B R A I N R E S E A R C H 1 1 4 5 ( 2 0 0 7 ) 4 1 – 4 7

ava i l ab l e a t www.sc i enced i rec t . com

www.e l sev i e r. com/ l oca te /b ra in res

Research Report

Study of biocompatibility of small intestinal submucosa (SIS)with Schwann cells in vitro

Yan Su, Bing-Fang Zeng⁎, Chang-Qing Zhang, Kai-Gang Zhang, Xue-Tao XieDepartment of Orthopaedics, The Sixth Affiliated People's Hospital, Shanghai Jiaotong University, 600 Yishan Road, Shanghai 200233, China

A R T I C L E I N F O

⁎ Corresponding author. Fax: +86 21 64369181E-mail address: yansu2004@yahoo.com.cn

0006-8993/$ – see front matter © 2007 Elsevidoi:10.1016/j.brainres.2007.01.138

A B S T R A C T

Article history:Accepted 17 January 2007Available online 13 February 2007

No satisfactory method currently exists for repairing long peripheral nerve defects. Effortshave been made to fabricate bioactive artificial nerve conduits, comprised of a biomaterialpre-seeded with Schwann cells (SCs), which creating a favorable micro-environment foraxonal regeneration, to be an alternative to autografting by means of tissue engineering.Small intestinal submucosa (SIS) possesses special biological characteristics and iscomprehensively researched for tissue repairing at varied tissues and organs. This studyinvestigated the biocompatibility of SISwith SCs in vitro. Cultured rat SCswere seededonSIS.Cell morphology was observed by light microscopy, scanning electron microscopy andtransmission electron microscope. The viability of SCs was measured by MTT assay.Secretion of NGF-β and BDNF was quantitatively assessed by ELISA, and NGF-β mRNA andBDNF mRNA were semi-quantitatively assessed by RT–PCR. The results indicated that SCscould adhere,migrate and proliferate on the surface of SIS in good condition with productivefunction of secreting growth factors. SIS has a good biocompatibility with SCs and SIS pre-seeded with SCs has potential to be an alternate candidate of autografting for repairing longperipheral nerve defects.

© 2007 Elsevier B.V. All rights reserved.

Keywords:Schwann cellBiocompatibilitySmall intestinal submucosaPeripheral nerve regeneration

1. Introduction

Treatment of the injured peripheral nerve with a long defectremains one of the most difficult problems in nervereconstructive surgery. Transplantation of autologous nerveis the widely utilized method when direct anastomosis isdifficult. However, this technique is limited when the sourceof donor nerve is insufficient, in particular when consideringthe morbidity in the donor site and additional operationtime (Lundborg and Malmö, 2000; Terzis et al., 1997).Therefore, efforts have been made to fabricate artificialnerve conduits, which are creating a favorable micro-

.(B.-F. Zeng).

er B.V. All rights reserved

environment for axonal regeneration, to overcome drawbacksof autologous nerve grafts by means of tissue engineering(Bellamkonda, 2006; Fansa and Keilhoff, 2004; Rochkind et al.,2004).

Schwann cells (SCs) are known to play an obligatory role inperipheral nerve regeneration by providing bioactive sub-strates on which axons migrate and by releasing moleculesthat regulate axonal outgrowth (Fawcett and Keynes, 1990;Thompson and Buettner, 2004). Thus, they are commonlyused in nerve tissue engineering as seed cells. Meanwhile,searching for an appropriate kind of material served asscaffold is critical. A variety of materials, including synthetic

.

Fig. 1 – SCs were positive for S-100 staining using theimmunocytochemistry method (fluorescence microscope,×100).

Fig. 2 – SCs grew and adhered on the edge of SIS in goodcondition (phase contrast microscope, ×100). The arrowindicates the interface of SCs and SIS.

42 B R A I N R E S E A R C H 1 1 4 5 ( 2 0 0 7 ) 4 1 – 4 7

and natural materials have attempted to be employed tobridge nerve gaps (Evans et al., 2002; Keilhoff et al., 2003;Mackmmon and Dellon, 1990; Smith et al., 2004; Hudson et al.,1999). Yet despite some advances in the field of tissueengineering, axonal regeneration using neither synthetic nornatural materials has reached to the equivalent level of theuse of autografts. Thus, further investigation to searchalternative nerve scaffold is demanded.

