University of ZurichZurich Open Repository and Archive

Winterthurerstr. 190

CH-8057 Zurich

http://www.zora.uzh.ch

Year: 2008

Comparative characterization of cultured human term amnionepithelial and mesenchymal stromal cells for application in cell

therapy

Bilic, G; Zeisberger, S M; Mallik, A; Zimmermann, R; Zisch, A H

Bilic, G; Zeisberger, S M; Mallik, A; Zimmermann, R; Zisch, A H (2008). Comparative characterization of culturedhuman term amnion epithelial and mesenchymal stromal cells for application in cell therapy. Cell Transplantation,17(8):955-968.Postprint available at:http://www.zora.uzh.ch

Posted at the Zurich Open Repository and Archive, University of Zurich.http://www.zora.uzh.ch

Originally published at:Cell Transplantation 2008, 17(8):955-968.

Bilic, G; Zeisberger, S M; Mallik, A; Zimmermann, R; Zisch, A H (2008). Comparative characterization of culturedhuman term amnion epithelial and mesenchymal stromal cells for application in cell therapy. Cell Transplantation,17(8):955-968.Postprint available at:http://www.zora.uzh.ch

Posted at the Zurich Open Repository and Archive, University of Zurich.http://www.zora.uzh.ch

Originally published at:Cell Transplantation 2008, 17(8):955-968.

Comparative characterization of cultured human term amnionepithelial and mesenchymal stromal cells for application in cell

therapy

Abstract

Emerging evidence suggests human amnion tissue as a valuable source of two distinct types ofpluripotent cells, amnion epithelial cells (hAECs) and mesenchymal stromal cells (hAMSCs), forapplications in cell replacement therapy. For some approaches, it may be necessary to culture anddifferentiate these cells before they can be transplanted. No systematic attempt has been yet made todetermine the quantity and quality of amnion cells after isolation and culture. We looked at amnion cellisolates from 27 term placentas. Following our optimized protocol, primary yields were 6.3 x 10(6)hAECs and 1.7 x 10(6) hAMSCs per gram amnion. All 27 cases gave vital cultures of hAMSCs, whileone third of cases (9 of 27) failed to give adherent cultures of hAECs. Primary cultures containedsignificantly more proliferating than apoptotic cells (hAECs: 16.4% vs. 4.0%; hAMSCs: 9.5% vs.2.4%). Neither hAECs nor hAMSCs were clonogenic. They showed slow proliferation that almoststopped beyond passage 5. Microscopic follow-up revealed that hAEC morphology gradually changedtowards mesenchymal phenotype over several passages. Flow cytometric characterization of primarycultures showed expression of mesenchymal progenitor markers CD73, CD90, CD105, and CD166, aswell as the embryonic stem cell markers SSEA-3 and -4 on both amnion cell types. These profiles weregrossly maintained in secondary cultures. Reverse transcriptase-PCR analysis exhibited transcripts ofOct-3/4 and stem cell factor in primary and secondary cultures of all cases, but no telomerase reversetranscriptase. Immunocytochemistry confirmed translation into Oct-3/4 protein in part of hAECcultures, but not in hAMSCs. Further, both amnion cell types stained for CD90 and SSEA-4. Osteogenicinduction studies with amnion cells from four cases showed significantly stronger differentiation ofhAECs than hAMSCs; this capacity to differentiate greatly varied between cases. In conclusion, hAECsand hAMSCs in culture exhibit and maintain a similar marker profile of mesenchymal progenitors.hAECs were found as a less reliable source than hAMSCs and altered morphology during subculture.

Cell Transplantation, Vol. 17, pp. 1–100, 2008 0963-6897/08 $90.00 + .00Printed in the USA. All rights reserved. E-ISSN 1555-3892Copyright 2008 Cognizant Comm. Corp. www.cognizantcommunication.com

Comparative Characterization of Cultured Human Term Amnion Epithelialand Mesenchymal Stromal Cells for Application in Cell Therapy

Grozdana Bilic,*1 Steffen M. Zeisberger,*1 Ajit S. Mallik,*†Roland Zimmermann,* and Andreas H. Zisch*†

*Department of Obstetrics, University Hospital Zurich, Zurich, Switzerland†Zurich Center for Integrative Human Physiology, Zurich, Switzerland

Emerging evidence suggests human amnion tissue as a valuable source of two distinct types of pluripotentcells, amnion epithelial cells (hAECs) and mesenchymal stromal cells (hAMSCs), for applications in cellreplacement therapy. For some approaches, it may be necessary to culture and differentiate these cells beforethey can be transplanted. No systematic attempt has been yet made to determine the quantity and quality ofamnion cells after isolation and culture. We looked at amnion cell isolates from 27 term placentas. Followingour optimized protocol, primary yields were 6.3 × 106 hAECs and 1.7 × 106 hAMSCs per gram amnion. All27 cases gave vital cultures of hAMSCs, while one third of cases (9 of 27) failed to give adherent culturesof hAECs. Primary cultures contained significantly more proliferating than apoptotic cells (hAECs: 16.4%vs. 4.0%; hAMSCs: 9.5% vs. 2.4%). Neither hAECs nor hAMSCs were clonogenic. They showed slowproliferation that almost stopped beyond passage 5. Microscopic follow-up revealed that hAEC morphologygradually changed towards mesenchymal phenotype over several passages. Flow cytometric characterizationof primary cultures showed expression of mesenchymal progenitor markers CD73, CD90, CD105, andCD166, as well as the embryonic stem cell markers SSEA-3 and -4 on both amnion cell types. These profileswere grossly maintained in secondary cultures. Reverse transcriptase-PCR analysis exhibited transcripts ofOct-3/4 and stem cell factor in primary and secondary cultures of all cases, but no telomerase reversetranscriptase. Immunocytochemistry confirmed translation into Oct-3/4 protein in part of hAEC cultures, butnot in hAMSCs. Further, both amnion cell types stained for CD90 and SSEA-4. Osteogenic induction studieswith amnion cells from four cases showed significantly stronger differentiation of hAECs than hAMSCs;this capacity to differentiate greatly varied between cases. In conclusion, hAECs and hAMSCs in cultureexhibit and maintain a similar marker profile of mesenchymal progenitors. hAECs were found as a lessreliable source than hAMSCs and altered morphology during subculture.

