structure, replication and recombination of dna. information flow from dna dna rna transcription...

Structure, Replication and Structure, Replication and Recombination of DNA Recombination of DNA

Information Flow From DNAInformation Flow From DNA

DNADNA

RNARNA

transcriptiontranscription

ProteinProtein

translationtranslation

replicationreplication

DNA StructureDNA StructurePrimary Primary

StructureStructureChain of Chain of

NucleotidesNucleotides

Secondary Secondary StructureStructure

Double Double HelixHelix

DNA StructureDNA Structure

Three components of a nucleotideThree components of a nucleotide 1. Nitrogen-containing base1. Nitrogen-containing base

purine or pyrimidinepurine or pyrimidine

2. 5-carbon sugar2. 5-carbon sugar

3. Phosphate group3. Phosphate group

Nucleotide = building block of DNANucleotide = building block of DNA

DNA StructureDNA StructurePurine basesPurine bases Adenine (A)Adenine (A)

Guanine (G)Guanine (G)

Pyrimidine Pyrimidine basesbases

Cytosine (C)Cytosine (C)

Thymine (T)Thymine (T)

5-carbon 5-carbon sugarsugar

DeoxyriboseDeoxyribose

PhosphatePhosphate POPO44

P---OH + OH---C P---OH + OH---C P---O---C + H P---O---C + H22OO

Chemical BondingChemical Bonding

Covalent Covalent BondBond

StrongStrong Atoms Atoms Share Share

ElectronsElectrons

Formation Formation of a of a

NucleotideNucleotide

HydrogenHydrogen

BondBond

WeakWeak Atoms Atoms “Share” a “Share” a HydrogenHydrogen

Pairing of Pairing of Nucleotide Nucleotide

BasesBases

Hydrogen bonds hold pairs of bases together.Hydrogen bonds hold pairs of bases together.

3’ 5’

3’5’

DNA Secondary Structure: DNA Secondary Structure: The Double HelixThe Double Helix

• Two polynucleotide chains Two polynucleotide chains are wound togetherare wound together

• Bases are located inside Bases are located inside the helixthe helix

• Sugar-phosphate groups Sugar-phosphate groups are on the outside as a are on the outside as a “backbone”“backbone”

• Bases are arranged like Bases are arranged like rungs on a ladder, rungs on a ladder, perpendicular to the perpendicular to the “backbone”“backbone”

DNA Secondary Structure: DNA Secondary Structure: The Double HelixThe Double Helix

• Hydrogen bonding Hydrogen bonding between bases holds between bases holds the chains together:the chains together:

A pairs with T A pairs with T G pairs with CG pairs with C

• Polynucleotide chains Polynucleotide chains have opposite polarityhave opposite polarity

One is 5’ One is 5’ 3’ 3’ other is 3’ other is 3’ 5’ 5’• 10 base pairs per turn 10 base pairs per turn

of the helixof the helix

Applying Your KnowledgeApplying Your Knowledge

In the DNA double helix, which base In the DNA double helix, which base is paired with adenine? is paired with adenine?

1.1. AdenineAdenine2.2. CytosineCytosine3.3. GuanineGuanine4.4. ThymineThymine5.5. UracilUracil

DNA Replication: An OverviewDNA Replication: An Overview

DNA ReplicationDNA Replication

DNA replication is semiconservative.DNA replication is semiconservative.Each strand is used as a template to Each strand is used as a template to produce a new strand.produce a new strand.

AGCTAGCTAGCTAGCTAGCTAGCT TCGATCGATCGATCGATCGATCGA

TCGATCGATCGA new

AGCTAGCTAGCT new

AGCTAGCTAGCTAGCTAGCTAGCT AGCTAGCTAGCT oldAGCTAGCTAGCT old

TCGATCGATCGATCGATCGATCGA TCGATCGATCGATCGATCGATCGA oldold

DNA ReplicationDNA Replication

5’—A G C T — 3’5’—A G C T — 3’

3’—T C G A—5’3’—T C G A—5’

A —5’A —5’GGCC

GG

3’— T3’— T

CC T— 3’T— 3’5’— A5’— A

DNA replication requires DNA replication requires 1. DNA polymerase, an enzyme that adds 1. DNA polymerase, an enzyme that adds nucleotides in a 5’nucleotides in a 5’3’ direction. 3’ direction. 2. Nucleoside triphosphates2. Nucleoside triphosphates 3. Energy: release of diphosphate 3. Energy: release of diphosphate

Origin of ReplicationOrigin of Replication

origin of replicationorigin of replication

replication forkreplication fork replication forkreplication fork

DNA replication begins at a replication origin and DNA replication begins at a replication origin and proceeds bidirectionally, creating two replication proceeds bidirectionally, creating two replication forks for each origin. Eukaryotic chromosomes have forks for each origin. Eukaryotic chromosomes have multiple origins of replication.multiple origins of replication.