Small intestinal submucosa (SIS) is a multilaminar portionof the small intestine and has been applied as a biomaterialscaffold for tissue engineering applications to artery (Badylaket al., 1989), the lower urinary tract (Campodonico et al., 2004),bone (Suckow et al., 1999), and abdominal wall (Zhang et al.,2003). Encouraging results with appropriate tissue regenera-tion and functional recovery have been reported in each ofthese applications. Therefore, SIS appears to have potentialto facilitate host tissue regeneration without concurrentimmunologic rejection or alteration (Badylak et al., 1989;Campodonico et al., 2004; Suckow et al., 1999; Zhang et al.,2003). Rat SIS was also applied to bridge a sciatic nerve gap inrats and the results demonstrated the feasible use of SC-seeded SIS as nerve guidance channel that was comparableto nerve autografts. But rat SIS was not firm enough toprevent lamellae from collapsing onto one another, therebypreventing further axonal regeneration (Hadlock et al., 2001).Porcine SIS is thicker and has greater mechanical strengththan rat SIS and may be more suitable to be applied asscaffold in peripheral nerve tissue engineering.

Good biocompatibility with SCs is essential for the bioma-terials used in peripheral nerve tissue engineering. However,the biocompatibility of porcine SIS with SCs has not beenevaluated in vitro previously andwe are not sure if porcine SISis suitable for SCs adherence and growth. In this study, wecultured rat SCs on porcine SIS in vitro and examinedadhesion, migration and proliferation of SCs. Moreover,secretion of growth factors by SCs on SIS was also evaluated.The study aimed to investigate the biocompatibility of porcineSIS with SCs in vitro and determine the feasibility of potentialapplication in nerve tissue engineering.

2. Results

2.1. Light microscopy

At 24 h after isolation by enzyme digestion, a large amount ofcells adhered and grew in spherical and short olivary shape.After 2 days, the adherent SCs appeared a bi- or tripolarmorphology with oval nuclei and connected to each other. At6 days, the identification of SCs was verified using theimmunocytochemistry for S-100 and the purity of SCsexceeded 95% (Fig. 1).

At 5 days after seeding on SIS, SCs were intensive aroundSIS and adhered on the edge of SIS. SCs grew in long olivaryshape with obvious cell body processes (Fig. 2).

2.2. SEM

At 1 day, SCs scattered and adhered on the surface of SIS,exhibiting a round cell body with short cell body processes(Fig. 3A). Then the density of SCs increased with prolonged co-culture time. At 5 days, SCs were observed to grow inmultilayer fashion on SIS. They migrated and proliferatedactively along the SIS surface in three-dimensional fashion,demonstrating long olivary, triangular or long fusiform shape.Furthermore, SCs arranged in bundles or took on radiatingvortex end to end arrangement (Figs. 3B, C). Protein granulessecreted on cellular surface were also shown. At 7 days, SCsgrew intensively and reached confluency (Fig. 3D).

2.3. TEM

SCs grew and adhered to the surface of SIS in good condition.The cell body of SCs stretched out and demonstrated longolivary with extending processes, having microvilli on theirsurface in abundance. A considerable number of chondrio-somes and ribosomes were seen in cytoplasm, and an ovalnuclear located at one side. At the interface of SCs and SIS,plenty of the minute foot plates were observed to attach SIStightly (Fig. 4).

Fig. 3 – SEM of Schwann cells cultured on SIS. SCs exhibited a round cell body with short cell body processes at 1 day (A).SCs migrated and proliferated actively along the SIS surface in three-dimensional fashion, arranging in bundles or took onradiating vortex end to end arrangement at 5 days (B, C). SCs grew intensively and reached confluence at 7 days (D).

