time-sensitive effects of hypoxia on differentiation of neural stem cells derived from mouse...

Original Research Paper

Time-sensitive effects of hypoxia ondifferentiation of neural stem cells derivedfrom mouse embryonic stem cells in vitro

Nguyen Huy Binh1, Hitomi Aoki2, Manabu Takamatsu1, Yuichiro Hatano1,Akihiro Hirata1,3, Hiroyuki Tomita1, Akira Hara1

1Department of Tumor Pathology, Gifu University Graduate School of Medicine, Japan, 2Department of Tissueand Organ Development, Gifu University Graduate School of Medicine, Japan, 3Division of Animal Experiment,Life Science Research Center, Gifu University, Japan

Objectives: Oxygen tension is an important component of microenvironment for the differentiation ofembryonic stem cells including neural lineage. However, the comprehensive influence of hypoxia on neuraldifferentiation during embryonic neural development has not yet been examined.Methods: In this study, we investigated the effect of low oxygen levels (5% O2), or hypoxia, in two stages ofneural differentiation in vitro: (1) inducing mouse embryonic stem cells into neural stem cells (NSCs); andthen (2) inducing NSCs into neural progenitor cells in neurospheres.Results: In the first stage, NSCs generation was reduced under hypoxia. Less mature morphologicalchanges (including neural marker) of NSCs were observed, suggesting the prevention of earlydifferentiation under hypoxic conditions. Thus undifferentiated stem cells were maintained in this stage.However, in the second stage, hypoxia induced neural differentiation in neurospheres. Nevertheless, non-neural progenitor cell formation, such as mesoderm progenitor cell lines or epithelial cell lines, wasrestricted by low oxygen tension.Discussions: Our results demonstrate that hypoxia is essential for regulating neural differentiation and showthe different effects on NSC differentiation dependent on the time-course of NSC development. In the earlystage of NSCs induction, hypoxia inhibits neural differentiation and maintains the undifferentiated state; inthe later stage of NSCs induction, hypoxia induces neural differentiation. Our study may contribute to thedevelopment of new insights for expansion and control of neural differentiation.

Keywords: Embryonic stem cells, Neural stem cells, Neural progenitor cells, Hypoxia, Neuronal development

IntroductionIn aerobic organisms, oxygen regulates various intra-

cellular pathways involved in cellular metabolism,

proliferation, survival, and fate, so that it is a critical

factor in tissue and organ morphogenesis during

mammalian embryonic development and throughout

post-natal life.1 Oxygen plays an important role in

regulating the growth and differentiation state of

neural stem cells (NSCs) in the developing embryo

stage of the mammalian central nervous system.1,2

Neural stem cells, which are multipotent precursor cells

that reside in specialized regions of the fetus, have long

life, self-renewable, and generate neurons, astrocytes,

and oligodendrocytes.3 This makes them attractive

entities for study to gain a better understanding of the

effects of oxygen levels on embryonic neural develop-

ment, as well as for possible therapeutic applications.

It is known that, in the early stage of embryonic

development, mammalian blastocysts are exposed to a

low concentration of O2 ranging from 1.5 to 5.3% in

the reproductive tract.4–6 Several studies have revealed

that hypoxia might profoundly influence stem cells

microenvironment and can promote the differentia-

tion of certain types of stem or progenitor cells, while

inhibiting the differentiation of others.7 Thus hypoxia

may be regarded as driving the regulation of stem/

progenitor cell differentiation, especially the regula-

tion of neural differentiation. In vivo, neural differ-

entiation during embryonic development includes two

stages: early stage and later stage of NSCs induction.

In the early stage of NSCs induction, the first NSCs to

arise are primitive NSCs, which can be isolated from

the anterior embryo from embryonic day E5.5 epiblast

until E8.5 neuroectoderm. In the later stage of NSCs

Correspondence to: Akira Hara, Department of Tumor Pathology, GifuUniversity Graduate School of Medicine, Yanagido 1-1, Gifu City, Gifu501-1194, Japan. Email: [email protected]

804� W. S. Maney & Son Ltd 2014DOI 10.1179/1743132814Y.0000000338 Neurological Research 2014 VOL. 36 NO. 9

induction, the transition of primitive NSCs to defini-

tive NSCs in the embryo at approximately E8.5 occurs

and definitive NSCs are present in the brain through-

out the life of the organism.8 In the early stage of neural

induction from embryonic stem cells, the transcription

of stem cell pluripotency genes such as Pou5f1 (Oct4),

Nanog, and Sox2 is not completely suppressed and

researchers have reported that NSCs are less likely to

be generated in low oxygen conditions.9,10 Fur-

thermore, during the later stages of neural induction,

low oxygen tension may activate molecular pathways

that regulate Wnt/beta-catenin, Oct4, and Notch

signaling and exert a positive effect on neural differen-

tiation of ES cells, resulting in a faster commitment

toward neural progenitors.1 Consequently, under-

standing the effects of hypoxia during neural commit-

ment is important for scientific and therapeutic

purposes and may provide new insights into ES cell

proliferation and differentiation. However, studies on

the influence of hypoxia in the early and later stages of

differentiation of NSC derived from ES cells have not

been conducted.

