other  less developed countries has been  less effective primarily due to 

their unregulated banana industries and lack of education amongst growers. 

Two groups of BBTV  isolates,  termed  the  South Pacific and Asian groups, 

have  been  distinguished  based  on  sequence  analyses  of DNA‐R,  ‐S  and  –N.  The 

South  Pacific  subgroup  includes  isolates  from  Angola,  Australia,  Burundi, 

Cameroon,  Democratic  Republic  of  Congo,  Egypt,  Fiji,  Gabon,  Hawaii,  India, 

Malawi,  Pakistan,  Tonga  and  Samoa, while  the Asian  subgroup  includes  isolates 

from China,  Indonesia,  Japan,  the  Philippines,  Taiwan  and Vietnam  (Amin  et  al., 

2008; Furuya et al., 2004 & 2005; Karan et al., 1994 & 1997; Kumar et al., 2011; 

Wanitchakorn et al., 2000; Xie and Hu, 1995). Between  isolates of each subgroup, 

the sequences of the major gene of DNA‐R,  ‐N and  ‐S differ by 7.5, 8.6 and 6.3% 

which  translates  to mean  differences  of  5.6,  6.7  and  1.4%,  respectively,  at  the 

amino  acid  level.  Further,  there  is  considerably  greater  variability  between  the 

sequences within  the  Asian  group  than  those within  the  South  pacific  group  of 

isolates. In spite of this variability, diagnostic tests using polymerase chain reaction 

(PCR) can reliably detect both subgroups of BBTV isolates (Mansoor et al., 2005). 

Bunchy  top  is an  important quarantine disease within East Africa. Despite 

the presence of this disease in Burundi, D.R. Congo, Malawi, Mozambique, Rwanda 

and  Zambia,  it has not been detected  in Uganda, Kenya and Tanzania. We have 

been  developing  a  diagnostic  capacity  for  BBTV,  and  other  important  banana 

viruses,  in Uganda, Kenya and Tanzania  to enable ongoing surveillance and allow 

the local provision of virus‐indexed banana planting material. As part of this work, 

surveys for banana viruses have been conducted in several East African countries. 

In  this  paper,  we  report  the  molecular  characterisation  of  BBTV  isolates  from 

Malawi and Rwanda. This  report presents an  important  sequence  record  for  the 

region and will contribute to regional efforts towards the control of this important 

disease.  

152  

 

Materials and Methods 

Plant samples  

Leaf samples (Table 1) were collected from field grown banana plants in Malawi in 

October,  2008  and  Rwanda  in March,  2009.  Samples were  collected  at  random 

field sites in each country and while most samples were collected based upon the 

presence of characteristic symptoms, a number of samples without symptoms of 

bunchy  top  were  also  collected.  Fresh  leaf  tissue  was  dried  over  silica  gel  for 

preservation until analysis. 

 

Amplification and cloning of BBTV 

Total nucleic acids were extracted from dried  leaf tissue as described by James et 

al., (2011a). The presence of BBTV was confirmed in samples using primers BBTV‐

DNARf  (5’  TGGTATATCAAGTGGAGAGGGG  3’)  and  BBTV‐DNARr  (5’ 

CCAGCTATTCATCGCCTTCG  3’)  designed  to  amplify  a  373  bp  region  of  the  BBTV 

DNA‐R major ORF. As a control  for quality of DNA extracts, a PCR  for the banana 

actin gene was performed using gene  specific primers  (James et al., 2011a). PCR 

mixes  (20  µl)  contained  10  µl  2x  GoTaq  Green  Master  Mix  (Promega  Corp, 

Madison, WI), 5 ρmol of each primer, 1 µl of nucleic acid extract and water to final 

volume.  PCR  cycling  conditions  were  an  initial  denaturation  of  94°C  for  2 min 

followed by 35 cycles of 94°C for 20 s, 57°C for 20 s, and 72°C for 30 s, with a final 

extension  at  72°C  for  2 min.  Reactions  products were  electrophoresed  through 

1.5% agarose gels, stained using 0.25x SYBR® Safe DNA Gel Stain (Invitrogen Corp, 

Carlsbad,  CA)  and  DNA  fragments  visualised  on  a  Safe  imager  blue‐light 

transilluminator (Invitrogen Corp, Carlsbad, CA). 

Following the initial PCR screening, the complete sequences of each of the 

six  integral DNA components of  two BBTV  isolates  from Rwanda and one  isolate 

from Malawi were  obtained.  Initially,  the  ORFs  of  the  DNA  components  of  the 

153  

Table 1 Leaf samples collected in Malawi and Rwanda, and results of PCR and RCA assays for detection of BBTV 

Sample number 

District  ‘Cultivar name’ Genome type 

Symptoms BBTV PCR 

RCA digest result 

Malawi, October 2008 

Ma64  Lilongwe  Cavendish  AAA bunchy top +  1kb 

Ma65  Lilongwe  Cavendish  AAA bunchy top +  1kb 

Ma66  Lilongwe  Cavendish  AAA bunchy top +  1kb 

Ma67  Lilongwe  Cavendish  AAA bunchy top +  1kb 

Ma68  Lilongwe  Cavendish  AAA bunchy top +  1kb 

Ma69  Lilongwe  Sukali AAB asymptomatic ‐  ‐

Ma71  Lilongwe  Cavendish  AAA bunchy top +  1kb 

Ma72  Nkhotakota  Cavendish  AAA bunchy top +  1kb 

Ma73  Nkhotakota  Nzeru AAA bunchy top +  1kb 

Ma74  Nkhotakota  Sukali AAB bunchy top +  1kb 

Ma75  Nkhotakota  Harare ABB bunchy top/mosaic +  1kb 

Ma76  Nkhotakota  Harare ABB bunchy top/mosaic +  1kb 

Ma77  Nkhotakota  Harare ABB bunchy top +  1kb 

Ma78  Nkhotakota  Harare ABB bunchy top +  1kb 

Ma79  Dwambadzi  Pisang Awak ABB asymptomatic ‐  1kb  

Ma80  Dwambadzi  Pisang Awak ABB bunchy top +  1kb 

Ma81  Dwambadzi  Pisang Awak ABB asymptomatic sucker from same stool as sample Ma82 

+  1kb 

Ma82  Dwambadzi  Pisang Awak ABB bunchy top/mosaic +  1kb 

Ma83  Dwambadzi  Zomba Red AAA bunchy top +  1kb 

Ma84  Dwambadzi  unknown Plantain AAB bunchy top +  1kb 

Ma85  Dwambadzi  FHIA‐21 AAAB bunchy top +  1kb 

Ma86  Dwambadzi  Cavendish AAA bunchy top +  1kb 

Ma87  Dwambadzi  TMBx 5295‐1 AABB bunchy top +  1kb 

Ma88  Dwambadzi  FHIA‐25 AAAA bunchy top +  1kb 

Ma89  Dwambadzi  SH‐3436 AAAA bunchy top +  1kb 

Ma90  Dwambadzi  FHIA‐23 AAAA bunchy top +  1kb 

Ma91  Dwambadzi  Yangambi Km5 AAA asymptomatic ‐  ‐

Ma92  Dwambadzi  FHIA‐17 AAAA bunchy top +  1kb 

Ma93  Dwambadzi  Bluggoe ABB bunchy top +  failed

Ma95  Nkhata bay  Pelipita ABB leaf mottling ‐  ‐

Ma96  Nkhata bay  Calcutta4 AA asymptomatic ‐  ‐

Ma97  Nkhata bay  M.balbisiana BB asymptomatic ‐  ‐

Ma98  Nkhata bay  FHIA‐2 AAAB bunchy top +  1kb 

Ma99  Nkhata bay  Calcutta4 AA mild mottle ‐  ‐

Ma100  Nkhata bay  Pisang Awak ABB bunchy top/mosaic +  1kb 

Ma101  Karonga  FHIA‐3 AABB leaf chlorosis ‐  ‐

Ma102  Karonga  FHIA‐3 AABB leaf chlorosis ‐  ‐

Ma103  Karonga  TMBx 5295‐1 AABB leaf chlorosis ‐  ‐

Ma104  Karonga  Cavendish  AAA leaf chlorosis ‐  ‐

   