Fig. 4 – TEM of Schwann cells attached and adhered to thesurface of SIS at 7 days. At the interface of SCs and SIS, plentyof the minute foot plates were observed to attach SIS tightly.The arrow indicates the interface of SCs and SIS (bar=2 μm).SC: Schwann cell; N: nucleus of Schwann cell; SIS: smallintestinal submucosa.

43B R A I N R E S E A R C H 1 1 4 5 ( 2 0 0 7 ) 4 1 – 4 7

2.4. MTT assay

The results are given in Fig. 5. The SCs' viability of SIS groupwas significantly higher than that of the control group at 3, 7and 10 days.

2.5. ELISA

The results are given in Figs. 6 and 7. After seeding on SIS, theamount of NGF-β and BDNF which were secreted by SCsincreased with the prolonged time. At 5 days, each groupreached a high level relatively. Compared to the control group,the level of both growth factors of the SIS group wassignificantly higher at 3, 5 and 7 days (P<0.05). NGF-β andBDNF were not detected in the blank control group.

2.6. RT–PCR

NGF-βmRNA (349 bp) and BDNFmRNA (393 bp) were detectedthrough RT–PCR in SCs of both the SIS group and the controlgroup (Fig. 8). Both products of the SIS group were observed to

Fig. 5 – The results of MTT assay (n=6). Error bars representmeans±SE. *P<0.05 vs. control group.

Fig. 7 – The concentration of BDNF in culture supernatantmeasured by ELISA (n=6). Error bars represent means±SE. *P<0.05 vs. control group.

44 B R A I N R E S E A R C H 1 1 4 5 ( 2 0 0 7 ) 4 1 – 4 7

be significantly higher than that of the control group (P<0.05).NGF-βmRNA and BDNFmRNA were not detected in the blankcontrol group.

3. Discussion

As a kind of physiologic and resident glial cells in peripheralnervous system (PNS), SCs offer a highly preferred substratefor axon migration and release bioactive factors that furtherenhance nerve regeneration (Martini, 1994; Thompson andBuettner, 2004). Previous studies have demonstrated thathollow nerve tubes without SCs have not resulted in acomparable result as autografts in the case of nerve defectsof >1 cm in a rat model or 3 cm in human subjects (Lundborg,1988;Machinnon andDellon, 1990). Hence, interests have beendirected to introduce cultured SCs into scaffold to constructbioactive nerve conduits for promoting nerve regeneration.Although the ideal material for a nerve guide has not beenidentified, successful materials must be biocompatible whichare suitable for SCs attachment, proliferation and secretion ofgrowth factors.

SIS is essentially acellular extracellular matrix (ECM), withabout 40% of the dry weight being composed of fibrillarcollagen. Studies have documented that SIS contains glyco-saminoglycan and glycoprotein, such as hyaluronic acid,heparin, heparan sulfate, chondroitin sulfate A, and dermatan

Fig. 6 – The concentration of NGF-β in culture supernatantmeasured by ELISA (n=6). Error bars represent means±SE.*P<0.05 vs. control group.

sulfate (Hurst and Bonner, 2001). As a biomaterial, thecomposition and structure of SIS are similar to extracellularmatrix of nature connective tissue. SIS possesses specialbiological characteristics to induce site-specific remodeling ofvarious connective tissues (Badylak et al., 1989; Campodonicoet al., 2004; Suckow et al., 1999; Zhang et al., 2003). SIS isunique from other previously used conduit materials becauseSIS contains functional growth factors that are likely vital tothe regenerative process (Voytik-Harbin et al., 1997). There-fore, enhanced attention has been paid to SIS application totissue engineering. Badylak et al. were the first to successfullyuse SIS as a vascular graft in dogs in 1989 (Badylak et al., 1989).Subsequently, SIS is comprehensively researched for tissuerepairing at varied tissues and organs and has gainedencouraging results. Taken together, the characteristics ofSIS appear to be: (1) surviving in a xenogenic host withoutobviously adverse immunologic consequences; (2) corre-sponding to local biomechanical effects and microenviron-ment, and contributing to tissue remodeling; (3) acceleratingcell proliferation and differentiation in special tissues; (4)inducing a body response to resist infection; and (5) harvestedeasily (Campodonico et al., 2004; Suckow et al., 1999; Zhanget al., 2003).