In this study, we demonstrate that hypoxia is

essential for regulating neural differentiation and that

hypoxia has various effects on the NSC differentiation

dependent on the time-course of NSC development.

We expect essential findings for the improvement of

current therapeutic strategies for the differentiation of

NSCs.

Materials and MethodsLow-oxygen cultureIn the normoxic condition, mouse embryonic stem

(mES) cells and neurospheres were placed in a 37uCincubator supplemented with 20% O2 and 5% CO2. In

the hypoxic condition, 5% O2, 5% CO2, and N2 gas

were mixed using compressed air and supplied into a

sealed container with a small outtake valve placed

inside a 37uC incubator (Wakenyaku CO2 incubator

9000E series, Kyoto, Japan).

ES cell cultureGreen fluorescent protein (GFP)-expressing ES cells11

were maintained on gelatin-coated dishes in Dulbecco’s

modified Eagle’s medium (DMEM, Invitrogen, CA,

USA) supplemented with 10% Hyclone Fetal Bovine

Serum (Thermo Scientific, Massachusetts, USA),

1024 M 2-mercaptoethanol, non-essential amino acid

solution (Invitrogen, California, USA), and human

leukemia inhibitory factor (LIF, 20 ng/ml ESGROH,

Millipore, Massachusetts, USA).

For differentiation, 2000 trypsinized mES cells

were placed in six-well plates seeded with mitomycin-

C treated mouse embryonic fibroblasts PA6 cells in

advance and differentiated in a minimal essential

medium (alphaMEM, Invitrogen, California, USA)

supplemented with 10% fetal calf serum (FBS,

Thermo Scientific, USA). Unless otherwise men-

tioned, 20 pM fibroblast growth factor (FGF),

10 pM cholera toxin, and 100 nM dexamethasone

were added from days 0 to 6, days 0 to 3, and days 3

to 6 of the culture, respectively. The medium was

changed twice per week.

Induction of neurospheresTo induce neurospheres, after washing the dish with

phosphate-buffered saline (PBS, Invitrogen, CA,

USA) to remove floating cells in the medium, only

differentiated mES colonies on PA6 were treated with

0.2% trypsin and dissociated into single cells and then

transferred to a growth medium in culture flasks

(Nunclon, Thermo Scientific) at a concentration of

150 000 cells/ml. The detached mES colonies were

mechanically dissociated in serum-free medium con-

sisting of DMEM and F-12 nutrient (1:1, Invitrogen,

La Jolla, CA, USA). The cells were grown in growth

medium (DMEM) and F-12 nutrient, epidermal

growth factor (EGF), FGF (20 ng/ml each; R&D

Systems, Minneapolis, MN, USA), and 2% B27H

supplement (Invitrogen, CA, USA). Half of the

medium was replaced every 2 days with fresh medium

containing the same concentrations of growth factors.

Analysis of neural differentiation in early stage(experiment-1) and later stage (experiment-2) ofNSCs induction under hypoxiaExperiment-1: Undifferentiated mES cells were co-

cultured with PA6 stromal cells for 6 days to induce

NSCs. In the normoxia group, mES was incubated in

20% oxygen from days 0 to 6. In the hypoxia group,

mES cells were incubated in 20% oxygen from days 0

to 1, then incubated in 5% oxygen from days 1 to 6.1,12

An outline of the experiment-1 is shown in Fig. 1A.

Experiment-2: undifferentiated mES cells were co-

cultured with PA6 stromal cells for 6 days to induce

NSCs. Then these cells were enzymatically digested

into single cells and transferred to a growth medium

with EGF, FGF, and B27 supplement in culture

flasks for 6 days to induce neurospheres containing

NSCs and neural progenitor cells. In the normoxia

group, neurospheres were incubated in 20% oxygen

from days 0 to 12. In the hypoxia group, neuro-

spheres were incubated in 20% oxygen from days 0 to

7, then incubated in 5% oxygen from days 7 to 12.1,12

An outline of the experiment-2 is shown in Fig. 1B.