154  

Table 1 continued 

Rwanda, March 2009 

Rw137  Rusizi (highlands)  Barabeshya  EAH‐AAA bunchy top +  1kb 

Rw138  Rusizi (rift valley)  Barabeshya  EAH‐AAA bunchy top  +  1kb 

Rw139  Rusizi (rift valley)  Barabeshya  EAH‐AAA heart leaf chlorosis/ necrosis  +  1kb 

Rw140  Rusizi (rift valley)  Barabeshya  EAH‐AAA bunchy top/heart leaf chlorosis  +  1kb 

Rw141  Rusizi (rift valley)  Yangambi Km5 AAA bunchy top  +  1kb 

Rw142  Rusizi (highlands)  Barabeshya  EAH‐AAA bunchy top  +  1kb 

Rw143  Rusizi (highlands)  Red Gros Michel AAA bunchy top  +  1kb 

Rw144  Rusizi (highlands)  Kisubi  AAB bunchy top  +  1kb 

Rw145  Rusizi (highlands)  Barabeshya  EAH‐AAA bunchy top  +  1kb 

155  

Malawi  isolate were amplified by PCR using primers designed on the sequence of 

an Australian  isolate of BBTV  (Harding et al., 1993; Burns et al., 1995). PCR was 

carried out using Pwo DNA polymerase (Roche Applied Science, Australia) in 25 µl 

reactions as follows: 1 x supplied PCR buffer, 0.5 U of polymerase, 0.2 mM dNTPs, 

5 ρmol of each primer, 1 µl of nucleic acid extract and water to final volume. PCR 

products were subsequently A‐tailed using Taq polymerase, gel purified and cloned 

into pGEM®‐T Easy (Promega Corp, Madison, WI). Three independent clones were 

sequenced in both the forward and reverse directions with universal M13 primers, 

using  the  BigDye®  Terminator  v3.1  Cycle  Sequencing  Kit  (Applied  Biosystems, 

Foster City, CA), followed by product separation on an Applied Biosystems 3130xl 

Genetic Analyser  (Griffith University DNA‐Sequencing  Facility, Griffith University, 

Nathan Campus, Qld, Australia).  

Using the sequences from cloned ORF fragments, sequence‐specific primers 

were designed within the ORF of each BBTV DNA to amplify the  intergenic region 

of each virus DNA, including a region of the ORF at each end which overlapped with 

the ORF PCR product. These primers were subsequently used in a PCR as described 

above  to  amplify  the  intergenic  region  of  each  of  the  six  BBTV  DNAs  from  the 

Malawi  isolate. The  sequences obtained  from both  the ORF PCRs  and  intergenic 

region PCRs were compared, primer sequences were removed from each sequence 

and  a  consensus  sequence  determined  for  each  DNA  component.  Full‐length 

sequences were assembled in Vector NTI Advance v.11 (Invitrogen Corp, Carlsbad, 

CA), which was subsequently used for the identification of putative ORFs and other 

conserved features of BBTV DNAs. 

Cloning  and  sequencing  of  the  two  Rwandan  isolates  was  essentially  as 

described  above  with  minor  variation.  The  ORF  and  intergenic  region  primers 

described  previously  were  used  to  amplify  BBTV  DNA  sequences  from  all 

components, except  for  three ORF  fragments which  failed  to amplify.  In order  to 

complete  the  sequence  in  these  cases,  sequence‐specific  ORF  primers  were 

designed  for  the  Rwandan  isolates  (based  on  the  intergenic  region  sequences 

generated with primers described previously  for  the Malawi  isolates),  and  these 

were used in a PCR with GoTaq green as described above.  

156  

 

Rolling‐circle amplification 

Rolling‐circle  amplification  (RCA) was  performed  using  the  protocol  described  in 

James et al. (2011a). RCA reactions were digested using 2 U of restriction enzyme 

StuI (Roche Applied Science, Australia), and the presence of a distinct 1 kb band in 

digests was considered indicative of the presence of BBTV. 

 

Phylogenetic analysis 

For phylogenetic analysis, sequences were aligned using the CLUSTAL W algorithm 

of MEGA4  (Tamura  et al., 2007). A phylogenetic  tree was  constructed using  the 

neighbour‐joining  method,  following  pair‐wise  sequence  comparison  using  the 

Kimura 2‐parameter model  in MEGA4  (Kimura, 1980).  For  comparison purposes, 

only selected isolates with full‐length DNA‐R sequences were included.  

 

Results 

Initial screening for BBTV 

Leaf  samples were  collected  from  39  banana  plants  growing  in  five  districts  in 

Malawi and from nine banana plants growing in one district in south‐west Rwanda 

(Table 1). Most samples were taken from plants showing characteristic symptoms 

of  bunchy  top,  although  leaves  from  symptomless  plants were  also  collected  in 

some cases. Nucleic acid extracts prepared  from  the  leaf samples were screened 

for BBTV using PCR and RCA.  

Using PCR, a product of the expected size of 400 bp was amplified from 28 

out of 39 samples from Malawi and all nine samples collected from Rwanda (Table 

1). These results were supported by the presence of a distinct 1 kb band in digests 

of  RCA  reactions  from  all  PCR  positive  samples  except  for  one Malawi  sample 

(Ma93) for which the RCA reaction failed. A faint 1 kb band was also observed in 

157  

the  digested  RCA  product  from  sample  Ma79,  which  was  taken  from  an 

asymptomatic  leaf  and which  tested negative  for BBTV using  PCR. Whether  this 

indicates  the  presence  of  BBTV  in  a  sample  with  no  symptoms,  a  very  early 

infection or represents another DNA target detected using RCA  is unknown.  In all 

other cases, the detection of BBTV in samples was consistent with the observation 

of typical bunchy top symptoms. 

 

Characterisation of Malawi and Rwanda BBTV isolates 

Two  BBTV  isolates  from  Rwanda  (Rw138  &  142)  and  one  isolate  from Malawi 

(Ma73) were chosen for further characterisation. The two Rwandan  isolates were 

selected  to  enable  comparisons  between  BBTV  isolates  occurring  at  different 

altitudes; sample Rw138 was taken from a plant growing in the Rift Valley (altitude 

970 m)  while  sample  Rw142  was  taken  from  a  plant  growing  in  the  highlands 

(altitude  1648‐1687m).  Using  a  PCR‐based  strategy,  the  six  integral  DNA 

components  of  all  three  BBTV  isolates  were  amplified,  and  these  were 

subsequently cloned and sequenced. A summary of the characteristics of each of 

the six DNAs from the three samples is presented in Table 2.  