Preliminary studies have revealed that SIS could be po-tentially applied as a neural guidance material in promotingaxonal regeneration (Hadlock et al., 2001; Smith et al., 2004).Another study also reported that SIS supported epidermalcell/fibroblast attachment and differentiation with depositionof basement membrane (BM) components (Lindberg and

Fig. 8 – Total RNA was analyzed for the expression ofNGF-β and BDNF by RT–PCR at 7 days. 1: NGF-β (SIS group); 2:NGF-β (control group); 3: BDNF (SIS group); 4: BDNF (controlgroup); M: Marker.

45B R A I N R E S E A R C H 1 1 4 5 ( 2 0 0 7 ) 4 1 – 4 7

Badylak, 2001). In the present study, the biocompatibility ofSIS with SCs was further investigated in vitro. The resultsindicated SIS was useful for growth of nerve cells. When co-cultured with SCs, SIS showed good ability to support SCsadhesion, survival, migration and proliferation on its surface.Observation of the ultrastructure of SCs by TEM demon-strated that SCs adhered tightly and grew productively on thesurface of SIS. MTT assay also showed that SIS had nocytotoxicity for SCs. Quantitative analysis of NGF-β and BDNFby ELISA, as well as semi-quantitative analysis of NGF-βmRNA and BDNF mRNA by RT–PCR, showed that SCs seededon SIS had more productive function of secretion than thenormal cultured SCs. NGF-β and BDNF are the main growthfactors secreted by SCs, which are known to have neuro-trophic effects on nerve regeneration (Schicho et al., 1999;Serpe et al., 2005).

SIS-contained glycoprotein and cellular factors may playimportant roles in supporting SC growth. The proteoglycancompositions in SIS binds with specific receptors on cellsurfaces and links ECM components, such as collagen typeIV, which facilitates SC adherence and migration. Further-more, extractable growth factors from SIS include FGF-2 andTGF-β (Voytik-Harbin et al., 1997). Studies have shown thatFGF-2 is mitogenic for cultured SCs in vitro (Mauritz et al.,2004), and TGF-β can promote proliferation and differentia-tion of SCs (Sulaiman and Gordon, 2002). In addition, as akind of extracellular matrix-derived scaffolds, the naturalthree-dimensional ultrastructure of SIS may also be suitablefor cells adherence and growth (Badylak et al., 1999). Takentogether, these factors create a proper microenvironment toenhance axonal regeneration.

As a xenogenic graft, host immunological response shouldalways be concerned. Allman has reported that porcine SISelicits an immunological response just restricted to the Th2

pathway, which is consistent with a remodeling reactionrather than rejection (Allman et al., 2001). As a ureteralallograft, despite the presence of chronic inflammatoryprocess, porcine SIS behaves as a biological tissue withoutacute rejective reaction (Greca et al., 2004). Absence of anacute rejection following porcine SIS xeno-implantationappears to be related to its characteristics of acellular extra-cellular matrix.

This study evaluated the biocompatibility of SIS with SCs invitro. It demonstrated that SCs could adhere and grow well onthe surface of SIS with productive function of secreting growthfactors. In conclusion, as a natural biomaterial, SIS hasexcellent neuroglial cell affinity. SIS pre-seeded with SCs haspotential to be an alternate candidate for autografting forrepairing long peripheral nerve defects. Further studies ofconstructing artificial nerve conduit using SIS pre-seeded withSCs to promote axonal regeneration will be followed in thefuture.

