sip presenation

Download SIP Presenation

Post on 08-Feb-2017

79 views

Category:

Documents

1 download

Embed Size (px)

TRANSCRIPT

Generation of knockout cell lines for the invasion-regulating scaffold gene AFAP1L1 in sarcoma cells by CRISPR/Cas9 technology

Generation of knockout cell lines for invasion-regulating scaffold gene AFAP1L1 insarcoma cells by CRISPR/Cas9 technologyRebecca ShapiroKalamazoo CollegeEvan Ingley, Ph.DHarry Perkins Institute of Medical ResearchPerth, Western Australia

IntroductionSarcoma and U2OS cell lineAFAP1L1 and metastasis

Still a lot unknown about sarcoma metastasisAFAP1L1 identifiedactin filament associated protein 1-like-1`Overall, it has been proven through many different studies that AFAP1L1is directly involved in an increase in cell motility and invasiveness in sarcomaCellsprogression of spindle cell sarcomas and metastasis through molecular pathwaysSrc/Lyn pathwaysAFAP1L1 intersects several invadopodia pathway components and influencesregulation of the cytoskeleton (Snyder et al.,2010). This allows for AFAP1L1 topromote metastasis and permits tumor cells to invade surrounding and distanttissue through invading the basement membraneNovel target for gene therapies and gene engineering studies2

CRISPR/Cas9CRISPR/Cas91987 in Ishino labCRISPR locusEndonuclease (Cas9)DSB can be repaired by non-homologous end joining (NHEJ) or homology directed repair (HDR)

Bacterial repeat segments that were seen as nonsense but are now known to correspond to foreign phage sequencesThe CRISPR locus contains several short repeated sequencesthat are separated by non-repetitive spacer sequences. When faced with viralinfections, the spacers found in the CRISPR complex can be used astranscriptional templates to create CRISPR RNA (cRNA).cRNA or single-guide RNAs directs Cas9 where to make DSB3

Present Study Overview

Homology Directed Repair (HDR) Pathway usedmCherry plasmid insertFluorescence Activated Cell Sorting (FACS) PCRSequencing verification

https://www.addgene.org/CRISPR/guide/

CRISPR/Cas9 system utilized to knockout AFAP1L1 from U2OS sarcoma cells

4

Designing CRISPR plasmidSigma Aldrich, 2015.

Px330 vector can be digestedsgRNA Sequence identified using software from MITLigated into vector Need the necessary overhanging elementsU6 promoter important to recognize for the HDR method quantificationEndogenous promoter Performed transformation----- Meeting Notes (4/28/15 22:54) -----20 bp guide RNA need flanking sequences

5

Continued Methods OverviewTransformation and colony screeningPlasmid preparationSequencing for confirmationCo-transfection into U2OS cellsFACS Sorting

5 CACC GTACCTCAGCGATACCACCC 3 Top5 CATGGAGTCGCTATGGTGGG CAAA 3 Bottom

----- Meeting Notes (4/28/15 18:57) -----ADD COTRANSFECTION FIGUREADD SEQUENCING FIGURE6

Co-transfection results Pre-FACS

----- Meeting Notes (4/28/15 22:57) -----mcherry repair plasmid did not flouresce red on its own!7

Cell Culture Growth

Cotransfection initiallyCells in which the CRISPR worked effectively were expected to integratethe repair plasmid containing an mCherry red fluorescent tag and be promoted viathe endogenous promoter on the plasmid. Through FACS sorting for redfluorescent positive cells, only the cells with the CRISPR/Cas9 system in effect,knocking out the AFAP1L1 gene, remained in the collection tube.FACS Sort data quantifies levels of red fluorescence in U2OS cells. The C FACS sort is able to utilize the fluorescence tag to quantify the exact number of positive, red fluorescent cells. These cells are then sorted out of the general U2OS population and placed into a collection tube, which can then be grown up and re-sorted once confluent and stable. These three FACS sorts are measured using gates that are set up by positive and negative controls. The positive control is simply the mCherry plasmid transfected into the U2OS cells, which therefore will allow cells to fluoresce. The negative control is the U2OS cells without any transfected plasmids, all which therefore is not expected to show any endogenous fluorescence. By setting up gates for where the fluorescence is and is not to be expected, the peaks of fluorescence can then be used to sort out the positive cells in the cotransfected U2OS sample. Grown in increasingly larger sized plates 96 well plate up until a 6 well plate and then a T75 flask

8

----- Meeting Notes (4/28/15 22:57) -----able to sort out the cells that were cutting out AFAP1L1 and replacing mCherry even better9

SummaryCRISPR plasmid was able to target AFAP1L1 successfullymCherry repair plasmid confirmed 99% positive red fluorescent U2OScellsCRISPR has been proven to be a more effective gene engineering toolFuture directionsSequence verification of each cloneObserving U2OS cell morphology without AFAP1L1Potential in vivo models (mice) and observe metastatic effect

CRISPR even more effective than microRNAs, TALENS, zinco finger domains. CRISPR leaves cleaner, more effective cuts and takes less time to engineer and useByusing the direction of a single-guide RNA, a double strand break was formed at aspecific gene target and the effectively knocked out. The single-guide RNA wasdesigned to be targeted by the Cas9 complex and in conjunction with the px330vector, establish the CRISPR plasmid. Once successfully co-transfected with therepair plasmid, which was designed to not include an endogenous promoter, theeffect of the CRISPR/Cas9 knockout system could be determined. Due to the lackof endogenous promoter of the repair mCherry tagged plasmid, the CRISPRplasmid would have to be successfully integrated10

Thank you!

SIP AdvisorDr. M. WollenbergSIP Review TeamMarie Bunker, Alec Duffey, Marie Hallinen JordanHenning, Margaret RiceEmily SklarReferee GroupCamryn RomphLouise SilvermanMarie BunkerFriends and family!

Ingley LabEvan Ingley, Ph.DCindy LeMatt LeeJanice Lam, Ph.DHarry Perkins Institute of ResearchHearst Undergraduate Research Fellowship

11