  The  BBTV  isolates  from  Malawi  and  Rwanda  had  a  similar  genome 

organisation  to  previously  published  BBTV  sequences.  Each  DNA  component 

encoded  a  single  large  open  reading  frame  (ORF), while DNA‐R  also  encoded  a 

smaller ORF  internal to the major ORF. The size and relative position of the ORFs 

on  each  component  were  analogous  to  a  previously  published  isolate  from 

Australia with  the  exception of  the ORF  from DNA‐U3 which was  shorter  in  the 

three  isolates studied. The predicted major ORF of DNA‐U3  in  isolates Ma73 and 

Rw142 comprised 231 nt; while in sample Rw138 the predicted ORF length was 177 

nt due to a two bp  insertion  in the sequence of this  isolate creating a stop codon 

earlier in the coding sequence compared with the other isolates. Although shorter 

than  the predicted ORF  length  in  an Australian  isolate  (261 nt),  the  231 nt ORF 

length  in  samples  Ma73  and  Rw142  was  consistent  with  sequences  of  this 

component from India and Pakistan.  

158  

 

 

 

 

 

 

 

 

Table 2 Characteristics of DNA components of BBTV isolates from Malawi and Rwanda 

  Malawi 73  Rwanda 138 Rwanda 142  

BBTV DNA  Total length (nt) 

Length of major ORF 

Total length (nt) 

Length of major ORF 

Total length (nt) 

Length of major ORF 

DNA‐Ra  1111  858  1111  858  1110  858 DNA‐U3  1063  231  1062 177 1062 231 DNA‐S  1075  510  1075  510  1074  510 DNA‐M  1046  351  1047  351  1046  351 DNA‐C  1018  483  1018  483  1018  483 DNA‐N  1086  462  1089 462 1088 462 aDNA‐R also contains a conserved small ORF internal to the major ORF 

159  

Additional  conserved  features  of  BBTV  genomes,  including  the  major 

common  region  (CR‐M),  stem‐loop common  region  (CR‐SL) and  iteron  sequences 

were  also  identified  in  the  three  isolates  sequenced.  Analysis  of  the  six  DNA 

components  for each  isolate  revealed a 89 bp  common  region  located 3´ of  the 

major ORF on each component. Sequence conservation within this region for each 

isolate was  in  the  order  of  63%  (Ma73),  66%  (Rw138)  and  65%  (Ma142), while 

sequence  conservation  when  all  DNAs  of  the  three  isolates  were  considered 

together  was  63%.  When  the  three  DNA‐R  sequences  were  omitted  from  the 

analysis, CR‐M sequence conservation across the three isolates increased to 72%. A 

31 nucleotide CR‐SL was  identified which comprised a 11 nucleotide  loop section 

flanked  by  10  nucleotide  stem  sequences.  This  31  nucleotide  region  was  81% 

conserved  amongst  the  18  sequences  comprising  the  three  isolates.  The  F1F2 

iteron sequence (GGGACGGGAC) was conserved on 10 of the 18 DNAs while on the 

remaining eight DNAs a single G to A change was present   (AGGGACGGGAC). This 

single base change was limited to the three DNA‐C and DNA‐M sequences, as well 

as  the  two  DNA‐U3  sequences  from  isolates  Rw138  and  Rw142.  The  R1  iteron 

sequence (GGGAC) was completely conserved across all DNAs sequenced. 

Sequence comparisons between the three isolates were done using the full‐

length nucleotide sequences of each DNA   component, as well as  the amino acid 

sequences of the major ORF of each component (except DNA‐U3), and internal ORF 

of DNA‐R (Table 3). At the nucleotide level, the two isolates from Rwanda were the 

most similar, with at  least 99.4% similarity across all components except DNA‐U3 

(98.1%).  When  the  nucleotide  sequences  of  isolate  Rw138  were  compared  to 

isolate Ma73, the similarity varied from 96.2% (DNA‐U3) to 99.2% (DNA‐S,  ‐M &  ‐

C). When  isolate Rw142 was compared to Ma73, the similarity varied from 97.6% 

(DNA‐U3)  to 99.4%  (DNA‐C). At  the amino acid  level, very high  similarities  (98.8‐

100%) were seen across the putative proteins encoded by DNA‐R, ‐S, ‐M, ‐ C and ‐N 

of all three isolates (Table 3). When the amino acid sequences of the internal ORF 

of DNA‐R were compared,  the  sequences of  the  two  isolates  from Rwanda were 

identical, while the Malawi isolate had a single amino acid change.  

 

160  

 

 

 

 

 

Table 3 Sequence similarity between Malawi and Rwanda BBTV DNA components 

BBTV DNA  % nt similarity   % aa similaritya, b   Rwanda 138  Rwanda 142 Rwanda 138 Rwanda 142

DNA‐R (REP)  98.9  98.9  99.6  100  Malawi 73     99.4    99.6  Rwanda 138      DNA‐R (intORF)      97.6  97.6  Malawi 73         100  Rwanda 138            DNA‐U3  96.2  97.6 Malawi 73     98.1      Rwanda 138            DNA‐S  99.2  99.3  100  100  Malawi 73     99.5 100 Rwanda 138            DNA‐M  99.2  98.9  100  100  Malawi 73     99.5    100  Rwanda 138      DNA‐C  99.2  99.4  99.4  99.4  Malawi 73     99.6    98.8  Rwanda 138            DNA‐N  98.8  98.9 100 100 Malawi 73     99.7    100  Rwanda 138            ain putative protein sequence of translated ORF nucleotide sequence bdue to differing length of the putative ORFs for DNA‐U3 a comparison was not done

161  

When the nucleotide sequences of each of the six DNA components of the 

three  isolates were compared to published sequences, DNA‐R,  ‐U3,  ‐M,  ‐C and  ‐N 

showed highest similarities  to  Indian  isolates of BBTV with sequence  identities of 

99%, 97%, 99%, 99% and 98%, respectively. The nucleotide sequence of DNA‐S was 

equally similar (99%) to  isolates from Australia, Burundi, Cameroon, Fiji, India and 

Myanmar.  

 

Phylogenetic analysis 

Phylogenetic  analysis  based  on  the  complete  nucleotide  sequences  of  DNA‐R 

revealed that the three East African BBTV isolates grouped within the South Pacific 

cluster of BBTV isolates and were most closely related to the representative Indian 

BBTV  isolate  included  in  the analysis  (Fig. 1). When  the analysis was done using 

nucleotide sequences of DNA‐S, the three isolates again clustered within the South 

Pacific subgroup of BBTV  isolates, but were most closely  related  to an Australian 

isolate (result not shown).  

 

Discussion 

In  this  study,  samples of bananas were collected  from  several districts  in central 

and northern Malawi,  as well  as one district  in  south‐west Rwanda. Bunchy  top 

disease symptoms were observed at all but one of the  locations visited (Karonga, 

Malawi) and the presence of BBTV was confirmed using PCR and RCA. Further, full‐

length sequences of all six DNA components from two BBTV isolates from Rwanda 

and one isolate from Malawi were cloned, sequenced and analysed. To the best of 

our  knowledge,  this  is  the  first  report  of  full‐length  sequences  of  African  BBTV 

isolates. Phylogenetic analysis of  the  full‐length  sequence of BBTV DNA‐R and  ‐S 

confirmed previous  studies which  suggested  that BBTV  isolates  from Africa were 

more  similar  to  the  South  Pacific  subgroup  of  BBTV  isolates  than  to  the  Asian 

subgroup of isolates (Karan et al., 1994 & 1997; Kumar et al., 2011; Wanitchakorn 

et al., 2000).  

162  

 

  

 

Figure  1  Neighbour‐joining  phylogram  of  BBTV  DNA‐R  sequences  based  on 

CLUSTAL W alignment (Bootstrap consensus tree shown following 1000 replicates). 