4. Experimental procedures

4.1. SIS preparation

Preparation of porcine SIS was followed previous descriptionby others (Abraham et al., 2000). Briefly, a segment of fresh

jejunum was harvested from healthy swine (weighting over200 kg) from a closed herd (Qi Xing Farm, Shanghai). Aftergently cleaning in water, the segment was everted and thetunica mucosa was abraded using longitudinal wipingmotions with a scalpel handle wrapped with moistenedgauze. The treated jejunal segment was everted again andthe serosa and tunica muscularis were then gently removedusing the same procedure. After mechanical cleaning, theintestine was slit longitudinally and cut into 15 cm sectionsthat were processed through a series of chemical cleaningsteps. The v/v ratio of each chemical cleaning solution totissue was 100:1, and the incubations all were carried out atambient room temperature. The tissue was first incubatedfor about 16 h in a solution of 100 mM ethylenediaminete-traacetic acid (EDTA) in 10 mM sodium hydroxide (NAOH)with a pH of 11–12. The second incubation in 1 M hydro-chloric acid (HCl) in 1 M sodium chloride (NaCl) at pH 0–1was carried out for 6–8 h. This was followed by incubation in1 M sodium chloride and 10 mM phosphate-buffered saline(PBS) at pH 7–7.4 for 16 h and then 2-h incubation in 10 mMPBS at pH 7–7.4. Finally, the tissue was rinsed in sterile waterat pH 5.8–7.0 for at least 2 h.

The preparation of porcine SIS was rinsed extensively with0.1% peracetic acid for 2 h, vacuum-sealed into hermeticpackaging, and terminally sterilized by gamma irradiation(25–35 kGy).

4.2. Isolation and culture of SCs

The bilateral sciatic nerves and brachial plexuses of 10neonatal Sprague-Dawley rats (Animals Center of AcademiaSinica, Shanghai) were harvested and washed 3 times withPBS (pH 7.4). The epineurium was separated and nerves weredissected into discrete fascicles (less than 1 mm), which wereenzymatically dissociated using 0.03% type I collagenase(Sigma, USA) and 0.25% trypsin in 10 ml PBS for 30 min at37 °C. The resulting cell suspension was centrifuged andplaced onto poly-L-lysine- (Sigma, USA) coated cell culturedishes in Dulbecco's modified Eagle's medium (DMEM)(Gibco, USA) with 10% fetal bovine serum (Hyclone, USA),incubated in a 37 °C humidified incubator with 5% CO2. After12 h, the medium containing 5 μM cytosine arabinoside(Sigma, USA) was added to deplete rapidly proliferatingfibroblasts for 48 h. The cells were then fed with DMEMsupplemented with 1% antibiotic (10,000 U/ml penicillin Gand 10 mg/ml streptomycin), 2 mM glutamine, 10% fetalbovine serum and 40 μg/ml bovine pituitary extract (Upstate,USA). The medium was changed every 3 days. After 6–7 days,the cells were passaged with 0.25% trypsin/EDTA afterconfluent monolayer was obtained. The whole surgicalprocedure was performed in laminar flow hood under asepticconditions following the guidelines of the institute's ethicalcommittee.

4.3. Seeding SCs on SIS

The prepared SIS was cut into pieces of 1 cm×1 cm andattached on each well of a 24-well tissue culture plate, afterwhich they were rinsed extensively with PBS. 2 ml SCs wereseeded onto SIS pieces at density of 5×105 cell/cm2. Wells

Table 1 – Nucleotide sequence and size of the expand PCRproducts for oligonucleotide primers for RT–PCR

NGF-β Forward 5′: GGCCACTCTGAGGTGCATAGReverse 5′: CATGGGCCTGGAAGTCTAAALength of product (bp) 349

BDNF Forward 5′: AAACCATAAGGACGCGGACTReverse 5′: GATTGGGTAGTTCGGCATTGLength of product (bp) 393

46 B R A I N R E S E A R C H 1 1 4 5 ( 2 0 0 7 ) 4 1 – 4 7

embedded with poly-L-lysine-coated coverslips were seededwith SCs as the control group. Wells attached with SIS alonewithout SCs seeding served as the blank control group. Allwells were incubated in DMEM containing 1% antibiotic(10,000 U/ml penicillin G and 10 mg/ml streptomycin), 2 mMglutamine, 10% fetal bovine serum and 40 μg/ml bovinepituitary extract, in a 37 °C humidified incubator with 5% CO2.

4.4. Evaluation of biocompatibility

4.4.1. Light microscopyThe growth of SCs surrounding SIS was observed under aninverted microscope (Olympus, Tokyo, Japan) every day.Photographs were taken at regular intervals.