Key words: Human amnion epithelial cells; Human amnion mesenchymal cells; Culture; Stemness markers;Cell transplantation

INTRODUCTION

It has become evident that various parts of humanplacenta that are normally discarded after delivery con-stitute valuable sources of maternal and fetal cells thatexhibit stem cell-like plasticity (9,14,16,26). Particularattention has been directed to the amnion layer of thedeflected part of the fetal membranes as a source ofstem/progenitor cells of fetal origin. Amnion tissue isderived from epiblast, which gives rise to all three germlayers of the embryo. Because it is formed in the earlystage of embryogenesis, immature undifferentiated cellsmay be reserved. Amnion contains two different celltypes: 1) amnion epithelial cells (hAECs), which form a

Received July 16, 2007; final acceptance February 28, 2008.1Both authors contributed equally to this work.Address correspondence to Grozdana Bilic, Ph.D. or Steffen M. Zeisberger, Ph.D., Department of Obstetrics, University Hospital Zurich, Frauenklin-ikstrasse 10, 8091 Zurich, Switzerland. Tel: +41 44 2558585; Fax: +41 44 2554430; E-mail: grozdana.bilic@usz.ch or steffen.zeisberger@usz.ch

1

continuous monolayer that contacts the amniotic fluid,and 2) amnion mesenchymal stromal cells (hAMSCs),which are sparsely distributed in the collagenous stromathat underlies the amnion epithelium (20). IsolatedhAECs were found to express markers normally presenton embryonic cells or germ cells (14,15). Their differen-tiation fates are beginning to be elucidated.

Emerging evidence suggest that amnion cells may bedifferentiated into cells expressing markers of mesoder-mal, endodermal, or ectodermal cells when stimulatedwith singular or cocktails of specific differentiation fac-tors in vitro. Characteristics of neural cells, pancreaticβ-cells, skeletal muscle, cardiomyocytes, or endothelialcells could be induced in human amnion cells (1,14,23,

2 BILIC ET AL.

29,31). Notably, some characteristics of other cell typesare intrinsically present in amnion cells [e.g., fresh iso-lates of hAECs were found to show some characteristicsand functions of hepatocytes (28), and hAMSCs showedcharacteristics of endothelial cells (1) as well as cardio-myocytes (31)]. Other important advantages are thathAECs are highly available, nonimmunogenic and evenimmunosupressive (2,30), and do not form tumors afterallotransplantation (27). For these properties, hAECsand possibly also hAMSCs, could become valuable trans-gene carriers in cell therapy of inherited metabolic dis-eases (18).

Transplantation of hAECs that were transduced beforein vitro with human low-density lipoporotein receptorsuccessfully reduced serum cholesterol in animals (27).An appealing strategy would be their differentiation invivo, after transplantation: temporary normalization ofblood glucose levels was achieved after implantation offreshly isolated hAECs into spleen of streptozotocin-treated diabetic mice, suggesting that hAECs could ac-quire β-cell fate in vivo (29). Important for transplanta-tion approaches, human amnion cells have the capacityto successfully and persistently engraft in vivo (2). Intra-venous delivery of fresh, unfractionated human isolatesinto newborn rats, or their interperitoneal delivery intonewborn swine, led to microcherism in multiple organsand tissues.

Knowledge about yields, vitality, phenotype, andexpansion of hAECs or hAMSCs is a prerequisite fortherapeutic application. Systematic comparative investi-gations have not yet been attempted. We have pre-viously established protocols for isolation and culture ofhAECs or hAMSCs from term or preterm amnion tissuewith the goal to generate living tissue grafts for closureof ruptured fetal membranes (3,4,19). Here we usedthese methods for a first systematic side-by-side charac-terization of hAECs versus hAMSCs regarding expan-sion and stemness from 27 term placentas after isolationand culture.

MATERIALS AND METHODDS

Isolation and Primary Culture of Term hAECsand hAMSCs

Amnion tissues were collected immediately afterelective cesarean section from term placentas of gesta-tional weeks 38 ± 0 (N = 27; between 37 and 39 weeksof gestational age) in the absence of labor, PROM,chorioamnionitis, or chromosomal abnormalities. Casesin this study included repeat cesarean section (N = 16),breech presentation (N = 8), and cephalo-pelvic dispro-portions (N = 3). Amnion and chorion laeve tissues wereseparated by blunt dissection (19), and the amnion wascut approximately 2 cm from the placental disc to avoidthe “zone of altered morphology” (12,13). If not indi-

cated otherwise, reagents were purchased from GibcoBRL (Basel, Switzerland).

To remove cellular debris and blood, the amnionsamples were washed in phosphate-buffered saline (PBS)and treated with 0.25% trypsin for 3 min. This first di-gestion supernatant, consisting primarily of red bloodcells, was discarded. hAECs were isolated by subse-quent treatment of amnion tissue with 1.2 U/ml dispasefor 60 min at 37°C followed by gentle manual scrapingof the amnion epithelial surface with a cell scraper. Thecomplete removal of hAECs from amnion tissue wasvalidated by microscopic inspection of amnion tissue.To isolate hAMSCs, the remaining amnion tissue wasminced and incubated with 2 mg/ml collagenase A(Roche Diagnostics, Rotkreuz, Switzerland) for 120 minat 37°C. Both cell types were cultured in a 1:1 mixtureof Ham’s F-12 and Dulbecco’s modified Eagle’s me-dium (Ham’s F-12/DMEM) supplemented with 10%heat-inactivated fetal bovine serum (FBS), 100 U/mlpenicillin, and 100 µg/ml streptomycin. In some experi-ments, the amnion cells were cultured in medium addi-tionally supplied with 10 ng/ml epithelial growth factor(EGF) (Sigma, Buchs, Switzerland). Cultures weregrown near to confluence in a humidified incubator at37°C and 5% CO2. Cell passage was performed usingtrypsin-EDTA. In some experiments, human testiculargerm cell tumor (TGCT) cell line EP2102 cells servedas positive control (kindly provided by Dr. ThomasMueller, University of Halle, Halle, Germany).

Cell Size Determination

Cell areas of total 369 hAECs and 170 hAMSCs inprimary adherence culture from 10 different amnioncases were measured. Cells were imaged with a DMILmicroscope (Leica, Glattbrugg, Switzerland) equippedwith a DML digital camera at day 4 of culture. Cellsize was measured using LeicaQ Win Image Analysissoftware (Leica Imaging System Ltd, Cambridge En-gland, UK).

Cell Proliferation and Apoptosis Assays

Cultured amnion cells were fixed with 3% paraform-aldehyde (PFA) for 15 min at culture day 4, washedthree times with PBS, permeabilized with 0.2% TritonX-100, and incubated with fluorescein isothiocyanate(FITC)-labeled mouse monoclonal antibody Ki-67(Zymed Laboratories, San Francisco, CA) at 4 µg/ml for1 h at room temperature. Cells were washed three timeswith PBS. Apoptosis was detected in primary cell cul-ture at day 4 using the in situ TUNEL kit according tothe manufacturer’s instructions (Roche, Basel, Switzer-land). Nuclei counterstaining was performed using4′6-diamidino-2-phenylindole dihydrochloride (DAPI;Molecular Probes, Eugene, OR). Fluorescing cells were

COMPARATIVE CHARACTERIZATION OF CULTURED AMNION CELLS 3

imaged with a DMIL fluorescence microscope (Leica)equipped with a DML digital camera (Leica). Cellcounts were obtained from fluorescence micrographs us-ing automated image analysis software ImageJ 1.34s(National Institute of Health, Bethesda, MD). Percent-ages of proliferating or apoptotic cells are given. Allexperiments were performed in triplicate.