GenBank  accession  numbers  for  BBTV  isolates  are  India  (GenBank  accession 

AF416470),  Australia  (GenBank  accession  NC_003479),  Myanmar  (GenBank 

accession  AB252639),  USA  (GenBank  accession  BBU18077),  Tonga  (GenBank 

accession  AF416467),  Fiji  (GenBank  accession  AF416466),  Pakistan  (GenBank 

accession  AM418536),  Egypt  (GenBank  accession  AF416465),  Vietnam  (GenBank 

accession AF416464),  China  (GenBank  accession AF246123),  Indonesia  (GenBank 

accession AB186924), Philippines (GenBank accession AF416469), Japan (GenBank 

accession AB108453),  Taiwan  (GenBank  accession AF416468), Abaca bunchy  top 

virus (GenBank accession EF546807).  

 

GC138 Rwanda

GC142 Rwanda

GC73 Malawi

India

Australia

Myanmar

USA (Hawaii)

Tonga

Fiji

Pakistan

Egypt

Vietnam

China

Indonesia

Philippines

Japan

Taiwan

Abaca bunchy top virus DNA-R 

87

64

100

100

99

99

61

0.01 

South 

Pacific 

subgroup 

Asian 

subgroup 

163  

Bunchy  top  symptoms were  first  observed  in Malawi  in  the  early  1990s 

(Mshani et al., 2008) although  the disease was not officially  reported until 1997 

(Kenyon et al., 1997). The early reports were from the central‐northern districts of 

Nkhata‐bay  and  Nkota‐kota,  but  bunchy  top  is  now  widespread  and  occurs  in 

banana growing regions  in the south, west, central and north districts of Malawi, 

with the exception of Karonga and Chitipa in the north, and Thyolo and Mulanje in 

the south (this study; Kumar et al., 2011). One possibility for this in the north is the 

geographic separation of Karonga/Chitipa from the nearest banana growing areas. 

Nkata bay is a distance of greater than 200 km, and is separated from Karonga by 

the northern limits of the Viphya Mountains and the Nyika Plateau, both of which 

may serve to  limit banana cultivation, as well as movement of banana plants and 

the  aphid  vector.  It  is more  likely,  however,  that  the  absence  of  bunchy  top  is 

related  to  the  limited cultivation of highly susceptible Cavendish banana  types at 

this location (authors’ observations; Kumar et al., 2011). 

A  very high  incidence of bunchy  top disease was observed  at many  sites 

visited  in Malawi  during  the  present  study, with plants  showing  severe  stunting 

and suckers exhibiting strong bunchy top symptoms. Further,  large populations of 

the  black  banana  aphid  vector  were  observed  at  almost  all  locations.  As  a 

consequence  of  the  high  disease  pressure  and  poor  management  by  growers, 

banana  production  in  some  areas  has  become  unprofitable  with  farmers 

abandoning  their plots.  In  an  effort  to  control  the disease, Mshani  et  al.  (2008) 

reported  that  800 ha of  severely  infected banana plantations  in  the Nkhata‐bay 

and Nkota‐kota districts were rogued to remove infected plants. However, without 

farmer  education,  and  available  sources  of  clean  planting material,  this  control 

strategy is unlikely to be effective in the long term. 

In contrast to Malawi, both the disease incidence and symptom severity in 

Rwanda were not as high. In most cases, symptoms were observed on older plants 

although,  upon  closer  inspection,  characteristic  symptoms  (i.e.  morse  code 

pattern)  could  also be detected on  suckers.  These  observations were  consistent 

amongst banana plants growing at different altitudes  in both  the Rift Valley and 

highland  regions of Rwanda.    Sequence  analysis of BBTV  isolates obtained  from 

164  

two plants  growing  at  altitudes of  970m  and  1648‐1687m  showed  that  the  two 

isolates were essentially  identical, and were also most similar  to  the  isolate  from 

Malawi,  suggesting  a  common  origin  for  these  isolates.  As  bunchy  top  has 

reportedly been  confined  to  the Rift Valley  region  in Rwanda,  this  suggests  that 

movement from the Rift Valley into the highlands is most likely from a local source 

through infected planting material. 

Although bunchy top has been observed on the African continent for more 

than  a  century  and  in  central Africa  for  several  decades,  it  is only  recently  that 

serious  disease  outbreaks  have  been  reported  (Mshani  et  al.,  2008;  Kumar  and 

Hanna, 2008; Kumar et al., 2011). Although  the  reason  for  this  is unknown,  it  is 

likely  to  be  associated with  a  range  of  different  factors  including  host  cultivar, 

temperature  and  vector.  Cavendish  type  banana  cultivars,  for  example,  are 

extremely susceptible to BBTV compared to other cultivars but Cavendish types are 

becoming increasingly popular in many regions of Africa. Bunchy top disease is also 

more prevalent  in  locations where warmer temperatures are more favourable for 

both  the  aphid  vector  (both  growth  and  virus  transmission)  and  rapid 

growth/expression  of  symptoms  (Anhalt  and Almeida,  2008; Magee,  1927).  This 

may  explain  the  lower  incidence  and  slower  spread  of  bunchy  top  disease  in 

regions such as Rwanda where vector prevalence  is  low, temperatures are cooler 

throughout  the year, and East African Highland bananas  (and not Cavendish) are 

the  dominant  cultivars  grown.  In  contrast,  in  countries  like  Malawi,  the 

combination of drier climate, warmer temperatures,  large vector populations and 

relatively recent shift to growing the highly susceptible cultivars  in the Cavendish 

complex  may  account  for  the  increasing  disease  incidence.  An  important 

observation made  during  these  disease  surveys was  that, whereas  aphids were 

difficult  to  find  at  the  locations  visited  in  the East African Highlands, mealybugs 

were  far  more  prevalent  as  was  the  incidence  of  BSV  infection  (A.  James, 

unpublished). 

The availability of sequences of East African  isolates of BBTV will  improve 

confidence  in  PCR‐based  diagnosis with  detection  of  local  isolates  validated  by 

diagnostic laboratories based in the region. The availability of positive controls to  

165  

indexing laboratories in the region is critical for preparedness, as BBTV is the most 

important virus threat to banana production in East Africa, particularly in Uganda, 

Kenya  and  Tanzania  where  the  virus  has  not  yet  been  reported.  Additionally, 

training  of  local  agricultural  and  extension  program  staff  in  recognising  and 

controlling  the disease  is a critical activity, Finally, with  transgenic BBTV‐resistant 

bananas considered the most suitable long‐term approach for BBTV control, efforts 

will be bolstered by knowledge that virus  isolates present  in the East Africa share 

significant sequence similarity with previously characterised isolates, improving the 

chances of developing durable, transgene mediated resistance to BBTV.  

 

Acknowledgements 

We are grateful to farmers  in both Malawi and Rwanda for allowing us to collect 

samples.  This  research  was  funded  by  the  Bill  and Melinda  Gates  Foundation 

Grand Challenges in Global Health Program. 

 

 

 

 

 

 

 

 

 

 

 

 

 

166  

References 

Amin,  I.,  Qazi,  J.,  Mansoor,  S.,  Ilyas,  M.,  Briddon,  R.W.  (2008)  Molecular 

characterisation  of  Banana  bunchy  top  virus  (BBTV)  from  Pakistan.  Virus 

Genes, 36, 191–198. 

Anhalt, M.D., Almeida, R.P.P.  (2008) Effect of  temperature, vector  life  stage, and 

plant access period on transmission of Banana bunchy top virus to banana. 

Phytopathology, 98, 743–748. 

Burns, T. M., R. M. Harding,  J. L. Dale  (1995) The genome organization of banana 

bunchy  top  virus:  analysis  of  six  ssDNA  components.  Journal  of  General 

Virology, 76, 1471–1482. 