Immunocytochemistry for NSCs in six-well plates(for experiment-1)Cells grown on six-well plates were fixed with 4%

paraformaldehyde (4% PFA) for 20 minutes, then

washed in 0.01 M PBS and incubated in blocking

solution (2% bovine serum albumin – 2% BSA) for

30 minutes. The cells were incubated with anti-Tuj-1

(mouse IgG, 1:1000, Covance, Princeton, NJ, USA)

in 2% BSA/PBS overnight at 4uC. The secondary

Binh et al. Time-sensitive effects of hypoxia on stem cells

Neurological Research 2014 VOL. 36 NO. 9 805

antibody Alexa Fluor 568 (red) goat anti-mouse IgG

(1:1,000, Invitrogen, Eugene, OR, USA) was used to

visualize the signal for 60 minutes at room temperature.

After washing with PBS, the cell nuclei were stained

with 49,6-diamino-2-phenylindole (DAPI, 1:1000,

Wako Pure Chemical, Osaka, Japan) for 5 minutes at

room temperature.

Immunohistochemistry for NSCs in neurospheres(for experiment-2)Neurospheres were collected and fixed overnight in 10%

phosphate-buffered formalin (pH 7.0), embedded in

paraffin, and then sectioned. The deparaffinized sec-

tions were blocked to endogenous peroxidase activity

by incubation in distilled water containing 3% hydrogen

peroxide for 5 minutes. Antigen retrieval was per-

formed using 0.01 M citrate buffer (pH 6.0) by the

Pascal heat-induced target retrieval system (DAKO,

Glostrup, Denmark). Non-specific binding sites were

blocked in 0.01 M PBS containing 2% BSA (Wako

Pure Chemical, Osaka, Japan) for 60 minutes.

Anti-Desmin (mouse IgG, 1:100; DAKO, Glostrup,

Denmark), anti-Cytokeratin AE1/3 (mouse IgG, 1:100;

DAKO, Glostrup, Denmark), anti-Ki-67 (rat IgG,

clone TEC-3, 1:100, DAKO, Glostrup, Denmark),

and anti-hypoxia-inducible factor-1alpha (anti-HIF-

1alpha) (mouse IgG, 1:500; Millipore, Massachusetts,

USA) in 2% BSA/PBS were added to the slides and

incubated overnight at 4uC. Primary antibodies were

detected with biotinylated anti-mouse IgG (Elite

PK 6102 Mouse IgG Vestastain ABC kit Vector

Laboratories, Burlingame, CA, USA) and biotinylated

anti-rat IgG (1:200, DAKO, Glostrup, Denmark) for

30 minutes, respectively, followed by incubation with

avidin-coupled peroxidase (Vectastain ABC kit, Vector

Laboratories, Burlingame, CA, USA) for 30 minutes.

The peroxidase binding sites were detected by staining

with 3,39-diaminobenzidine (DAB) in 50 mM Tris–

EDTA buffer (pH 7.6). Finally, counterstaining was

performed using Mayer’s hematoxylin. For negative

controls, the primary antibody was substituted with

Figure 1 (A) Experiment-1: undifferentiated mouse embryonic stem (mES) cells were co-cultured with PA6 stromal cells for

6 days to induce neural stem cells (NSCs). Normoxia group: from days 0 to 6, incubated in 20% O2 Hypoxia group: from days 0

to 1, incubated in 20% O2; from days 1 to 6, incubated in 5% O2. (B) Experiment-2: undifferentiated mES cells were co-cultured

with PA6 stromal cells for 6 days to induce NSCs. Then these cells were enzymatically digested into single cells and transferred

to a growth medium with fibroblast growth factor (FGF), epidermal growth factor (EGF), and B27 supplement in culture flasks

for 6 days to induce neurospheres containing NSCs and neural progenitor cells. Normoxia group: from days 0 to 12, incubated

in 20% O2. Hypoxia group: from days 0 to 7, incubated in 20% O2; from days 7 to 12, incubated in 5% O2.


806 Neurological Research 2014 VOL. 36 NO. 9

http://www.maneyonline.com/action/showImage?doi=10.1179/1743132814Y.0000000338&iName=master.img-000.jpg&w=472&h=354

the buffer (PBS) or with non-immune immunoglo-

bulin G.

Immunofluorescence chemistry for NSCs inneurospheres (for experiment-2)The first antibodies, anti-Nestin (rabbit IgG, 1:200;

Immuno-Biological Laboratory, Gunma, Japan), anti-

microtubule associated protein-2 (anti-MAP2) (mouse

IgG, 1:500; Sigma-Aldrich, St. Louis, MO, USA), and

anti-glial fibrillary acidic protein (anti-GFAP) (rabbit

IgG, 1:500; DAKO, Glostrup, Denmark) in 2% BSA/

PBS were added to the slides and incubated overnight

at 4uC. The second antibodies, Alexa Fluor 568 (red)

goat anti-mouse IgG (1:1,000, Invitrogen, Eugene,

OR, USA) and Alexa Fluor 488 (green) goat anti-

rabbit IgG (1:1,000, Invitrogen, Eugene, OR, USA)

were used to visualize the signal for 60 minutes at

room temperature. After washing with PBS, the cell

nuclei were stained with 4,6-diamino-2-phenylindole

(DAPI, 1:1,000, Wako Pure Chemical, Osaka, Japan)

for 5 minutes at room temperature.