Immunocytochemistry

hAECs and hAMSCs were fixed with 3% PFA for15 min, washed three times with PBS, and permeabil-ized with 0.2% Triton X-100. F-actin filaments werevisualized with rhodamine-labeled phalloidin (Molecu-lar Probes). Nuclei were stained with DAPI. Fluorescingcells were imaged with a DMIL fluorescence micro-scope (Leica) equipped with a DML digital camera(Leica). For SSEA-4, Oct-3/4, and CD90 detection,hAECs and hAMSCs were cultured on collagen-coatedcoverslips (Karl Hecht KG, Sondheim, Germany) andfixed as described above. Cells were permeabilizedwhen needed, rinsed with PBS twice, blocked with 2%bovine serum albumin (BSA) for 1 h, and quenched in0.2 M glycine for 10 min. Samples were then incubatedwith directly labeled tetramethylrhodamine isothiocya-nate (TRITC)-conjugated primary monoclonal antibod-ies (mAb) to: SSEA-4 (MC813-70), Oct-3/4 (240408)(R&D Systems, Minneapolis, MN), or CD90 (5E10)(BD Pharmingen, San Diego, CA) for 16 h at 4°C, andthen nuclei were counterstained with DAPI. The sam-ples were rinsed with PBS and mounted in fluorescentmounting medium (Dako, Carpinteria, CA). Analysiswas performed with fluorescent microscope OlympusBX61 (Olympus, Hamburg, Germany) equipped with anOlympus F-Few2 digital camera and analysed with anal-ySIS 5.0 software (Olympus).

Flow Cytometry

Cells were collected by trypsinization. Reaction wasperformed on live cells, using 105 cells per antibody re-action. Cells were incubated for 45 min at 4°C. Antibod-ies were used at a 1:50 dilution: mouse monoclonal anti-bodies specific for MHC-I (G46-2.6), MHC-II (G46-6),CD44 (G44-26), CD49e (IIA1), CD73 (AD2), CD90(5E10), CD166 (3A6) (all from BD Pharmingen); CD34(AC136), CD45 (5B1) (both from Miltenyi Biotec, Au-burn, CA); CD105 (MEM-226) (Abcam, Cambridge,UK), SSEA-3 (MAB 1434), SSEA-4 (MC813-70), STRO-1 (STRO-1) (R&D Systems); CD117 (YB5.B8) (eBio-scince, San Diego, CA, USA). Corresponding isotypeimmunoglobulins (Ig) were used as negative controls(Pharmingen; R&D). Primary mAbs were mostly di-rectly labeled with FITC, TRITC, phycoerythrin (PE),or allophycocyanin (APC). Where necessary, secondarylabeled goat or rat anti-mouse IgG1, anti-IgG2, and anti-

IgG3 (all from Pharmingen) were added for 45 min at4°C. Cells were fixed in 4% buffered formalin and ana-lyzed with a flow cytometer (FACSCalibur, BectonDickinson, Franklin Lakes, NJ). A minimum of 104

gated events were acquired for each sample.

Reverse Transcription-Polymerase ChainReaction (RT-PCR)

Total RNA was isolated using RNeasy Micro-kit(Qiagen, Hilden, Germany). RNA concentrations weremeasured by absorbance at 260 nm with a spectropho-tometer (NanoDrop, Wilmington, DE), and 1 µg ofDNase I-treated RNA of each sample served as a tem-plate for cDNA synthesis with ImProm-II Reverse Tran-scription System (Promega, Madison, WI), before per-forming PCR analysis. The cDNA templates wereamplified at 40 cycles of 95°C (35 s), 58°C (40 s), 72°C(60 s), followed with 74°C for 5 min. PCR productswere visualized with ethidium bromide on a 1.5% agar-ose gel. Primer sequences and product sizes are listed inTable 1.

In Vitro Differentiation of hAECs and hAMSCs

Differentiation studies were performed with primarycultures (P0) of hAECs and hAMSCs from four cases.For that, cells were seeded at a density of 2 × 105 perwell in 48-well plates (Becton Dickinson). Finally, cellswere examined microscopically with a Zeiss Axiovert200M (Carl Zeiss, Feldbach, Switzerland) equipped witha digital camera (AxioCam MRc, Carl Zeiss) and ana-lyzed with AxioVs40 V 4.5.0.0 imaging software (CarlZeiss).

Osteogenic Induction. Osteogenic differentiation wasperformed as recommended by the manufacturer of theosteogenic induction medium (Lonza, Walkersville, MD,USA). hAECs and hAMSCs were maintained in ostege-nic induction medium for 2 weeks, with fresh mediumadded every third day. Control cultures were grown instandard culture medium Ham’s F-12/DMEM supple-mented with 10% FBS. Alkaline phosphatise (ALP) ex-pression was demonstrated by cytochemical stainingwith FAST BCIP/NBT (5-bromo-4-chloro-3-indolylphosphate/nitro blue tetrazolium) tablet (Sigma-Aldrich,Buchs, Switzerland). For that, cells were fixed in pre-cooled methanol for 5 min, rinsed with deionized water,then incubated with FAST BCIP/NBT substrate for 10min at room temperature. Finally, stained cells werewashed with water and examined microscopically.

Myogenic Induction. Myogenic differentiation wasperformed as described previously (22). hAECs andhAMSC were exposed to myogenic induction mediumcomposed of DMEM-H (Gibco), 10% FBS, 5% horseserum, 50 µM hydrocortisone, and 0.1 µM dexametha-

4 BILIC ET AL.

Table 1. Primers Used for Marker Expression Analysis (RT-PCR)