Fahmy, T.  (1924) A banana disease  caused by  a  species of Heteroda. Ministry of 

Agriculture (Bot. Section), Egypt. Bulletin No. 30. 

Furuya, N., Kawano, S., Natsuaki, K.T. (2005) Characterisation and genetic status of 

banana bunchy  top virus  isolated  from Okinawa,  Japan.  Journal of General 

Plant Pathology, 71, 68–73. 

Furuya, N., Somowiyarjo, S., Natsuaki, K.T. (2004) Virus detection from local banana 

cultivars and the first molecular characterisation of banana bunchy top virus 

in Indonesia. Journal of Agricultural Science ‐ Tokyo University of Agriculture, 

49, 75–81. 

Harding,  R.M.,  Burns,  T.M.,  Dale,  J.L.  (1991)  Virus‐like  particles  associated  with 

banana bunchy  top  disease  contain  small  single‐stranded DNA.  Journal  of 

General Virology, 72, 225–230. 

Harding, R. M., Burns, T. M., Hafner, G., Dietzgen, R. G., Dale, J. L. (1993) Nucleotide 

sequence  of  one  component  of  the  banana  bunchy  top  virus  genome 

contains a putative replicase gene. Journal of General Virology, 74, 323–328. 

James, A.P., Geijskes, R.J., Dale, J.L., Harding, R.M. (2011a) Development of a novel 

rolling‐circle amplification  technique  to detect banana  streak  virus which 

also discriminates between integrated and episomal virus sequences. Plant 

Disease, 95, 57–62. 

167  

Karan, M.,  Harding,  R.M.,  Dale,  J.L.  (1994)  Evidence  for  two  groups  of  banana 

bunchy top virus isolates.  Journal of General Virology, 75, 3541–3546. 

Karan, M., Harding, R.M., Dale, J.L.  (1997) Association of banana bunchy top virus 

DNA components 2 to 6 with bunchy top disease. Molecular Plant Pathology 

On‐line: [http://www.bspp.org.uk/mppol/] 1997/0624karan]. 

Kenyon, L., Brown, M., Khonje, P. (1997) First report of banana bunchy top virus in 

Malawi. Plant Disease, 81, 1096. 

Kimura,  M.  (1980)  A  simple  method  for  estimating  evolutionary  rate  of  base 

substitutions  through  comparative  studies  of  nucleotide  sequences. 

Journal of Molecular Evolution, 16, 111–120. 

Kumar,  L.,  Hanna,  R.  (2008)  Banana  bunchy  top  virus  in  sub‐Saharan  Africa: 

established  or  emerging  problem?  In  Banana  and  Plantain  in  Africa: 

Harnessing  international partnerships  to  increase  research  impact, pp. 95–

96. Eds T. Dubois, S. Hauser, C. Staver, and D. Coyne: ISHS. 

Kumar, P.L., Ayodele, M., Oben, T.T., Mahungu, N.M., Beed, F., Coyne, D., Londa, L., 

Mutunda,  M.P.,  Kiala,  D.,  Maruthi,  M.N.  (2009)  First  report  of  Banana 

bunchy top virus in banana and plantain in Angola. Plant Pathology, 58, 402. 

Kumar, P.L., Hanna, R., Alabi, O.J., Soko, M.M., Oben, T.T., Vangu, G.H.P., Naidu, 

R.A.  (2011) Banana bunchy  top virus  in sub‐Saharan Africa:  Investigations 

on virus distribution and diversity. Virus Research, 159, 171–182. 

Magee, C.J.P. (1927) Investigation on the bunchy top disease of the banana. Council 

for scientific and industrial research. Bulletin No. 30. 

Magee, C.J.P.  (1967) The control of banana bunchy  top. South Pacific Commission 

Technical paper No. 150. Noumea: SPC. 

Mansoor, S., Qazi, J., Amin, I., Khati, A., Khan, I.A., Raza, S., Zafar, Y., Briddon, R.W. 

(2005)  A  PCR‐based  method,  with  internal  control,  for  the  detection  of 

Banana bunchy top virus in banana. Molecular Biotechnology, 30, 167–169. 

Mshani, V. E., Soko, M. M., Banda, D. L. N., Mwenebanda, B. M. L., Msosa, T. K., 

Mkankhama, Mwamlima,  L.  H.  (2008)  Evaluation  of  banana  and  plantain 

168  

hybrid  cultivars  in  banana  bunchy  top  affected  areas.  In  Plant  protection 

progress report for the 2007/2008 season, pp. 23–31. Lilongwe : Ministry of 

Agriculture and Food Security. 

Oben,  T.T.,  Hanna,  R.,  Ngeve,  J.,  Alabi,  O.J.,  Naidu,  R.A.,  Kumar,  P.L.  (2009) 

Occurrence  of  banana  bunchy  top  disease  caused  by  Bananan  bunchy  top 

virus on banana and plantain (Musa sp.) in Cameroon. Plant Disease, 93, 1076. 

Tamura, K., Dudley,  J., Nei, M., Kumar, S.  (2007) MEGA4: Molecular Evolutionary 

Genetics  Analysis  (MEGA)  software  version  4.0.  Molecular  Biology  and 

Evolution, 24, 1596–1599. 

Thomas,  J. E., Dietzgen, R. G.  (1991) Purification,  characterization and  serological 

detection of virus‐like particles associated with banana bunchy top virus  in 

Australia. Journal of General Virology, 72, 217–224. 

Thomas, J.E.,  Iskra‐Caruana, M.L. (2000) Bunchy top.  In Diseases of banana, abaca 

and enset, pp. 241–253. Eds D.R.Jones. United Kingdom: CABI. 

Thomas, J.E., Iskra‐Caruana, M‐L., Jones, D.R. (1994) Musa Disease Fact Sheet N° 4: 

Banana Bunchy Top Disease. INIBAP. 

Vetten, H. J., Chu, P. W. G., Dale, J. L. & 7 other authors (2005) Family Nanoviridae. 

In  Virus  Taxonomy:  Eighth  Report  of  the  International  Committee  on 

Taxonomy  of  Viruses,  pp.  343–352.  Eds  C.M.  Fauquet,  M.A.  Mayo,  J. 

Maniloff, U. Desselberger and L.A. Ball. London: Elsevier. 

Wanitchakorn, R., Harding, R.M., Dale, J.L. (2000) Sequence variability  in the coat 

protein  gene  of  two  groups  of  banana  bunchy  top  isolates.  Archives  of 

Virology, 145, 593–602. 

Xie, W.S.,  Hu,  J.S.  (1995) Molecular  cloning,  sequence  analysis,  and  detection  of 

banana bunchy top virus in Hawaii. Phytopathology, 85, 339–347. 

   

169  

CHAPTER 7 

GENERAL DISCUSSION 

Viruses  are  important  constraints  for  banana  production  in  many  countries. 

Historically, Banana bunchy  top  virus  (BBTV) has been  the most  important  virus 

disease  of  bananas  worldwide.  In  the  past  20  years  BBTV  has  emerged  as  a 

significant production constraint in many countries of sub‐Saharan Africa. Although 

not present in several countries in East Africa, bunchy top represents the greatest 

threat to production in these areas from a virus disease. In contrast, Banana streak 

disease, caused by a complex of Banana streak virus (BSV) species, is widespread in 

Kenya  and  Uganda.  Although  the  effects  on  production  are  not  as  limiting  as 

bunchy top, the prevalence of streak disease in these countries makes it regionally 

important. Diagnosis of BSV  is difficult due  to  considerable nucleotide  sequence 

variability  in  characterised  BSV  isolates  and  the  presence  of  endogenous  BSV 

(eBSV)  sequences  present  in  the  Musa  genome,  some  of  which  can  become 

activated to cause episomal infections. Because of these factors BSV is considered 

a  serious  constraint  for  Musa  breeding  programmes  and  the  international 

exchange of Musa germplasm. The research contained in this thesis, therefore, was 

directed  towards  the  development  of  diagnostics  for  banana  viruses,  with  a 

particular focus on BSV detection, and the characterisation of viruses which infect 

banana in East Africa.  