Cell counts and statistical analysisPhotographs for immunohistochemistry staining were

taken under a microscope with a high-resolution digital

camera (Olympus, Tokyo, Japan). Fluorescence was

also photographed under a fluorescence microscope

with a high-resolution digital camera (Olympus,

Tokyo, Japan). The number of immunoreactive cells

in five visual fields (50–100 cells per field) in each

sample was counted in a randomized fashion. All

results are expressed as mean¡standard error (SE).

Reverse Transcription Polymerase ChainReaction (RT-PCR)Total RNA was extracted from cells using the RNeasy

Mini kit (Qiagen, Valencia, CA, USA). Total RNA

(0.5 mg each) was reverse transcribed using Superscript

III Reverse Transcriptase (Invitrogen, Carlsbad, CA,

USA). Quantitative real-time PCR was carried out

with the Thermal Cycler Dice Real Time System Single

(Takara, Kyoto, Japan) using the SYBR Green

(Takara, Kyoto, Japan) method. The primers were

as follows:

MAP2 (ATGACAGGCAAGTCGGTGAAG and

TTGAGTCCACTGGTCGAGGTT)

GFAP (CGGAGACGCATCACCTCTG and TG-

GAGGAGTCATTCGAGACAA)

Nestin (GTGCCTCTGGATGATG and TTGAC-

CTTCCTCCCCCTC)

Oct4 (ACCAGTTGCCATTGGTGGAAA and C-

ATGAGGAGAGTCCGGTACTT)

HIF-1alpha (GTCCCAGCTACGAAGTTACAG-

C and CAGTGCAGGATACACAAGGTTT)

Beta-actin (ATGGAGCCACCGATCCACA and

CATCCGTAAAGACCTCTATGCCAAC)

For evaluation of gene expression, beta-actin was

used as internal control.

ResultsThe hypoxic condition inhibited generation ofNSC from mES cells co-cultured with PA6To investigate the effect of hypoxia on generation of

NSCs from mES cells, we incubated mES cells co-

cultured with PA6 for 5 days under the hypoxic or

normoxic condition (Fig. 1A). This culture technique

is known as an efficient method for induction of

NSCs from mES cells under the normoxic condition.6

Morphological differences of the outgrowth cells

were easily recognizable between the two conditions

as prominent neurite outgrowth emerging from the

colonies was observed in the normoxic culture

whereas less frequent neurite outgrowth was seen in

the hypoxic culture (Fig. 2D and E).

Neurite outgrowths from NSC colonies on PA6

feeder were assessed by the immunocytochemical

method. Tuj-1 (early NSC marker) positive cells

appeared prominently in normoxic cell culture, while

a limited number of Tuj-1-positive cells were

observed in hypoxic cell culture (Fig. 2C). The results

from RT-PCR (Fig. 3) showed the expressions of

Nestin (NSC marker) were most remarkable in

normoxic culture and suppressed in a hypoxic culture

(P , 0.001). These results suggested that hypoxia

inhibited the generation of NSCs from mES cells.

Hypoxic condition promoted the generation ofneural progenitor cells from NSCs contained inneurospheresNext, to determine the effect of hypoxia on genera-

tion of neural progenitor cells from NSCs in neuro-

spheres, we generated neurospheres composed of

free-floating clusters of NSCs supplied with EGF,

FGF, and B27 in hypoxic or normoxic conditions

(Fig. 1B). This culture technique is known as an

efficient method for induction of neural progenitor

cells from NSCs.13 Immunohistochemical staining

examinations showed that neurospheres in hypoxic

culture were composed of more MAP2 (neural

progenitor cells marker) positive cells and GFAP

(glial progenitor cells marker) positive cells as com-

pared with those in normoxic culture (Fig. 4A, B, D,

and E). The frequencies of MAP2-positive cells in

hypoxic culture and normoxic culture were approxi-

mately 28.6 and 15.2%, respectively (Fig. 4C).