Marker Forward Primer Reverse Primer Product Size

hOct-3/4 GACAACAATGAAAATCTTCAGGAGA TTCTGGCGCCGGTTACAGAACCA 218 bphSCF GATGTTTTGCCAAGTCATTGTTGG ACTGACTCTGGAATCTTTCTCAGG 347 bphTERT AGAGTGTCTGGAGCAAGTTGC CGTAGTCCATGTTCACAATCG 185 bphActin CGGGAAATCGTGCGTGACAT GAACTTTGGGGGATGCTCGC 712 bp

sone for 1 week. Fresh media were added on day 3.Control cultures were grown in DMEM-H/10% FBS.For immunocytochemical staining, cells were washedtwice with PBS and fixed with 3% PFA for 15 min atroom temperature. Fixed cells were washed three timeswith PBS and permeabilized with 0.2% Triton X-100.Following this step, cells were rinsed twice with PBSand blocked with 2% BSA for 1 h at room temperature.Subsequently, cells were quenched with 0.2 M glycinefor 10 min. Thereafter cells were incubated with mouseanti-human MyoD (5.8A) (Imgenex, San Diego, CA,USA) or mouse anti-human myogenin (5FD) (Imgenex)antibodies at dilution of 1:100 in 0.1% BSA for 1 h atroom temperature. Cells were washed and incubatedwith Alexa Fluor 488-labeled secondary antibody (Mo-lecular Probes) at dilution of 1:1000 in 0.1% BSA for 1h at room temperature. Nuclei were counterstained withDAPI. The samples were rinsed with PBS, mounted influorescent mounting medium (Dako, Carpinteria, CA,USA), and analyzed microscopically.

Adipogenic Induction. hAECs and hAMSCs wereexposed to adipogenic induction medium (Miltenyi Bio-tec, Bergisch Gladbach, Germany) for 3 weeks, withfresh media added twice weekly. Control cultures weregrown in standard culture medium Ham’s F-12/DMEM/10% FBS. Oil Red O was utilized to visualize fat drop-lets following the manufacturer’s instructions (MiltenyiBiotec). Briefly, cells were washed twice with PBS,fixed in precooled methanol for 5 min, rinsed with de-ionized water, then incubated with Oil Red O (Sigma-Aldrich) staining reagent for 20 min at room tempera-ture. Finally, stained cells were washed with water andanalyzed microscopically.

Statistical Analysis

Data are shown as mean ± SEM. Two-tailed unpairedt-test was performed using GraphPad Prism version 4.00for Windows (GraphPad Software, San Diego, CA,USA). Significance level was set at p < 0.05.

RESULTS

Outgrowth Characteristics and Vitality of PrimaryAmnion Cell Cultures

Isolations were performed with term amnion (N = 27)dissected from the deflected part of the fetal membranes.

We used a newly optimized two-step protocol that se-quentially releases hAECs and hAMSCs from amnion.This new protocol seeks to increase yield of vital cellsby avoiding the repeated harsh exposure of amnion cellsto trypsin (three to four times for 15 min) in the previousprotocol (3,4,19). The sequence of our new protocolcomprises a single short trypsinization step (3 min), fol-lowed by treatment with the enzyme dispase, which isknown to produce less damage to cell membranes(6,24). In a first step, we combined treatment of amnionwith 1.2 U/ml dispase and gentle mechanical scraping toremove the epithelial layer. Optical inspection verifiedcomplete recovery of all epithelial cells. In a secondstep, the remaining amnion stroma was digested with 2mg/ml collagenase A to obtain the hAMSC population.Yields of live cells, as determined by trypan blue exclu-sion, reproduced within a narrow range and assumed 6.3 ±1.4 × 106 hAECs and 1.7 ± 0.3 × 106 hAMSCs per gramof wet amnion tissue (Fig. 1A).

We selected for cell fractions capable of adhering toculture dishes. In 9 out of 27 cases, hAECs completelyfailed to attach after plating. In successful hAEC cul-tures, only a small fraction of freshly isolated hAECsattached and grew out. Seeding density was importantfor hAECs: 1.75 × 105 cells/cm2 were found the minimalseeding density required to give proliferating cultures.hAMSC culture was successful in all 27 cases, and allhAMSCs adhered within 16 h and could be further ex-panded. For hAMSCs, a seeding density of 4 × 104 cells/cm2 was sufficient. Rigorous optical inspection showedthat hAEC and hAMSC cultures were homogenous.hAECs and hAMSCs greatly differ in shape, size, andorganization, which allows to assess culture homogene-ity by phase contrast microscopy. Measurements of sin-gle cell areas showed that hAMSCs were three timeslarger than hAECs (i.e., 4266 ± 333 µm2 compared to1403 ± 194 µm2 (Fig. 1B).

Figure 2A and D depicts the distinct morphologiesof hAECs and hAMSCs after overnight culture. hAECsformed islands (Fig. 2A, arrowheads) with cell-to-cellcontact that subsequently grew out into cobblestone-likeepithelium (Fig. 2B), while hAMSCs did not form is-lands and grew out from individual cells possessing ir-regular shape and prominent cell protrusions (Fig. 2Dand E, arrows). The two cell types also exhibit very dif-

COMPARATIVE CHARACTERIZATION OF CULTURED AMNION CELLS 5

Figure 1. Basic characteristics of hAECs and hAMSCs isolated at term. (A) Initial cell yields,before plating, per gram of wet term amnion tissue (N = 18 amnion cases). The ratio of isolatedhAECs and hAMSCs was significantly different and was about 4:1. (B) Primary hAECs and hAMSCsin adherent culture exhibit significantly different cell size. Cell size of hAMSCs was about three-fold higher compared to hAECs (N = 10 amnion cases; n = 369 for hAECs and n = 170 for hAMSCs).(C) Primary hAECs and hAMSCs exhibit similar vitality. For both amnion cell types, rates ofproliferating cells were significantly higher than rates of cells undergoing apoptosis. Proliferationand apoptotic rates did not significantly differ between hAECs and hAMSCs. Rates of proliferating(Ki-67 staining) or apoptotic cells (TUNEL staining) are expressed as percentages of total numberof cells (DAPI staining). N = 10 amnion cases. Values are mean ± SEM. *p < 0.05.

ferent actin organization in culture. Representative im-ages of phalloidin-stained cultures in Figure 2C and Fshow that hAECs exhibit cortical F-actin expression,while hAMSCs have an extensive array of actin fila-ments in their cytoplasm. Further, neither staining forvimentin nor cytokeratin 18 expression were found spe-cific for hAMSC and hAEC type in culture, respectively(data not shown).