Banana streak virus  

Banana streak disease does not cause the same spectacular yield losses as bunchy 

top  disease.  In  fact,  based  on  field  observations  during  this  study,  yield  losses 

appeared negligible  in many  instances despite clear symptoms being observed on 

banana  plants.  It was  not  uncommon  to  see  large  bunches  developing  on  full‐

grown bananas despite many plants  in a  field showing symptoms consistent with 

streak disease, particularly  in  the  south west of Uganda. The  severity of banana 

streak  is  related  to  the  combined  effects  of  host‐plant  cultivar,  virus  species 

present and the prevailing environmental and cultivation conditions.  

170  

The RCA method developed in this study is an important step forward in the 

detection and characterisation of badnaviruses, and other members of the family 

Caulimoviridae.  With  endogenous  badnavirus  sequences  prevalent  in  both  the 

Musa acuminata and M. balbisiana genome (Geering et al., 2005), a method which 

specifically detects episomal forms of the virus DNA is advantageous. Furthermore, 

with endogenous  virus  sequences  reported  for  virus  species  from  five of  the  six 

genera  in the  family Caulimoviridae,  it  is highly  likely that RCA detection of these 

large DNA viruses will find application in a wide range of host‐virus combinations. A 

recent report by Geering et al. (2010) described the occurrence of a novel group of 

endogenous  virus  sequences,  which  have  similarity  to  members  of  the 

Caulimoviridae, in species from a number of plant families. RCA would undoubtedly 

be  a useful method  to  investigate  the possible occurrence of  episomal  forms of 

these  sequences,  which  may  or  may  not  infect  the  same  host  plants  as  their 

endogenous counterparts.  

This  study used  the novel RCA method  to characterise  six new  full‐length 

BSV  isolates which represent distinct species based on ICTV guidelines. Geering et 

al. (2011) recently reported the full‐length sequence of one of these putative new 

species, and proposed the name Banana streak IM virus (BSIMV). The sequence of 

BSIMV reported by Geering et al.  (2011) was one nucleotide shorter than that of 

the  Kenyan  isolate  of  BSIMV  identified  in  the  present  study  while  the  two 

sequences shared 99.2% nucleotide  identity over their complete genomes  (99.6% 

in the RT/RNaseH‐coding region). For the six putative new BSV species, biological 

information  on  their  transmission,  cultivar  reactions  and  yield  effects would  be 

useful to determine  if control  is warranted.  Interestingly, the results from surveys 

revealed  that of  these six species, only BSIMV had a significant number  (75%) of 

infections  in  B‐genome  banana  cultivars, while  the  remaining  five  species were 

almost exclusively detected  in AAA‐genome cultivars (one RCA positive sample of 

BSUMV was detected  in a AAB‐genome cultivar). This result is consistent with the 

findings of Harper et al. (2005), which showed that of the 19 sequences reported 

for BSUAV, BSUIV, BSULV and BSUMV, all but one (sample 30 therein) were present 

in AAA‐genome cultivars. This finding may simply highlight the cultivar preference 

171  

of farmers in the East African highlands (predominantly AAA‐genome bananas from 

the East African highland banana subgroup) or reinforce previous observations of 

the very slow  rate of mealy bug  transmission of BSV between plants  (Kubiriba et 

al., 2001), and  thus confirming  that  the primary means of BSV dissemination  for 

these species is through vegetative propagation.  

Harper  et  al.  (2005)  identified  13  distinct  BSV  sequence  groups  (named 

banana streak Uganda‐A to  ‐M virus)  in samples of banana with streak disease  in 

Uganda.  In  the present  study,  the  episomal nature of  four of  these  species was 

confirmed  and  one  isolate  of  each  was  completely  characterised.  However,  a 

number  of  potential  BSV  species  detected  by  Harper  et  al.  (2005)  were  not 

identified  in  this study, although several samples were collected  from bananas  in 

Uganda with streak symptoms which were positive for BSV infection using RCA and 

the BSV isolate was not identified. This result could indicate that further isolates of 

episomal BSV are present in Uganda awaiting characterisation.  

In banana,  the opportunity exists  to  identify and characterise  further BSV 

species.  With  many  endogenous  sequences  identified  in  banana  for  which 

episomal counterparts have not yet been  identified (Geering et al., 2005), as well 

as  field  isolates which  are  only  partially  characterised  (Harper  et  al.,  2005),  the 

search  to  identify  further  episomal  BSV  isolates  will  continue.  Phylogenetic 

analyses  have  demonstrated  three  distinct  subgroups  of  badnavirus  sequences 

(Gayral and Iskra‐Caruana, 2009; Harper et al., 2005). BSV isolates separate into all 

three of these subgroups, with episomal BSV only identified in subgroup 1 (BSGFV, 

BSMYV, BSOLV, BSVNV, BSIMV, BSCAV and BSUAV) and subgroup 3 (BSUIV, BSULV 

and BSUMV). Seven of the Ugandan BSV sequences (Banana streak Uganda‐B to ‐H 

virus) reported by Harper et al.  (2005) cluster  in subgroup 2. Confirmation of the 

episomal  nature  of  BSV  isolates  from  subgroup  2  is  of  interest.  In  the  present 

study,  a putative new  episomal BSV  sequence was  identified  from  an Australian 

germplasm  collection  using  the  novel  RCA  method.  This  BSV  sequence,  of 

approximately  7  kbp,  appears  to  be  complete  based  on  comparison with  other 

members of badnavirus subgroup 2. Based on nucleotide similarity  in  the 543 bp 

region of the polymerase gene delineated by the Badna‐FP/RP primers reported in 

172  

Yang et al. (2003), this sequence  is most similar to the BSUgBV/BSUgEV subgroup 

with approximately 78% nucleotide similarity. This  isolate  is also phylogenetically 

most closely related to the putative subgroup 2 BSV sequences infecting banana in 

Uganda  (Fig.  1).  This  recent  work  provides  evidence  that  a  banana‐infecting 

‘subgroup  2’  isolate  of  BSV  exists  as  an  episomal  infection.  Further,  using  PCR 

primers designed  to amplify  a 2.5  kbp  region of  the  genome,  a  fragment of  the 

expected  size  was  amplified  from  a  diverse  genetic  group  of  banana  cultivars 

suggesting  this  episomal  sequence  may  have  a  highly  similar  endogenous 

counterpart.  

The  most  significant  effects  of  BSV  at  present  are  not  on  the  field 

production  of  banana  but  on  the  propagation  of  banana  by  tissue‐culture, 

international movement of banana germplasm (as tissue cultures) and on efforts at 

genetic  improvement  of  banana  by  breeding  activities.  This  is  mostly  as  a 

consequence of the activation of eBSV within the genome of M. balbisiana (Iskra‐

Caruana et al., 2010), but  is coupled  to  the  lack of a  robust, sensitive method  to 

index for BSV. The RCA method developed in this study should detect all described 

BSV  species.  Importantly,  the  four  species  of  BSV with  endogenous  equivalents 

were shown to be detected using the RCA method. This method could be used to 

index  tissue  culture  accessions which  are  received by  importing organisations  in 

countries  interested  in exchanging Musa germplasm, particularly those accessions 

which contain a M. balbisiana genome component. As activation of eBSV appears 

limited  to genotypes which possess only  a  single B‐genome  component,  such  as 

tetraploid hybrids (AAAB) and plantains (AAB), monitoring for activation need not 

be  conducted  on  every Musa  accession  exchanged. Additionally,  as  activation  is 

limited  to  less  than  25%  of  progeny  plants  produced  in  tissue  culture  (Iskra‐

Caruana et al., 2010), there is an almost certain chance that plants free of infection 

would be identified. 