Similarly, the frequencies of GFAP-positive cells in

hypoxic culture and normoxic culture were approxi-

mately 7.4 and 3.2%, respectively (Fig. 4F). There

was a significant difference in the percentages of

GFAP and MAP2 expressing cells between the two

culture conditions (P , 0.05). In addition, over 50%

of the cells in the neurospheres in normoxic culture

were ki-67 (proliferating cell marker) positive,

whereas only about 20% positive cells were found in

hypoxic culture (Fig. 5A–C). Furthermore, Nestin

(primitive NSC marker) immunopositive cells



appeared frequently in normoxic culture but rarely in

hypoxic culture (Fig. 5D–F). The presence of many

cells positive for Ki-67 and Nestin means that the

primitive proliferating NSCs exist in neurospheres

under the hypoxic condition.

The mRNA expressions of MAP2, GFAP, Nestin,

and hypoxia-inducible factor-1alpha (HIF-1alpha)

were checked in days 8, 10, and 12 according to our

protocol for experiment-2 (Fig. 1B). In the neuro-

spheres, mRNA expressions of MAP2, GFAP, and

Nestin were found and the existence of neural

progenitor cells, glia progenitor cells, and NSCs in the

neurospheres was confirmed (Fig. 6A–C). The expres-

sion of GFAP and MAP2 increased during neurosphere

formation in both culture conditions. However, the

expression of GFAP and MAP2 was most remarkable

in hypoxic culture but was suppressed in normoxic

culture (P , 0.05) (Fig. 6A and B). Contrary to GFAP

and MAP2, we found the expression of Nestin was

maintained in normoxic culture and decreased in

hypoxic culture (Fig. 6C). After 5 days of culture in

the hypoxic condition, there was a significant difference

in Nestin expression between hypoxic culture and

normoxic culture (P , 0.01).

The time-course of HIF-1alpha up-regulationunder hypoxic stimulation and effects ongeneration of non-neural cell lines in theneurospheresTo follow the time-course of HIF-1alpha up-regula-

tion under hypoxic stimulation we used RT-PCR to

check the HIF-1alpha expression in days 8, 10, and

12 in both conditions (Fig. 6). Significantly higher

expression of HIF-1alpha was found at days 8, 10,

and 12 in hypoxic culture as compared with normoxic

culture (Fig. 6D). In particular, a much higher

Figure 3 RT-PCR was used for analyzing the expression of

Oct4 (maker for pluripotent mouse embryonic stem (mES))

and Nestin (marker for primitive NSCs) in day 6 (experiment-

1). The bar chart represents mean and standard error (SE).

NS not significant; *** P , 0.001.

Figure 2 Neural differentiation of mES cells co-cultured with PA6 was inhibited by hypoxia (experiment-1). (A, B) Tuj-1

immunofluorescence staining (early neural stem cells (NSCs) marker in red) was expressed in the outgrowth cells in two

cultures conditions. (C) Percentage of Tuj-1-positive cells in hypoxic and normoxic culture condition; there was a significantly

different between two culture conditions (P , 0.05). (D, E) Prominent neurite outgrowth emerging from the colonies was

observed in the normoxic culture, whereas less frequent neurite outgrowth was seen in the hypoxic culture. These results were

shown by the percentage of neurite-bearing cells and neurite length. The bar chart represents mean and SE. * P , 0.05; ** P ,

0.01; *** P , 0.001. Bar 5 100 mM.





expression of HIF-1alpha was observed at day 8. The

up-regulation of HIF-1alpha under hypoxic condi-

tion was confirmed by immunocytochemistry of

neurospheres shown in Fig. 8. It was clearly observed

that HIF-1alpha showed significantly strong expres-

sion in hypoxic culture condition (P , 0.001).

The expression of non-neural markers in neuro-

spheres was evaluated in both culture conditions.

Immunohistochemical analysis demonstrated that

frequencies of immunopositive cells for both Des-

min (marker of mesoderm progenitor cells) and

Cytokeratin AE1/AE3 (marker for cells of epithelial

origin including skin and hair progenitor cells)

decreased significantly in hypoxic culture (Fig. 7).

These results suggest that HIF-1alpha is more up-

regulated under hypoxia and may inhibit the expres-

sion of non-neural markers in neurospheres.

DiscussionThe present study addressed the effects of hypoxic

condition in two stages of neural differentiation

in vitro: (1) inducing mES cells into NSCs; and then

(2) inducing NSCs into neural progenitor cells in

neurospheres. It was found that (i) in the early stage

of NSC induction, hypoxia inhibited neural lineage

differentiation from mES cells; (ii) in the later stage of

NSC induction, hypoxia induced neural differentiation.