Ki-67 and TUNEL staining were used to identify pro-liferating or apoptotic cells in primary cultures. For bothamnion cell types, rates of proliferating cells (hAECs:16.4 ± 3.8%; hAMSCs: 9.5 ± 2.8%; N = 10 cases) weresignificantly higher than rates of cells undergoing apo-ptosis in the same culture (hAECs: 4.0 ± 1.0%; hAMSCs:2.4 ± 0.5%) (Fig. 1C). Proliferation and apoptotic rates

did not significantly differ between hAECs and hAMSCs.The primary amnion cells did not show any clonal out-growth in high dilution seeding assays (data not shown).Overall, proliferation in culture was slow. In our hands,amnion cells could be serially passaged up to five times(which took about 120 days) (Fig. 3A and B), at a lowsplitting rate of 1:2 per passage. Although initial yieldsof freshly isolated hAMSCs were approximately fourtimes lower than that of hAECs, comparable quantitiesof hAECs and hAMSCs were obtained after subcultiva-tion. Examination of cultures revealed that cell prolifera-tion slowed down with every passage and almost stoppedbeyond passage 5. The diagram in Figure 3A illustratesminimal and maximal yields of cultured hAECs andhAMSCs at indicated culture time points. We propose

6 BILIC ET AL.

Figure 2. Primary hAECs and hAMSCs exhibit different morphology and outgrowth pattern in culture. Cell shape and cell organiza-tion were analyzed by phase contrast microscopy and fluorescence microscopy to visualize phalloidin-stained F-actin cytoskeleton(red) and DAPI-stained cell nuclei (blue). (A–C) hAECs formed and grew out in loose cell islands (A; arrowheads) that grew toconfluent cobblestone monolayer (B). hAECs exhibit cortical expression of filamentous actin (C). (D–F) hAMSCs grow out assingular cells. Dense cultures showed cell protrusions towards neighboring cells (E; arrows). hAMSCs displayed strong expressionof F-actin throughout the cell (F). N = 5 amnion cases. Scale bar: 50 µm.

that hAECs from ≤passage 1, and hAMSCs from ≤pas-sage 3 could be reasonable practical cell sources fortransplantation.

hAECs Gradually Assume Mesenchymal MorphologyDuring Subculture

An important point concerns whether the cells main-tain their initial phenotype upon expansion in culture.We looked at the morphology of serially passaged am-nion cells from five cases by fluorescence microscopyof phalloidine-stained cells. We observed that a strikingchange of hAEC morphology over time: individual cellarea became enlarged and the regular cubic shape be-came irregular. After three passages (day 50 in culture),hAEC morphology became similar to that of culture-expanded hAMSCs, suggesting epithelial–mesenchymaltransition. Figure 3B shows fluorescent microscopic fol-low-up of cultures at days 7, 21, 30, 50, 90, and 120.With every passage, the cortical actin expression patternof hAECS became more and more similar to the actinexpression pattern of AMSCs. At passage 5, the two cell

types were indistinguishably by morphology. Change ofhAEC morphology was slower when culture was per-formed in the presence of 10 ng/ml EGF (data notshown). For hAMSCs, no change of morphology wasobserved throughout five passages.

Mesenchymal and Embryonic SC MarkerProfile of Primary hAEC and hAMSC Culturesby Flow Cytometry

We used flow cytometry to screen the phenotypes ofprimary cultured hAECs and hAMSCs. Figure 4 andFigure 5A and B depict the results with hAECs andhAMSCs from eight cases. hAECs and hAMSCs ex-pressed high levels of HLA-ABC (MHC-I) but no HLA-DR (MHC-II). Expression of HLA-ABC on hAECs wassignificantly lower than on hAMSCs (p < 0.05) (Fig.4A, B). As shown in Figure 5A–C, both cell types werenegative for hematopoetic markers CD34 and CD45.Both amnion cell types were positive for surface mark-ers of mesenchymal stromal (stem) cells (i.e., CD44,CD49e, CD73, CD90, CD105, CD166, STRO-1), as

COMPARATIVE CHARACTERIZATION OF CULTURED AMNION CELLS 7

well as embryonic stem cells SSEA-3 and -4. SomehAMSC cultures showed weak expression of hemato-poietic progenitor cell marker c-kit/CD117. While wefound little variation in levels of marker expressionwithin the individual cases, there were differences in ex-pression levels of several markers between the hAECand hAMSC study groups. Expression of CD44, CD49e,and CD90 was significantly higher on hAMSCs than onhAECs (p < 0.05). Levels of CD73, CD166, and SSEA-3 and -4 were significantly higher on hAECs (p < 0.05).

Subsequent analysis of marker profiles was per-formed for secondary (passage 1) amnion cultures of alleight amnion cases (Fig. 5C). There were no significantchanges in levels of marker expression between passage0 and 1 on both cell types, except for embryonic markerSSEA-4 on hAMSCs (p < 0.05). In one amnion case,we monitored SSEA-4 levels on hAECs and hAMSCs

Figure 3. Morphology and yields of cultured hAECs and hAMSCs. (A) Minimal and maximal yields of cultured hAECs andhAMSCs at indicated culture time points. hAECs from ≤passage 1, and hAMSCs from ≤passage 4 could be optimal sources fortransplantation. Gray background denotes potentially optimal harvest windows, based on grounds of stable cell morphology andpractical culture times. (B) Representative images showing the morphologies of hAECs and hAMSCs at indicated stages of culture,from passage 0 to 5, over total 120 days. Cell shape was visualized by phalloidin staining of actin cytoskeleton. hAECs exhibittypical epithelial morphology and growth pattern only at passages 0 and 1, but acquire hAMSC-like morphology upon furtherpassages. By contrast, there were no changes of hAMSC morphology over the full duration of culture. N = 5 amnion cases. Scalebars: 25 µm.

over four passages, and we observed that numbers ofhAECs and hAMSCs positive for SSEA-4 epitope dur-ing subculture dropped by 48% and 73%, respectively(Fig. 5D).

“Stemness” Characteristics by RT-PCRand Immunocytochemistry

By RT-PCR, we tested primary and secondary cul-tures derived from eight cases for markers known to beimportant for pluripotency or self-renewal of embryonicstem cells. These included octamer-binding protein Oct-3/4 (17), stem cell factor (SCF) (7), and telomerase re-verse transcriptase (TERT) (7). Human testicular germcell tumor (TGCT) cell line 2102 EP was used as posi-tive control. Cultures from all eight amnions were posi-tive for transcripts of Oct-3/4 and SCF (Fig. 6A) butnegative for TERT. We next investigated by immunocy-

8 BILIC ET AL.

Figure 4. Immunological marker profile of primary hAECs and hAMSCs. (A) Flow cytometry demonstrated that hAECs andhAMSCs express HLA-ABC but not HLA-DR. (B) hAMSCs showed significantly higher expression of HLA-ABC than hAECs.N = 8 amnion cases. *p < 0.05.

tochemistry whether Oct-3/4 transcripts translated intoOct-3/4 protein (N = 5 cases). Figure 6B depicts repre-sentative images. Nuclear expression of Oct-3/4 proteinwas clearly detected in hAECs but undetectable inhAMSCs. Interestingly, only two out of five hAECs cul-tures were positive for Oct-3/4 protein, indicating bio-logical disparity among amnion tissues from differentindividuals. These two Oct-3/4-positive cases were alsopositive for SSEA-4 on hAECs as well as on hAMSCs.SSEA-4 was detected at sites of cell–cell contact. Fi-nally, hAEC and hAMSC cultures from all five caseswere found positive for CD90 (Fig. 6B).