   

173  

Banana bunchy top virus 

Banana bunchy  top virus  (BBTV)  is  the most  important virus which  infects 

banana. As Charles McGee wrote  in 1927:‐ “It would be difficult  for anyone who 

has  not  visited  these  devastated  areas  to  visualize  the  completeness  of  the 

destruction wrought in such a short time by a plant disease”.  McGee was writing 

about  the  devastation  to  banana  production  in  eastern  Australia,  specifically 

northern New South Wales and south east Queensland, where bunchy top disease 

nearly  destroyed  the  banana  industry.  At  this  time  bunchy  top  incidence  in 

plantations  reached  100%  is  some  districts,  and many  banana  plantations were 

being deserted due  to  lack of  fruit production. Almost 90 years  later a profitable 

banana  industry  now  exists  in  these  areas  due  to  controls  devised  and 

implemented  following McGee’s  early work  to  understand  the  epidemiology  of 

bunchy top. Strict controls over the movement and selection of planting material 

combined  with  inspections  of  plantations  where  the  disease  occurs  and  strict 

roguing of  infected plants have  allowed banana production  to  continue  in  areas 

where the disease occurs, without eradication being achieved.  

Despite the lack of any known sources of host plant resistance in cultivated 

banana varieties,  long term control of bunchy top can be still achieved. However, 

these  controls  rely  on  strong  legislative  regulation  and  strict  enforcement. 

Epidemics  of  bunchy  top  have  been  recorded  in many  places, more  recently  in 

Pakistan  in the 1990’s (Amin et al., 2008) and  in modern times across the African 

continent  (Kumar and Hanna, 2008; Kumar et al., 2011; Mshani et al., 2008). The 

devastation  that Charles McGee described  in Australia  is  the  scenario  in present 

day  Malawi,  where  fields  of  abandoned  bananas  showing  the  most  severe  of 

bunchy top symptoms provide a reservoir of infection which, when combined with 

large numbers of the aphid vector, enable the disease to thrive. Grower education, 

legislative  controls  and  clean  planting  material  are  paramount  for  banana 

production  to  continue  under  these  conditions.  Even where  fields  have  a  lower 

incidence  of  bunchy  top,  diseased  plants  which  never  produce  fruit  are  not 

removed by growers. Without education on the factors which contribute to disease

174    

AJ968450 BSIMV Ug49-2 

HQ659760 BSIMV-Au 

HQ593112 BSIMV-Ke  

AJ968447 BSIMV\21-6 

AY750155 BSVNV

NC_004540 KTSV 

NC_003381 BSOLV

HQ593111 BSCAV

HQ593107 BSUAV

AJ968452 BSUgAV Ug44-3 

AJ968455 BSUgAV Ug45-2 

NC_006955 BSMYV

GU121676 PBCoV 

NC_003382 CiYMV 

NC_001574 CSSV 

GQ428155 PVBV

AJ968464 BSUgCV Ug11-4 

AJ968470 BSUgGV Ug53-1 

AJ968472 BSUgHV Ug22-1 

Novel BSV sequence

AJ968465 BSUgDV Ug52-1 

AJ968469 BSUgFV Ug11-3 

AJ968463 BSUgBV Ug11-5 

AJ968466 BSUgEV Ug11-2 

NC_007002 BSGFV

NC_001343 ComYMV 

NC_003031 SCBIMV 

NC_008017 SCBMOV 

AJ968539 BSUgMV Ug21-5 

AJ968540 BSUgMV Ug26-3 

HQ593110 BSUMV

AJ968501 BSUgJV Ug29-1 

AJ968481 BSUgIV Ug2-10 

HQ593108 BSUIV

AJ968473 BSUgIV Ug1-2 

AJ968504 BSUgKV Ug8-1 

AJ968506 BSUgKV Ug9-2 

HQ593109 BSULV

AJ968510 BSUgLV Ug6-10

AJ968513 BSUgLV Ug7-4

AF357836 TaBV

NC_001914 RTBV

NC_001497 CaMV

86

100

100

74

100

100

100

77

98

45

40

62

100

100

99

100

52

78

100

99

81

72

42

95

93

91

82

65

39

40

54

39

43

18

27

73

85

99

0.05 

175  

Fig. 1. Phylogenetic tree, using neighbour‐joining method (Kimura 2‐parameter model with 

bootstrapping  (1000  replicates)),  of  partial  RT/RNaseH‐coding  region  sequences  of 

selected  badnaviruses.  Rice  tungro  bacilliform  virus  (RTBV;  genus  Tungrovirus)  and 

Cauliflower  mosaic  virus  (CaMV;  genus  Caulimovirus)  were  used  as  out‐groups  to  the 

genus Badnavirus. GenBank accession numbers are listed with virus names in parentheses.  

Virus  name  abbreviations  are  Banana  streak  IM  virus  (BSIMV),  Banana  streak OL  virus 

(BSOLV), Banana  streak MY  virus  (BSMYV), Kalanchoe  top‐spotting  virus  (KTSV), Banana 

streak VN virus (BSVNV), Banana streak CA virus (BSCAV), Banana streak UA virus (BSUAV), 

Banana streak GF virus (BSGFV), Pineapple bacilliform cosmosus virus (PBCoV), Commelina 

yellow mottle virus (ComYMV), Cacao swollen shoot virus (CSSV), Citrus yellow mosaic virus 

(CiYMV), Pelargonium vein banding virus (PVBV), Banana streak Uganda A‐M virus (BSUgA‐

MV),  Dioscorea  bacilliform  SN  virus  (DBV),  Taro  bacilliform  virus  (TaBV),  Sugarcane 

bacilliform IM virus (SCBIMV), Sugarcane bacilliform MO virus (SCBMOV), Banana streak UI 

virus (BSUIV), Banana streak UL virus (BAULV) and Banana streak UM virus (BSUMV). New 

group 2 BSV identified in bold font. 

  

development and spread, this situation will continue and control will be impossible 

to achieve.  

Host‐plant resistance  is the most promising way of controlling an endemic 

plant  disease,  especially  in  countries  where  legislative  controls  are  weak  and 

education on managing virus diseases  is poor. For BBTV,  transgenic  resistance  to 

the virus  is  the most promising option  for  the development of  resistant banana. 

This is because no known natural resistance to BBTV has been reported and, even 

if  these  were  available,  the  low  levels  of  fertility  which  complicate  genetic 

improvement of banana by traditional breeding approaches would make  it nearly 

impossible to reconstitute the diverse range of dessert and cooking bananas which 

are in use by growers across such a diverse continent as Africa. Sequencing of East 

African isolates of BBTV in this work has confirmed their  identity within the south 

Pacific  subgroup  of  BBTV  isolates  and  identified  very  high  levels  of  sequence 

conservation with other isolates from this subgroup. As a consequence, transgenic 

resistance against isolates of BBTV in East Africa might be possible using sequences 

derived  from other  south  Pacific  isolates,  for  example  an  isolate  from Australia, 

Hawaii  or  Pakistan.  Several  authors  have  recently  suggested  the  use  of  hairpin‐

mediated RNA  silencing  (RNAi) as an option  to generate  transgenic  resistance  to 

BBTV  in  banana  (Amin  et  al.,  2008;  Borth  et  al.,  2011).  Once  proven,  this 

technology could be applied into selected cultivars which are regionally important 

within East Africa and elsewhere to achieve control of bunchy top disease.  

