supplementary figure s1. potential sad promoter elements ... ?· kawagoe y, murai n (1992) four...

Download Supplementary Figure S1. Potential SAD promoter elements ... ?· Kawagoe Y, Murai N (1992) Four distinct…

Post on 03-Apr-2019

212 views

Category:

Documents

0 download

Embed Size (px)

TRANSCRIPT

1

1

Supplementary Figure S1. Potential SAD promoter elements conferring gene expression in seeds.

a SAD-A promoter (GenBank accession no. AF242183) TGGTCCTTTTAGGCCTAGGATTCTSCTTGGAAAGGGTCATCGACCACTCAGTCAATGGTGGAGCATTGAATCCAAATTTACAAGGAAGATGTGAGTTAGTTAGTGACCTTGGCTTCTCTCTACCAGAAATTTCTTATCCCATGTTTCCAAGTGAGGCGATACCGTCCTTGAGGCGACCTATTATCGTCTCCTCTCCTAGGACGTCCTATAGTCATCGCGTTAGACAAATCCTTTTACAAATATAACACTACATATATATAATACATTGATTAACTACTACAACATGACATATTTTTCTACACCTACGCCAATCACCATGACACACACTCGYTTGATGAGAAATACTTATATTGTGGTTGGATTGATTATGAATTATGTATGGTGAAACATTTATTCGGGTGATTCATGCATCAAATCGAATATGTACAAACTATTCACAGGAATTTGTATGTCTTTGCAAAATCTATGATCACTTGATAACAGGTTGACCAAAGTTATGATGAGTGTTTTGATCATGTGTTAGGATCAAGACTACCATATTCTATACAGTTGAGAGATTGAGGTGAGATACATGAGGTAATATATTAAGATATCACATCCTTACATGTTTCTCACGCTTCAAGGAGAGTTCTTGAGGGCAAATGAGGAGGGAACAATTGCGGAGAAATCAACGGAAGAGGGAAGGAAGTCATGAAGGTAGTCTAGTCCATACAAACGCATGTATCCAAGACATTACAATTACACTCTTGYTTGGAAGGGGTTTGAAGCCCGTCACAAGATATGTAGTTGTTGTGCATCAAATTGTAAAAGAGACTAAGAATGCCTCATATCACAAGAGATTGAGGATGATGAGAGTATGTCATTGAACCCAATCAAGAAACTAGTTTATTTTTTTCGTCATTTTGTTTGTGTTTMATTAATAATATTAATAAATTATTATTGTTATTTATTTTAATTTAATAAAATATGTTAAATATTTATTCACTATGTTTACAATATGTTAGAATTATATAATTTGAAAGAGATTAAAAATAATACATAAACAATTTAAAACAATATTAGAGGTACAATTTGGTTTTGAATGTCAATTTTTTTATAAAAAAAACCCTGAAAAAAAGTCTTGACATCTCTTAGTCTTCTCTATGACACCGCATCTTTCAAGAAAGCAATGTTACAACAACAGTCTTGCATACTACGTACTAGTATTCATTTGGAAGGTTCTGGACAAGCAATGAGAACGTCAGATCAAACTGTGGTTAAAAATATTCAACGAAAACATTCAACTAAAAACAACTTTGCAATAACTCATTCACATGGTCATGGATATGGATGTATATATTTTGTGGTGCCCACTTTTGTTGACAATTTGGAGTACTTTAATAGTAAATACTACCATTATTTTATCTAGAGAAAGCGATGGAAATTCGGACAAAAAAATACACTTTTCGTGTTGAATTGAAAGTAATGTTTGATTCATGAGAGCCGCGGTTGACGGTCCACCCAATCTGAAAAGATCAAGATGACTTAGTATCATATTCCATCACGTCTCGTAGACCCAATCAGTATAAAAGGATAGTAAGGATCCATTTTCTGTACATCAATAAACAAATCATTTTCCATACATACAAAAATGGCAGAATCTTCATCAACCAAAACCGGTCTTAGGTTAGCCGGCAAAGTAGCCATCGTCACCGGAGGTGCCAGCGGTATCGGCAAAGAGACTGCGCATCTCTTTGCCAATCAAGCTGCACGTATGG

b SAD-C promoter (GenBank accession no. AF242182) ATCTCGTTGTTGTGCATCAAATTATAAAGAAAACTAAGAATGCCTCACTTCACAAGAGGTTGAGGATGATGAAAGTATATCATTGAACCCAATATAAAGACTAATTTGTTTTTTTTCATATTTTTAATTGTGTTTAATTAATACTATCGTCCACGTGCTCGTCTGTCCGTTTTTTTTAATGCGCATACGGATAAAAATATGAGCGGTATTTTTGTGTRTCTATTTTAATTTAAATTCAATTGATTTTGAATATCAAATTTAAGAATATAAATTTTCCAAAAAATTGTTTGACATCTCTTAGTCTTCTCCATGACACCGCGTCTATCAAGAAAGCARTGTTACTAGTAATACATTTTGGAAGGTTCTGAACCCGCAATGACAACATCAGATCAAACTGTCGTTAAAAATATTCAACGAAAACATTCAACTAAAAACAACTTTTCAATAACTCATGATCATGGATATGGATGTATTTATTTTGTGGCGCCCACTTTTGTTGACAATTTAAATCAATTTGGCGTGCTACTATTTTTGGTGACATATTTTATAAATTAAATAACAAGCCAAATATGAAACATTGATTACACTATGCTAAAATACACTTTCCGTGTTCAAAGGAATGTTTGATTCATGAGAGCCGCGGTTGACGGTCCACCCAATCTGAAAAGATCAACCTGACTTAGTATCATATTCCATCACGTCTCGTAGACCCAATCAGTATAAAAGGATAGTAAGGATCCATTTTCTGTACATCAATAAACAAATCATTTTCCATTATACATACAAAAATGGCAGAATCTTCATCAACCAAAACCGGTCTTAGGTTAGCCGGCAAAGTAGCCATCGTCACCGGAGGTGCCAGTGGTATCGGCAAAGAGACGGCGCATCTCTTTGCCAATCAAGCTGCACGTAT ATGTGTT reverse complement of AACACAT. One base mismatch (permitted) of TACACAT activating