Differentiation Potential of hAMCs and hAMSCs

We performed functional differentiation assays tolook at whether expression of “stemness” markers inthese two amnion cell populations associated with a ca-pability to differentiate. For that, we did a side-by-sideculture of hAECs and hAMSCs from four cases in os-teogenic, adipogenic, or myogenic differentiation media.Our analyses revealed significant osteogenic differentiationof hAECs, but weak, insignificant osteogenic differentia-tion of hAMSCs (Fig. 7). Neither hAECs nor hAMSCsshowed adipogenic or myogenic differentiation (notshown). Figure 7A and B displays the results of our os-teogenic assay. Cytochemical staining of ALP-positivecells in culture showed that hAECs were significantlymore responsive to osteogenic induction than hAMSCs.Still, broad disparity in osteogenic response betweenhAECs from different cases became apparent. hAECsfrom cases 1 and 2 exhibited significantly higher expres-sion of ALP than hAECs from cases 3 and 4 (p < 0.05)(Fig. 7A, B). In the two strong responders, cases 1 and2, the proportions of ALP-positive cells were 53% and

63%, respectively. hAMSCs from all four cases showedweak insignificant osteogenic differentiation. Less than10% of cultured hAMSCs stained positive for ALP, andthese numbers were not significantly different from con-trols.

DISCUSSION

Isolation of hAECs from term human amnion has be-come an increasingly popular road for acquisition of pu-tative stem cells for allotransplantation. Another road,far less traveled, is isolation of hAMSCs from the col-lagenous stroma of amnion. We studied the shared anddistinct properties of cultured hAMSCs and hAECs from27 term placentas regarding their expansion and stem-ness profile.

We found that outgrowth of hAMSCs is more reli-able and morphologically more stable than hAECs. Bothamnion cell types showed slow proliferation in cultureand were not clonogenic, as expected by their lack ofTERT (Fig. 6A). Lower initial yields of hAMSCs thanhAECs (Fig. 3A) was found compensated during expan-sion by better replating efficiency of hAMSCs. Stablyoutgrowing hAMSCs were obtained from all 27 amnioncases. By contrast, in a third of amnion cases, hAECculture was not successful because seeded cells did notattach. Although we formally cannot exclude technicalproblems upon isolation, our experience with amnioncell culture over many years led us to propose that “nooutgrowth” behavior was for intrinsic biological reasons.The failure of some hAEC isolates to attach in vitroraises a potential concern also for direct transplantationapplications as cells might also fail to engraft in vivo,but this remains to be investigated.

Cell therapy in a clinical setting will require cell

COMPARATIVE CHARACTERIZATION OF CULTURED AMNION CELLS 9

Figure 5. Phenotype of primary (passage 0) and secondary (passage 1) hAECs and hAMSCs. The profiles represent systematicscreening of eight amnion cases. Cells were tested for indicated mesenchymal stem cells, embryonic stem cells, and hematopoieticmarkers. (A) Representative FACS histograms of primary hAECs and hAMSCs. (B) Screen of primary cultured (P0) hAECs andhAMSCs. Cells were positive for CD44, CD49e, CD73, CD90, CD105, CD166, STRO-1, SSEA-3, and SSEA-4, and negative forhematopoetic markers CD34 and CD45. (C) Screen of passage 1 hAECs and hAMSCs. Marker expression profiles did not signifi-cantly change from passage 0 to passage 1, except that of embryonic marker SSEA-4 on hAMSCs. *p < 0.05. (D) FACS monitoringof SSEA-4 during subculture of hAECs and hAMSCs over four passages revealed gradual decrease of cell numbers positive forSSEA-4. This analysis was performed for a single amnion case. P, passage.

10 BILIC ET AL.

Figure 5. Continued.

numbers in the several hundred million range, ratherthan a few million (8,11,25). Calculations from culturedata by us (Fig. 3A) and others (1) showed that subculti-vation over several months will be necessary to accom-plish several hundred millions of hAECs and hAMSCsfrom a single amnion. However, long-term cell cultureis tedious, costly, and impractical in clinics. Further, wecaution about the utility of amnion cell products fromlong-term culture. As documented in this study (Fig.3B), subcultured hAECs undergo profound alterationfrom epithelial to mesenchymal cell morphology; it wasalso observed by others that cultured hAECs formedmultinucleated giant cells (14). Thus, we propose thatcell harvest at early passage 1 may be optimal, becauseat this stage of culture the initial phenotype and mor-phology of hAECs and hAMSCs is retained, which wediscuss below (Fig. 3).

Our definition of primary cultures from eight amnioncases by flow cytometry revealed a very consistent phe-notype for each amnion cell type (Fig. 5A, C). Althoughgreatly different by cell morphology and organization,hAECs and hAMSCs exhibited remarkably similar sig-nature regarding expression of surface antigens definingmesenchymal stromal cells such as CD73, CD90,CD105, CD166 (5,10), and concomitant lack of hemato-poietic markers CD34 and CD45 and the immunologicmarker HLA-DR (MHC-II). The lower levels of HLA-ABC (MHC-I) on hAECs pointed to potential superiorimmunoprotection. Comparative profiling of culturesdemonstrated that phenotypes of both amnion cell typeswere grossly maintained between passage 0 and passage1 (Fig. 5B, C). Further, neither staining for vimentin norcytokeratin 18 expression were found specific forhAMSC and hAEC type in culture, respectively. Therelation between these two amnion cell types in vivo(e.g., if hAMSCs may derive from hAECs) is not clear.Transmission electron microscopic studies of hAMSC

ultrastructure suggested an epithelial–mesenchymal hy-brid phenotype (21), and in this study, we found thathAECs gradually assume mesenchymal features duringsubculture (Fig. 3B). Molecular discrimination at leastof cultured amnion cells will be possible in the future:during the preparation of this manuscript, Wolbank etal. published that CD49d (α4 integrin) is selectively ex-pressed on cultured hAMSCs, but not on hAECs (30).