Continuous and Discontinuous Continuous and Discontinuous SynthesisSynthesis

DNA Polymerase builds a new strand in a 5’DNA Polymerase builds a new strand in a 5’3’ 3’ direction. This leads to continuous synthesis on direction. This leads to continuous synthesis on the strand oriented 3’the strand oriented 3’5’ and discontinuous on 5’ and discontinuous on the strand oriented 5’the strand oriented 5’3’. 3’.

movement of forkmovement of fork

5’5’

3’3’

3’3’

5’5’

Lagging strandLagging strandDiscontinuous Discontinuous

Leading strandLeading strandContinuousContinuous

Okasaki Fragments Okasaki Fragments


Discontinuous synthesis occurs on Discontinuous synthesis occurs on the DNA template oriented the DNA template oriented

1.1. 3’3’5’5’

2.2. 5’5’3’3’

3.3. Either 3’Either 3’5’ or 5’5’ or 5’3’3’

4.4. Both 3’Both 3’5’ and 5’5’ and 5’3’3’

5.5. Neither 3’Neither 3’5’ or 5’5’ or 5’3’3’

Steps in DNA Replication (Bacterial)Steps in DNA Replication (Bacterial)

1.1. InitiationInitiation

Initiator Proteins bind to replication Initiator Proteins bind to replication origin and cause a small section to origin and cause a small section to unwind.unwind.


2.2. UnwindingUnwinding

Helicase molecules Helicase molecules further unwind helix.further unwind helix.

Single-stranded binding proteins keep Single-stranded binding proteins keep helix from reforming.helix from reforming.DNA gyrase reduces supercoils ahead DNA gyrase reduces supercoils ahead of replication fork. of replication fork.

Steps in DNA Replication (Bacterial)Steps in DNA Replication (Bacterial)3.3. ElongationElongation

Primase synthesizes a short RNA Primase synthesizes a short RNA strand = primer.strand = primer.

DNA polymerase III adds nucleotides DNA polymerase III adds nucleotides to the primer in a 5’to the primer in a 5’3’ direction.3’ direction.


3.3. ElongationElongation

A single primer is required for leading A single primer is required for leading strand replication. strand replication. On the lagging strand, a new primer is On the lagging strand, a new primer is used at the start of each Okasaki used at the start of each Okasaki fragment.fragment.

Steps in DNA Replication (Bacterial)Steps in DNA Replication (Bacterial)3.3. ElongationElongation

DNA polymerase I replaces primer DNA polymerase I replaces primer RNA with DNA nucleotides. RNA with DNA nucleotides. DNA ligase seals gaps in sugar-DNA ligase seals gaps in sugar-phosphate backbone.phosphate backbone.

Steps in DNA Replication Steps in DNA Replication (Bacterial)(Bacterial)

4.4. TerminationTermination

Termination occurs when two Termination occurs when two replication forks meet.replication forks meet.

E. coliE. coli cells have a protein called Tus cells have a protein called Tus that binds to termination sequences that binds to termination sequences and blocks helicase movement. and blocks helicase movement.