expression of seed storage protein (Josefsson et al., 1987). CANNTG E-box cooperating with other cis-elements to activate seed-specific promoters for

heterologous expression (Kawagoe and Murai, 1992). CATGCAT Almost complete RY repeat element (CATGCATG; Chamberland et al., 1992, Reidt et al.,

2000).

2

2

References Chamberland S, Daile N, Bernier F (1992). The legumin boxes and the 3 part of a soybean -conglycinin

promoter are involved in seed gene expression in transgenic tobacco plants. Plant Molecular Biol 19: 937949

Josefsson LG, Lenman M, Ericson ML, and Rask L (1987) Structure of a gene encoding the 1.7 S storage protein, napin, from Brassica napus. J Biol Chem 262: 12196-12201.

Kawagoe Y, Murai N (1992) Four distinct nuclear proteins recognize in vitro the proximal promoter of the bean seed storage protein beta-phaseolin gene conferring spatial and temporal control. Plant J 2: 927936

Reidt W, Wohlfarth T, Ellerstrm M, Czihal A, Tewes A, Ezcurra I, Rask L, Bumlein H (2000) Gene regulation during late embryogenesis: the RY motif of maturation-specific gene promoters is a direct target of the FUS3 gene product. Plant J 21: 401-408.

3

3

Supplementary Figure S2. MALDI-TOF MS analysis chromatograms (a,b) and analysis reports (c,d) for the SAD content of immunoprecipitates from pea seeds (a,c) and leaves of pea plants irradiated for 5d with UV-B radiation (b,d). Peaks in the chromatograms indicated with red numbers represent peptides derived from SAD proteins that were used in their identification.

4

4

5

5

6

6

7

7

Supplementary Table S1. Substrates tested in enzymatic activity assays with recombinant SAD-A and SAD-C proteins. For alcohols and hydroxylic compounds, NAD+ was used as co-factor. For carbonyls and quinones, NADH was used. Chemical compound Activity with

SAD Chemical compound Activity with

SAD Steroids Plant hormones -sitosterol No Gibberellic acid 3 No campesterol No Gibberellic acid 42 No 17-hydroxyprogesterone No Gibberellic acid 72 No Deoxycorticosterone No Gibberellic acid 192 No 5-androstane-3,17-diol No Gibberellic acid 242 No Hydrocortisone No (+-)-cis,trans-Abscisic acid No 4-pregnen-20-ol-3-one No Teasterone3 No Corticosterone No 3-dehydroteasterone3 No Testosterone No Typhasterol3 No 6-deoxoteasterone3 No Monoterpenes 3-dehydro-6-deoxoteasterone3 No Pulegone No 6-deoxotyphasterol3 No Quinones and aromatic Sugars and sugar alcohols carbonyls Adonitol No 1,4-Benzoquinone - a Arabinose No 2,5-Dimethylbenzoquinone Yes Glucose4 No 2,6-Dimethylbenzoquinone Yes Sucrose5 No 2,6-Dimethoxybenzoquinone Yes Sorbitol No Duroquinone Yes 1,4-Naphthoquinone Yes Flavonoids 1,2-Naphthoquinone - a Kaempferol No Anthraquinone No 4,5,7-Trihydroxyflavanone No Thymoquinone Yes Menadione, vit K3 Yes Aromatic hydroxyls Menaquinone, vit K2 No Pyrogallol No Phylloquinone, vit K1 No Hydroquinone No Decylplastoquinone No Pyrocatechol No Ubiquinone (Q10) No 8-Methoxypsoralen No Alcohols Methoxatin - a Ethanol6 No 4-nitrobenzaldehyde Yes Propanol7 No Metyrapone No Butanol No Glycerol8 No Lignans Methanol9 No Matairesinol1 No a reacts non-enzymatically with NADH (Scherbak, N., Strid, . and Eriksson, L.A. (2005) Non-enzymatic oxidation of NADH by quinones. Chem. Phys. Lett. 414, 243-247). Suppliers of compounds: Unless otherwise stated, all chemicals were of the Sigma, Aldrich, Fluka or Supelco brands of the Sigma-Aldrich Company, St Louis, MO. Other suppliers were: 1ArbaNova, Turku, Finland; 2Prof. Lewis Mander, Australian National University, Canberra provided us with these compounds; 3Prof. Shuzo Fujioka, RIKEN, Saitama, Japan provided us with these compounds; 4ICN, Aurora, OH; 5Serva, Heidelberg, Germany; 6Solveco, Stockholm, Sweden; 7AppliChem, Darmstadt, Germany; 8Duchefa, Haarlem, The Netherlands; 9Scharlab, Sentmenat, Spain