supplementary information - nature research · supplementary information doi:...

SUPPLEMENTARY INFORMATIONdoi: 10.1038/nnano.2009.313

nature nanotechnology | www.nature.com/naturenanotechnology 1

SUPPLEMENTARY INFORMATION

Supplementary methods

Characterisation of particles

Micron-sized and nano-sized particles were the same as those that have been used in our

laboratory previously.16 TEM images showing their size can be found in Papageorgiou et

al16(Figure1). Here, the diameter of the micron-sized particles was found to be 2.904±1.064µm,

and the nanoparticle diameter was found to be 29.5±6.3nm. The chemical composition of

these particles is shown in the tables below.

Table 2: Chemical composition of micron-sized CoCr particles Percentage composition of CoCr micron-sized particles. Constituent Element Composition (%) Chromium 28.8 Molybdenum 5.9 Silicon 0.67 Manganese 0.64 Iron 0.23 Nickel 0.1 Carbon 0.014 Cobalt Balance Table 3: Chemical composition of nano-sized CoCr particles Percentage composition of CoCr nano-sized particles.

Constituent Element Minimum Composition (%)

Maximum Composition (%)

Chromium 26 30 Molybdenum 5 7 Silicon - 1 Manganese - 1 Iron - 0.75 Nickel - 1 Carbon 0.15 0.35 Nitrogen - 0.25 Cobalt Balance Balance

© 2009 Macmillan Publishers Limited. All rights reserved.

2 nature nanotechnology | www.nature.com/naturenanotechnology

SUPPLEMENTARY INFORMATION doi: 10.1038/nnano.2009.313

Analysis of fibroblasts

Live-cell imaging of fibroblasts was carried out using an Olympus IX-71 inverted microscope fitted

with a CoolSNAP HQ CCD camera (Photometrics) and driven by MetaMorph software (Universal

Imaging Corporation). Cells were maintained in DMEM at 37ºC and 5% CO2, and imaged in 3 cm

cell imaging dishes (MatTek Co., Ashland, MA), or in 12-well cell culture plates (using a 60x Uplan

Fluorite objective 0.65-1.25 NA, at maximum aperture, or a LUCPlan FLN 40x objective 0.60 NA

respectively). Typically, phase contrast images were taken at 5 minute intervals over a period of up to

72 hours.

Analysis of barrier

Trans epithelial electrical resistance (TEER)

The barrier integrity was evaluated using TEER measurements taken with an Endohm 12

chamber and voltohmeter (EVOM) containing 3 ml of medium at 23°C. TEER values for the

cell layer were obtained by subtracting the intrinsic resistance (blank insert membrane) from

the total resistance (insert membrane with cells). TEER values were corrected for the surface

area and expressed as Ω·cm2. Parameters for TEER values had to fall within a standard

operating procedure range in order for the experiment to be carried out. For experimental

purposes, these BeWo b30 cells constituted the model placental barrier suspended over the

fibroblasts in a transwell insert. (Fig. 1a)

Transport markers

Sodium fluorescein (Na-Flu) transport was conducted by adding 0.5 ml of 5 µM Na-Flu to

the apical chamber and 1.5 ml of DMEM F-12 medium without phenol red, (supplemented

with 1% PSLG, 1% AmpB and 10% FBS) to the basal chamber of each Transwell®. Plates

were incubated for 3 hours at 37°C and 5% CO2. 50 μl samples were removed from the basal

chamber into a black 96-well plate and read at excitation 485 nm (+/- 12) and emission 520




nm on a FluoSTAR OPTIMA fluorescence microplate reader from BMG Labtech. All values

were blank-corrected and sample concentrations were determined using a Na-Flu serial

dilution standard curve.

Fluorescein isothiocyanate (FITC)-labelled dextran (purchased from Sigma-Aldrich), with an

average molecular weight of either 3,000-5,000 (FD4) or 40,000 (FD40), was used to

investigate the influence of size upon paracellular marker transport in the BeWo model

system. For each Transwell®, 0.5ml of 10 μM FD4 or FD40 was added to the apical chamber

and 1.5 ml of DMEM F-12 medium without phenol red (supplemented as above) added to the

basal chamber. The same procedure was then followed as for Na-Flu transport measurement.