The search for stem cells in term human amnion invivo had suggested that hAECs, but not hAMSCs, ex-press markers of pluripotency (15). Studies of isolated,cultured hAECs indicated that some cells in the popula-tion retain stem cell characteristics when allowed togrow in clustered structures, whereas they seem to loosetheir stem cell antigens when grown as “basal layer” di-rectly attached to the culture dish (14). By these terms, theadherent monolayer cultures in our study represent such“basal layer.” Our data indicate that cultured hAMSCsalso express markers of undifferentiated cells. Flow cy-tometry showed primary and secondary cultures of bothamnion cell types positive for SSEA-3, SSEA-4, andSTRO-1 in every tested amnion case (Fig. 5A, B). Im-munocytochemistry confirmed the SSEA-4 epitope onhAECs as well as hAMSCs, but only in two out of fiveamnion cases (Fig. 6B), whereas the signal was beyondimmunocytochemical detection in three cases. Highersensitivity of flow cytometry versus immunocytochem-istry is a possible explanation for this discrepancy. Like-wise, Oct-3/4 transcripts were detected in every hAECand hAMSC primary and secondary culture tested (Fig.6A), but by immunocytochemistry, Oct-3/4 protein wasfound only in hAECs, and only in part of the amnioncases. Possibly, cultured hAECs from different casescontained hAECs at distinct state of differentiation. Atthis point, it remains unclear whether Oct-3/4 proteinexists in cultured hAMSCs. We believe that caution isnecessary to interpret the presence of gene transcripts

COMPARATIVE CHARACTERIZATION OF CULTURED AMNION CELLS 11

Figure 6. Immunoytochemistry and RT-PCR analysis of stem cell marker expression on amnion cells. (A) RT-PCR analysis forOct-3/4, SCF, and TERT transcripts in passage 0 and passage 1 amnion cells from eight amnion cases. All cultures showedtranscripts of Oct-3/4 and SCF, but not of TERT. The human TGCT cell line 2102 EP served as positive control. (B) Representativefluorescence micrographs of primary hAECs and hAMSCs that were stained with antibodies specific for Oct-3/4, SSEA-4, orCD90; nuclei were counterstained with DAPI. Five amnion cases were tested. Immunocytochemistry confirmed SSEA-4 and CD90on hAECs as well as hAMSCs. Only hAECs were found positive for Oct-3/4. Of note, only two of five amnion cases stainedpositive for SSEA-4 and Oct-3/4, indicating inherent heterogeneity among amnion cases as described in the Results section. Scalebar: 25 µm.

12 BILIC ET AL.

Figure 7. Side-by-side comparison of hAECs versus hAMSCs for ability to undergo osteogenic differentiation. Four cases wereexamined. Cells were kept in osteogenic induction medium (+) or maintained without induction in standard medium (−). (A)Osteogenic differentiation was visualized by colorimetric detection of ALP expression. (B) Percentage of ALP-positive cells tototal number of cells in culture. In three cases, hAECs were significantly more responsive to osteogenic induction than theirmesenchymal counterparts. Also, broad biological disparity between amnion cases regarding plasticity became evident. hAMSCsfrom all four cases showed weak, insignificant differentiation. *p < 0.05. Scale bars: 100 µm.

COMPARATIVE CHARACTERIZATION OF CULTURED AMNION CELLS 13

for prediction of stemness. By the criteria of Oct-3/4expression, the epithelial population appears to be lessdifferentiated compared to the mesenchymal population.

Our studies of stemness in functional differentiationassays suggest limited plasticity of amnion cell isolates,at least under in vitro induction conditions. Our testsfor osteogenic, adipogenic, and myogenic differentiationonly showed osteogenic differentiation, which we foundstrong and significant in hAECs but weak and insignifi-cant in the corresponding hAMSCs (Fig. 7). Of furthernote, our test with four amnion cases also points to greatdisparity between hAECs from different cases regardingplasticity. Together, while both hAECs and hAMSCsexhibit very similar surface profiles of mesenchymalprogenitor, based on our in vitro data, hAECs appear topossess much stronger mesodermal differentiation ca-pacity than hAMSCs. In fact, our study could not pro-vide any evidence of significant functional stemness ofhAMSCs.

In conclusion, it remains to be resolved whether end-differentiated, functional cells can be produced fromboth types of amnion cells in vitro or directly in vivo. Acentral point for clarification will be whether controlleddifferentiation can be accomplished and be scaled up toa clinically relevant level.

ACKNOWLEDGMENTS: We acknowledge following fundingsources: G. Bilic is supported by a Swiss National ScienceFoundation grant 31000-108270 to A.H.Z. and R.Z.; S. Zeis-berger is supported by the European Commission FP6-project“CRYSTAL, Cryopreservation of stem cells for human thera-peutic application” to A.H.Z. and R.Z.; A. S. Mallik is sup-ported by the European Commission FP6-project grant “Eu-roSTEC; European program for soft tissue engineering forchildren with birth defects” to A.H.Z. and R.Z.; and a Ph.D.stipend of the Zurich Centre for Integrative Human Physiol-ogy. We thank Esther Kleiner for technical assistance.

REFERENCES

1. Alviano, F.; Fossati, V.; Marchionni, C.; Arpinati, M.;Bonsi, L.; Franchina, M.; Lanzoni, G.; Cantoni, S.; Caval-lini, C.; Bianchi, F.; Tazzari, P. L.; Pasquinelli, G.; Foroni,L.; Ventura, C.; Grossi, A.; Bagnara, G. P. Term Amnioticmembrane is a high throughput source for multipotentmesenchymal stem cells with the ability to differentiateinto endothelial cells in vitro. BMC Dev. Biol. 7:11; 2007.

2. Bailo, M.; Soncini, M.; Vertua, E.; Signoroni, P. B.;Sanzone, S.; Lombardi, G.; Arienti, D.; Calamani, F.;Zatti, D.; Paul, P.; Albertini, A.; Zorzi, F.; Cavagnini, A.;Candotti, F.; Wengler, G. S.; Parolini, O. Engraftment po-tential of human amnion and chorion cells derived fromterm placenta. Transplantation 78(10):1439–1448; 2004.

3. Bilic, G.; Hall, H.; Bittermann, A. G.; Zammeretti, P.;Burkhart, T.; Ochsenbein-Kolble, N.; Zimmermann, R.Human preterm amnion cells cultured in 3-dimensionalcollagen I and fibrin matrices for tissue engineering pur-poses. Am. J. Obstet. Gynecol. 193(5):1724–1732; 2005.

4. Bilic, G.; Ochsenbein-Kolble, N.; Hall, H.; Huch, R.;Zimmermann, R. In vitro lesion repair by human amnion

epithelial and mesenchymal cells. Am. J. Obstet. Gynecol.190(1):87–92; 2004.

5. Dominici, M.; Le Blanc, K.; Mueller, I.; Slaper-Corten-bach, I.; Marini, F.; Krause, D.; Deans, R.; Keating, A.;Prockop, D.; Horwitz, E. Minimal criteria for definingmultipotent mesenchymal stromal cells. The InternationalSociety for Cellular Therapy position statement. Cytother-apy 8(4):315–317; 2006.

6. Freshney, R. I. Primary culture. In: Freshney, R. I., ed.Culture of animal cells, 5th ed. Hoboken, NJ: John Wiley& Sons, Inc.; 2005:175–197.