It is known that oxygen levels in developing tissue

are regulated, and thus it is no surprise that oxygen

levels have specific effects in neural differentiation in

vitro as well as in vivo.14 Other studies which have

manipulated the oxygen concentration in NSC

studies both in vitro and in vivo and their findings

suggest that a mild hypoxic microenvironment has an

important influence on stem cells because mammalian

blastocysts are exposed to a low concentration of

O2 ranging from 1.5 to 5.3% during embryonic

development.1,12 In most studies, hypoxia was con-

sidered to have driver-effects in regulating stem/

progenitor cell differentiation, especially in the regu-

lation of neural differentiation.1,15 However, there is

no comprehensive study on the influence of hypoxia

on this regulation for neural differentiation asso-

ciated with the time-course of embryonic neural

development, especially in the early stage and later

stage of NSC differentiation. In our study, we applied

5% of oxygen as the hypoxic condition for the

analysis of neural differentiation in vitro. Our study

confirmed that a hypoxic microenvironment is one of

the important regulators of neural stem/progenitor

differentiation in vitro.

Whether the hypoxic condition is required for

neural differentiation of mES cell-derived NSCs is

controversial.15 In the early stage of NSC induction,

Figure 4 Neurospheres were incubated for 5 days under hypoxic condition or normoxic condition (experiment-2). (A, B) MAP2

immunofluorescence staining (neural progenitor cells marker in red) and (D, E) GFAP immunofluorescence staining (glial

progenitor cells marker in green) were examined. (C, F) There were significantly different percentages of MAP2 and GFAP-

positive cells between two culture conditions. The bar chart represents mean and standard error (SE). * P , 0.05. Bar 5 100 mM.




our immunocytochemistry and morphological analy-

sis showed less Tuj-1- (early NSCs marker) positive

cells and less matured neural morphology (percentage

of neurite-bearing cells and the length of neurite) in

hypoxic condition compared with those in normoxic

condition. It has been shown that hypoxia inhibited

neural differentiation during the early stage of NSCs

induction. Gustafsson et al.16 found that hypoxia in

the early stage of NSC development blocked the

differentiation of myogenic satellite cells and primary

NSCs. In particular, NSCs were also reported to be

less generated from human parthenogenetic stem cells

at low oxygen tension in the early stage of NSC

development.9 A number of studies have shown that

culturing under hypoxic conditions prevents the

differentiation of human ES cell colonies and

maintains them in a fully pluripotent state.10 These

findings support our present study. Thus, hypoxia

during the early stage of NSCs induction probably

maintains pluripotency of ES cells and consequently

inhibits too early neural differentiation in develop-

ment of the fetal nervous system.

Next, our study also confirmed the effect of a

hypoxic microenvironment on regulating neural

stem/progenitor differentiation in the later stage of

NSC induction. We found that a hypoxic micro-

environment induced more neural progenitor cells

(MAP2 -positive cells) and glial progenitor cells

(GFAP-positive cells) but reduced the expression of

primitive NSC markers (Nestin) and non-neural

markers (Desmin and Cytokeratin AE1/3) in the

neurospheres. The Ki-67-positive-proliferating cells

in neurosphere were also reduced in the hypoxic

condition. Our observations regarding the effects of

hypoxia on neurospheres were opposite to those seen

in the early stage of NCS induction. Recent studies

have shown that more neural progenitor cells were

produced under the hypoxic conditions.17 Moreover,

the differentiation potential of human fetal neural

progenitor cells were also explored under lowered

oxygen levels.18 Studer et al. and Morrison et al.

reported that when oxygen was lowered to more

physiological levels (3% oxygen) there were marked

trophic and proliferative effects on neural precursors

and significantly changed developmental kinetics and

outcome as compared with traditional culture condi-

tions (20% oxygen).19,20 These findings about neural

differentiation of neural progenitor cells accord with

our result of neural differentiation in the later stage

of NSC induction under hypoxic conditions. In the

Figure 5 Expression of neural stem cells (NSC) markers in neurospheres were inhibited in hypoxic culture condition

(experiment-2). (A, B) Immunochemistry staining of Ki-67 (proliferating cell marker) and (D, E) immunofluorescence staining of

Nestin (primitive NSCs marker in green) were examined. (C, F) There were significantly different percentages of Ki-67 and

Nestin-positive cells between two culture conditions. The bar chart represents mean and standard error (SE). ** P , 0.01. Bar in

Ki-67 staining 5 100 mM; bar in Nestin staining 5 50 mM.




present study, the expression of mRNA showed that

MAP2 and GFAP up-regulated during neurosphere

formation in both culture conditions, but the expres-

sion of MAP2 and GFAP were significantly higher in

hypoxic culture than in normoxic culture (Fig. 6A

and B). Conversely, mRNA expression of NSC

marker such as Nestin decreased after 5 days of

hypoxia. These results suggest that a hypoxic micro-

environment promotes NSCs to neural and glial

progenitor cells and then differentiates them into

neurons and glia cells in the later stage of NSCs

induction.