Electron Microscopy

BeWo cell barriers were also fixed in cold 5% glutaraldehyde in 0.1M phosphate buffer or

2.5% glutaraldehyde in 0.1M sodium cacodylate buffer. The membranes were then cut from

their plastic supports and were subsequently post-fixed with osmium tetroxide (2%, 0.1 M

PIPES buffer pH 7.2) and dehydrated in graded ethanol before embedding in LR white resin

or epon. 50 – 75nm cross-sections were cut and stained for Transmission electron microscopy

(TEM) analysis with uranyl acetate and lead citrate. For TEM imaging, a JEOL JEM 1200

EX Transmission Electron Microscope was used with attached Oxford Instruments LINK

ISIS energy dispersive X-ray analysis (EDXA) system. Scanning electron microscope (SEM)

analysis of 3 μm-thick resin sections of micron-sized particle-treated barriers was performed

using a Jeol 5600LV SEM with attached Oxford Instruments LINK ISIS energy dispersive X-

ray analysis (EDXA) system. Particle size analysis was performed manually using Soft

Imaging Systems GmbH analySIS 3.0 image analysis software.




RT-PCR analysis

Reverse transcription-PCR experiments were done according to standard protocols. Total

RNA extractions from BeWo cells and BJ fibroblasts were performed using RNeasy Mini kit

(Qiagen), followed by reverse transcription using SUPERSCRIPT™ III (Invitrogen, Paisley,

UK) RNAse H-reverse transcriptase with oligo-dT. The following specific primers were used

in PCR with BIOTAQ DNA Polymerase (Bioline): hP2X1, 5’-

TTTCATCGTGACCCCGAAGCAG-3’ and 5’-TCAAAGCGAATCCCAAACACC-3’

(predicted size: 633 bp); hP2X2, 5’- TGGTGTCATCGGGGTCATTATC-3’ and 5’-

AAACCTTTGGGGTCTGTGGGTGT-3’ (predicted size: 627 bp); hP2X3, 5’-

CACCTCGGTCTTTGTCATCATCAC-3’ and 5’-TGTTGAACTTGCCAGCATTCC-3’

(predicted size: 695 bp); hP2X4, 5’-ACAGCAACGGAGTCTCAACAGG-3’ and 5’-

CCTTCCCAAACACAATGATGTCG-3’ (predicted size: 561 bp); hP2X5, 5’-

AACCTGATTGTGACCCCCAACC-3’ and 5’-TCGCAGAAGAAAGCACCCTTGC-3’

(predicted size: 683 bp); hP2X6, 5’-GGTGACCAACTTCCTTGTGACG-3’ and 5’-

CCCAGTGAACTCTGATGCCTACAG-3’ (predicted size: 476 bp) and hP2X7, 5’-

GGGGAACTCTTTCTTCGTGATGA -3’ and 5’- ACGGCAGTGATGGAACCAACGG -3’

(predicted size: 517 bp), hPNX-1, 5’ -ATGGCCATCGCTCAACTGGCC-3’ and 5’-

TCAGCAAGAAGAATCCAGAAG-3’ (predicted size: 810 bp), human connexin43, 5’-

TCATTTTCCGAATCCTGCTGC-3’ and 5’-CCCCTCGCATTTTCACCTTAC-3’ (predicted

size: 360 bp). The efficacy of these primers was checked with corresponding hP2X receptor,

hP2Y receptor and pannexin-1 cDNA in pcDNA3.1 plasmids. The temperature profile for

PCR was 1 min at 94 C followed by amplification for 30 cycles which consisted of 30 s at

94 C, 40s for all P2X and connexin-43, 80s for pannexin-1 and 30 s at for P2Y receptors at

60 C, and 1 min at 72 C and a final extension for 5 min at 72 C. PCR products were then




analyzed by electrophoresis in 1% agarose gel containing ethidium bromide, and visualized

by UV trans-illumination.