7. Fuchs, E.; Segre, J. A. Stem cells: A new lease on life.Cell 100(1):143–155; 2000.

8. Hodges, H.; Pollock, K.; Stroemer, P.; Patel, S.; Steva-nato, L.; Reuter, I.; Sinden, J. Making stem cell lines suit-able for transplantation. Cell Transplant. 16(2):101–115;2007.

9. In’t Anker, P. S.; Scherjon, S. A.; Kleijburg-van der Keur,C.; de Groot-Swings, G. M.; Claas, F. H.; Fibbe, W. E.;Kanhai, H. H. Isolation of mesenchymal stem cells of fetalor maternal origin from human placenta. Stem Cells 22(7):1338–1345; 2004.

10. Keating, A. Mesenchymal stromal cells. Curr. Opin. Hem-atol. 13(6):419–425; 2006.

11. Kobayashi, N. Cell therapy for diabetes mellitus. CellTransplant. 15(10):849–854; 2006.

12. Malak, T. M.; Bell, S. C. Structural characteristics of termhuman fetal membranes: A novel zone of extreme mor-phological alteration within the rupture site. Br. J. Obstet.Gynaecol. 101(5):375–386; 1994.

13. McLaren, J.; Malak, T. M.; Bell, S. C. Structural charac-teristics of term human fetal membranes prior to labour:Identification of an area of altered morphology overlyingthe cervix. Hum. Reprod. 14(1):237–241; 1999.

14. Miki, T.; Lehmann, T.; Cai, H.; Stolz, D. B.; Strom, S. C.Stem cell characteristics of amniotic epithelial cells. StemCells 23(10):1549–1559; 2005.

15. Miki, T.; Mitamura, K.; Ross, M. A.; Stolz, D. B.; Strom,S. C. Identification of stem cell marker-positive cells byimmunofluorescence in term human amnion. J. Reprod.Immunol. 75(2):91–96; 2007.

16. Miki, T.; Strom, S. C. Amnion-derived pluripotent/multi-potent stem cells. Stem Cell Rev. 2(2):133–142; 2006.

17. Niwa, H.; Masui, S.; Chambers, I.; Smith, A. G.; Miya-zaki, J. Phenotypic complementation establishes require-ments for specific POU domain and generic transactiva-tion function of Oct-3/4 in embryonic stem cells. Mol.Cell. Biol. 22(5):1526–1536; 2002.

18. Noguchi, H.; Xu, G.; Matsumoto, S.; Kaneto, H.; Kobay-ashi, N.; Bonner-Weir, S.; Hayashi, S. Induction of pan-creatic stem/progenitor cells into insulin-producing cellsby adenoviral-mediated gene transfer technology. CellTransplant. 15(10):929–938; 2006.

19. Ochsenbein-Kolble, N.; Bilic, G.; Hall, H.; Huch, R.;Zimmermann, R. Inducing proliferation of human amnionepithelial and mesenchymal cells for prospective engineer-ing of membrane repair. J. Perinat. Med. 31(4):287–294;2003.

20. Parry, S.; Strauss, 3rd, J. F. Premature rupture of the fetalmembranes. N. Engl. J. Med. 338(10):663–670; 1998.

21. Pasquinelli, G.; Tazzari, P.; Ricci, F.; Vaselli, C.; Buzzi,M.; Conte, R.; Orrico, C.; Foroni, L.; Stella, A.; Alviano,F.; Bagnara, G. P.; Lucarelli, E. Ultrastructural character-istics of human mesenchymal stromal (stem) cells derived

14 BILIC ET AL.

from bone marrow and term placenta. Ultrastruct. Pathol.31(1):23–31; 2007.

22. Portmann-Lanz, C. B.; Schoeberlein, A.; Huber, A.;Sager, R.; Malek, A.; Holzgreve, W.; Surbek, D. V. Pla-cental mesenchymal stem cells as potential autologousgraft for pre- and perinatal neuroregeneration. Am. J.Obstet. Gynecol. 194(3):664–673; 2006.

23. Sakuragawa, N.; Kakinuma, K.; Kikuchi, A.; Okano, H.;Uchida, S.; Kamo, I.; Kobayashi, M.; Yokoyama, Y. Hu-man amnion mesenchyme cells express phenotypes ofneuroglial progenitor cells. J. Neurosci. Res. 78(2):208–214; 2004.

24. Stenn, K. S.; Link, R.; Moellmann, G.; Madri, J.; Kuklin-ska, E. Dispase, a neutral protease from Bacillus poly-myxa, is a powerful fibronectinase and type IV collagen-ase. J. Invest. Dermatol. 93(2):287–290; 1989.

25. Stute, N.; Holtz, K.; Bubenheim, M.; Lange, C.; Blake,F.; Zander, A. R. Autologous serum for isolation andexpansion of human mesenchymal stem cells for clinicaluse. Exp. Hematol. 32(12):1212–1225; 2004.

26. Takahashi, K.; Igura, K.; Zhang, X.; Mitsuru, A.; Taka-hashi, T. A. Effects of osteogenic induction on mesenchy-mal cells from fetal and maternal parts of human placenta.Cell Transplant. 13(4):337–341; 2004.

27. Takahashi, S.; Ohsugi, K.; Yamamoto, T.; Shiomi, M.;Sakuragawa, N. A novel approach to ex vivo gene therapyfor familial hypercholesterolemia using human amnioticepithelial cells as a transgene carrier. Tohoku J. Exp. Med.193(4):279–292; 2001.

28. Takashima, S.; Ise, H.; Zhao, P.; Akaike, T.; Nikaido, T.Human amniotic epithelial cells possess hepatocyte-likecharacteristics and functions. Cell Struct. Funct. 29(3):73–84; 2004.

29. Wei, J. P.; Zhang, T. S.; Kawa, S.; Aizawa, T.; Ota, M.;Akaike, T.; Kato, K.; Konishi, I.; Nikaido, T. Human am-nion-isolated cells normalize blood glucose in streptozo-tocin-induced diabetic mice. Cell Transplant. 12(5):545–552; 2003.

30. Wolbank, S.; Peterbauer, A.; Fahrner, M.; Hennerbichler,S.; van Griensven, M.; Stadler, G.; Redl, H.; Gabriel, C.Dose-dependent immunomodulatory effect of human stemcells from amniotic membrane: A comparison with humanmesenchymal stem cells from adipose tissue. Tissue Eng.13(6):1173–1183; 2007.

31. Zhao, P.; Ise, H.; Hongo, M.; Ota, M.; Konishi, I.; Nikaido,T. Human amniotic mesenchymal cells have some charac-teristics of cardiomyocytes. Transplantation 79(5):528–535; 2005.