PCR is routinely used to detect BBTV as this method is extremely sensitive, 

rapid,  robust  and  cost‐effective.  For  countries  in  East  Africa where  BBTV  is  not 

present, such as Kenya, Tanzania and Uganda, confirmation that the primers used 

in PCR can detect  local  isolates of BBTV  is paramount. The work described  in this 

thesis  has  enabled  the  establishment  of  virus  indexing  capabilities  for  BBTV  at 

laboratories in these three countries, with BBTV isolates from Rwanda and Malawi 

made available as positive control samples and primers  for  indexing validated on 

these samples. Additionally, the training of project staff  from Uganda, Kenya and 

Tanzania  in  symptom  recognition  should  improve  regional efforts  to monitor  for 

BBTV. The survey work described  in this thesis will form a useful basis for further 

177  

efforts to monitor border areas for bunchy top incursions and hopefully assist with 

early detection of the disease if it does move into these countries.  

Conclusion 

Internationally, diagnostic testing for banana viruses has historically been confined 

to  a  very  few  groups  of  laboratories  and  not  located within  the major  banana 

growing  regions.  This  has  placed  severe  limitations  on  (i)  the  international 

movement  of  banana  germplasm,  (ii)  the  within  country  production  and 

distribution of virus tested banana tissue culture and clean field planting material 

and (iii) the general availability of, and access to, diagnostics for banana viruses for 

quarantine and survey purposes. Prior to the research presented here, detection of 

BSV  was  the major  factor  limiting  the  development  of  banana  virus  diagnostic 

capacity  because  the  accepted  technique,  IC‐PCR,  was  dependent  on  the 

availability  of  a  polyclonal  antibody  that  was  not  commercially  available.  The 

diagnostics  for  the  other  significant  banana  viruses  were  or  could  be  made 

available  using  commercially  and  readily  available  components.  Importantly,  the 

work described in this thesis has made a significant contribution to the availability 

of generic DNA‐based diagnostic tests for BSV. The ability to diagnose  infection of 

BSV  using  straight‐forward,  commercially  prepared  reagents  which  avoid  the 

requirement for the use of antisera, will make BSV diagnostics universally available. 

Methods  which  utilise  antisera  for  BSV  detection  suffer  from  the  serological 

variability of BSV  isolates, a  likely  lack of continuity of supply, and when using  IC‐

PCR the narrow scope of detection when using virus‐specific primers sets and the 

occurrence of  false positives arising  from  integrated virus sequences.  In contrast, 

RCA negates the use of antisera, detects a broad range of  isolates and specifically 

detects episomal virus sequences.  The availability of improved diagnostics for BSV 

together with DNA based diagnostics  for  the other significant banana viruses will 

enhance international efforts to exchange germplasm and utilise tissue culture for 

multiplication of bananas in which activation of endogenous sequences occurs. As 

an example, three  laboratories  in East Africa have developed capacity for banana 

virus diagnostics as part of the broader collaboration in the Bill and Melinda Gates 

178  

Foundation  funded  project  and  are  already  implementing  this  capacity  for  the 

practical benefit of farmers in those countries. 

179  

References 

Amin,  I.,  Qazi,  J.,  Mansoor,  S.,  Ilyas,  M.  and  Briddon,  R.W.  (2008).  Molecular 

characterisation  of  Banana  bunchy  top  virus  (BBTV)  from  Pakistan.  Virus 

Genes 36:191–198. 

Borth, W., Perez, E., Cheah, K., Chen, Y., Xie, W.S., Gaskill, D., Khalil, S., Sether, D., 

Melzer, M., Wang, M., Manshardt, R., Gonsalves, D. and Hu, J.S. (2011). In 

Proc. Int’l ISHS‐Promusa Symp. on Global Perspectives on Asian Challenges 

pp449–458.  Edited  by  I.  Van  den  Bergh,  M.  Smith,  R.  Swennen,  C. 

Hermanto. Acta Hort. 897, ISHS. 

Gayral, P. and Iskra‐Caruana, M.L. (2009). Phylogeny of Banana streak virus reveals 

recent  and  repetitive  endogenization  in  the  genome  of  its  banana  host 

(Musa sp.). J. Mol. Evol. 69:65–80. 

Geering, A.D.W., Choisne, N., Vezzuli, S., Scalabrin, S., Quesneville, H., Velasco, R. 

and Teycheney, P–Y. (2010). Viruses for breakfast, lunch and dinner. Proc. of 

the  9th  Australasian  Plant  Virology  Workshop  pp38.  Australasian  Plant 

Pathology Society. 

Geering, A.D.W., Olszewski, N.E., Harper, G., Lockhart, B.E., Hull, R. and Thomas, J.E. 

(2005). Banana contains a diverse array of endogenous badnaviruses. J. Gen. 

Virol. 86:511–520. 

Geering, A.D.W., Parry, J.N. and Thomas, J.E. (2011). Complete genome sequence of 

a novel badnavirus, banana streak IM virus. Arch. Virol. 156:733–737. 

Harper, G., Hart, D., Moult,  S.,  Hull,  R., Geering,  A.  and  Thomas,  J.,  (2005).  The 

diversity of Banana  streak virus  isolates  in Uganda. Arch. Virol. 150:2407–

2420. 

Iskra‐Caruana, M‐L., Baurens,  F‐C., Gayral,  P.  and Chabannes, M.  (2010). A  four–

partner plant–virus interaction: enemies can also come from within. MPMI. 

23:1394–1402.  

180  

Kubiriba,  J.,  Legg,  J.P.,  Tushemereirwe, W.  and Adipala,  E.  (2001). Disease  spread 

patterns of Banana streak virus  in  farmers’  fields  in Uganda. Ann. Appl. Biol. 

139:31–36. 

Kumar,  L.  and Hanna,  R.  (2008).  Banana  bunchy  top  virus  in  sub‐Saharan Africa: 

established  or  emerging  problem?  In  Banana  and  Plantain  in  Africa: 

Harnessing international partnerships to increase research impact pp95–96. 

Edited by T. Dubois, S. Hauser, C. Staver, and D. Coyne. ISHS. 

Kumar, P.L., Hanna, R., Alabi, O.J., Soko, M.M., Oben, T.T., Vangu, G.H.P. and Naidu, 

R.A.  (2011). Banana bunchy  top virus  in  sub‐Saharan Africa:  Investigations 

on virus distribution and diversity. Virus Res. 159:171–182. 

Magee,  C.J.P.  (1927).  Investigation  on  the  bunchy  top  disease  of  the  banana. 

Council for scientific and industrial research. Bulletin No. 30. Melbourne. 

Mshani,  V.E.,  Soko,  M.M.,  Banda,  D.L.N.,  Mwenebanda,  B.M.L.,  Msosa,  T.K., 

Mkankhama and Mwamlima, L. H. (2008). Evaluation of banana and plantain 

hybrid  cultivars  in  banana  bunchy  top  affected  areas.  In  Plant  protection 

progress report for the 2007/2008 season pp23–31. Ministry of Agriculture 

and Food Security, Malawi. 

Yang,  I.C., Hafner, G.J., Revill, P.A., Dale, J.L. and Harding, R.M. (2003).     Sequence 

diversity  of  South  Pacific  isolates  of  Taro  bacilliform  virus  and  the 

development of a PCR‐based diagnostic test. Arch. Virol. 148:1957–1968.