Analysis of individual BeWo cells

Fura-2 Calcium Assay

BeWo cells were plated at a concentration of 1.2x104 cells/well in a 96-well black assay plate

with clear bottom (Corning Inc., Corning, NY) and cultured overnight. Cells were

preincubated with 4 µM Fura-2 AM (Invitrogen) at 37°C for 40 min in loading buffer

(136mM NaCl, 1.8mM KCl, 1.2mM KH2PO4, 5mM NaHCO3, 2mM CaCl2 and 1.2mM

MgSO4, 20mM HEPES, 6mM D-Glucose and 5mM EGTA). Before recording, Fura-2 AM

was removed and replaced with the standard extracellular solution (147mM NaCl, 10mM

HEPES, 13mM -Glucose, 2mM KCl, 2mM CaCl2 and 1mM MgCl2) and pre-incubated for

10min with 1μM of the P2X7 antagonist A74003 or 10μM of the P2Y receptor pathway

inhibitor U73122 when indicated. Fluorescence was recorded by an automatic fluorescence

plate reader, FlexStation 3 (Molecular Devices, Sunnyvale, CA) over 300 sec at 4-s intervals.

The dual excitation for Fura-2 was 340 nm / 380 nm, and the emission was 510 nm. Agonists

were added into the wells automatically by the machine at designated time points. Data were

acquired by the SoftMax Pro 5 software, and the intracellular calcium level was expressed as

the ratio of the emission intensities for 340 and 380 nm.

WST-1 assay

The viability of cells was determined using a 4-[3-(4-Iodophenyl)-2-(4-nitrophenyl)-2H-5-

tetrazolio]-1,3-benzene disulphonate (WST-1) assay (Roche). Briefly, BeWo cells were

seeded at 2.5 x 105 cells/mL in a 96-well, flat-bottom plate. Plates were incubated for 24

hours at 37°C and 5% CO2 and then washed once in PBS. Wells were replenished with 100ul

fresh media (phenol-red free) and 10 µl of the WST-1 reagent was added to each well. Plates




were incubated for an additional 3 hours and then read on a FluoSTAR OPTIMA

fluorescence microplate reader from BMG Labtech (Aylesbury, UK). at 420-480 nm.

Analysis of media

Two-dimensional gel electrophoresis

Samples were concentrated using Microcon-3 centrifugal filter devices (Millipore) and

washed extensively into 5mM Tris, pH7. Concentrated samples (~50µl) were made up to

450µl with 7M Urea, 2M Thiourea, 4% CHAPS, 0.002% Bromophenol Blue, 0.5% (v/v) IPG

Buffer pH3-11NL (GE Healthcare) and 1.2% (v/v) Destreak reagent (GE Healthcare).

Samples were left at room temperature for 1hr prior to loading onto 24cm immobiline

DryStrip first dimension IPG strips pH3-11 non linear (GE Healthcare) by passive

rehydration.

Following rehydration overnight, isoelectric focusing was performed using the Ettan IPGphor

(GE Healthcare) according to the manufacturer’s instructions (in brief, 500V for 1hr, 1000V

for 1hr and 8000 V for 8.5hr). The focused IPG strips were then incubated for 15min. in

10ml SDS equilibration buffer (50mM Tris-HCl, pH8.8, 6M urea, 30%(v/v) glycerol, 2%

SDS, 0.002% bromophenol blue) containing 100mg DTT and for a further 15min. in 10ml

equilibration buffer containing 250mg iodoacetamide.




The equilibrated strips were applied to the surface of vertical 15% SDS-polyacrylamide gels

and proteins separated in the second dimension using the Ettan DALT 6 separation unit (GE

Healthcare) at 0.2W/gel for 1hr, 0.4W/gel for 1hr and then 20W/gel until completion. Gels

were fixed for an hour in 50% methanol, 10% acetic acid and stained overnight using Sypro

Ruby total protein stain (Invitrogen). Following destaining in 10% methanol, 7% acetic acid,

the gels were imaged using a Typhoon 9400 Variable Mode Imager (GE Healthcare).