4.4.2. Scanning electron microscopy (SEM)On days 1, 3, 5, and 7 after SCs were seeded onto SIS, thesamples were washedwith PBS and fixed in 2% glutaraldehydesolution. The samples were then postfixed with 1% osmiumtetroxide, dehydrated in a graded series of ethanol solutions,dried at critical point drier (Hitachi, Tokyo, Japan) and gold-coated.All sampleswere observedusingSEM (PhilipsQUANTA-200, Holland).

4.4.3. Transmission electron microscope (TEM)On day 7 after SCs were seeded onto SIS, the samples werewashed with PBS and fixed in 2% glutaraldehyde solution.The samples were then postfixed with 1% osmium tetroxide,dehydrated in a graded series of ethanol solutions andembedded in Epon 812 epoxy resin. Ultrathin sections (70–90 nm) were prepared, stained with lead citrate and uranylacetate and observed using TEM (Hitachi H-600, Tokyo,Japan).

4.4.4. MTT assay3-(4,5-Dimethylthiazol-2-yl)-2.5-diphenyl tetrazolium bro-mide (MTT, Sigma, USA) was prepared as 0.5 mg/ml stocksolution in PBS. On days 1, 3, 7, and 10 after SCs were seeded ineach group, the viability was assessed. Briefly, the culturemedium of each well was replaced with 100 μl DMEM. 25 μlMTT in PBS (0.1 M, pH 7.2) was added to each well. After 4 h ofincubation at 37 °C, 100 μl lysis buffer (20% SDS in 50% N,N-dimethylformamide, pH 4.7) was added. After 20 h of incuba-tion at 37 °C, the supernatants of all wells were respectivelyaspirated out to be measured photometrically with an EIX-800Microelisa reader (Bio-Tek Inc., USA) at 570 nm.

4.4.5. Enzyme-linked immunosorbent assay (ELISA)On days 1, 3, 5, and 7 after SCs were seeded in each group,cellular supernatant was analyzed by ELISA kits (Boster,China) for nerve growth factor-β (NGF-β) and brain-derivedneurotrophic factor (BDNF) according to the manufacturer'sdirections. Briefly, the samples were added to each well of96-well plates pre-coated with specific antibody and incu-bated for 90 min at 37 °C. The plates were washed andincubated with biotinylated rabbit anti-rat isotype-specificantibody for 90 min at 37 °C. The plates were washed; avidin–biotin complex (ABC) working dilutions was added andincubated for 30 min at 37 °C. The plates were washed againand TMB solution was added and incubated for 25 min at

37 °C. Finally, stop solution was added and absorbance wasread at 450 nm on a microplate reader (Bio-Tek Instruments,Winooski, VT).

4.4.6. Reverse transcriptase–polymerase chain reaction(RT–PCR)On day 7 after SCs were seeded in each group, the total RNAwas extracted using the RNeasy extraction kit (Invitrogen,USA) and genomic DNAwas removed by DNAse I, according tothemanufacturer's protocol. RNAwas reverse transcribed in a20 μl final volume using 10 μl of total RNA, 0.5 μg oligodT,200 μM of each deoxyribonucleoside triphosphate (dNTP),20 units RNasin and 200 units M-MLV Reverse Transcriptase(Promega, USA), according to the protocol and with the bufferssupplied by the manufacturer. Two separate negative controlreactions, either without RNA or without M-MLV, alsoaccompanied each reaction.

PCR was performed using 2 μl of synthesized cDNA with1.25 U Taq polymerase (Tiangen Biotech, Germany), 200 μMdNTPs, 0.4 μM of each primer, 1.5 mM MgCl2, the buffersupplied by the company, and deionized distilled water in a50 μl total reaction volume. All common components wereadded into a master mix and then aliquotted into tubes. Thecycling conditions were as follows: Initial denaturation at95 °C for 3 min followed by 30 cycles of: 95 °C for 30 s, 60 °C for30 s, 72 °C for 45 s, and a final extension of 72 °C for 5 min. Theproducts were analysed on a 1.5% agarose (Invitrogen) gelcomplemented with 0.025‰ ethidium bromide, where aDL2000 DNA-ladder (TaKaRa, Japan) was run in parallel tothe samples. β-Actin was used as the loading control. The gelswere pictured with a digital camera (Sony DSC-S75 Cybershot)and a Kodak Digital Science 1D™ analysing system (KodakScientific Imaging Systems, New Haven, CT, USA) was used todetermine the densities of NGF-β and BDNF bands for both SISand control groups.