Neural differentiation is a result of the sum of all

signals impinging on the cells and the biochemical

state of the cell.14 The potential mechanism of the

hypoxia on NSC differentiation remains to be

elucidated, but there are several studies showing that

HIF-1alpha stabilization under hypoxia is considered

to directly or indirectly regulate many genes, which

control neural differentiation. Clarke found that low

oxygen concentrations may be involved in neural

differentiation through different pathways in the

early stage of NSCs and later stage of NSCs.21

Consequently, the response of the ES cells and NSCs

to a hypoxic microenvironment at different times of

NSCs induction might cause different effects on

neural differentiation: (i) in the early stage of NSC

induction, hypoxia inhibits neural lineage differentia-

tion from mES cells and maintains undifferentiated

property; (ii) in the later stage of NSC induction,

hypoxia induces neural differentiation including

neural and glial lineages.

In the early stage of NSC differentiation,

Mazumdar showed that HIF-1alpha modulates

Wnt/beta-catenin signaling in hypoxic ES cells by

enhancing beta-catenin activation.22 Moreover, en-

hanced HIF-1alpha expression by hypoxia may affect

the transcription of stem cell pluripotency genes such

as Pou5f1 (Oct4), Nanog, and Sox2, and then prevent

neural differentiation.9 In the later stage of NCS

induction, low oxygen tension may activate molecu-

lar pathways that regulate Wnt/beta-catenin, Oct4,

and Notch signaling and exert a positive effect on

early differentiation of NSCs, resulting in a faster

commitment toward neural progenitors.1 In the later

stage of NSC induction of the present study, HIF-

1alpha expression up-regulated in hypoxic condition,

which was confirmed by RT-PCR in days 8, 10, and

12 (Fig. 6D) and immunocytochemistry staining

(Fig. 8), may induce proliferation and neural differ-

entiation of NSCs in neurospheres. Although grow-

ing neural progenitor cells under low oxygen

concentration depends on the culture conditions

and on the cell mode,15 our findings demonstrated

that hypoxia is essential for regulating neural

differentiation and its effects depend on the time-

course of NSCs differentiation. These results taken

together suggest that mild hypoxic microenvironment

Figure 6 RT-PCR was used for analyzing the expression of MAP2, GFAP, Nestin, and HIF-1alpha of in days 8, 10, and 12 in two

culture conditions (experiment-2). The chart represents mean and standard error (SE). * P , 0.05; ** P , 0.01; *** P , 0.001; NS

not significant.




might be an important factor in neural differentiation

outcome, especially in the later stage of NSCs

induction.1,12

In future, NSCs are promising candidates for use

as donor cells in transplantation therapy for repairing

tissue damage and replacing organs. However, NSCs

derived from pluripotent stem cells have long-life

multipotent ability and possess possible risk of tera-

toma formation when applied in cell replacement

therapies in the future. Some studies have identified

better protocols for generating neurons with lower

teratoma formation risk.23 Our study suggested that

Figure 8 Immunocytochemistry of HIF-1alpha in neurospheres in hypoxic and normoxic culture conditions (experiment-2). (A,

B) Immunocytochemistry staining of HIF-1alpha was examined. (C) There was significantly different percentages of HIF-1alpha-

positive cells between two culture conditions. The bar chart represents mean and standard error (SE). *** P , 0.001. Bar 5

100 mM.

Figure 7 Expression of non-neural markers in neurospheres was inhibited in hypoxic culture condition (experiment-2). (A, B)

Immunohistochemistry staining of Desmin (marker of mesoderm progenitor cells); and (D, E) immunohistochemistry staining

of Cytokeratin AE1/3 (marker for cells of epithelial origin including skin and hair progenitor cells) were examined. (C, F) There

were significantly different percentages of Desmin and Cytokeratin AE1/3-positive cells between two culture conditions. The

bar chart represents mean and standard error (SE). * P , 0.05; ** P , 0.01. Bar 5 100 mM.





hypoxia could be considered as a potential element

for controlling proliferation and differentiation of

NSCs possessing multipotent ability.

In conclusion, we showed that hypoxia is essential

for regulating neural differentiation and we demon-

strated the different effects on the NSC differentia-

tion occurring during development. These results

highlight the importance of oxygen homeostasis in

regulating neural differentiation in cell fate commit-

ment and maturation. It is suggested that oxygen

tension control may be crucial for neural embryonic

development and neural generation in vitro. The

hypoxic culture of the present study expanded ES

cells into neuron progenitor cells with low risk of

teratoma formation and also provided a useful and

effective tool for future cell therapy.

Disclaimer statementsContributors None.

Funding None.

Conflicts of interest No competing financial inter-

ests exist.

Ethics approval We fully complied with the

‘Guidelines Concerning Experimental Animals’ issued

by the Japanese Association for Laboratory Animal

Science and exercised due consideration so as not to

cause any ethical problems.