Accuracy of DNA ReplicationAccuracy of DNA Replication1.1. Nucleotide SelectionNucleotide Selection2.2. DNA proofreading: 3’DNA proofreading: 3’5’ exonuclease 5’ exonuclease

activity of DNA polymeraseactivity of DNA polymerase3.3. Mismatch Repair: repair enzymesMismatch Repair: repair enzymes

Modes of ReplicationModes of Replication

Differences for Eukaryotic DNA ReplicationDifferences for Eukaryotic DNA Replication

• Replication Licensing Factor attaches to Replication Licensing Factor attaches to each origin, initiator protein only each origin, initiator protein only recognizes “licensed” originsrecognizes “licensed” origins

• Multiple polymerases function in Multiple polymerases function in replication, recombination, repairreplication, recombination, repair– Alpha: synthesizes primer and a short stretch Alpha: synthesizes primer and a short stretch

of DNAof DNA– Delta: continues replication on the lagging Delta: continues replication on the lagging

strandstrand– Epsilon: continues replication on the leading Epsilon: continues replication on the leading

strandstrand• Topoisomerase enzymes relax supercoilsTopoisomerase enzymes relax supercoils


A new DNA strand is synthesizedA new DNA strand is synthesized1.1. From 3’From 3’5’5’

2.2. From 5’From 5’3’3’

3.3. Either from 3’Either from 3’5’ or 5’5’ or 5’3’3’

4.4. Both from 3’Both from 3’5’ and 5’5’ and 5’3’3’

5.5. Neither from 3’Neither from 3’5’ or 5’5’ or 5’3’3’


Which enzyme produces a short Which enzyme produces a short stretch of RNA nucleotides used as a stretch of RNA nucleotides used as a starting point for DNA synthesis? starting point for DNA synthesis?

1.1. HelicaseHelicase2.2. DNA polymerase IDNA polymerase I3.3. Single strand binding proteinSingle strand binding protein4.4. DNA polymerase IIIDNA polymerase III5.5. PrimasePrimase


Which enzyme can remove an Which enzyme can remove an incorrectly-inserted nucleotide? incorrectly-inserted nucleotide?

1.1. HelicaseHelicase2.2. DNA Gyrase DNA Gyrase 3.3. Single strand binding proteinSingle strand binding protein4.4. DNA polymerase DNA polymerase 5.5. PrimasePrimase

Replication at the Ends of Linear ChromosomesReplication at the Ends of Linear Chromosomes

• Removal of the Removal of the primer at the primer at the end of a linear end of a linear chromosome chromosome leaves a gap leaves a gap

• Linear Linear chromosomes chromosomes tend to shorten tend to shorten at the at the telomeres over telomeres over repeated cycles repeated cycles of replicationof replication

Telomerase Extends the Telomere’s 3’ EndTelomerase Extends the Telomere’s 3’ End

• Telomerase is an Telomerase is an enzyme composed enzyme composed of both protein and of both protein and RNA RNA

• RNA portion binds RNA portion binds to the overhanging to the overhanging 3’ end of the 3’ end of the telomere, providing telomere, providing a template for a template for elongationelongation

• Mechanism for Mechanism for replicating the replicating the complementary complementary strand is uncertain strand is uncertain

RecombinationRecombination

Holliday Model of RecombinationHolliday Model of Recombination

Single strand breaks occur at the same Single strand breaks occur at the same position on homologous DNA helices. position on homologous DNA helices.Single-stranded ends migrate into theSingle-stranded ends migrate into the alternate helix. alternate helix.

Holliday Model of RecombinationHolliday Model of Recombination

Each migrating strand joins to the existing Each migrating strand joins to the existing strand, creating a Holliday junction. strand, creating a Holliday junction.Branch point can migrate, increasing the Branch point can migrate, increasing the amount of heteroduplex DNA. amount of heteroduplex DNA.

Holliday Model of RecombinationHolliday Model of RecombinationResolving the Holliday IntermediateResolving the Holliday Intermediate

Separation of the duplexes Separation of the duplexes requires cleavage in either the requires cleavage in either the horizontal or vertical plane. horizontal or vertical plane.

Holliday Model of Holliday Model of RecombinationRecombinationResolving the Resolving the

Holliday Holliday IntermediateIntermediate

Cleavage in the vertical plane, Cleavage in the vertical plane, followed by rejoining of followed by rejoining of nucleotide strands, produces nucleotide strands, produces crossover recombinant products. crossover recombinant products.

Gene Conversion Occurs with Repair Gene Conversion Occurs with Repair of Heteroduplex DNA of Heteroduplex DNA

Gene Conversion Occurs with Repair Gene Conversion Occurs with Repair of Heteroduplex DNAof Heteroduplex DNA

Gene Conversion can lead to abnormal genetic ratios.Gene Conversion can lead to abnormal genetic ratios.

structure, replication and recombination of dna. information flow from dna dna rna transcription...

Documents