Primers were designed in Table 1.

4.4.7. Statistical analysisA one-way ANOVA was used to compare the means ofdifferent groups, and statistical significance was accepted atthe 0.05 confidence level.

Acknowledgments

We wish to thank Professor Wang Yang of Department ofAnatomy and Histology–Embryology, Shanghai MedicalCollege, Fudan University for her kind help in cell culture.This work was supported by National Natural ScienceFoundation of China (Grant No. 303714444).

47B R A I N R E S E A R C H 1 1 4 5 ( 2 0 0 7 ) 4 1 – 4 7

R E F E R E N C E S

Abraham, G.A., Murray, J., Billiar, K., Sullivan, S.J., 2000. Evaluationof the porcine intestinal collagen layer as a biomaterial.J. Biomed. Mater. Res. 51, 442–452.

Allman, A.J., McPherson, T.B., Badylak, S.F., Merrill, L.C.,Kallakury, B., Sheehan, C., Raeder, R.H., Metzger, D.W.,2001. Xenogeneic extracellular matrix grafts elicit aTH2-restricted immune response. Transplantation 71,1631–1640.

Badylak, S.F., Lantz, G.C., Coffey, A., Geddes, L.A., 1989. Smallintestinal submucosa as a large diameter vascular graft in thedog. J. Surg. Res. 47, 74–80.

Badylak, S., Liang, A., Record, R., Tullius, R., Hodde, J., 1999.Endothelial cell adherence to small intestinal submucosa: anacellular bioscaffold. Biomaterials 20, 2257–2263.

Bellamkonda, R.V., 2006. Peripheral nerve regeneration: anopinion on channels, scaffolds and anisotropy. Biomaterials27, 3515–3518.

Campodonico, F., Benelli, R., Michelazzi, A., Ognio, E., Toncini, C.,Maffezzini, M., 2004. Bladder cell culture on small intestinalsubmucosa as bioscaffold: experimental study on engineeredurothelial grafts. Eur. Urol. 46, 531–537.

Evans, G.R., Brandt, K., Katz, S., Chauvin, P., Otto, L., Bogle, M.,Wang, B., Meszlenyi, R.K., Lu, L., Mikos, A.G., Patrick Jr., C.W.,2002. Bioactive poly(L-lactic acid) conduits seeded withSchwann cells for peripheral nerve regeneration. Biomaterials23, 841–848.

Fansa, H., Keilhoff, G., 2004. Comparison of different biogenicmatrices seeded with cultured Schwann cells for bridgingperipheral nerve defects. Neurol. Res. 26, 167–173.

Fawcett, J.W., Keynes, R.J., 1990. Peripheral nerve regeneration.Annu. Rev. Neurosci. 13, 43–60.

Greca, F.H., Noronha, L., Bendhack, M., Feres, A., Soccol, A., Duda,J.R., 2004. Use of small intestine submucosa as ureteralallograft in pigs. Int. Braz. J. Urol. 30, 327–335.

Hadlock, T.A., Sundback, C.A., Hunter, D.A., Vacanti, J.P., Cheney,M.L., 2001. A new artificial nerve graft containing rolledSchwann cell monolayers. Microsurgery 21, 96–101.

Hudson, T.W., Evans, G.R., Schmidt, C.E., 1999. Engineeringstrategies for peripheral nerve repair. Clin. Plast. Surg. 26,617–628.

Hurst, R.E., Bonner, R.B., 2001. Mapping of the distribution ofsignificant proteins and proteoglycans in small intestinalsubmucosa by fluorescence microscopy. J. Biomater. Sci.,Polym. Ed. 12, 1267–1279.