AcknowledgementsThe authors are indebted to Ms. Kyoko Takahashi

for her excellent technical assistance. This work was

supported by grants from the Ministry of Education,

Culture, Sports, Science and Technology of Japan.

References1 De Filippis L, Delia D. Hypoxia in the regulation of neural

stem cells. Cell Mol Life Sci. 2011;68:2831–44.2 Panchision DM. The role of oxygen in regulating neural stem

cells in development and disease. J Cell Physiol. 2009;220:562–8.3 Breunig JJ, Haydar TF, Rakic P. Neural stem cells: historical

perspective and future prospects. Neuron. 2011;70:614–25.4 Burton G.J. Oxygen, the Janus gas; its effects on human

placental development and function. J Anat. 2009;215:27–35.5 Fischer B, Bavister BD. Oxygen tension in the oviduct and

uterus of rhesus monkeys, hamsters and rabbits. J ReprodFertil. 1993;99:673–9.

6 Jauniaux E, Watson A, Ozturk O, et al. In-vivo measurement ofintrauterine gases and acid-base values in early humanpregnancy. Hum Reprod. 1999;14:2901–4.

7 Simon MC, Keith B. The role of oxygen availability inembryonic development and stem cell function. Nat Rev MolCell Biol. 2008;9:285–96.

8 Hitoshi S, Seaberg R, Koscik C et al. Primitive neural stem cellsfrom the mammalian epiblast differentiate to definitive neuralstem cells under the control of Notch signaling. Genes Dev.2004;18:1806–11.

9 Abramihina TV, Isaev DA, Semechkin RA. Effect of hypoxiaon neural induction in colonies of human parthenogenetic stemcells. Bull Exp Biol Med. 2012;154:130–2.

10 Ezashi T, Das P, Roberts RM. Low O2 tensions and theprevention of differentiation of hES cells. Proc Natl Acad SciUSA. 2005;102:4783–8.

11 Hirano M, Yamamoto A, Yoshimura N, et al. Generation ofstructures formed by lens and retinal cells differentiating fromembryonic stem cells. Dev Dyn. 2003;228:664–71.

12 Santilli G, Lamorte G, Carlessi L. Mild hypoxia enhancesproliferation and multipotency of human neural stem cells.PLoS One.. 2010;5(1):e8575.

13 Kitajima H, Yoshimura S, Kokuzawa J, et al. (2005). Culturemethod for the induction of neurospheres from mouseembryonic stem cells by coculture with PA6 stromal cells. JNeurosci Res. 2005;80:467–74.

14 Prithi R, Evan S. Neuronal stem cells and their manipulation.In: Robert L and Irina K. Essential Stem Cell Methods:Elsevier, 2009: pp. 23–51.

15 Vieira HL, Alves PM, Vercelli A. Modulation of neuronal stemcell differentiation by hypoxia and reactive oxygen species. ProgNeurobiol. 2011;93(3):444–55.

16 Zheng X, Pereira T, et al. Hypoxia requires notch signaling tomaintain the undifferentiated cell state. Dev Cell. 2005;9:617–28.

17 Zhang CP, Zhu LL, Zhao T, et al. Characteristics of NeuralStem Cells Expanded in Lowered Oxygen and the PotentialRole of Hypoxia-Inducible Factor-1Alpha. Neurosignals.2007;15:259–65.

18 Giese AK, Frahm J, Hubner R, et al. Erythropoietin and theeffect of oxygen during proliferation and differentiation ofhuman neural progenitor cells. BMC Cell Biology. 2010;11:94.

19 Morrison SJ, Csete M, Groves AK, et al. Culture in reducedlevels of oxygen promotes clonogenic sympathoadrenal differ-entiation by isolated neural crest stem cells. J Neurosci.2000;20:7370–6.

20 Studer L, Csete M, Lee SH, et al. Enhanced proliferation,survival, and dopaminergic differentiation of CNS precursorsin lowered oxygen. J Neurosci. 2000;20:7377–83.

21 Clarke L, van der Kooy D. Low Oxygen Enhances Primitiveand Definitive Neural Stem Cell Colony Formation byInhibiting Distinct Cell Death Pathways. Stem Cells.2009;27:1879–86.

22 Mazumdar J, O’Brien WT, Johnson RS, et al. (2010). O2regulates stem cells through Wnt/b-catenin signalling. Nat CellBiol. 2010;12:1007–13.

23 Hara A, Taguchi A, Aoki H, et al. Folate antagonist,methotrexate induces neuronal differentiation of humanembryonic stem cells transplanted into nude mouse retina.Neurosci Lett. 2010;477(3):138–43.



time-sensitive effects of hypoxia on differentiation of neural stem cells derived from mouse...

Documents