Proteolytic digestion and mass spectrometry

Protein spots of interest were excised from the gel using the Investigator ProPic automated

spot picker and digested with trypsin using the ProGest automated digestion unit (both from

Perkin Elmer Life Sciences). The resulting peptides were analysed using a 4700 MALDI-

Tof/Tof mass spectrometer (Applied Biosystems) to give a peptide mass fingerprint and

peptide sequence information, which was searched against the MSDB database using the

Mascot search engine from Matrix Science to identify the protein.




a

d

b

c

Supplementary Figure 1

Supplementary figure 1: Indirect exposures of CoCr particles and ions with (c and d) and

without (a and b) gap junction blockers do not alter the integrity of the BeWo cell barrier. (a

and c) Barrier permeability as measured by passage of NaFlu (376Da), FD4 (4000Da) and

FD40 (40000Da). (b and d) Tight-junction integrity between BeWo cells in the barrier as

measured with the trans-epithelial electrical resistance (TEER). All values are means ± 95%

CI *P ≤ 0.05, **P ≤ 0.01, ***P ≤ 0.001 compared with control (n=3).




a b

*


Supplementary figure 2: Mitotic and apoptotic frequency after exposure to CoCr

nanoparticles (metal). Exposures to human fibroblasts were for 24 hours and either (a)

direct (no BeWo cells and no permeable plastic insert) or (b) indirect (through a BeWo cell

barrier). Mitotic and apoptotic frequency was measured using live cell imaging (filmed for 44

hours after exposure). Direct exposure to CoCr NP caused a significant reduction in mitotic

frequency with no change in apoptotic frequency. There was no change in either mitotic or

apoptotic frequency after indirect exposure. *p=0.05.



SUPPLEMENTARY INFORMATION doi: 10.1038/nnano.2009.313Supplementary Figure 3

Supplementary figure 3: TEM images of untreated BeWo cell barrier. N=nucleus. (a)

Bewo cell barrier 2-3 cells in thickness. (b) Arrow shows tight junction, arrowhead shows

desmosome. (c) Arrowhead shows gap junction.



SUPPLEMENTARY INFORMATIONdoi: 10.1038/nnano.2009.313Supplementary Figure 4

Supplementary figure 4: Confocal image of untreated BeWo cell barrier. Cells were

stained with Zo-1 (arrow) showing tight junctions and DAPI showing cell nucleus (N).




a

b

c


Supplementary figure 5: Ca2+ flux in BeWo cells after stimulation with ATP, and inhibition of CoCr-

induced DNA damage by calcineurin inhibitors.

1mM ATP was used to stimulate Ca2+ flux alone and in the presence of (a) 1μM A740003 (to block P2X7

receptors) and (b) 10μM U73122 (to block P2Y receptors). The ATP induced ca2+ flux was P2Y but not P2X7

receptor dependant. (c) DNA damage (as recorded by the Alkaline Comet assay) caused by indirect exposure to

CoCr NP is blocked by the calcineurin inhibitors Cyclosporin A (CsA) and FK506. Values are means ± 95% CI.

*P ≤ 0.05, **P ≤ 0.01, ***P ≤ 0.001 compared with CoCr NP (n=3).



SUPPLEMENTARY INFORMATIONdoi: 10.1038/nnano.2009.313Supplementary Figure 6

Supplementary figure 6: The secretion of transferrin from the BeWo cell barrier.

Two-dimensional gel electrophoresis of the supernatant taken from media below the

BeWo cell barrier in the absence of fibroblasts. Protein spot patterns after exposure to

(a) protein-free media, (b) CoCr NP and (c) 10µM ATP. A cluster of spots (boxed) at

approximately 100kDa can be seen after exposure to CoCr NP and ATP. These spots

disappear in the presence of 300µM Gap 26 (d), 20µM PPADS (e) and 2 units/ml

apyrase (f).


supplementary information - nature research · supplementary information doi:...

Documents