Keilhoff, G., Stang, F., Wolf, G., Fansa, H., 2003. Bio-compatibility oftype I/III collagen matrix for peripheral nerve reconstruction.Biomaterials 24, 2779–2787.

Lindberg, K., Badylak, S.F., 2001. Porcine small intestinal sub-mucosa (SIS): a bioscaffold supporting in vitro primary humanepidermal cell differentiation and synthesis of basementmembrane proteins. Burn 27, 254–266.

Lundborg, G., 1988. Nerve regeneration: the nerve chamber as anexperimental tool. Nerve Injury and Repair. ChurchillLibingstone, New York, pp. 163–178.

Lundborg, G., Malmö, 2000. A 25-year perspective of peripheralnerve surgery: evolving neuroscientific concepts and clinicalsignificance. J. Hand Surg. 25, 391–414.

Machinnon, S.E., Dellon, A.L., 1990. Clinical nerve reconstructionwith a bioabsorbable polyglycolic acid tube. Plast. Reconstr.Surg. 85, 419–424.

Mackmmon, S.E., Dellon, A.L., 1990. Clinical nerve reconstructionwith a bioabsorbable polyglycolic acid tube. Plast. Reconstr.Surg. 85, 419–424.

Martini, R., 1994. Expression and functional roles of neural cellsurfacemolecules and extracellular matrix components duringdevelopment and regeneration of peripheral nerve.J. Neurocytol. 23, 1–28.

Mauritz, C., Grothe, C., Haastert, K., 2004. Comparative study of cellculture and purification methods to obtain highly enrichedcultures of proliferating adult rat Schwann cells. J. Neurosci.Res. 77, 453–461.

Rochkind, S., Astachov, L., el-Ani, D., Hayon, T., Graif, M., Barsky,L., Alon, M., Odvak, I., Nevo, Z., Shahar, A., 2004. Furtherdevelopment of reconstructive and cell tissue-engineeringtechnology for treatment of complete peripheral nerve injuryin rats. Neurol. Res. 26, 161–166.

Schicho, R., Skofitsch, G., Donnerer, J., 1999. Regenerative effect ofhuman recombinant NGF on capsaicin-lesioned sensoryneurons in the adult rat. Brain Res. 815, 60–69.

Serpe, C.J., Byram, S.C., Sanders, V.M., Jones, K.J., 2005.Brain-derived neurotrophic factor supports facial motoneuronsurvival after facial nerve transection in immunodeficientmice. Brain Behav. Immun. 19, 173–180.

Smith, R.M., Wiedl, C., Chubb, P., Greene, C.H., 2004. Role of smallintestine submucosa (SIS) as a nerve conduit: preliminaryreport. J. Invest. Surg. 17, 339–344.

Suckow, M.A., Voytik-Harbin, S.L., Terril, L.A., Badylak, S.F., 1999.Enhanced bone regeneration using porcine small intestinalsubmucosa. J. Invest. Surg. 12, 277–287.

Sulaiman, O.A., Gordon, T., 2002. Transforming growth factor-betaand forskolin attenuate the adverse effects of long-termSchwann cell denervation on peripheral nerve regenerationin vivo. Glia 37, 206–218.

Terzis, J.K., Sun, D.D., Thanos, P.K., 1997. History and basic sciencereview: past, present, and future of nerve repair. J. Reconstr.Microsurg. 13, 215–225.

Thompson, D.M., Buettner, H.M., 2004. Oriented Schwann cellmonolayers for directed neurite outgrowth. Ann. Biomed. Eng.32, 1120–1130.

Voytik-Harbin, S.L., Brightman, A.O., Kraine, M.R., Waisner, B.,Badylak, S.F., 1997. Identification of extractable growth factorsfrom small intestinal submucosa. J. Cell. Biochem. 67, 478–491.

Zhang, F., Zhang, J., Lin, S., Oswald, T., Sones, W., Cai, Z.,Dorsett-Martin, W., Lineaweaver, W.C., 2003. Small intestinalsubmucosa in abdominal wall repair after TRAM flapharvesting in a rat model. Plast. Reconstr. Surg. 112, 565–570.